Methods of diagnosing and treating neurodegenerative disease

Abstract

Described herein are methods and kits for the early diagnosis of neurodegenerative diseases, such as Alzheimer's disease, by detecting the enzymatic activities of L1 variants. Increased levels of the enzymatic activities serve as biological indicators that can signal the presence or risk of developing such diseases, preceding the visible or detectable changes identified by conventional techniques. Also provided herein, are methods of treating neurodegenerative diseases following early diagnosis.

Description

Attorney Docket No. 42256-634.601METHODS OF DIAGNOSING AND TREATING NEURODE GENERATIVE DISEASECROSS REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application 63 / 776,763 filed on March 24, 2025, which is incorporated herein by reference in its entirety.STATEMENT AS TO FEDERALLY SPONSPORED RESEARCH

[0002] This invention was made with government support under R01 AG065541 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND

[0003] Long Interspersed Nuclear Element-1 (LI) is a germline transposable element that exists in -500,000 copies in the human genome. A minority of these copies are thought to be capable of retrotransposon activity through which they can produce germline insertional mutagenesis to influence evolution of species. LI has two potential protein-coding sequences - open reading frame 1 and 2 (ORF1 and ORF2) - that respectively express an RNA binding protein and a reverse transcriptase / endonuclease. Heterogeneity of LI sequences could produce variant ORF1 and / or ORF2 proteins. LI retrotransposon activity has been linked to the progression of multiple diseases. However, the specific roles for LI variant proteins beyond promotion of retrotransposition are not well defined, especially beyond germline activities since LI can also be expressed in somatic tissues.SUMMARY

[0004] Long Interspersed Nuclear Element-1 (LI) contains two open reading frames, ORF1 and ORF2. ORF1 encodes an RNA binding protein, while ORF2 encodes a reverse transcriptase and an endonuclease. LI activity, particularly ORF2 can be linked to the progression of neurodegenerative diseases.

[0005] Provided herein, in some embodiments, is a method of diagnosing a neurodegenerative disease in a subject in need thereof, the method comprising: detecting a change in an enzymatic activity of a Long Interspersed Nuclear Element- 1 (LI) variant in a sample obtained from a subject compared with a reference enzymatic activity of a control subject not having the neurodegenerative disease, wherein the change in the enzymatic activity indicates that the subject has or is at risk of developing the neurodegenerativeAttorney Docket No. 42256-634.601disease. In some embodiments, the LI variant comprises a bicistronic open reading frame 1 (ORF1) and open reading frame 2 (ORF2) variant, a monocistronic ORF1 variant, or a monocistronic ORF2 variant. In some embodiments, the LI variant is a monocistronic ORF2 variant. In some embodiments, the monocistronic ORF2 variant comprises an intact ORF2 variant or a partial ORF2 variant. In some embodiments, the intact ORF2 variant comprises or encodes a reverse transcriptase (RT) domain, an endonuclease (EN) domain, or a combination thereof. In some embodiments, the partial ORF2 variant comprises or encodes a RT domain, an EN domain, or a combination thereof. In some embodiments, the enzymatic activity comprises a reverse transcriptase (RT) activity, an endonuclease (EN) activity, or both. In some embodiments, the change in the enzymatic activity of the LI variant comprises an increase or a decrease in the enzymatic activity. In some embodiments, the change in the enzymatic activity is the increase in the enzymatic activity. In some embodiments, the increase in the enzymatic activity comprises an increase in the reverse transcriptase (RT) activity, an increase in the endonuclease (EN) activity, or an increase in both. In some embodiments, the change in the enzymatic activity is associated with one LI variant. In some embodiments, the change in the enzymatic activity is associated with two or more LI variants. In some embodiments, the LI variant comprises a synonymous mutation compared with a nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the LI variant comprises a non-synonymous mutation compared with the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the LI variant is a genomic cDNA (gencDNA). In some embodiments, the LI variant is an RNA. In some embodiments, the LI variant is a mRNA. In some embodiments, the LI variant is a polypeptide. In some embodiments, the LI variant is identified by in situ hybridization or immunological hybridization. In some embodiments, the LI variant is identified by a probe binding to the LI variant. In some embodiments, the probe comprises a polynucleotide probe or a polypeptide probe. In some embodiments, the polynucleotide probe comprises a single-strand sequence of DNA. In some embodiments, the polynucleotide probe comprises a single-strand sequence of RNA. In some embodiments, the polypeptide probe comprises an antibody or an antigen binding fragment thereof. In some embodiments, the probe is labeled using a fluorochrome or a radioactive isotope. In some embodiments, the probe is labeled using an affinity tag. In some embodiments, the affinity tag comprises biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof. In some embodiments, the neurodegenerative disease comprises Alzheimer’s disease. In some embodiments, the Alzheimer’s disease comprises familial Alzheimer’s disease or sporadicAttorney Docket No. 42256-634.601Alzheimer’s disease. In some embodiments, the subject is a human. In some embodiments, the sample comprises a bodily fluid or a cell. In some embodiments, the bodily fluid comprises blood plasma, serum, cerebrospinal fluid, urine, saliva, semen, tears, sweat, fecal matter, breast milk, synovial fluid, pleural fluid, pericardial fluid, peritoneal fluid, or amniotic fluid. In some embodiments, the cell comprises a neuronal cell. In some embodiments, the method further comprises administering the subject a therapeutic agent targeting the change in the enzymatic activity.

[0006] Provided herein, in some embodiments, is a method of treating a neurodegenerative disease in a subject in need thereof, the method comprising: administering to a subject a therapeutic agent, wherein the subject has a change in an enzymatic activity associated with a LI variant relative to the enzymatic level of LI variant in a control subject not having the neurodegenerative disease, wherein the therapeutic agent decreases the change in the enzymatic activity of the LI variant in the subject. In some embodiments, the therapeutic comprises a nucleoside reverse transcriptase inhibitor (NRTI) or a non-nucleoside reverse transcriptase inhibitor (NNRTI). In some embodiments, the therapeutic agent is the nucleoside reverse transcriptase inhibitor (NRTI). In some embodiments, the nucleoside reverse transcriptase inhibitor (NRTI) comprises Abacavir, Emtricitabine, Lamivudine, Tenofovir alafenamide, Tenofovir disoproxil fumarate, or Zidovudine. In some embodiments, the therapeutic is the non-nucleoside reverse transcriptase inhibitor (NNRTI). In some embodiments, the non-nucleoside reverse transcriptase inhibitor (NNRTI) comprises Nevirapine, Efavirenz, Etravirine, Doravirine, Delavirdine, or Rilpivirine. In some embodiments, the therapeutic agent comprises an antisense oligonucleotide (AON), an RNA interfering agent (RNAi), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a peptide, a peptidomimetic, a small molecule, an aptamer, or a combination thereof. In some embodiments, the antisense oligonucleotide targets the LI variant comprising a LI ORF1, a LI ORF2, or both. In some embodiments, the therapeutic agent is a small molecule. In some embodiments, the therapeutic agent comprises an antibody or an antigen binding fragment thereof. In some embodiments, the antibody or the antigen binding fragment thereof binds to a polypeptide encoded by the LI variant.

[0007] Further provided herein, in some embodiments, is a kit comprising: (a) a probe for detecting at least one LI variant; and (b) a detecting reagent for detecting binding of the probe with the at least one LI variant. In some embodiments, the at least one LI variant comprises a bicistronic LI ORF1 and ORF2 variant, a monocistronic LI ORF1 variant, a monocistronic intact LI ORF2 variant, or a monocistronic partial LI ORF2 variant. In someAttorney Docket No. 42256-634.601embodiments, the at least one LI variant is associated with a change in an enzymatic activity comprising a reverse transcriptase (RT) activity, an endonuclease (EN) activity, or a combination thereof. In some embodiments, the at least one LI variant is an RNA. In some embodiments, the at least one LI variant is a genomic cDNA (gencDNA). In some embodiments, the at least one LI variant is a polypeptide. In some embodiments, the probe comprises a polynucleotide probe or a polypeptide probe. In some embodiments, the probe comprises a single-strand sequence of DNA. In some embodiments, the probe comprises a single-strand sequence of RNA. In some embodiments, the probe comprises an antibody or an antigen binding fragment thereof. In some embodiments, the probe is labeled using a fluorochrome or a radioactive isotope. In some embodiments, the probe is labeled using an affinity tag. In some embodiments, the affinity tag is biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof. In some embodiments, the detecting reagent binds to the probe. In some embodiments, the detecting reagent comprises a fluorescent or a radioactive label.INCORPORATION BY REFERENCE

