RNA vaccines against rift valley fever virus (RVFV)
Patent Information
- Application Number
- PCT/US2026/020286
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-23
- Filing Date
- 2026-03-23
- Publication Date
- 2026-10-01
Smart Images

Figure 00000039_0000 
Figure 00000039_0001 
Figure 00000040_0000
Abstract
Description
FJ ref. UTMB-P0422US / Client ref. BUKR-A-24ARNA VACCINES AGAINST RIFT VALLEY FEVER VIRUS (RVFV)RELATED APPLICATIONS
[0001] This Application claims priority to U.S. Provisional Patent Application 63 / 776,174 filed March 23, 2025 which is incorporated herein by reference in its entirety.REFERENCE TO SEQUENCE LISTING
[0002] A sequence listing required by 37 CFR 1.821-1.825 is being submitted electronically with this application. The sequence listing is incorporated herein by reference. The sequence listing that is contained in the file named "UTMBP0422" which is 12,584 Bytes (as measured in Microsoft Windows®) and was created on 3 / 23 / 2025.FIELD
[0003] Aspects of the invention are directed generally to the field of medicine and virology, and in particular to immunotherapy and vaccines.BACKGROUND
[0004] Rift Valley Fever Virus (RVFV) is a member of the Phlebovirus genus within the Phenuiviridae family of the order Bunyavirales. It is a zoonotic virus, primarily affecting domesticated animals such as cattle, sheep, goats, and camels, but can also infect humans. RVFV is transmitted primarily by mosquitoes, notably from the Aedes and Cui ex genera. It can also spread through contact with the blood or organs of infected animals, particularly during the slaughtering or butchering process. The virus is endemic to Africa, with outbreaks reported in the sub-Saharan region, Egypt, Madagascar, and more recently in countries around the Arabian Peninsula, like Saudi Arabia and Yemen.
[0005] RVFV presents several current challenges in terms of health, economics, and epidemiology. RVFV can lead to significant economic losses due to the death of livestock and trade restrictions. In livestock, RVFV causes high morbidity and mortality, abortions, and congenital abnormalities. In humans, RVFV can cause a spectrum of diseases, from mild flu-like symptoms to severe complications like hemorrhagic fever, encephalitis, or ocular damage. Lessthan 1% of human cases develop into these severe forms, which can be fatal or result in longterm health issues such as vision loss or neurological damage. Human outbreaks are often associated with large-scale epizootics in animal populations, especially after heavy rainfall and during rainy seasons which increase mosquito breeding sites.
[0006] There is a challenge in early detection due to the nonspecific nature of initial symptoms, which can mimic other diseases like malaria or dengue. This complicates timely intervention and containment, particularly in regions with limited diagnostic capabilities. While there are vaccines available for livestock, human vaccines are experimental or not widely available or licensed. The development of safe, effective vaccines for both human and veterinary use remains a priority. Also, RVFV is recognized as a potential bioterrorism agent, listed by both the US Department of Agriculture and the US Department of Health and Human Services as a select agent due to its potential for causing significant consequences.
[0007] These problems highlight the need for ongoing research, improved surveillance systems, better vector control strategies, and the development of effective vaccines and treatments to manage and mitigate the impact of RVFV.SUMMARY
[0008] A solution to some of the problems associated with RVFV is design, production, and administration of a RVFV nucleic acid vaccine (NAV). In certain aspects the NAV is an mRNA vaccine. In the preferred embodiment, uridine in the mRNA is fully substituted with Nl-methylpseudouridine (MIT) to minimize innate immune activation while retaining or improving immunogenicity and protective efficacy.
[0009] Certain embodiments are directed to mRNA vaccines comprising an RNA encoding 5’ to 3’ an untranslated region (5’ UTR) segment, a Rift Valley Fever Virus (RVFV) glycoprotein precursor gene (GPC) coding segment, a double stop codon, a 3’ untranslated region (3’ UFR) segment, and poly-adenosine (pA) segment. In certain aspects the Rift Valley Fever Virus glycoprotein precursor gene (GPC) coding segment encodes RVFV Kenya 83 strain GPC. In certain aspects the 3’ UTR comprises concatenated sequences of human genomic origin, partial mitochondrially encoded 12S rRNA (mtRNRl) and amino-terminal enhancer of split (AES).
[0010] In a representative embodiment the mRNA can comprise, but is not limited to the nucleic acid sequence:TAATACGACTCACTATAUGG2ACTCTTCTGGTCCCCACAGACTCAGAGAGAACC CACC3ATGGCTGGAATCGCTATGACCGTGCTGCCCGCCCTGGCTGTCTTTGCCCTGGC TCCCGTCGTCTTTGCTGAGGACCCACATCTGAGAAACCGCCCTGGCAAGGGCCACAA CTACATCGACGGCATGACCCAGGAGGACGCCACCTGCAAGCCTGTGACCTACGCTG GAGCTTGCAGCTCCTTCGACGTGCTGCTGGAGAAGGGCAAGTTCCCTCTGTTCCAGA GCTACGCCCACCACAGAACCCTGCTGGAGGCCGTGCACGACACCATCATCGCTAAG GCTGACCCTCCTAGCTGCGACCTGCAGTCCGCCCACGGAAACCCTTGCATGAAGGA GAAGCTGGTCATGAAGACCCACTGCCCCAACGACTACCAGTCCGCCCACTACCTGA ACAACGACGGCAAGATGGCCAGCGTGAAGTGCCCCCCTAAGTACGAGCTGACCGAG GACTGCAACTTCTGCCGCCAGATGACCGGCGCCAGCCTGAAGAAGGGCTCCTACCC CCTGCAGGACCTGTTCTGCCAGAGCTCCGAGGACGACGGCAGCAAGCTGAAGACCA AGATGAAGGGCGTGTGCGAAGTGGGAGTGCAGGCCCTGAAGAAGTGCGACGGACA GCTGTCCACCGCTCACGAGGTGGTGCCTTTCGCCGTGTTCAAGAACAGCAAGAAGGT GTACCTGGACAAGCTGGACCTGAAGACCGAGGAGAACCTGCTGCCCGACTCCTTCG TGTGCTTCGAGCACAAGGGCCAGTACAAGGGCACCATGGACAGCGGCCAGACCAAG CGGGAGCTGAAGAGCTTCGACATCTCCCAGTGCCCTAAGATCGGAGGACACGGATC CAAGAAGTGCACCGGCGACGCTGCTTTCTGCAGCGCCTACGAGTGCACCGCCCAGT ACGCCAACGCTTACTGCAGCCACGCTAACGGATCCGGAATCGTGCAGATCCAGGTG TCCGGCGTGTGGAAGAAGCCTCTGTGCGTGGGCTACGAGCGGGTGGTGGTGAAGAG GGAGCTGAGCGCCAAGCCTATCCAGCGCGTGGAGCCCTGCACCACCTGCATCACCA AGTGCGAGCCTCACGGCCTGGTGGTGAGATCCACCGGCTTCAAGATCAGCTCCGCC GTGGCTTGCGCTAGCGGCGTGTGCGTGACCGGCTCCCAGAGCCCTTCCACCGAGATC ACCCTGAAGTACCCTGGAATCTCCCAGAGCTCCGGAGGCGACATCGGAGTGCACAT GGCTCACGACGACCAGAGCGTGAGCTCCAAGATCGTGGCTCACTGCCCTCCTCAGG ACCCTTGCCTGGTGCACGGATGCATCGTGTGCGCTCACGGCCTGATCAACTACCAGT GCCACACCGCCCTGAGCGCCTTCGTGGTGGTGTTCGTGTTCAGCTCCATCGCCATCA TCTGCCTGGCCATCCTGTACCGGGTGCTGAAGTGCCTGAAGATCGCCCCTAGGAAGG TGCTGAACCCCCTGATGTGGATCACCGCCTTCATCCGCTGGGTGTACAAGAAGATGG TGGCCAGAGTGGCCGACAACATCAACCAGGTGAACAGGGAGATCGGATGGATGGAGGGAGGACAGCTGGCCCTGGGAAACCCTGCCCCTATCCCCCGCCACGCCCCTATCCC CAGATACTCCACCTACCTGATGCTGCTGCTGATCGTGTCCTACGCTAGCGCCTGCTC CGAGCTGATCCAGGCCAGCTCCAGGATCACCACCTGCAGCACCGAGGGCGTGAACA CCAAGTGCAGGCTGTCCGGAACCGCCCTGATCAGAGCTGGAAGCGTGGGAGCTGAG GCTTGCCTGATGCTGAAGGGCGTGAAGGAGGACCAGACCAAGTTCCTGAAGATCAA GACCGTGAGCTCCGAGCTGAGCTGCAGGGAGGGACAGTCCTACTGGACCGGCAGCT TCTCCCCTAAGTGCCTGAGCTCCCGGAGGTGCCACCTGGTGGGAGAGTGCCACGTGA ACCGCTGCCTGTCCTGGAGAGACAACGAGACAAGCGCCGAGTTCTCCTTCGTGGGC GAGAGCACCACCATGAGAGAGAACAAGTGCTTCGAGCAGTGCGGAGGATGGGGAT GCGGATGCTTCAACGTGAACCCCTCCTGCCTGTTCGTGCACACCTACCTGCAGAGCG TGCGGAAGGAGGCCCTGAGGGTGTTCAACTGCATCGACTGGGTGCACAAGCTGACC CTGGAGATCACCGACTTCGACGGAAGCGTGTCCACCATCGACCTGGGAGCTAGCTC CAGCCGGTTCACCAACTGGGGAAGCGTGTCCCTGAGCCTGGACGCTGAGGGAATCT CCGGAAGCAACTCCTTCAGCTTCATCGAGTCCCCTGGCAAGGGATACGCTATCGTGG ACGAGCCTTTCAGCGAGATCCCTAGGCAGGGCTTCCTGGGAGAGATCAGGTGCAAC TCCGAGTCCAGCGTGCTGAGCGCCCACGAGTCCTGCCTGAGGGCTCCTAACCTGATC AGCTACAAGCCCATGATCGACCAGCTGGAGTGCACCACCAACCTGATCGACCCTTTC GTGGTGTTCGAGAGGGGCTCCCTGCCTCAGACCAGGAACGACAAGACCTTCGCCGC TAGCAAGGGAAACAGGGGAGTGCAGGCCTTCAGCAAGGGATCCGTGCAGGCTGACC TGACCCTGATGTTCGACAACTTCGAGGTGGACTTCGTGGGAGCTGCCGTGTCCTGCG ACGCTGCCTTCCTGAACCTGACCGGATGCTACAGCTGCAACGCTGGAGCTCGGGTGT