[0008] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. For example, CS Liu et al. RNA Isoform Diversity in Human Neurodegenerative Diseases. eNeuro. 2024 Dec 27;ll(12):ENEURO.0296-24.2024.doi:10.1523 / ENEURO.0296-24.2024. is incorporated by reference in its entirety for all purposes.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] The novel features described herein are set forth with particularity in the appended claims. A better understanding of the features and advantages of the features described herein will be obtained by reference to the following detailed description that sets forth illustrative examples, in which the principles of the features described herein are utilized, and the accompanying drawings of which:

[0010] FIGs. 1A-1F illustrate discordant LI ORF2 and ORF1 RNA expression in aged human cortical neurons. FIG. 1A illustrates a schematic of RNAscope probes designed against the functional domains of LI ORF1 and ORF2 for examination of LI spatial transcriptomic expression in aged human post-mortem brain tissue (non-diseased and Alzheimer’s disease prefrontal cortex and medial temporal gyrus, n=31). FIG. IB illustratesAttorney Docket No. 42256-634.601RNAscope of LI 0RF1 and LI ORF2 and shows a moderate colocalization in both MAP2+ and MAP2- nuclei. Scale bar 50 pm. Cytoplasmic ORFl-alone was also detected (some noted by white arrowheads). Magnification of MAP2+ and MAP2- nuclei with each probe isolated (grey boxes). Nuclear boundaries determined by DAPI labelling (dashed line). FIG. 1C illustrates H-score calculation based on the percentage of cells binned according to probe signal intensity. Cells were scored from 0-4 based on area adjusted median fluorescence intensity (MFI) as described in methods and prior literature; 0-400, 0= no-signal, 400=highest signal. FIG. ID illustrates ORF1 H-score for MAP2- cells compared to MAP2+ cells.Median ± interquartile range (IQR). ****p-value<0.0001. Wilcoxon test. FIG. IE illustrates ORF2 H-Score for MAP2- cells compared to MAP2+ cells. Median ± interquartile range (IQR). ****p-value<0.0001. Wilcoxon test. FIG. IF illustrates a violin plot of ORF2 / ORF1 MFI ratio per individual MAP2- versus MAP2+ cells. Median ± IQR. ****p-value<0.0001. Wilcoxon test.

[0011] FIGs. 2A-2F illustrate long read PacBio sequencing of the LI neural transcriptome reveals interindividual and sample variation. FIG. 2A. illustrates a schematic of the experimental workflow and bioinformatic pipeline for analysis of the polyA+ LI neural transcriptome in the prefrontal cortex (PFC) and medial temporal gyrus (MTG) of nondiseased (ND) and Alzheimer’s disease (AD) post-mortem human brain (ages 46-94, n=31).FIG. 2B illustrates a schematic of LI ORF variant calling based on identified open reading frames from LI long-read sequencing. LI transcripts were classified as (A) full-length bicistronic ORF1 and ORF2, (B) monocistronic intact ORF1, (C) monocistronic intact ORF2, (D) partial ORF2 (intact EN + RT domain), and (E) partial ORF2 (intact EN without RT domain). FIG. 2C illustrates a histogram of the percentage of LI reads relative to length (bpbase pairs). Bin 500bp. Median ± interquartile range (IQR). FIG. 2D illustrates the percentage of fragmented reads for transcripts of each length based on off-target, non-Ll reads indicating capture of non-Ll mRNAs beyond 6000 bps and an ability to capture full-length bicistronic LI transcripts, if present. Median, IQR, min and max. FIG. 2E illustrates the percentage of LI reads classified as each LI ORF variant type as compared to LI transcripts with no intact ORF, per FIG. 2B. Median, IQR, min and max. FIG. 2F illustrates the number of distinct full-length bicistronic ORF1 and ORF2, monocistronic intact ORF1, and monocistronic intact ORF2 variants identified. Each bar represents an individual brain sample (n=31).

[0012] FIGs. 3A-3E illustrate the correlation between reverse transcriptase (RT) activity in the human brain and LI ORF2 in neurons. FIG. 3 A illustrates a schematic of theAtorney Docket No. 42256-634.601experimental workflow and fluorescence product-enhanced RT (FPERT) assay. FIG. 3B illustrates RT activity (as pU of control recombinant HIV RT) of post-mortem human brain samples from non-disease (ND) and Alzheimer's disease (AD) prefrontal cortex (PFC - filled circles) and medial temporal gyrus (MTG - open circles). Median ± interquartile range (IQR), min and max, non-significant (ns): Mann -Whitney test. FIG. 3C illustrates relative RT activity of the micro-dissected grey vs. white matter compared to whole brain lysates from three brains. Mean ± SD. **p-value<0.01, ***p-value<0.001, ****p-value<0.0001. Multiple unpaired t-test. FIG. 3D illustrates a scatterplot of RT activity (pU) in post-mortem human brain samples (n=31) relative to ORF2 H-score in MAP2+ nuclei. *p-value=0.0176, y=12.22x-357.3, Simple linear regression. FIG. 3E illustrates a scatterplot of RT activity (pU) in post-mortem human brain samples (n=31) relative to 0RF1 H-score in MAP2+ nuclei. ns. Simple linear regression.

[0013] FIGs. 4A-4E illustrate concomitant endonuclease and reverse transcriptase activities from intact and partial ORF2 variants. FIG. 4A illustrates twelve representative proteinencoding ORF2 variants utilised in the functional assays: intact ORF2 variants (#1-7) contain an endonuclease (EN) domain, reverse transcriptase (RT) domain, and c-terminus; partial ORF2 variants (#8-12) contain an intact EN and RT domain but a truncated / absent c-terminus. FIG. 4B illustrates fold-change in RT activity, as determined by fluorescence product-enhanced RT (FPERT) assay, of ORF2 variants relative to EGFP control transfections across triplicate experiments. Mean ± SEM. *p-value<0.05, ***p-value<0.001, ****p-value<0.0001. One-way ANOVA. FIG. 4C illustrates that transfected LN229s (ORF2 variant expression constructs versus EGFP) were labelled for y-H2AX, a marker of doublestrand DNA breaks. Scale bar 100pm, 20X. Representative images of EGFP controls, ORF2 variant #1 (intact), and ORF2 variant #8 (partial). FIG. 4D illustrates a heat-map of the difference in fold change of y-H2AX median fluorescence intensity (MFI) between conditions (x-axis variants divided by y-axis variants). Asterisks indicate statistical significance of fold change in y-H2AX MFVnuclei between conditions. *p-value<0.05, **p-value<0.01, ***p-value<0.001, ****p-value<0.0001. Mann-Whitney test. Empty boxes denote a lack of statistical significance. FIG. 4E illustrates a scatterplot of fold change of y-H2AX MFI versus mean RT activity of variants. Dot colour and number indicative of variant ID.

[0014] FIG. 5 illustrates single nucleotide variants (SNVs) and single amino acid variants (SAVs) across 12 ORF2 coding variants examined in functional assays. SNVs and SAVs across the 12 functionally assayed ORF2 variants were compared to the ORF2 region in theAttomey Docket No. 42256-634.601LI consensus sequence. Endonuclease (EN), reverse transcriptase (RT), and c-terminus domains are indicated. Pile-up display indicates frequency of SNVs / SAVs across the 12 evaluated variants, along with one deletion (#9). Percent identity, percent coverage, and number of mismatched nucleotides (nt) and amino acids (aa) as compared to the LI consensus sequence are depicted to the right of each variant.

[0015] FIGs. 6A-6L illustrate spatial transcriptomic analysis of LI ORF1 and ORF2 in the Alzheimer’s and non-disease prefrontal cortex and medial temporal gyrus. FIG. 6A illustrates RNAscope of LI ORF1 and LI ORF2 colocalization with MAP2- (non-neuronal) and MAP2+ (neuronal) cells in the grey and white matter of a human post-mortem cortical tissue sample. FIG. 6B illustrates comparison of fluorophore choice on LI ORF1 and ORF2 H-score. Standard - fluorophore used for experiments; Switch - fluorophore switched between LI ORF1 and ORF2. FIG. 6C illustrates a violin plot of ORF2 / ORF1 ratio based on fluorophore choice. Standard - fluorophore used for experiments; Switch - fluorophore switched between LI ORF1 and ORF2. No change in statistical difference between non-neuronal and neuronal based on fluorophore. ****p-value<0.0001, Mann-Whitney test. FIG. 6D illustrates RNAscope for LI ORF1 and ORF2 in a human post-mortem cortical tissue sample with and without RNase pre-treatment FIG. 6E illustrates H-score differences between MAP2- (non-neuronal) and MAP2+ (neuronal) cells with awareness for disease (Alzheimer’s disease - AD and non-diseased - ND) and region (prefrontal cortex - PFC and medial temporal gyrus - MTG) for ORF1. Median ± quartiles. *p-value<0.05; **p-value<0.01; ***p-value<0.001; ****p-value<0.0001. Comparison between cell types:Wilcoxon test. Comparison between diseases: Mann-Whitney test. FIG. 6F illustrates H-score differences between MAP2- (non-neuronal) and MAP2+ (neuronal) cells with awareness for disease (Alzheimer’s disease - AD and non-diseased - ND) and region (prefrontal cortex - PFC and medial temporal gyrus - MTG) for ORF2. Median ± quartiles. *p-value<0.05; **p-value<0.01; ***p-value<0.001; ****p-value<0.0001. Comparison between cell types, Wilcoxon test. Comparison between diseases Mann-Whitney test.FIG. 6G illustrate a violin plot of ORF2 / ORF1 median fluorescence intensity (MFI) ratio per individual MAP2- and MAP2+ cell with awareness for disease (AD+ND) and region (PFC+MTG). Median ± quartiles. *p-value<0.05; **p-value<0.01. Wilcoxon test. FIG. 6H illustrates metadata comparison between AD and ND PFC and MTG samples - age at death.FIG. 61 illustrates metadata comparison between AD and ND PFC and MTG samples - postmortem interval. FIG. 6J illustrates metadata comparison between AD and ND PFC and MTG samples - RNA integrity number. FIG. 6K illustrates an analysis workflow withAttorney Docket No. 42256-634.601Qupath for identifying cells and quantifying RNAscope signals. Further details in methods.FIG. 6L illustrate a relationship between estimated puncta per nuclei and MFI per nuclei. Correlation analysis. r2=0.9099. p-value <0.0001. These data support the RNA origins of RNAscope signals, spatial differences in signal, and signal quantification methods.

[0016] FIGs. 7A-7P illustrate Long-read LI transcriptomic analysis of Alzheimer’s and nondisease prefrontal cortex and medial temporal gyrus. FIG. 7A illustrates the percentage of LI reads that were in antisense vs. sense orientation. Median, IQR, min and max. ****p-value<0.0001, paired t-test. FIG. 7B illustrates the percentage of LI reads that contain a 5’UTR region or a YY1 binding site. Median, IQR, min and max. FIG. 7C illustrates the percentage of LI reads that contain unmasked, flanking regions that map back to the human genome, indicating “read-through”, intragenic LI reads. FIG. 7D illustrates the percentage of LI reads assigned a LI family annotation based on Censor. Mean + SD. Reads were frequently annotated with multiple subfamilies (average of 1.86 annotations / read) -percentages of read assignments total to >100%. FIG. 7E illustrates the percentage of LI reads assigned to the youngest subfamily of LI - LIPA. Mean + SD. FIG. 7F illustrates the percentage of LI reads >6kb that encode an intact, bicistronic ORF1+ORF2. Mean 1.31%, median 0.00%; this percentage represents <0.01% of all LI reads. FIG.7G illustrates the histogram of the 16 full-length, bicistronic ORF1+ORF2 variants identified, relative to the percentage of samples (n=31) expressing each variant. FIG. 7H illustrates the histogram of the 48 intact, monocistronic ORF2 variants identified, relative to the percentage of samples (n=31) expressing each variant. FIG. 71 illustrates the histogram of the 554 partial ORF2 variants (intact EN / RT domains) identified, relative to the percentage of samples (n=31) expressing each variant. FIG. 7 J illustrates LI enrichment in PacBio long -read RNASeq in Alzheimer’s disease (AD) and non-diseased (ND) prefrontal cortex (PFC) and medial temporal gyrus (MTG) samples (LI reads / total reads). No significant difference in LI enrichment between groups. One-way ANOVA. Dashed line - estimated unenriched Ll% (-2.5%). FIG. 7K illustrates histogram of the percentage of LI reads relative to length (bpbase pairs) for AD and ND PFC and MTG samples. Bin 500bp. Median ± IQR. FIG. 7L illustrates the percentage of LI reads classified as bicistronic, full-length ORF1 and ORF2 for AD and ND PFC and MTG samples. FIG. 7M illustrates the percentage of LI reads classified as monocistronic intact ORF1 for AD and ND PFC and MTG samples. FIG. 7N illustrates the percentage of LI reads classified as monocistronic intact ORF2 for AD and ND PFC and MTG samples. FIG. 70 illustrates the percentage of LI reads classified as partial ORF2 (intact EN + RT domain) for AD and ND PFC and MTG samples. FIG. 7P illustratesAttorney Docket No. 42256-634.601the percentage of LI reads classified as partial 0RF2 (intact EN domain) for AD and ND PFC and MTG samples. Median ± IQR. ns, One way ANOVA. These data reveal similarities in LI transcriptome between AD and ND in a limited cohort; variant sequences as a function of disease remain to be determined.

[0017] FIGs. 8A-8E illustrate endogenous RT activity relative to LI expression and variants.FIG. 8A illustrates scatterplot of RT activity (pU) in post-mortem human brain samples (n=31) relative to ORF1 H-score in MAP2- nuclei, ns, Simple linear regression. FIG. 8B illustrates scatterplot of RT activity (pU) in post-mortem human brain samples (n=31) relative to ORF2 H-score in MAP2- nuclei. p-value=0.0025, y=22.37+494.1, Simple linear regression. FIGs. 8C-8E illustrates scatterplot of RT activity (pU) in post-mortem human brain samples (n=31) relative to % of LI reads containing (FIG. 8C) bicistronic, full-length ORF1 and ORF2 transcripts, (FIG. 8D) monocistronic intact ORF2 transcripts, or (FIG. 8E) a partial ORF2 transcript (intact EN + RT domain).

[0018] FIG. 9 illustrates LI ORF2 variants for over-expression based function assays. SAVs (amino acid changes denoted in bold red) across the 12 functionally assayed ORF2 variants as compared to the ORF2 region in LI reporter (L1RP) and the LI consensus sequence.Endonuclease (EN), reverse transcriptase (RT), and c-terminus domains are highlighted. Percent identity, percent coverage, and number of mismatched amino acids (aa) as compared to the L1RP, as well as samples in which each variant was identified, are depicted at the bottom. Highlighted aa noted as important for poly(A) tract binding.DETAILED DESCRIPTION

[0019] Long Interspersed Nuclear Element-1 (LI) contains two open reading frames, ORF1 and ORF2. ORF1 encodes an RNA binding protein, while ORF2 encodes a reverse transcriptase and an endonuclease. These proteins function either in cis or trans, leading to different genomic mutations. Consequently, LI activity has been associated with the progression of multiple diseases. Accordingly, described herein, in some aspects, is a method of diagnosing a neurodegenerative disease in a subject in need thereof. In some embodiments, the method comprises detecting a change in an enzymatic activity of a Long Interspersed Nuclear Element- 1 (LI) variant in a sample obtained from a subject compared with a reference enzymatic activity of a control subject not having the neurodegenerative disease. In some embodiments, the change in the enzymatic activity indicates that the subject has or is at risk of developing the neurodegenerative disease. In some embodiments, the LI variant comprises a bicistronic open reading frame 1 (ORF1) and open reading frame 2 (ORF2)Attorney Docket No. 42256-634.601variant, a monocistronic ORF1 variant, or a monocistronic ORF2 variant. In some embodiments, the LI variant is a monocistronic ORF1 variant or a monocistronic ORF2 variant. In some embodiments, the LI variant comprises a monocistronic ORF2 variant. In some embodiments, the LI variant is a monocistronic ORF2 variant. In some embodiments, the monocistronic ORF2 variant comprises an intact ORF2 variant or a partial ORF2 variant. In some embodiments, the monocistronic ORF2 variant is an intact ORF2 variant. In some embodiments, the monocistronic ORF2 variant is a partial ORF2 variant. In some embodiments, the ORF2 variant comprises a reverse transcriptase (RT) domain, an endonuclease (EN) domain, or a combination thereof. In some embodiments, the ORF2 variant comprises an ORF2 variant. In some embodiments, the intact ORF2 variant comprises a reverse transcriptase (RT) domain, an endonuclease (EN) domain, or a combination thereof. In some embodiments, the ORF2 comprises a partial ORF2 variant. In some embodiments, the partial ORF2 variant comprises a RT, a EN domains, or a combination thereof.