GCCTGAGCATCACCTCCACCGGAACCGGCACCCTGAGCGCCCACAACAAGGACGGC TCCCTGCACATCGTGCTGCCTAGCGAGAACGGCACCAAGGACCAGTGCCAGATCCT GCACTTCACCGTGCCCGAGGTGGAGGAGGAGTTCATGTACTCCTGCGACGGCGACG AGAGGCCTCTGCTGGTGAAGGGCACCCTGATCGCCATCGACCCCTTCGACGACAGG AGAGAGGCTGGAGGAGAGAGCACCGTGGTGAACCCTAAGTCCGGCAGCTGGAACTT CTTCGACTGGTTCAGCGGCCTGATGTCCTGGTTCGGAGGACCCCTGAAGACCATCCT GCTGATCTGCCTGTACGTGGCCCTGAGCATCGGCCTGTTCTTCCTGCTGATCTATCTG GGGAGGACTGGACTGTCAAAAATGTGGCTGGCTGCTACAAAAAAGGCTTCT4TGATA G5CAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACA GCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAA TTTCGTGCCA GCCA CACCCTGGTACTGCtTGCA CGCAA TGCTA GCTGCCCCTTTCC CGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCAC CTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCC6AAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7(SEQ ID NO:1)1= promoter (e.g., T7 promoter (SEQ ID NO:2)), 2= transcription start site, 3= 5’ UTR (e.g., 5’ human hemoglobin subunit alpha sequence (SEQ ID NO:3)), 4= open reading frame (ORF) (e.g., Rift Valley Fever Virus (RVFV) glycoprotein precursor gene (GPC) (SEQ ID NO:4), 5= dual translation stop, 6= 3’ UTR (SEQ ID NO:5), 7= poly-adenylate tail (pA).
[0011] Certain embodiments are directed to an mRNA vaccine comprising an RNA encoding 5’ to 3’ an untranslated region (5’ UTR) segment, a Rift Valley Fever Virus (RVFV) glycoprotein precursor gene (GPC) coding segment, a double stop codon, a 3’ untranslated region (3’ UTR) segment, and poly-adenosine (pA) segment and comprising one of more of (i) a promoter having a nucleic acid sequence of SEQ ID NO:2, (ii) a 5’ UTR having a nucleic acid sequence of SEQ ID NO:3, (iii) an ORF having a nucleic acid sequence of SEQ ID NO:4, and / or (iv) a 3’ UTR having a nucleic acid sequence of SEQ ID NO:5. Certain embodiments are directed to a mRNA vaccine comprising a nucleic acid sequence of SEQ ID NO: 1.
[0012] Other embodiments are directed to methods of inducing an immune response to Rift Valley Fever Virus comprising administering to a mammalian subject an mRNA vaccine described herein. In certain aspects the mammalian subject is a human subject.
[0013] Other embodiments are directed delivery vehicles comprising a mRNA described herein. In certain aspects the delivery vehicle is a lipid nanoparticle comprising an mRNA described herein.
[0014] In other embodiments, a single intramuscular immunization with only 1 pg of the LNP-encapsulated RVFV GPC mRNA vaccine (with uridine fully substituted to Nl-methylpseudouridine) provided complete (100%) protection against lethal RVFV ZH-501 challenge in BALB / c mice, with no detectable clinical signs (see Example 1 and FIG. 9). This low-dose, single-shot protection demonstrates the exceptional potency and dose-sparing potential of the claimed vaccines.
[0015] Other embodiments of the invention are discussed throughout this application. Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well and vice versa. Each embodiment described herein is understood to be embodiments of the invention that are applicable to all aspects of the invention. It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions and kits of the invention can be used to achieve methods of the invention.
[0016] The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”
[0017] Throughout this application, the term “about” is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.
[0018] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.”
[0019] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0020] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” “contains”, “containing,” “characterized by” or any other variation thereof, are intended to encompass a non-exclusive inclusion, subject to any limitation explicitly indicated otherwise, of the recited components. For example, a chemical composition and / or method that “comprises” a list of elements (e.g., components or features or steps) is not necessarily limited to only those elements (or components or features or steps), but may include other elements (or components or features or steps) not expressly listed or inherent to the composition and / or method.
[0021] As used herein, the transitional phrases “consists of’ and “consisting of’ exclude any element, step, or component not specified. For example, “consists of’ or “consisting of’ used in a claim would limit the claim to the components, materials or steps specifically recited in theclaim except for impurities ordinarily associated therewith (i.e., impurities within a given component). When the phrase “consists of’ or “consisting of’ appears in a clause of the body of a claim, rather than immediately following the preamble, the phrase “consists of’ or “consisting of’ limits only the elements (or components or steps) set forth in that clause; other elements (or components) are not excluded from the claim as a whole.
[0022] As used herein, the transitional phrases “consists essentially of’ and “consisting essentially of’ are used to define a composition and / or method that includes materials, steps, features, components, or elements, in addition to those literally disclosed, provided that these additional materials, steps, features, components, or elements do not materially affect the basic and novel characteristic(s) of the claimed invention. The term “consisting essentially of’ occupies a middle ground between “comprising” and “consisting of’.Definitions
[0023] The following definitions are provided to clarify the meaning of specific terms used throughout this patent application. These terms are defined to ensure a clear and consistent understanding of the invention’s scope, embodiments, and claims. Unless otherwise specified, the terms used herein have the meanings set forth below.
[0024] The term “mRNA vaccine” refers to a messenger RNA (mRNA) polynucleotide that encodes at least one antigen (here, a Rift Valley Fever Virus (RVFV) glycoprotein precursor (GPC)) and may be capable of being translated in a cell to produce the antigen, thereby inducing an immune response. In certain embodiments the mRNA vaccine comprises, in 5' to 3' order, a 5' untranslated region (5' UTR) segment, an open reading frame (ORF) encoding the antigen, a stop codon or double stop codon, a 3' untranslated region (3' UTR) segment, and a poly-adenosine (pA) segment, as described herein.
[0025] The term “5' untranslated region (5' UTR) segment” refers to a non-coding nucleotide sequence located 5' of the start codon that is transcribed but not translated and that regulates translation efficiency and / or mRNA stability. In certain embodiments the 5' UTR has the nucleic acid sequence of SEQ ID NO:3 (human hemoglobin subunit alpha sequence).
[0026] The term “Rift Valley Fever Virus (RVFV) glycoprotein precursor (GPC) coding segment” or “RVFV GPC coding segment” refers to an open reading frame that encodes the glycoprotein precursor polypeptide of RVFV starting from the 4thinitiation codon within the segment M. In certain embodiments the RVFV GPC coding segment encodes the GPC of RVFVKenya 83 strain (GenBank reference accession No DQ380198 starting from position 411) and has the nucleic acid sequence of SEQ ID NO:4 or a sequence having at least 90%, at least 95%, or at least 98% sequence identity to SEQ ID NO:4. Sequence identity is calculated using the BLAST algorithm (BLASTN for nucleic acids or BLASTP for polypeptides) with default parameters (expect threshold 10, word size 28 for nucleotides or 3 for amino acids, match / mismatch scores 1 / -2, gap costs linear).