[0020] In some embodiments, the enzymatic activity comprises a reverse transcriptase (RT) activity, an endonuclease (EN) activity, or both. In some embodiments, the enzymatic activity is a reverse transcriptase (RT) activity. In some embodiments, the enzymatic activity is an endonuclease (EN) activity. In some embodiments, the enzymatic activity is a reverse transcriptase (RT) activity and an endonuclease (EN) activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises an increase or a decrease in the enzymatic activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises an increase or a decrease in the RT activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises an increase or a decrease in the EN activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises an increase or a decrease in the RT and EN activity. In some embodiments, the change in enzymatic activity of the LI variant is at least or about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%. In some embodiments, the change in the enzymatic activity of the LI variant is at least or about 1.5X, 2X, 2.5X, 3X, 3.5X, 4.0X, 4.5X, 5X, 6X, 7X, 8X, 9X, 10X, or more than 10X more. In some embodiment, the change in the enzymatic activity is a decrease in the enzymatic activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises a decrease in the RT activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises a decrease in the EN activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises a decrease in the RT and EN activity. In some embodiments, the change in the enzymatic activity is the increase in theAttorney Docket No. 42256-634.601enzymatic activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises an increase in the RT activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises an increase in the EN activity. In some embodiments, the change in the enzymatic activity of the LI variant comprises an increase in the RT and EN activity. In some embodiments, the increase in the enzymatic activity of the LI variant is at least or about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%. In some embodiments, the increase in the enzymatic activity of the LI variant is at least or about 1.5X, 2X, 2.5X, 3X, 3.5X, 4. OX, 4.5X, 5X, 6X, 7X, 8X, 9X, 10X, or more than 10X more. In some embodiments, the increase in the enzymatic activity comprises an increase in the reverse transcriptase (RT) activity, an increase in the endonuclease (EN) activity, or an increase in both. In some embodiments, the increase in the enzymatic activity is an increase in the reverse transcriptase (RT) activity. In some embodiments, the increase in the enzymatic activity is an increase in the endonuclease (EN) activity. In some embodiments, the increase in the enzymatic activity is an increase in the reverse transcriptase (RT) activity and the endonuclease (EN) activity. In some embodiments, the increase in the RT activity of the LI variant is at least or about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%. In some embodiments, the increase in the RT activity of the LI variant is at least or about 1.5X, 2X, 2.5X, 3X, 3.5X, 4.0X, 4.5X, 5X, 6X, 7X, 8X, 9X, 10X, or more than 10X more. In some embodiments, the increase in the EN activity of the LI variant is at least or about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%. In some embodiments, the increase in the EN activity of the LI variant is at least or about 1.5X, 2X, 2.5X, 3X, 3.5X, 4.0X, 4.5X, 5X, 6X, 7X, 8X, 9X, 10X, or more than 10X more. In some embodiments, the increase in the RT and EN activity of the LI variant is at least or about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%. In some embodiments, the increase in the RT and EN activity of the LI variant is at least or about 1.5X, 2X, 2.5X, 3X, 3.5X, 4. OX, 4.5X, 5X, 6X, 7X, 8X, 9X, 10X, or more than 10X more. In some embodiments, the change in the enzymatic activity is associated with one LI variant. In some embodiments, the increase in the enzymatic activity is associated with one LI variant. In some embodiments, the increase in the RT activity is associated with one LI variant. In some embodiments, the increase in the EN activity is associated with one LI variant. In some embodiments, the increase in the RT and EN activity is associated with one LI variant. InAttorney Docket No. 42256-634.601some embodiments, the change in the enzymatic activity is associated with two, three, four, five, or more LI variants.

[0021] In some embodiments, the change in the enzymatic activity is associated with two or more LI variants. In some embodiments, the increase in the enzymatic activity is associated with two, three, four, five, or more LI variants. In some embodiments, the increase in the enzymatic activity is associated with two or more LI variants. In some embodiments, the increase in the RT activity is associated with two, three, four, five, or more LI variants. In some embodiments, the increase in the RT activity is associated with two or more LI variants. In some embodiments, the increase in the EN activity is associated with two, three, four, five, or more LI variants. In some embodiments, the increase in the EN activity is associated with two or more LI variants. In some embodiments, the increase in the RT and EN activity is associated with two, three, four, five, or more LI variants. In some embodiments, the increase in the RT and EN activity is associated with two or more LI variants. In some embodiments, the LI variant comprises a synonymous mutation compared with a nucleotide sequence sharing at least 85%, at least 90%, at least 95%, or at least 99% identity as SEQ ID NO: 1. In some embodiments, the LI variant comprises a synonymous mutation compared with at least one nucleotide sequence sharing at least 85%, at least 90%, at least 95%, or at least 99% identity as SEQ ID NO: 1. In some embodiments, the LI variant comprises a synonymous mutation compared with a nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LI variant comprises a synonymous mutation compared with at least one nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LI variant comprises a non-synonymous mutation compared with a nucleotide sequence sharing at least 85%, at least 90%, at least 95%, or at least 99% identity as SEQ ID NO: 1. In some embodiments, the LI variant comprises a non-synonymous mutation compared with at least one nucleotide sequence sharing at least 85%, at least 90%, at least 95%, or at least 99% identity as SEQ ID NO: 1. In some embodiments, the LI variant comprises a non-synonymous mutation compared with a nucleotide sequence of SEQ ID NO: 1. In some embodiments, the LI variant comprises a non-synonymous mutation compared with at least one nucleotide sequence of SEQ ID NO: 1.

[0022] In some embodiments, the LI variant comprises a genomic sequence. In some embodiments, the genomic sequence comprises a transposable element. In some embodiments, the LI variant comprises a genomic cDNA (gencDNA). In some embodiments, the LI variant is a genomic cDNA (gencDNA). In some embodiments, the LI variant comprises an RNA. In some embodiments, the LI variant comprises a pre-mRNA. In someAttorney Docket No. 42256-634.601embodiments, the LI variant comprises a mRNA. In some embodiments, the LI variant is a mRNA. In some embodiments, the RNA is reverse transcribed to cDNA, and a LI variant is identified. In some embodiments, the LI variant comprises a cDNA. In some embodiments, the LI variant comprises a polypeptide. In some embodiments, the LI variant comprises a protein. In some embodiments, the LI variant is a protein. In some embodiments, the LI variant is an enzyme. In some embodiments, the LI variant is identified by in situ hybridization or immunological hybridization. In some embodiments, the in situ hybridization is chromogenic in situ hybridization or fluorescence in situ hybridization. In some embodiments, the LI variant is detected from RNA in situ from a brain tissue of a subject. In some embodiments, the LI variant is detected from RNA extracted from a sample. Exemplary methods for identifying LI variant include, but not limited to, In situ hybridization, Southern blotting, and Northern blotting. In some embodiments, the LI variant is identified by a probe binding to the LI variant. In some embodiments, the probes are used for in situ hybridization. In some embodiments, the LI variant is identified using probes that hybridize to LI variant. In some embodiments, the probes hybridize to the genomic DNA. In some embodiments, the probes hybridize to the cDNA. In some embodiments, the probes hybridize to the RNA. In some embodiments, the probes hybridize to a range of about 35 to about 50 nucleotides in the RNA or DNA. In some embodiments, measuring binding of the probes to the LI variant further comprises a pull-down assay. In some embodiments, the probe comprises a polynucleotide probe or a polypeptide probe. In some embodiments, the probe comprises a single-strand sequence of DNA. In some embodiments, the probe comprises a single-strand sequence of RNA. In some embodiments, the probe comprises an antibody or an antigen binding fragment thereof. In some embodiments, a probe is labeled with a radioactive label, a fluorochrome label, an enzyme, a chemiluminescent tag, a colorimetric tag, an affinity tag or other labels or tags. In some embodiments, the probe is labeled using a fluorochrome or a radioactive isotope. Exemplary fluorochromes include, but are not limited to, Alexa-Fluor dyes (e.g., Alexa Fluor® 350, Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 500, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor® 700, and Alexa Fluor® 750), APC, Cascade Blue, Cascade Yellow and R-phycoerythrin (PE), DyLight 405, DyLight 488, DyLight 550, DyLight 650, DyLight 680, DyLight 755, DyLight 800, FITC, Pacific Blue, PerCP, Rhodamine, and Texas Red, Cy5, Cy5.5, Cy7. Exemplary radioactive isotopes include, but are not limited to, Carbon-14Attorney Docket No. 42256-634.601(14C), Tritium (3H), Sulfur-35 (35S), Phosphorus-32 (32P), Iodine-131 (1311), 75Se, Bromo [18F]fluoride. In some embodiments, the probe is labeled using an affinity tag. Exemplary affinity tags include, but are not limited to, biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof. In some embodiments, the affinity tag is recognized by avidin, streptavidin, nickel, or glutathione. In some embodiments, the affinity tag comprises biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof.

[0023] In some embodiments, the neurodegenerative disease comprises Alzheimer's disease (AD), Parkinson's disease, Huntington disease, Amyotrophic lateral sclerosis, Dementia with Lewy bodies, Friedreich ataxia, Motor neuron disease, Multiple sclerosis, Multiple system atrophy, Corticobasal degeneration, Transmissible spongiform encephalopathy, Progressive supranuclear palsy, Creutzfeldt-Jakob disease, Dementia, Pick's disease, Spinal muscular atrophy, Chronic traumatic encephalopathy, Frontotemporal dementia. In some embodiments, the neurodegenerative disease is Alzheimer’s disease. In some embodiments, the Alzheimer’s disease comprises familial Alzheimer’s disease or sporadic Alzheimer’s disease. In some embodiments, the Alzheimer’s disease comprises typical AD, limbic-predominant AD, hippocampal-sparing AD, and minimal atrophy AD. In some embodiments, the subject comprises a human. In some embodiments, the subject is a human. The sample may be derived from any cell, tissue, or biological fluid from the subject. The sample may comprise any clinically relevant tissue, such as, but not limited to, neuron, cerebrospinal fluid, fine needle aspirate, or a sample of body fluid, such as blood, plasma, serum, lymph, ascetic fluid, cystic fluid or urine. In some embodiments, the sample comprises a bodily fluid or a cell. In some embodiments, the sample is a bodily fluid. In some embodiments, the sample is a cell. In some embodiments, the sample comprises exosomes. Exosomes are cell-derived vesicles that are released from many cell types including, but not limited to, dendritic cells (DCs), lymphocytes, platelets, mast cells, epithelial cells, endothelial cells, and neurons. In some embodiments, the exosomes are found in blood. In some embodiments, the exosomes are found in cerebrospinal fluid. In some embodiments, the sample comprises exosomes from the blood. In some embodiments, the sample comprises exosomes from cerebrospinal fluid. In some embodiments, nucleic acid is extracted from the sample. In some embodiments, the nucleic acid is DNA. In some embodiments, polypeptide is isolated from the sample. In some embodiments, the bodily fluid comprises blood plasma, serum, cerebrospinal fluid, urine, saliva, semen, tears, sweat, fecal matter, breast milk, synovial fluid, pleural fluid, pericardial fluid, peritoneal fluid, or amniotic fluid. In some embodiments, the sample is a blood sample.Attorney Docket No. 42256-634.601In some embodiments, the cell comprises a neuronal cell, or a Glial cell. In some embodiments, the cell is a neuronal cell.

[0024] Described herein, in some aspects, is a method of treating a neurodegenerative disease in a subject in need thereof. In some embodiments, the method comprises administering to a subject a therapeutic agent. In some embodiments, the subject has a change in an enzymatic activity associated with a LI variant relative to the enzymatic level of LI variant in a control subject not having the neurodegenerative disease. In some embodiments, the therapeutic agent decreases the change in the enzymatic activity of the LI variant in the subject. In some embodiments, the therapeutic comprises a nucleoside reverse transcriptase inhibitor (NRTI), a non-nucleoside reverse transcriptase inhibitor (NNRTI), or a combination thereof. In some embodiments, the therapeutic agent is the nucleoside reverse transcriptase inhibitor (NRTI). In some embodiments, the nucleoside reverse transcriptase inhibitor (NRTI) comprises Abacavir, Emtricitabine, Lamivudine, Tenofovir alafenamide, Tenofovir disoproxil fumarate, or Zidovudine. In some embodiments, the therapeutic is the non-nucleoside reverse transcriptase inhibitor (NNRTI). In some embodiments, the non-nucleoside reverse transcriptase inhibitor (NNRTI) comprises Nevirapine, Efavirenz, Etravirine, Doravirine, Delavirdine, or Rilpivirine. In some embodiments, the therapeutic agent comprises an antisense oligonucleotide (AON), RNA interfering agent (RNAi), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a peptide, a peptidomimetic, a small molecule, or an aptamer. In some embodiments, the therapeutic agent is an antisense oligonucleotide (AON). In some embodiments, the AON comprises antisense oligonucleotide strands. In some embodiments, the AON comprises sense oligonucleotide strands. In some embodiments, the AON comprises antisense oligonucleotide strands and sense oligonucleotide strands. In some embodiments, the AON targets RNA of the one or more LI variants. In some embodiments, the RNA is pre-mRNA. In some embodiments, the RNA is mRNA. In some embodiments, the AON targets DNA of the one or more LI variants. In some embodiments, the DNA is genomic DNA. In some embodiments, the AON targets the LI variant comprising a LI ORF1, a LI ORF2, or both. In some embodiments, the AON targets the ORF1 variant. In some embodiments, the AON targets the ORF2 variant. In some embodiments, the AON targets the RT domain in the ORF2 variant. In some embodiments, the AON targets the EN domain in the ORF2 variant. In some embodiments, the AON targets the non-RT domain in the ORF2 variant. In some embodiments, the AON targets the non-EN domain in the ORF2 variant. In some embodiments, the therapeutic agent comprises a small molecule. In some embodiments, the therapeutic agent is a small molecule. In someAttorney Docket No. 42256-634.601embodiments, the small molecule is an antagonist of the LI variant wherein the LI variant is a genomic DNA. In some embodiments, the small molecule is an antagonist of the LI variant wherein the LI variant is an RNA. In some embodiments, the small molecule is an antagonist of the LI variant wherein the LI variant is a protein. In some embodiments, the therapeutic agent comprises an antibody or an antigen binding fragment thereof. Exemplary antibodies include, but are not limited to, a monoclonal antibody, a polyclonal antibody, a bi-specific antibody, a multispecific antibody, a grafted antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a single-chain Fvs (scFv), a single chain antibody, a Fab fragment, a F(ab') fragment, disulfide-linked Fvs (sdFv), an intrabody, an anti -idiotypic (anti-Id) antibody, or ab antigen-binding fragments thereof. In some embodiments, the antibody or the antigen binding fragment thereof binds to a polypeptide encoded by the LI variant. In some embodiments, the antibody binds to a polypeptide encoded by LI ORF1 variant. In some embodiments, the antibody binds to a polypeptide encoded by LI ORF2 variant. In some embodiments, the antibody binds to a polypeptide encoded by LI ORF2 RT domain. In some embodiments, the antibody binds to a polypeptide encoded by LI ORF2 EN domain. In some embodiments, the antibody binds to the enzyme of reverse transcriptase. In some embodiments, the antibody binds to the enzyme of endonuclease. In some embodiments, the antibody is a blocking antibody. In some embodiments, the antibody is an intracellular antibody or the binding fragments selectively binding to a peptide encoded by a LI 0RF1 or LI ORF2 variant. In some embodiments, the antibody does not bind to wide-type protein. Examples of delivery an intracellular antibody targeting peptide encoded by LI 0RF1 or LI 0RF2, include, but are not limited to, gene therapy, direct administration, cell penetrating peptides, physical delivery, chemical delivery, viral and virus like nanocarriers.