[0027] The term “double stop codon” refers to two consecutive translation termination codons (for example, TGA followed immediately by TAA) placed after the ORF to ensure efficient termination of translation.
[0028] The term “3' untranslated region (3' UTR) segment” refers to a non-coding nucleotide sequence located immediately 3' of the stop codon(s) that is transcribed but not translated and that regulates mRNA stability, localization, and / or translation. In certain embodiments the 3' UTR comprises concatenated sequences of human genomic origin that include a partial mitochondrially encoded 12S rRNA (mtRNRl) and amino-terminal enhancer of split (AES) and has the nucleic acid sequence of SEQ ID NO:5.
[0029] The term “poly-adenosine (pA) segment” or “poly(A) tail” refers to a stretch of adenosine residues added to the 3' end of the mRNA that enhances stability and translation. In certain embodiments the pA segment comprises between 80 and 150 adenosine residues (inclusive).
[0030] The term “nucleic acid sequence of SEQ ID N0:X” refers to the nucleotide sequence set forth under the identifier SEQ ID N0:X in the Sequence Listing submitted herewith.
[0031] The term “substantially all uridine residues are replaced with Nl-methylpseudouridine (MI )” means that at least 95%, at least 98%, or 100% of the uridine residues in the mRNA are replaced with N1 -methylpseudouridine. In the preferred embodiment 100% of the uridines are replaced (fully substituted MIT-mRNA).
[0032] The term “5' cap structure” refers to a modified guanine nucleotide added to the 5' end of the mRNA. In certain embodiments the 5' cap is a CleanCap-AG or Cap-1 structure added co-transcriptionally during in vitro transcription.
[0033] The term “pharmaceutical composition” refers to a composition comprising the mRNA vaccine together with one or more pharmaceutically acceptable excipients, carriers, or diluents suitable for administration to a mammalian subject.
[0034] The term “lipid nanoparticle” or “LNP” refers to a nanoparticle formulation comprising lipids that encapsulates the mRNA vaccine, thereby possibly protecting the mRNA and facilitating its delivery into cells. In certain embodiments the lipid nanoparticle comprises an ionizable lipid, a helper lipid, cholesterol, and a PEG-lipid.
[0035] The term “inducing an immune response against Rift Valley Fever Virus (RVFV)” means stimulating the production of RVFV-specific antibodies (including virus-neutralizing antibodies) and / or RVFV-specific T-cell responses in a subject sufficient to provide prophylactic or therapeutic benefit against RVFV infection.
[0036] The term “mammalian subject” includes humans, non-human primates, livestock (cattle, sheep, goats, camels), and laboratory animals (mice, rats, etc.). In certain embodiments the mammalian subject is a human.
[0037] The term “administered intramuscularly” means injection of the mRNA vaccine into a muscle using a needle and syringe or other suitable device.
[0038] The term “effective amount” means an amount of mRNA vaccine sufficient to induce a measurable immune response and / or protective effect against RVFV in a subject. Exemplary effective amounts may include 0.1 pg to 50 pg of mRNA, including 1 pg, 2 pg, 5 pg, or 10 pg.
[0039] The term “prime-boost regimen” means administration of at least two doses of the mRNA vaccine, for example a first (prime) dose on day 0 and a second (boost) dose on day 21 (or other suitable interval).
[0040] The term “virus-neutralizing antibodies” means antibodies that bind to RVFV and prevent or reduce viral infection of cells, as measured by plaque reduction neutralization test (PRNT) or similar assay.
[0041] The term “protects the subject against lethal RVFV challenge” means that, following administration of the mRNA vaccine, the subject survives a lethal dose of live RVFV that is lethal to a majority of unvaccinated (naive) control subjects, with complete survival, no detectable clinical signs of disease (possibly including no significant or sustained weight loss, no lethargy, no ruffled fur, or other morbidity indicators), and no detectable RVFV RNA in liver tissue at the end of the 28-day observation period. In certain embodiments, such protection is achieved with a single 1 pg dose in BALB / c mice.
[0042] The term “single dose” means administration of the mRNA vaccine only once (without a subsequent boost) in an amount sufficient to provide protective immunity.
[0043] The term “kit” refers to a packaged combination of the mRNA vaccine or LNP together with instructions for use, for example instructions for intramuscular administration to a human subject for the prevention or treatment of Rift Valley Fever.
[0044] The term “in vitro transcription using a T7 promoter having the sequence of SEQ ID NO:2” refers to enzymatic synthesis of the mRNA from a DNA template that includes the T7 promoter sequence of SEQ ID NO:2 upstream of the 5' UTR
[0045] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.DESCRIPTION OF THE DRAWINGS
[0046] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the specification embodiments presented herein.
[0047] FIG. 1. mRNA vaccine against Rift Valley Fever virus: comparison of modified vs non-modified mRNA platform.
[0048] FIG. 2. Dot blot showing detection of double-stranded RNA (dsRNA) contaminants using J2 antibody in mRNA prior and after cellulose purification.
[0049] FIG. 3. MIT modification of mRNA disables innate immune response (type I interferon) in transfected A549 cells.
[0050] FIG. 4. flow cytometry histogram demonstrating RVFV GPC protein expression in A549 cells transfected with non-transfected control, RVFV GPC U-mRNA, or RVFV GPC MIT-mRNA.
[0051] FIG. 5. Vaccination and protective efficacy of the non-modified linear mRNA platforms: map of the study.
[0052] FIG. 6. Virus-neutralizing antibody responses (PRNT50 titers) on day 28 after the second dose across dose groups.
[0053] FIG. 7. Kaplan-Meier survival curve demonstrating protective efficacy against 103PFURVFV ZH-501 intraperitoneal challenge.
[0054] FIG. 8. Graph showing weight change following vaccination and RVFV challenge.
[0055] FIG. 9A-9F. BALB / c mice (4 weeks old) were immunized once intramuscularly with 1 pg or 5 pg of LNP-encapsulated RVFV GPC mRNA vaccine and challenged 28 days later with 1000 PFU of RVFV ZH-501 strain (subcutaneous), along with age-matched naive controls. (A) virus-neutralizing antibody titers in pre-challenge sera; (B) RVFV Gn-binding antibody titers in pre-challenge sera by ELISA; (C) Kaplan-Meier survival curve; (D) body weight changes postchallenge in the 1 pg immunized group (no significant weight loss or clinical signs); (E) body weight changes post-challenge in the 5 pg immunized group; (F) body weight changes postchallenge in naive controls.DESCRIPTION
[0056] The following discussion is directed to various embodiments of the invention. The term “invention” is not intended to refer to any particular embodiment or otherwise limit the scope of the disclosure. Although one or more of these embodiments may be preferred, the embodiments disclosed should not be interpreted, or otherwise used, as limiting the scope of the disclosure, including the claims. In addition, one skilled in the art will understand that the following description has broad application, and the discussion of any embodiment is meant only to be an example of that embodiment and not intended to imply that the scope of the disclosure, including the claims, is limited to that embodiment.
[0057] RVFV has a tripartite, single-stranded, negative-sense RNA genome. The segments are termed L (large), M (medium), and S (small), encoding for RNA-dependent RNA polymerase, envelope glycoproteins, and nucleocapsid protein respectively. The virus particle (virion) is enveloped, roughly spherical with a diameter of about 80-120 nm. There are vaccines available for livestock which significantly reduce the spread of the virus. For humans, there is no widely approved vaccine, though research continues.1. Rift Valley Fever Virus (RVFV) Vaccine
[0058] A current interest in the fields of therapeutics and diagnostics is the ability and methods for designing, synthesizing, and delivering a nucleic acid to effect physiologic outcomesbeneficial to a cell, a tissue, an organ and ultimately to a subject. The nucleic acid can be a ribonucleic acid (RNA) such as a messenger RNA (mRNA) encoding a peptide or polypeptide of interest. One beneficial outcome is the intracellular translation of the nucleic acid and production of at least one encoded peptide or polypeptide of interest. Of particular interest, is the ability to design, synthesize and deliver a nucleic acid, such as a ribonucleic acid (RNA) which encodes an antigen for the purpose of vaccination.
[0059] Described herein are compositions (including pharmaceutical compositions) and methods for the design, preparation, manufacture, formulation, and / or use of nucleic acid vaccines (NAVs) where at least one component of the NAV is a nucleic acid molecule, e.g., a RNA polynucleotide, and / or a mRNA which encodes an antigen derived from an infectious agent. Also provided are systems, processes, devices and kits for the design and / or utilization of the NAVs described herein.
[0060] Certain embodiments of this disclosure are directed to new RVFV vaccines, e.g., mRNA vaccines. In certain aspects a vaccine mRNA construct includes a 5’ untranslated sequence, an open reading frame of RVFV glycoprotein precursor gene (GPC), a stop-codon, a 3 ’untranslated sequence, and ends with a tail of adenosines. In certain aspects the 5’ untranslated sequence can be a human hemoglobin subunit alpha (HBA). The RVFV open reading frame can be but is not limited to a Kenya 83 RVFV glycoprotein precursor gene (GPC). The stop-codon can be a double stop-codon. In certain aspects the 3 ’untranslated sequence can be two head-to-tail concatenated sequences of human genomic origin, such as partial mitochondrially encoded 12S rRNA (mtRNRl) and amino-terminal enhancer of split (AES). The poly adenosine can be a tail of 50 to 200 adenosines, in certain aspects 110-120 adenosines.
[0061] An mRNA can be produced from a DNA template via in-vitro transcription with T7 polymerase (the T7 promoter is included in the template upstream of the 5’ sequence), with co-transcriptional addition of Cap-1 equivalent structure (CleanCap-AG), and incorporating either the regular uridine or N1 -methylpseudouridine. In certain aspects, after the in-vitro transcription, an mRNA can be but is not required to be dephosphorylated and purified from double-stranded RNA contaminants using cellulose in the presence of 16% ethanol.
[0062] Expression of RVFV GPC can be confirmed via transfection of A549 cells with determination of the target protein in flow cytometry using anti-RVFV mouse ascitic fluid or other antibodies. It was determined that the construct formulated with regular uridine triggerstype I interferon response in transfected cells whereas a construct formulated with N1-methylpseudouridine does not trigger such a response.
[0063] A purified mRNA is encapsulated in lipid nanoparticles and can be used for immunization of mice via intramuscular route, with 1, 2, 5 or 10 pg of vaccine injected once or twice, on days 0 (prime) and 21 (boost). In certain aspects the vaccine is injected 1, 2, 3, 4, or more times.
[0064] Evaluation of serologic responses in immunized mice revealed that the animals developed GPC-binding and neutralizing antibodies to RVFV in dose-dependent manner. Although statistically insignificant due to high variability, it appeared that animals vaccinated with 10 pg of RNA developed higher antibody titers than the animals vaccinated with 5 and 1-2 pg of RNA, and animals vaccinated with N1 -methylpseudouridine construct developed greater antibody responses than animals vaccinated with the regular uridine construct across the doses used.
[0065] In proof of concept studies, twenty-one days after the boost or 28 days after a single vaccination, mice were challenged with 103PFU of RVFV (e.g., strain ZH-501) intraperitoneally. Each group consisted of 5 animals, and the experiment included a naive control group. The observation period continued for 28 days post challenge with daily temperature and weight determination along with assessment of general clinical scores. Four out of 5 control animals developed severe diseases and were euthanized on days 6-10 post challenge. The remaining fifth control mouse that survived in one experiment developed moderate clinical scores but recovered by day 10 post challenge and remained clinically normal during the observation period. RVFV RNA was detected in liver tissues of all succumbed mice but not in the survivor (which is compatible with virus clearance after 1stweek of infection as described elsewhere). The MIT-modified vaccine groups did not develop any clinical signs, weight loss, or temperature changes during the 28-day observation period, and no RVFV RNA was detectable in liver tissue at euthanasia on day 28 (see Example 1 and FIG. 9 for full details of the 1 pg single-dose MIT-modified group demonstrating complete protection without detectable morbidity). One mouse in the group vaccinated with 5 pg of the regular uridine construct developed acute disease and was euthanized on day 23 post challenge. RVFV RNA was not detected in the liver of this mouse, and together with the time of disease onset this suggests that this case was not caused by RVFV. In general, these data suggest that both of the developedRVFV mRNA vaccines - based on modified and non-modified mRNA - elicited robust antibody responses and protected mice against lethal challenge with infectious RVFV.II. Nucleic Acid Vaccines (NAVs)
[0066] Nucleic Acid Vaccines (NAVs) described herein comprise one or more polynucleotides (platform or construct) which encode one or more RVFV antigens. Polynucleotide constructs include antigen-encoding RNA polynucleotides such as mRNAs. The polynucleotide constructs can include at least one chemical modification. The sequences provided can be the sense strand of a sequence but one of skill would readily identify the complementary anti-sense sequence as well. Also, the nucleotide sequences may be presented as DNA sequences, deoxyribose adenine, guanine, thymine, cytosine (AGTC) and / or RNA sequences ribose adenine, guanine, uracil, cytosine (AGUC); one of skill would readily identify the RNA or DNA counterpart.
[0067] NAV compositions of the invention may comprise other components including, but not limited to, adjuvants. Adjuvants may also be administered with or in combination with one or more NAVs. In one aspect, an adjuvant acts as a co-signal to prime T-cells and / or B-cells and / or NK cells as to the existence of an infection. Adjuvants may be co-administered by any route, e.g., intramuscularly, subcutaneous, IV or intradermal injections. Adjuvants useful in the present invention may include, but are not limited to, natural or synthetic adjuvants. Adjuvants can be selected from any of the classes (1) mineral salts, e.g., aluminum hydroxide and aluminum or calcium phosphate gels; (2) emulsions including: oil emulsions and surfactant based formulations, e.g., microfluidized detergent stabilized oil-in-water emulsion, purified saponin, oil-in-water emulsion, stabilized water-in-oil emulsion; (3) particulate adjuvants, e.g., virosomes (unilamellar liposomal vehicles incorporating influenza haemagglutinin), structured complex of saponins and lipids, polylactide co-glycolide (PLG); (4) microbial derivatives; (5) endogenous human immunomodulators; and / or (6) inert vehicles, such as gold particles; (7) microorganism derived adjuvants; (8) tensoactive compounds; (9) carbohydrates; or combinations thereof.
[0068] Specific adjuvants may include, without limitation, cationic liposome-DNA complex JVRS-100, aluminum hydroxide vaccine adjuvant, aluminum phosphate vaccine adjuvant, aluminum potassium sulfate adjuvant, alhydrogel, ISCOM(s)™, Freund's Complete Adjuvant, Freund's Incomplete Adjuvant, CpG DNA Vaccine Adjuvant, Cholera toxin, Cholera toxin Bsubunit, Liposomes, Saponin Vaccine Adjuvant, DDA Adjuvant, Squalene-based Adjuvants, Etx B subunit Adjuvant, IL-12 Vaccine Adjuvant, LTK63 Vaccine Mutant Adjuvant, TiterMax Gold Adjuvant, Ribi Vaccine Adjuvant, Montanide ISA 720 Adjuvant, Corynebacterium-derived P40 Vaccine Adjuvant, MPL™ Adjuvant, AS04, AS02, Lipopolysaccharide Vaccine Adjuvant, Muramyl Dipeptide Adjuvant, CRL1005, Killed Corynebacterium parvum Vaccine Adjuvant, Montanide ISA 51, Bordetella pertussis component Vaccine Adjuvant, Cationic Liposomal Vaccine Adjuvant, Adamantylamide Dipeptide Vaccine Adjuvant, Arlacel A, VSA-3 Adjuvant, Aluminum vaccine adjuvant, Polygen Vaccine Adjuvant, Adjumer™, Algal Glucan, Bay R1005, Theramide®, Stearyl Tyrosine, Specol, Algammulin, Avridine®, Calcium Phosphate Gel, CTA 1-DD gene fusion protein, DOC / Alum Complex, Gamma Inulin, Gerbu Adjuvant, GM-CSF, GMDP, Recombinant hlFN-gamma / Interferon-g, Interleukin- 1 , Interleukin-2, Interleukin-7, Sclavo peptide, Rehydragel LV, Rehydragel HP A, Loxoribine, MF59, MTP-PE Liposomes, Murametide. Murapalmitine, D-Murapalmitine, NAGO, Non-Ionic Surfactant Vesicles, PMMA, Protein Cochleates, QS-21, SPT (Antigen Formulation), nanoemulsion vaccine adjuvant, AS03, Quil-A vaccine adjuvant, RC529 vaccine adjuvant, LTR1920 Vaccine Adjuvant, E. coli heat-labile toxin, LT, amorphous aluminum hydroxyphosphate sulfate adjuvant, Calcium phosphate vaccine adjuvant, Montanide Incomplete Seppic Adjuvant, Imiquimod, Resiquimod, AF03, Flagellin, Poly(LC), ISCOMATRIX®, Abisco-100 vaccine adjuvant, Albumin-heparin microparticles vaccine adjuvant. AS-2 vaccine adjuvant, B7-2 vaccine adjuvant, DHEA vaccine adjuvant, Immunoliposomes Containing Antibodies to Costimulatory Molecules, SAF-1, Sendai Proteoliposomes, Sendai-containing Lipid Matrices, Threonyl muramyl dipeptide (TMDP), Ty Particles vaccine adjuvant, Bupivacaine vaccine adjuvant, DL-PGL (Polyester poly (DL-lactide-co-glycolide)) vaccine adjuvant, IL- 15 vaccine adjuvant, LTK72 vaccine adjuvant, MPL-SE vaccine adjuvant, non-toxic mutant E112K of Cholera Toxin mCT-E112K, and / or Matrix-S. Other adjuvants which may be co-administered with the NAVs of the invention include, but are not limited to interferons, TNF-alpha, TNF-beta, chemokines such as CCL21, eotaxin, HMGB1, SA100-8alpha, GCSF, GMCSF, granulysin, lactoferrin, ovalbumin, CD-40L, CD28 agonists, PD-1, soluble PD1, LI or L2, or interleukins such as IL-1, IL-2, IL-4, IL-6, IL-7, IL-10. IL-12, IL-13, IL -21. IL-23, IL-15, IL-17, and IL-18. These may be administered with the NAV on the same encoded polynucleotide, e.g., polycistronic, or as separate mRNA encoding the adjuvant and antigen.