[0025] Described herein, in some aspects, is a kit. In some embodiments, the kit comprises a probe for detecting at least one LI variant. In some embodiments, the kit comprises detecting reagent for detecting binding of the probe with the at least one LI variant. In some embodiments, kits are provided for detecting a portion or all of an exon, or a combination thereof. In some embodiments, kits are provided for detecting intraexonic junction between exons. In some embodiments, the at least one LI variant comprises a bicistronic LI ORF1 and ORF2 variant, a monocistronic LI ORF1 variant, a monocistronic intact LI ORF2 variant, or a monocistronic partial LI ORF2 variant. In some embodiments, two, three, four, five, or more LI variants are associated with a change in an enzymatic activity. In some embodiments, two, or more LI variants are associated with a change in an enzymatic activity.Attorney Docket No. 42256-634.601In some embodiments, at least one LI variant is associated with a change in an enzymatic activity. In some embodiments, one LI variant is associated with a change in an enzymatic activity. In some embodiments, at least one LI variant is associated with a change in an enzymatic activity comprising reverse transcriptase (RT) activity, endonuclease (EN) activity, or a combination thereof. In some embodiments, two, three, four, five, or more LI variants are associated with a change in the RT activity. In some embodiments, two, or more LI variants are associated with a change in the RT activity. In some embodiments, at least one LI variant is associated with a change in the RT activity. In some embodiments, one LI variant is associated with a change in the RT activity. In some embodiments, two, three, four, five, or more LI variants are associated with a change in the EN activity. In some embodiments, two, or more LI variants are associated with a change in the EN activity. In some embodiments, at least one LI variant is associated with a change in the EN activity. In some embodiments, one LI variant is associated with a change in the EN activity. In some embodiments, two, three, four, five, or more LI variants are associated with a change in the RT and EN activity. In some embodiments, two, or more LI variants are associated with a change in the RT and EN activity. In some embodiments, at least one LI variant is associated with a change in the RT and EN activity. In some embodiments, one LI variant is associated with a change in the RT and EN activity. In some embodiments, at least one LI variant comprises an RNA. In some embodiments, the LI variant comprises a pre-mRNA. In some embodiments, the LI variant comprises a mRNA. In some embodiments, the LI variant is a mRNA. In some embodiments, the RNA is reverse transcribed to cDNA, and a LI variant is identified. In some embodiments, the LI variant comprises a cDNA. In some embodiments, at least one LI variant comprises a genomic sequence. In some embodiments, the genomic sequence comprises a transposable element. In some embodiments, the LI variant comprises a genomic cDNA (gencDNA). In some embodiments, the LI variant is a genomic cDNA (gencDNA). In some embodiments, at least one LI variant comprises a polypeptide. In some embodiments, the LI variant comprises a protein. In some embodiments, the LI variant is a protein. In some embodiments, the LI variant is an enzyme. In some embodiments, the LI variant is identified by a probe binding to the LI variant. In some embodiments, the probe comprises a polynucleotide probe or a polypeptide probe. In some embodiments, kits comprise probes for hybridization or amplification of a target nucleic acid. In some embodiments, the probe comprises a single-strand sequence of DNA. In some embodiments, the probe comprises a single-strand sequence of RNA. In some embodiments, the probe comprises an antibody or an antigen binding fragment thereof. In some embodiments, a probeAttorney Docket No. 42256-634.601is labeled with a radioactive label, a fluorochrome label, an enzyme, a chemiluminescent tag, a colorimetric tag, an affinity tag or other labels or tags. In some embodiments, the probe is labeled using a fluorochrome or a radioactive isotope. In some embodiments, the probe is labeled using an affinity tag. In some embodiments, the affinity tag is recognized by avidin, streptavidin, nickel, or glutathione. In some embodiments, the affinity tag comprises biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof. In some embodiments, the detecting reagent binds to the probe. In some embodiments, the detecting reagent comprises a fluorescent or a radioactive label.Long Interspersed Nuclear Element-1 (LI)

[0026] Myriad DNA sequence changes have been documented in single neurons to produce somatic genomic mosaicism (SGM). SGM more commonly affects non-coding sequences that represent over 98% of the human genome, but an exception that alters coding sequences has been reported. RT-mediated somatic gene recombination (SGR) involves the generation of myriad intronless and non-annotated coding “genomic cDNAs” (gencDNAs) within genomic DNA of the normal and ageing human brain, which is further associated with Alzheimer’s disease (AD). GencDNAs are proposed to require RT for SGR to take place, wherein RT acts on mRNAs to produce SNVs and predicted amino acid and structural changes followed by retroinsertion back into neural genomes. GencDNAs have parallels with germline processed pseudogenes that are non-functional “genetic fossils" with intronless cDNA structures lacking coding potential. By comparison, gencDNAs are somatic, have coding potential, and can occur in many different forms for a single gene within one individual. Little is known about either endogenous brain RT activity or actual gene, transcript, and cellular sources of RTs within the ageing human brain.

[0027] LI (Long Interspersed Element-1; LINE-1) is one of the most abundant and actively transcribed classes of transposable elements in the human germline genome, with -500,000 copies composing -17% of the human genome. LI has colonized the genome over time via a copy-and-paste mechanism, enabling evolutionary age and subfamily assignment of LI species. Most germline Lis contain inactivating deletions and mutations, however the evolutionarily youngest LI subfamily, L1HS, has retained functionality through an estimated 80-100 Lis believed to be retrotransposition-competent. Furthermore, Lis are polymorphic, with genomic copies varying amongst individuals and populations, thus adding further nuance to the functional implications of Lis in both development and disease.Attorney Docket No. 42256-634.601

[0028] LI repeats, integrating into different chromosomal loci, affect the activity of genes and cause different genomic mutations. Somatic variability of the human genome is linked to the activity of some subfamilies of LI, in particular, a high level of LI retrotranspositions has been observed in brain tissues. However, the contribution of LI to genomic variability during normal aging and in age-related neurodegenerative diseases is poorly understood.

[0029] LI retrotransposons are bicistronic, containing both ORFs (open reading frames) on a single mRNA that encodes proteins ORF Ip and ORF2p. ORF Ip is a trimer-forming RNA binding protein that binds to LI mRNA. ORF2p contains several functional domains including RT and EN domains. These proteins function in cis to enable LI retrotransposition. ORFlp trimers bind to LI mRNA, forming a ribonucleoprotein (RNP) complex, after which LI mRNA is reverse transcribed to produce a single stranded LI cDNA (via the ORF2p RT domain) followed by insertion into the genome (via the ORF2p EN domain), resulting in insertional mutagenesis and genomic mosaicism. In trans, ORF2p can also reverse transcribe non-self RNA, leading to the production of germline processed pseudogenes, ALUs / SINEs (repetitive elements), and single-stranded DNA (ssDNA), without requiring a functional ORFlp. The structure of ORF2p demonstrated distinct RT and EN components of the translated protein, including the generation of double strand DNA breaks (DSBs) in the absence of a functional RT domain, and cytosolic RNA: DNA hybrids in the absence of a functional EN domain.

[0030] Described herein is a method for detecting LI variants. In some embodiments, the detection of the LI variants in a subject, where the subject either has or is at risk of developing a neurodegenerative disease described herein. In some embodiments, the variants are genomic cDNAs (gencDNAs). In some embodiments, the variants are RNAs comprising mRNAs. In some embodiments, the variants are proteins.

[0031] In some embodiments, the LI variant comprises an RNA LI variant. In some embodiments, the RNA LI is reverse transcribed and introduced into the genomic DNA. In some embodiments, the LI variant is a DNA LI variant. In some embodiments, the DNA LI variant is gencDNA. In some embodiments, reverse transcription of RNA is introduced by an enzyme comprising reverse transcriptase encoded by LI ORF2p RT domain. In some embodiments, incorporation of cDNA into the genomic DNA involves a break in the DNA. In some embodiments, the break is a single-stranded break. In some embodiments, the break is a double-stranded break. In some embodiments, the break is introduced by an enzyme comprising endonuclease encoded by LI ORF2p EN domain.Attorney Docket No. 42256-634.601

[0032] In some embodiments, the LI variant is 5’ truncated. In some embodiments, the LI variant is of sense orientation. In some embodiments, the LI variant is of antisense orientation. In some embodiments, the LI variant comprises 5’ UTR comprising an RNA polymerase II promoter, and a regulatory site for LI repression, wherein the regulatory site is a YY1 binding site. In some embodiments, the LI variant is intragenic. In some embodiments, the LI variant is intergenic. In some embodiments, the LI variant is coding. In some embodiments, the LI variant is non-coding.

[0033] Further described herein, in some embodiments, is a method for detecting open reading frames (ORFs) of the LI variant. In some embodiments, the LI variant comprises a bicistronic ORF1 and ORF2. In some embodiments, the LI variant comprises a monocistronic ORF1. In some embodiments, the LI variant comprises an intact monocistronic ORF2. In some embodiments, the LI variant comprises a partial ORF2.

[0034] Further described herein, in some embodiments, is a method for detecting domains of the LI ORF. In some embodiment, the bicistronic ORF1 and ORF2 of LI variant comprises an intact RT domain, an intact EN domain, or both. In some embodiments, the intact monocistronic LI ORF2 variant comprises an intact RT domain, an intact EN domain, or both. In some embodiments, the partial monocistronic LI ORF2 variant comprise an intact RT domain, an intact EN domain, or both. In some embodiments, the intact ORF2 variant comprises an EN domain, an RT domain, and c-terminus. In some embodiments, the partial ORF2 variant comprises an EN domain, an RT domain, and a truncated / absent c-terminus.