[0069] An “effective amount” of the NAV composition is provided based, at least in part, on the target tissue, target cell type, means of administration, physical characteristics of the polynucleotide (e.g., size, and extent of modified nucleosides) and other components of the NAV, and other determinants. In general, an effective amount of the NAV composition provides an induced or boosted immune response as a function of antigen production in the cell.
[0070] Activation of the Immune Response. According to various embodiments, the NAVs comprising the polynucleotides disclosed herein may act as a vaccine. As used herein, a “vaccine” refers to a composition, for example, a substance or preparation that stimulates, induces, causes or improves immunity in an organism, e.g., a mammalian organism (a human, etc.). Preferably, a vaccine provides immunity against one or more diseases or disorders, including prophylactic and / or therapeutic immunity. NAVs may be administered prophylactically or therapeutically as part of an active immunization scheme to healthy individuals or early in infection during the incubation phase or during active infection after onset of symptoms.
[0071] In one embodiment, the polynucleotides of the NAVs of the invention may be administrated with a booster. As used herein, when referring to a prophylactic composition, such as a vaccine, the term “booster” refers to an extra administration of the prophylactic composition. A booster (or booster vaccine) may be given after an earlier administration of the prophylactic composition. In certain aspects, the polynucleotides of the NAVs of the invention may be administered intranasally, intramuscularly, or intradermally.III. NAV Polynucleotides Encoding Antigens
[0072] According to certain embodiments, the polynucleotides encode at least one polypeptide of interest (an antigen or immunogen). Antigens of the present invention may be wild type derived from RVFV or modified, engineered, designed or artificial. They may have any combination of the features described herein. In certain embodiments, the antigen is derived from the glycoprotein precursor of RVFV or fragments thereof.
[0073] In one embodiment, the length of a region encoding at least one polypeptide of interest of the polynucleotides present invention is greater than about 30 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500,1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000, 4,000, 5,000, 6,000, 7,000 nucleotides). As used herein, such a region may be referred to as a “coding region” or “region encoding” or “open reading frame (ORF)”.
[0074] In one embodiment, the polynucleotides of the present invention is or functions as a messenger RNA (mRNA). As used herein, the term “messenger RNA” (mRNA) refers to any polynucleotide which encodes at least one peptide or polypeptide of interest and which is capable of being translated to produce the encoded peptide polypeptide of interest in vitro, in vivo, in situ or ex vivo.
[0075] In one embodiment, the polynucleotides of the present invention may be structurally modified or chemically modified. As used herein, a “structural” modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to affect structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide “ATCG” may be chemically modified to “AT-5meC-G”. The same polynucleotide may be structurally modified from “ATCG” to “ATCCCG”. Here, the dinucleotide “CC” has been inserted, resulting in a structural modification to the polynucleotide.
[0076] In certain aspects, the polynucleotides have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation, such as where all uridines are replaced by a uridine analog, e.g., pseudouridine. In another embodiment, the polynucleotides may have a uniform chemical modification of two, three, or four of the same nucleoside type throughout the entire polynucleotide (such as all uridines and all cytosines, etc. are modified in the same way). When the polynucleotides of the present invention are chemically and / or structurally modified the polynucleotides may be referred to as “modified polynucleotides.”
[0077] Polynucleotide Architecture. Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5’ UTR, a 3’ UTR, a 5’ cap and a poly-A tail. The polynucleotides described herein may function as mRNA.
[0078] As used herein, “polypeptide” means a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. In one embodiment, the polypeptides of interest are antigens encoded by the polynucleotides as described herein.
[0079] “Substitutional variants” of polypeptides are those that have at least one amino acid residue in a native or starting sequence removed and a different amino acid inserted in its place at the same position. The substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.
[0080] As used herein the term “conservative amino acid substitution” refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine and leucine for another non-polar residue. Likewise, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine. Additionally, the substitution of a basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and / or a polar residue for a non-polar residue.
[0081] “Insertional variants” of polypeptides are those with one or more amino acids are inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. “Immediately adjacent” to an amino acid means connected to either the alpha-carboxy or alpha-amino functional group of the amino acid.
[0082] “Deletional variants” of polypeptides are those with one or more amino acids in the native or starting amino acid sequence removed. Ordinarily, deletional variants will have one or more amino acids deleted in a particular region of the molecule.
[0083] “Covalent derivatives” of polypeptides include modifications of a native or starting protein with an organic proteinaceous or non-proteinaceous derivatizing agent, and / or post-translational modifications. Covalent modifications are traditionally introduced by reacting targeted amino acid residues of the protein with an organic derivatizing agent that is capable of reacting with selected side-chains or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. The resultant covalent derivatives are useful in programs directed at identifying residues important for biological activity, for immunoassays, or for the preparation of anti-protein antibodies for immunoaffinity purification of the recombinant glycoprotein. Such modifications are within the ordinary skill in the art and are performed without undue experimentation.
[0084] As used herein the terms “termini” or “terminus” of polypeptides refers to an extremity of a peptide or polypeptide. Such extremity is not limited only to the first or final site of the peptide or polypeptide but may include additional amino acids in the terminal regions. The polypeptide based molecules of the present invention may be characterized as having both an N-terminus (terminated by an amino acid with a free amino group (NH2)) and a C-terminus (terminated by an amino acid with a free carboxyl group (COOH)). Proteins of the invention are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non-covalent forces (multimers, oligomers). These sorts of proteins will have multiple N- and C-termini. Alternatively, the termini of the polypeptides may be modified such that they begin or end, as the case may be, with a non-polypeptide based moiety such as an organic conjugate.
[0085] In some embodiments, the encoded polypeptide variant may have the same or a similar activity as the reference polypeptide (e.g., RVFV glycoprotein precursor). Generally, variants of a particular polynucleotide or polypeptide of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art. Such tools for alignment include those of the BLAST suite (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), “Gapped BLAST and PSL BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25:3389-3402.) Other tools are described herein, specifically in the definition of “Identity.”
[0086] Default parameters in the BLAST algorithm include, for example, an expect threshold of 10, Word size of 28, Match / Mismatch Scores 1, -2, Gap costs Linear. Any filter can be applied as well as a selection for species specific repeats, e.g., Homo sapiens.
[0087] Cell-Penetrating Polypeptides. The polynucleotides disclosed herein may also encode one or more cell-penetrating polypeptides. As used herein, “cell-penetrating polypeptide” or CPP refers to a polypeptide which may facilitate the cellular uptake of molecules. A cell-penetrating polypeptide of the present invention may contain one or more detectable labels. The polypeptides may be partially labeled or completely labeled throughout. The polynucleotides may encode the detectable label completely, partially or not at all. The cell-penetrating peptide may also include a signal sequence. As used herein, a “signal sequence” refers to a sequence of amino acid residues bound at the amino terminus of a nascent protein during protein translation. The signal sequence may be used to signal the secretion of the cell-penetrating polypeptide.
[0088] Polynucleotides Plaving Untranslated Regions (UTRs). The polynucleotides of the present invention (e.g., antigen-encoding polynucleotides featured in the NAVs of the invention) may comprise one or more regions or parts which act or function as an untranslated region. Where polynucleotides are designed to encode at least one polypeptide of interest, the polynucleotides may comprise one or more of these untranslated regions.
[0089] By definition, untranslated regions (UTRs) of a gene are transcribed but not translated. In mRNA, the 5’ UTR starts at the transcription start site and continues to the start codon but does not include the start codon; whereas, the 3’ UTR starts immediately following the stop codon and continues until the transcriptional termination signal. The regulatory features of UTR can be incorporated into the polynucleotides of the present invention to among other things, enhance the stability of the molecule.
[0090] Natural 5’ UTRs bear features which play roles in translation initiation. They harbor signatures like Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. 5’ UTR also have been known to form secondary structures which are involved in elongation factor binding. By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of the polynucleotides of the invention.
[0091] Other non-UTR sequences may also be used as regions or subregions within the polynucleotides. For example, introns or portions of introns sequences may be incorporated intoregions of the polynucleotides of the invention. Incorporation of intronic sequences may increase protein production as well as polynucleotide levels.
[0092] Combinations of features may be included in flanking regions and may be contained within other features. For example, the ORF may be flanked by a 5’ UTR which may contain a strong Kozak translational initiation signal and / or a 3’ UTR which may include an oligo(dT) sequence for templated addition of a poly-A tail. 5’ UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes.
[0093] A UTR from various gene(s) may be incorporated into the regions of the polynucleotide. Furthermore, multiple UTRs of any known gene may be utilized. It is also within the scope of the present invention to provide artificial UTRs which are not variants of wild type regions. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected or may be altered in orientation or location. Hence a 5’ or 3’ UTR may be inverted, shortened, lengthened, made with one or more other 5’ UTRs or 3’ UTRs. As used herein, the term “altered” as it relates to a UTR sequence, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3’ or 5’ UTR may be altered relative to a wild type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. Any of these changes producing an “altered” UTR (whether 3 ’ or 5’) comprise a variant UTR.
[0094] Regions Having a 5’ Cap. The 5’ cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5’ proximal introns removal during mRNA splicing.
[0095] Endogenous mRNA molecules may be 5’-end capped generating a 5’-ppp-5’-triphosphate linkage between a terminal guanosine cap residue and the 5 ’-terminal transcribed sense nucleotide of the mRNA molecule. This 5’-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or ante-terminal transcribed nucleotides of the 5’ end of the mRNA may optionally also be 2’-O-methylated. 5’-decapping through hydrolysis and cleavage of the guanylate cap structure may target a nucleic acid molecule, such as an mRNA molecule, for degradation.
[0096] Additional modifications include, but are not limited to, 2’-O-methylation of the ribose sugars of 5’-terminal and / or 5 ’ -anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2’-hydroxyl group of the sugar ring. Multiple distinct 5’-cap structures can be used to generate the 5’-cap of a nucleic acid molecule, such as a polynucleotide which functions as an mRNA molecule.
[0097] Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e., endogenous, wild-type or physiological) 5 ’-caps in their chemical structure, while retaining cap function. Cap analogs may be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or linked to the polynucleotides of the invention.
[0098] Poly-A Tails. During RNA processing, a long chain of adenine nucleotides (poly-A tail) may be added to a polynucleotide such as an mRNA molecule in order to increase stability. Immediately after transcription, the 3’ end of the transcript may be cleaved to free a 3’ hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues long.
[0099] According to the present disclosure, terminal groups on the poly A tail may be incorporated for stabilization into polynucleotides (e.g., antigen-encoding polynucleotides featured in the RNAVs of the invention). Polynucleotides of the present disclosure may include des-3’ hydroxyl tails. They may also include structural moi eties or 2’-0 methyl modifications as taught by Junjie Li, et al. (Current Biology, Vol. 15, 1501-1507, Aug. 23, 2005, the contents of which are incorporated herein by reference in its entirety).
[0100] The polynucleotides may be designed to encode transcripts with alternative polyA tail structures including histone mRNA. These mRNAs are distinguished by their lack of a 3’ poly(A) tail, the function of which is instead assumed by a stable stem-loop structure and its cognate stem-loop binding protein (SLBP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs.
[0101] Unique poly-A tail lengths provide certain advantages to the polynucleotides of the present disclosure (e.g., antigen-encoding polynucleotides featured in the NAVs).
[0102] Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In another embodiment, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1.500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1.000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 3,000, from 2,000 to 3,000, from 2,000 to 2,500, and from 2,500 to 3,000).
[0103] In one embodiment, the poly-A tail is designed relative to the length of the overall polynucleotide or the length of a particular region of the polynucleotide. This design may be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the polynucleotides.
[0104] Start Codon Region. In some aspects, the polynucleotides may have regions that are analogous to or function like a start codon region.
[0105] In one embodiment, the translation of a polynucleotide may initiate on a codon which is not the start codon AUG. Translation of the polynucleotide may initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG. As a non-limiting example, the translation of a polynucleotide begins on the alternative start codon ACG. As another non-limiting example, polynucleotide translation begins on the alternative start codon CTG or CUG. As yet another non-limiting example, the translation of a polynucleotide begins on the alternative start codon GTG or GUG.
[0106] Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and / or the structure of the polynucleotide. (See e.g., Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of which are herein incorporated by reference in its entirety). Masking any of thenucleotides flanking a codon that initiates translation may be used to alter the position of translation initiation, translation efficiency, length and / or structure of a polynucleotide.
[0107] Stop Codon Region. In one aspect, the polynucleotides may include at least one or two stop codons before the 3’ untranslated region (UTR). The stop codon may be selected from TGA, TAA and TAG. In one aspect, the polynucleotides include the stop codon TGA and one additional stop codon. In a further embodiment the addition stop codon may be TAA. In another embodiment, the polynucleotides of the present invention include three stop codons.
[0108] Signal Sequences. The polynucleotides described herein may also encode additional features which facilitate trafficking of the polypeptides to therapeutically relevant sites. One such feature which aids in protein trafficking is the signal sequence. As used herein, a “signal sequence” or “signal peptide” is a polynucleotide or polypeptide, respectively, which is from about 9 to 200 nucleotides (3-60 amino acids) in length which is incorporated at the 5’ (or N-terminus) of the coding region or polypeptide encoded, respectively. Addition of these sequences result in trafficking of the encoded polypeptide to the endoplasmic reticulum through one or more secretory pathways. Some signal peptides are cleaved from the protein by signal peptidase after the proteins are transported.
[0109] Codon Optimization. The polynucleotides contained in the NAVs of the invention, their regions or parts or subregions may be codon optimized. Codon optimization methods are known in the art and may be useful in efforts to achieve one or more of several goals. These goals include to match codon frequencies in target and host organisms to ensure proper folding, bias GC content to increase mRNA stability or reduce secondary structures, minimize tandem repeat codons or base runs that may impair gene construction or expression, customize transcriptional and translational control regions, insert or remove protein trafficking sequences, remove / add post translation modification sites in encoded protein (e.g. glycosylation sites), add, remove or shuffle protein domains, insert or delete restriction sites, modify ribosome binding sites and mRNA degradation sites, to adjust translational rates to allow the various domains of the protein to fold properly, or to reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art, nonlimiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park Calif.) and / or proprietary methods. In one embodiment, the ORF sequence is optimized using optimization algorithms.
[0110] In some embodiments, a 5’ UTR and / or a 3’ UTR region may be provided as flanking regions. Multiple 5’ or 3’ UTRs may be included in the flanking regions and may be the same or of different sequences. Any portion of the flanking regions, including none, may be codon optimized and any may independently contain one or more different structural or chemical modifications, before and / or after codon optimization.
[0111] In Vitro Transcription-Enzymatic Synthesis. cDNA encoding the polynucleotides described herein may be transcribed using an in vitro transcription (IVT) system. The system typically comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor and a polymerase. The NTPs may be manufactured in house, may be selected from a supplier, or may be synthesized as described herein. The NTPs may be selected from, but are not limited to, those described herein including natural and unnatural (modified) NTPs. The polymerase may be selected from, but is not limited to, T7 RNA polymerase, T3 RNA polymerase and mutant polymerases such as, but not limited to, polymerases able to incorporate polynucleotides (e.g., modified nucleic acids).
[0112] Solid-Phase Chemical Synthesis. Chimeric polynucleotides or circular polynucleotides described herein may be manufactured in whole or in part using solid phase techniques.
[0113] Solid-phase chemical synthesis of polynucleotides or nucleic acids is an automated method wherein molecules are immobilized on a solid support and synthesized step by step in a reactant solution. Impurities and excess reagents are washed away and no purification is required after each step. The automation of the process is amenable on a computer-controlled solid-phase synthesizer. Solid-phase synthesis allows rapid production of polynucleotides or nucleic acids in a relatively large scale that leads to the commercial availability of some polynucleotides or nucleic acids. Furthermore, it is useful in site-specific introduction of chemical modifications in the polynucleotide or nucleic acid sequences. It is an indispensable tool in designing modified derivatives of natural nucleic acids.
[0114] Liquid Phase Chemical Synthesis. The synthesis of chimeric polynucleotides or circular polynucleotides of the present invention (e.g., antigen-encoding polynucleotides featured in the NAVs of the invention) by the sequential addition of monomer building blocks may be carried out in a liquid phase. A covalent bond is formed between the monomers or between a terminal functional group of the growing chain and an incoming monomer. Functional groupsnot involved in the reaction must be temporarily protected. After the addition of each monomer building block, the reaction mixture has to be purified before adding the next monomer building block. The functional group at one terminal of the chain has to be deprotected to be able to react with the next monomer building blocks. A liquid phase synthesis is labor- and time-consuming and cannot not be automated. Despite the limitations, liquid phase synthesis is still useful in preparing short polynucleotides in a large scale. Because the system is homogenous, it does not require a large excess of reagents and is cost-effective in this respect.
[0115] Combination of Synthetic Methods. The synthetic methods discussed above each has its own advantages and limitations. Attempts have been conducted to combine these methods to overcome the limitations. Such combinations of methods are within the scope of the present invention.IV. Pharmaceutical Vaccine Compositions
[0116] The present invention provides pharmaceutical compositions including NAVs and NAV compositions and / or complexes optionally in combination with one or more pharmaceutically acceptable excipients. The present invention provides NAVs and NAV pharmaceutical compositions and complexes optionally in combination with one or more pharmaceutically acceptable excipients. Pharmaceutical compositions may optionally comprise one or more additional active substances, e.g., therapeutically and / or prophylactically active substances. Pharmaceutical compositions of the present invention may be sterile and / or pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceutical agents may be found, for example, in Remington: The Science and Practice of Pharmacy 21’ ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety).
[0117] In some embodiments, compositions are administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase “active ingredient” generally refers to the NAVs or the polynucleotides contained therein, e.g., antigen-encoding polynucleotides, for example, RNA polynucleotides, to be delivered as described herein.
[0118] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g., non-human mammals.Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.
[0119] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into a desired single- or multi-dose unit.
[0120] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the invention will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100%. e.g., between 0.5 and 50%, between 1-30%, between 5-80%, at least 80% (w / w) active ingredients.
[0121] Formulations. Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and / or one or more other accessory ingredients.
[0122] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
[0123] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and / or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1% and 99% (w / w) of the active ingredient. By way of example, the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1-30%, between 5-80%, at least 80% (w / w) active ingredient.
[0124] Pharmaceutical formulations may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes, but is not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, Md., 2006; incorporated herein by reference in its entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component s) of the pharmaceutical composition.
[0125] Pharmaceutically acceptable excipients used in the manufacture of pharmaceutical compositions include, but are not limited to, inert diluents, surface active agents and / or emulsifiers, preservatives, buffering agents, lubricating agents, and / or oils. Such excipients may optionally be included in the pharmaceutical formulations of the invention.
[0126] Liposomes, Lipoplexes, and Lipid Nanoparticles. The NAVs of the invention can be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles. In one embodiment, pharmaceutical compositions of NAVs include liposomes. Liposomes are artificially prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of nutrients and pharmaceutical formulations. Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV) which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV) which may be smaller than 50 nm indiameter, and a large unilamellar vesicle (LUV) which may be between 50 and 500 nm in diameter. Liposome design may include, but is not limited to, opsonins or ligands in order to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes may contain a low or a high pH in order to improve the delivery of the pharmaceutical formulations.
[0127] In one embodiment, pharmaceutical compositions described herein may include, without limitation, liposomes such as those formed from l,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), l,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), and MC3 (US20100324120; herein incorporated by reference in its entirety) and liposomes which may deliver small molecule drugs such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).
[0128] Suspension Formulations. In some embodiments, suspension formulations are provided comprising NA Vs, water immiscible oil depots, surfactants and / or co-surfactants and / or co-solvents. Combinations of oils and surfactants may enable suspension formulation with NAVs. Delivery of NAVs in a water immiscible depot may be used to improve bioavailability through sustained release of NAVs from the depot to the surrounding physiologic environment and prevent polynucleotides degradation by nucleases.
[0129] In some embodiments, suspension formulations of NAV may be prepared using combinations of polynucleotides, oil-based solutions and surfactants. Such formulations may be prepared as a two-part system comprising an aqueous phase comprising polynucleotides and an oil-based phase comprising oil and surfactants. Exemplary oils for suspension formulations may include, but are not limited to sesame oil and Miglyol (comprising esters of saturated coconut and palmkemel oil-derived caprylic and capric fatty acids and glycerin or propylene glycol), com oil, soybean oil, peanut oil, beeswax and / or palm seed oil. Exemplary surfactants may include, but are not limited to Cremophor, polysorbate 20, polysorbate 80, polyethylene glycol, transcutol, Capmul®, labrasol, isopropyl myristate, and / or Span 80. In some embodiments, suspensions may comprise co-solvents including, but not limited to ethanol, glycerol and / or propylene glycol.
[0130] Cryoprotectants. In some embodiments, NAV formulations may comprise cyroprotectants. As used herein, there term “cryoprotectant” refers to one or more agent thatwhen combined with a given substance, helps to reduce or eliminate damage to that substance that occurs upon freezing. In some embodiments, cryoprotectants are combined with NAVs in order to stabilize them during freezing. Frozen storage of NAVs between -20° C. and -80° C. may be advantageous for long term (e.g. 36 months) stability of polynucleotide. In some embodiments, cryoprotectants are included in NAV formulations to stabilize polynucleotide through freeze / thaw cycles and under frozen storage conditions. Cryoprotectants of the present disclosure may include, but are not limited to sucrose, trehalose, lactose, glycerol, dextrose, raffinose and / or mannitol. Trehalose is listed by the Food and Drug Administration as being generally regarded as safe (GRAS) and is commonly used in commercial pharmaceutical formulations.
[0131] Bulking Agents. In some embodiments, NAV formulations may comprise bulking agents. As used herein, there term “bulking agent” refers to one or more agents included in formulations to impart a desired consistency to the formulation and / or stabilization of formulation components. In some embodiments, bulking agents are included in lyophilized NAV formulations to yield a “pharmaceutically elegant” cake, stabilizing the lyophilized NAVs during long term (e.g. 36 month) storage. Bulking agents of the present disclosure may include, but are not limited to sucrose, trehalose, mannitol, glycine, lactose and / or raffinose. In some embodiments, combinations of cryoprotectants and bulking agents (for example, sucrose / glycine or trehalose / mannitol) may be included to both stabilize NAVs during freezing and provide a bulking agent for lyophilization.
[0132] Administration. The NAVs of the present invention may be administered by any route which results in a therapeutically effective outcome.
[0133] Parenteral and Injectable Administration. Liquid dosage forms for parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and / or elixirs.
[0134] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing agents, wetting agents, and / or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions, and / or emulsions in nontoxic parenterally acceptable diluents and / or solvents. Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositionswhich can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
[0135] Dosing. The present invention provides methods comprising administering NAVs and in accordance with the invention to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. Compositions in accordance with the invention are typically formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.
[0136] In certain embodiments, compositions in accordance with the present invention may be administered at dosage levels sufficient to deliver from about 0.01 pg to about 100 pg, from about 0.1 pg to about 50 pg, from about 0.1 pg to about 10 pg, one or more times a day, to obtain the desired therapeutic effect (see e.g., the range of unit doses described in International Publication No WO2013078199, herein incorporated by reference in its entirety). The desired dosage may be delivered three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used.
[0137] According to the present disclosure, NAVs may be administered in split-dose regimens. As used herein, a “split dose” is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose. As used herein, a“single unit dose” is a dose of any therapeutic administer in one dose / at one time / single route / single point of contact, i.e., single administration event. As used herein, a “total daily dose” is an amount given or prescribed in 24 hr period. It may be administered as a single unit dose. In one embodiment, the NAVs of the present invention are administered to a subject in split doses. The NAVs may be formulated in buffer only or in a formulation described herein.
[0138] Multi-Dose and Repeat-Dose Administration. In some embodiments, NAV compounds and / or compositions of the present invention may be administered in two or more doses (referred to herein as “multi-dose administration”). Such doses may comprise the same components or may comprise components not included in a previous dose. Such doses may comprise the same mass and / or volume of components or an altered mass and / or volume of components in comparison to a previous dose. In some embodiments, multi-dose administration may comprise repeat-dose administration. As used herein, the term “repeat-dose administration” refers to two or more doses administered consecutively or within a regimen of repeat doses comprising substantially the same components provided at substantially the same mass and / or volume. In some embodiments, subjects may display a repeat-dose response. As used herein, the term “repeat-dose response” refers to a response in a subject to a repeat-dose that differs from that of another dose administered within a repeat-dose administration regimen. In some embodiments, such a response may be the expression of a protein in response to a repeat-dose comprising NAV. In such embodiments, protein expression may be elevated in comparison to another dose administered within a repeat-dose administration regimen or protein expression may be reduced in comparison to another dose administered within a repeat-dose administration regimen. Alteration of protein expression may be from about 1% to about 20%, from about 5% to about 50% from about 10% to about 60%, from about 25% to about 75%, from about 40% to about 100% and / or at least 100%. A reduction in expression of mRNA administered as part of a repeat-dose regimen, wherein the level of protein translated from the administered RNA is reduced by more than 40% in comparison to another dose within the repeat-dose regimen is referred to herein as “repeat-dose resistance.”V. Kits and Devices
[0139] The invention provides a variety of kits for conveniently and / or effectively carrying out methods of the present invention. Typically, kits will comprise sufficient amounts and / ornumbers of components to allow a user to perform multiple treatments of a subject(s) and / or to perform multiple experiments.
[0140] In one aspect, the present invention provides kits comprising the NAV molecules (including any proteins or polynucleotides) of the invention. In one embodiment, the kit comprises one or more nucleic acid vaccines.
[0141] The kits can be for protein production, comprising a first polynucleotides comprising a translatable region of an antigen. The kit may further comprise packaging and instructions and / or a delivery agent to form a formulation composition. The delivery agent may comprise a saline, a buffered solution, or a delivery agent.
[0142] In one embodiment, the buffer solution may include sodium chloride, calcium chloride, phosphate and / or EDTA. In another embodiment, the buffer solution may include, but is not limited to, saline, saline with 2 mM calcium, 5% sucrose, 5% sucrose with 2 mM calcium, 5% Mannitol, 5% Mannitol with 2 mM calcium, Ringer's lactate, sodium chloride, sodium chloride with 2 mM calcium and mannose. In a further embodiment, the buffer solutions may be precipitated, or it may be lyophilized. The amount of each component may be varied to enable consistent, reproducible higher concentration saline or simple buffer formulations. The components may also be varied in order to increase the stability of polynucleotides in the buffer solution over a period of time and / or under a variety of conditions.VI. Examples
[0143] The following examples as well as the figures are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples or figures represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
[0144] Example 1: Immunogenicity and Protective Efficacy of LNP -Encapsulated RVFV GPC mRNA Vaccine in BALB / c Mice, Demonstrating Complete Protection at Low Dose
[0145] To demonstrate the potency of the claimed LNP-encapsulated RVFV GPC mRNA vaccine, 4-week-old female BALB / c mice received a single intramuscular immunization with 1 pg or 5 pg of the vaccine (with uridine fully substituted by N1 -methylpseudouridine). Twentyeight days later, mice were challenged subcutaneously with 1000 PFU of virulent RVFV ZH-501, a dose uniformly lethal to naive BALB / c mice. Age-matched naive controls were included.
[0146] As shown in FIG. 9A, both doses of the fully substituted MIT-mRNA vaccine induced high virus-neutralizing antibody titers; as shown in FIG. 9B, robust Gn-binding antibodies were elicited by ELISA. Naive sera showed no activity.
[0147] Post-challenge, complete (100%) survival was observed in both immunized groups through the 28-day observation period (FIG. 9C), while all naive controls succumbed rapidly.
[0148] Crucially, mice receiving the low 1 pg dose exhibited no detectable clinical signs of disease. As shown in FIG. 9D, body weight remained stable with only minimal, transient fluctuations indistinguishable from normal variation; no lethargy, ruffled fur, or other morbidity was observed. The 5 pg dose produced similarly excellent results (FIG. 9E). In contrast, naive controls showed rapid, severe weight loss and typical lethal disease signs (FIG. 9F). No RVFV RNA was detectable in livers of any immunized mice at day 28.
[0149] These data unexpectedly demonstrate that a single 1 pg dose of the claimed mRNA vaccine (fully MIT-substituted SEQ ID NO:1 in LNP) elicits potent neutralizing (PRNT50) and binding antibodies, conferring complete protection without any detectable clinical signs against lethal RVFV challenge — highlighting superior potency and dose-sparing compared with other nucleic acid platforms. This protection is attributable to the combination of MIT modification (reducing innate IFN response; see FIGS. 2-3), specific UTR design (enhancing mRNA stability and translation), and robust GPC expression. For other mammalian subjects (e.g., non-human primates or livestock such as sheep / goats), the skilled artisan can reasonably scale doses proportionally (e.g., 10-100 pg based on body weight and established mRNA vaccine scaling practices), administer via the intramuscular route, and evaluate immunogenicity / protection using analogous assays (e.g., PRNT, ELISA, viral challenge models in NHP or ruminants). Primeboost regimens (e.g., day 0 prime and day 21 boost) may further enhance antibody titers if desired, consistent with standard mRNA vaccine protocols.
Claims
CLAIMS1. An mRNA vaccine comprising an RNA encoding 5’ to 3’ an untranslated region (5’ UTR) segment, a Rift Valley Fever Virus (RVFV) glycoprotein precursor gene (GPC) coding segment, a double stop codon, a 3’ untranslated region (3’ UTR) segment, and poly-adenosine (pA) segment.
2. The mRNA vaccine of claim 1, wherein the Rift Valley Fever Virus glycoprotein precursor gene (GPC) coding segment encodes RVFV Kenya 83 strain.
3. The mRNA vaccine of claim 1, wherein the 3’ UTR comprises concatenated sequences of human genomic origin, partial mitochondrially encoded 12S rRNA (mtRNRl) and aminoterminal enhancer of split (AES).
4. The mRNA vaccine of claim 1, wherein the promoter has a nucleic acid sequence of SEQ ID N0:2.
5. The mRNA vaccine of claim 1, wherein the 5’ UTR has a nucleic acid sequence of SEQ ID NOG.
6. The mRNA vaccine of claim 1, wherein the ORF has a nucleic acid sequence of SEQ ID NO:4.
7. The mRNA vaccine of claim 1, wherein the 3’ UTR has a nucleic acid sequence of SEQ ID N0:5.
8. The mRNA vaccine of claim 1, wherein the mRNA has a nucleic acid sequence of SEQ ID NO:1.
9. The mRNA vaccine of any one of claims 1-8, wherein substantially all uridine residues in the mRNA are replaced with N1 -methylpseudouridine (MIT).
10. The mRNA vaccine of any one of claims 1-8, wherein the pA segment comprises between 80 and 150 adenosine residues.
11. A pharmaceutical composition comprising the mRNA vaccine of any one of claims 1-8 and a pharmaceutically acceptable excipient.
12. A method of inducing an immune response to Rift Valley Fever Virus comprising administering to a mammalian subject an mRNA vaccine of any one of claim 1 to 8.
13. The method of claim 12, wherein the mammalian subject is a human subject.
14. A lipid nanoparticle comprising an mRNA of any one of claim 1 to 8.
15. The lipid nanoparticle of claim 14, wherein the lipid nanoparticle comprises an ionizable lipid, a helper lipid, cholesterol, and a PEG-lipid.
16. A method of inducing an immune response against Rift Valley Fever Virus (RVFV) in a mammalian subject, the method comprising administering to the subject an effective amount of the mRNA vaccine of any one of claims 1-10 or the pharmaceutical composition of claim 11 or the lipid nanoparticle of claim 14 or 15.
17. The method of claim 16, wherein the mammalian subject is a human.
18. The method of claim 16 or 17, wherein the mRNA vaccine or lipid nanoparticle is administered intramuscularly.
19. The method of any one of claims 16-18, wherein the effective amount is between 0.1 pg and 50 pg of mRNA.
20. The method of any one of claims 16-19, wherein the effective amount is 1 pg, 2 pg, 5 pg, or 10 pg of mRNA.
21. The method of any one of claims 16-20, wherein the mRNA vaccine or lipid nanoparticle is administered in a prime-boost regimen, wherein a first dose is administered on day 0 and a second dose is administered on day 21.
22. The method of any one of claims 16-21, wherein administration induces virusneutralizing antibodies in the subject.
23. The method of any one of claims 16-22, wherein administration protects the subject against lethal RVFV challenge.
24. The method of claim 23, wherein the lethal challenge is 103PFU of RVFV strain ZH-501 administered subcutaneously or intraperitoneally.
25. The method of any one of claims 16-24, wherein the mRNA vaccine or lipid nanoparticle is administered as a single dose that provides protective immunity.
26. A kit comprising:(a) the mRNA vaccine of any one of claims 1-10 or the lipid nanoparticle of claim 12 or 13, and(b) instructions for intramuscular administration to a human subject for the prevention or treatment of Rift Valley Fever.
27. The mRNA vaccine, pharmaceutical composition, lipid nanoparticle, method, or kit of any one of claims 1—26, wherein the mRNA is produced by in vitro transcription using a T7 promoter having the sequence of SEQ ID NO:2.
28. The method of any one of claims 16-27, wherein the mRNA vaccine or lipid nanoparticle is administered as a single 1 pg dose and provides complete (100%) protection against lethal RVFV ZH-501 challenge with no detectable clinical signs of disease, including no significant weight loss, in B ALB / c mice.
29. The method of claim 28, wherein no RVFV RNA is detectable in liver tissue of immunized mice at 28 days post-challenge.
30. The mRNA vaccine, pharmaceutical composition, lipid nanoparticle, method, or kit of any one of claims 1-29, wherein the mRNA is fully substituted with Nl-methylpseudouridine (MI ) and comprises the nucleic acid sequence of SEQ ID NO:1.
31. The method of claim 28 or 29, wherein the mRNA vaccine comprises the nucleic acid sequence of SEQ ID NO: 1 fully substituted with Nl-methylpseudouridine (MIT).
32. The mRNA vaccine, pharmaceutical composition, lipid nanoparticle, method, or kit of any one of claims 1-29, wherein the GPC coding segment is codon-optimized for mammalian expression.