[0035] The LI consensus sequences are set forth in SEQ ID NOs: 1-3 (Table 1) Further described herein, in some embodiments, are single nucleotide variations (SNVs) capable of producing single amino acid variations (SAVs). In some embodiments, the LI ORF2 variant comprises SNVs encoding SAVs (FIG. 5). In some embodiments, the RT or EN domains of LI variant comprises SNVs encoding SAVs. In some embodiments, the LI ORF2 variant comprises a synonymous mutation. In some embodiments, the LI ORF2 variant comprises a non-synonymous mutation. The amino acid sequence of ORF2 region in the LI consensus is set forth in SEQ ID NO: 4 (Table 4).Table 1. Nucleotide sequence of LI consensusSEQ Name SequenceID NO:1 Hot GGGGGAGGAGCCAAGATGGCCGAATAGGAACAGCTCCG element GTCTACAGCTCCCAGCGTGAGCGACGCAGAAGACGGTGA consensus TTTCTGCATTTCCATCTGAGGTACCGGGTTCATCTCACTAGGGAGTGCCAGACAGTGGGCGCAGGCCAGTGTGTGTGCGCACCGTGCGCGAGCCGAAGCAGGGCGAGGCATTGCCTCAAtorney Docket No. 42256-634.601CCTGGGAAGCGCAAGGGGTCAGGGAGTTCCCTTTCCGAG TCAAAGAAAGGGGTGACGGACGCACCTGGAAAATCGGGT CACTCCCACCCGAATATTGCGCTTTTCAGACCGGCTTAAG AAACGGCGCACCACGAGACTATATCCCACACCTGGCTCG GAGGGTCCTACGCCCACGGAATCTCGCTGATTGCTAGCA CAGCAGTCTGAGATCAAACTGCAAGGCGGCAACGAGGCT GGGGGAGGGGCGCCCGCCATTGCCCAGGCTTGCTTAGGT AAACAAAGCAGCCGGGAAGCTCGAACTGGGTGGAGCCC ACCACAGCTCAAGGAGGCCTGCCTGCCTCTGTAGGCTCC ACCTCTGGGGGCAGGGCACAGACAAACAAAAAGACAGC AGTAACCTCTGCAGACTTAAGTGTCCCTGTCTGACAGCTT TGAAGAGAGCAGTGGTTCTCCCAGCACGCAGCTGGAGAT CTGAGAACGGGCAGACTGCCTCCTCAAGTGGGTCCCTGA CTCCTGACCCCCGAGCAGCCTAACTGGGAGGCACCCCCC AGCAGGGGCACACTGACACCTCACACGGCAGGGTATTCC AACAGACCTGCAGCTGAGGGTCCTGTCTGTTAGAAGGAA AACTAACAACCAGAAAGGACATCTACACCGAAAACCCAT CTGTACATCACCATCATCAAAGACCAAAAGTAGATAAAA CCACAAAGATGGGGAAAAAACAGAACAGAAAAACTGGA AACTCTAAAACGCAGAGCGCCTCTCCTCCTCCAAAGGAA CGCAGTTCCTCACCAGCAACAGAACAAAGCTGGATGGAG AATGATTTTGATGAGCTGAGAGAAGAAGGCTTCAGACGA TCAAATTACTCTGAGCTACGGGAGGACATTCAAACCAAA GGCAAAGAAGTTGAAAACTTTGAAAAAAATTTAGAAGAA TGTATAACT AGAATAACCAATACAGAGAAGTGCTTAAAGGAGCTGATG GAGCTGAAAACCAAGGCTCGAGAACTACGTGAAGAATGC AGAAGCCTCAGGAGCCGATGCGATCAACTGGAAGAAAG GGTATCAGCAATGGAAGATGAAATGAATGAAATGAAGCG AGAAGGGAAGTTTAGAGAAAAAAGAATAAAAAGAAATG AGCAAAGCCTCCAAGAAATATGGGACTATGTGAAAAGAC CAAATCTACGTCTGATTGGTGTACCTGAAAGTGATGTGGA GAATGGAACCAAGTTGGAAAACACTCTGCAGGATATTAT CCAGGAGAACTTCCCCAATCTAGCAAGGCAGGCCAACGT TCAGATTCAG GAAATACAGAGAACGCCACAAAGATACTCCTCGAGAAGA GCAACTCCAAGACACATAATTGTCAGATTCACCAAAGTT GAAATGAAGGAAAAAATGTTAAGGGCAGCCAGAGAGAA AGGTCGGGTTACCCTCAAAGGAAAGCCCATCAGACTAAC AGCGGATCTCTCGGCAGAAACCCTACAAGCCAGAAGAGA GTGGGGGCCAATATTCAACATTCTTAAAGAAAAGAATTT TCAACCCAGAATTTCATATCCAGCCAAACTAAGCTTCATA AGTGAAGGAGAAATAAAATACTTTATAGACAAGCAAATG TTGAGAGATTTTGTCACCACCAGGCCTGCCCTAAAAGAG CTCCTGAAGGA AGCGCTAAACATGGAAAGGAACAACCGGTACCAGCCGCT GCAAAATCATGCCAAAATGTAAAGACCATCGAGACTAGG AAGAAACTGCATCAACTAATGAGCAAAATCACCAGCTAA CATCATAATGACAGGATCAAATTCACACATAACAATATTAACTTTAAATATAAATGGACTAAATTCTGCAATTAAAAGAtorney Docket No. 42256-634.601ACACAGACTGGCAAGTTGGATAAAGAGTCAAGACCCATC AGTGTGCTGTATTCAGGAAACCCATCTCACGTGCAGAGA CACACATAGGCTCAAAATAAAAGGATGGAGGAAGATCTA CCAAGCCAATGGAAAACAAAAAAAGGCAGGGGTTGCAA TCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAGA TCAAAAGAGACAAAGAAGGCCATTACATAATGGTAAAGG GATCAATTCAACAAGAGGAGCTAACTATCCTAAATATTT ATGCACCCAATACAGGAGCACCCAGATTCATAAAGCAAG TCCTCAGTGACCTACAAAGAGACTTAGACTCCCACACATT AATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGG AATTGAACTCAGCTCTGCACCAAGCAGACCTAATAGACA TCTACAGAACTCTCCACCCCAAATCAACAGAATATACATT TTTTTCAGCACCACACCACACCTATTCCAAAATTGACCAC ATAGTTGGAAGTAAAGCTCTCCTCAGCAAATGTA AAAGAACAGAAATTATAACAAACTATCTCTCAGACCACA GTGCAATCAAACTAGAACTCAGGATTAAGAATCTCACTC AAAGCCGCTCAACTACATGGAAACTGAACAACCTGCTCC TGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAA TAAAGATGTTCTTTGAAACCAACGAGAACAAAGACACCA CATACCAGAATCTCTGGGACGCATTCAAAGCAGTGTGTA GAGGGAAATTTATAGCACTAAATGCCTACAAGAGAAAGC AGGAAAGATCCAAAATTGACACCCTAACATCACAATTAA AAGAACTAGAAAAGCAAGAGCAAACACATTCAAAAGCT AGCAGAAGGCAAGAAATAACTAAAATCAGAGCAGAACT GAAGGAAATAGAGACACAAAAAACCCTTCAAAAAATCA ATGAATCCAGGAGCTGGTTTTTTGAAAGGATCAACAAAA TTGATAGACCGCTAGCAAGACTAATAAAGAAAAAAAGAG AGAAGAATCAAATAGACACAATAAAAAATGATAAAGGG GATATCACCACCGATCCCACAGAAATACAAACTACCATC AGAGAATACTACAAACACCTCTACGCAAATAAACTAGAA AATCTAGAAGAAATGGATACATTCCTCGACACATACACT CTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAAT CGACCAATAACAGGCTCTGAAATTGTGGCAATAATCAAT AGTTTACCAACCAAAAAGAGTCCAGGACCAGATGGATTC ACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTA CCATTCCTTCTGAAACTATTCCAATCAATAGAAAAAGAG GGAATCCTCCCTAACTCATTTTATGAGGCCAGCATCATTC TGATACCAAAGCCGGGCAGAGACACAACCAAAAAAGAG AATTTTAGACCAATATCCTTGATGAACATTGATGCAAAAA TCCTCAATAAAATACTGGCAAACCGAATCCAGCAGCACA TCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCC TGGGATGCAAGGCTGGTTCAATATACGCAAATCAATAAA TGTAATCCAGCATATAAACAGAGCCAAAGACAAAAACCA CATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAA AATTCAACAACCCTTCATGCTAAAAACTCTCAATAAATTA GGTATTGATGGGACGTATTTCAAAATAATAAGAGCTATCT ATGACAAACCCACAGCCAATATCATACTGAATGGGCAAA AACTGGAAGCATTCCCTTTGAAAACCGGCACAAGACAGGGATGCCCTCTCTCACCGCTCCTATTCAACATAGTGTTGGAAtorney Docket No. 42256-634.601AGTTCTGGCCAGGGCAATCAGGCAGGAGAAGGAAATAA AGGGTATTCAATTAGGAAAAGAGGAAGTCAAATTGTCCC TGTTTGCAGACGACATGATTGTTTATCTAGAAAACCCCAT CGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTC AGCAAAGTCTCAGGATACAAAATCAATGTACA AAAATCACAAGCATTCTTATACACCAACAACAGACAAAC AGAGAGCCAAATCATGGGTGAACTCCCATTCACAATTGC TTCAAAGAGAATAAAATACCTAGGAATCCAACTTACAAG GGATGTGAAGGACCTCTTCAAGGAGAACTACAAACCACT GCTCAAGGAAATAAAAGAGGAGACAAACAAATGGAAGA ACATTCCATGCTCATGGGTAGGAAGAATCAATATCGTGA AAATGGCCATACTGCCCAAGGTAATTTACAGATTCAATG CCATCCCCATCAAGCTACCAATGACTTTCTTCACAGAATT GGAAAAAACTACTTTAAAGTTCATATGGAACCAAAAAAG AGCCCGCATTGCCAAGTCAATCCTAAGCCAAAAGAACAA AGCTGGAGGCATCACACTACCTGACTTCAAACTATACTAC AAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAA AACAGAGATATAGATCAATGGAACAGAACAGAGCCCTCA GAAATAATGCCGCATATCTACAACTATCTGATCTTTGACA AACCTGAGAAAAACAAGCAATGGGGAAAGGATTCCCTAT TTAATAAATGGTGCTGGGAAAACTGGCTAGCCATATGTA GAAAGCTGAAACTGGATCCCTTCCTTACACCTTATACAAA AATCAATTCAAGATGGATTAAAGATTTAAACGTTAAACC TAAAACCATAAAAACCCTAGAAGAAAACCTAGGCATTAC CATTCAGGACATAGGCGTGGGCAAGGACTTCATGTCCAA AACACCAAAAGCAATGGCAACAAAAGACAAAATTGACA AATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAA AAGAAACTACCATCAGAGTGAACAGGCAACCTACAACAT GGGAGAAAATTTTTGCAACCTACTCATCTGACAAAGGGC TAATATCCAGAATCTACAATGAACTCAAACAAATTTACA AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCGAAG GACATGAACAGACACTTCTCAAAAGAAGACATTTATGCA GCCAAAAAACACATGAAGAAATGCTCATCATCACTGGCC ATCAGAGAAATGCAAATCAAAACCACTATGAGATATCAT CTCACACCA GTTAGAATGGCAATCATTAAAAAGTCAGGAAACAACAGG TGCTGGAGAGGATGCGGAGAAATAGGAACACTTTTACAC TGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGT CAGTGTGGCGATTCCTCAGGGATCTAGAACTAGAAATAC CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAA TGAGTATAAATCATGCTGCTATAAAGACACATGCACACG TATGTTTATTGCGGCACTATTCACAATAGCAAAGACTTGG AACCAACCCAAATGTCCAACAATGATAGACTGGATTAAG AAAATGTGGCACATATACACCATGGAATACTATGCAGCC ATAAAAAATGA TGAGTTCATATCCTTTGTAGGGACATGGATGAAATTGGAA ACCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACC AAACACCGCATATTCTCACTCATAGGTGGGAATTGAACA ATGAGATCACATGGACACAGGAAGGGGAATATCACACTCTGGGGACTGTGGTGGGGTCGGGGGAGGGGGGAGGGATAAtorney Docket No. 42256-634.601GCATTGGGAGATATACCTAATGCTAGATGACACATTAGT GGGTGCAGCGCACCAGCATGGCACATGTATACATATGTA ACTAACCTGCACAATGTGCACATGTACCCTAAAACTTAG AGTATAATAAA2 Ta- Id GGGGGAGGAGCCAAGATGGCCGAATAGGAACAGCTCCG consensus GTCTACAGCTCCCAGCGTGAGCGACGCAGAAGACGGTGA TTTCTGCATTTCCATCTGAGGTACCGGGTTCATCTCACTA GGGAGTGCCAGACAGTGGGCGCAGGCCAGTGTGTGTGCG CACCGTGCGCGAGCCGAAGCAGGGCGAGGCATTGCCTCA CCTGGGAAGCGCAAGGGGTCAGGGAGTTCCCTTTCCGAG TCAAAGAAAGGGGTGACGGACGCACCTGGAAAATCGGGT CACTCCCACCCGAATATTGCGCTTTTCAGACCGGCTTAAG AAACGGCGCACCACGAGACTATATCCCACACCTGGCTCG GAGGGTCCTACGCCCACGGAATCTCGCTGATTGCTAGCA CAGCAGTCTGAGATCAAACTGCAAGGCGGCAACGAGGCT GGGGGAGGGGCGCCCGCCATTGCCCAGGCTTGCTTAGGT AAACAAAGCAGCCGGGAAGCTCGAACTGGGTGGAGCCC ACCACAGCTCAAGGAGGCCTGCCTGCCTCTGTAGGCTCC ACCTCTGGGGGCAGGGCACAGACAAACAAAAAGACAGC AGTAACCTCTGCAGACTTAAGTGTCCCTGTCTGACAGCTT TGAAGAGAGCAGTGGTTCTCCCAGCACGCAGCTGGAGAT CTGAGAACGGGCAGACTGCCTCCTCAAGTGGGTCCCTGA CTCCTGACCCCCGAGCAGCCTAACTGGGAGGCACCCCCC AGCAGGGGCACACTGACACCTCACACGGCAGGGTATTCC AACAGACCTGCAGCTGAGGGTCCTGTCTGTTAGAAGGAA AACTAACAACCAGAAAGGACATCTACACCGAAAACCCAT CTGTACATCACCATCATCAAAGACCAAAAGTAGATAAAA CCACAAAGATGGGGAAAAAACAGAACAGAAAAACTGGA AACTCTAAAACGCAGAGCGCCTCTCCTCCTCCAAAGGAA CGCAGTTCCTCACCAGCAACAGAACAAAGCTGGATGGAG AATGATTTTGACGAGCTGAGAGAAGAAGGCTTCAGACGA TCAAATTACTCTGAGCTACGGGAGGACATTCAAACCAAA GGCAAAGAAGTTGAAAACTTTGAAAAAAATTTAGAAGAA TGTATAACTAGAATAACCAATACAGAGAAGTGCTTAAAG GAGCTGATGGAGCTGAAAACCAAGGCTCGAGAACTACGT GAAGAATGCAGAAGCCTCAGGAGCCGATGCGATCAACTG GAAGAAAGGGTATCAGCAATGGAAGATGAAATGAATGA AATGAAGCGAGAAGGGAAGTTTAGAGAAAAAAGAATAA AAAGAAATGAGCAAAGCCTCCAAGAAATATGGGACTATG TGAAAAGACCAAATCTACGTCTGATTGGTGTACCTGAAA GTGATGTGGAGAATGGAACCAAGTTGGAAAACACTCTGC AGGATATTATCCAGGAGAACTTCCCCAATCTAGCAAGGC AGGCCAACGTTCAGATTCAGGAAATACAGAGAACGCCAC AAAGATACTCCTCGAGAAGAGCAACTCCAAGACACATAA TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGT TAAGGGCAGCCAGAGAGAAAGGTCGGGTTACCCTCAAAG GAAAGCCCATCAGACTAACAGCGGATCTCTCGGCAGAAA CCCTACAAGCCAGAAGAGAGTGGGGGCCAATATTCAACA TTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAAACTAAGCTTCATAAGTGAAGGAGAAATAAAATAAtorney Docket No. 42256-634.601CTTTATAGACAAGCAAATGTTGAGAGATTTTGTCACCACC AGGCCTGCCCTAAAAGAGCTCCTGAAGGAAGCGCTAAAC ATGGAAAGGAACAACCGGTACCAGCCGCTGCAAAATCAT GCCAAAATGTAAAGACCATCGAGACTAGGAAGAAACTGC ATCAACTAATGAGCAAAATCACCAGCTAACATCATAATG ACAGGATCAAATTCACACATAACAATATTAACTTTAAAT ATAAATGGACTAAATTCTGCAATTAAAAGACACAGACTG GCAAGTTGGATAAAGAGTCAAGACCCATCAGTGTGCTGT ATTCAGGAAACCCATCTCACGTGCAGAGACACACATAGG CTCAAAATAAAAGGATGGAGGAAGATCTACCAAGCCAAT GGAAAACAAAAAAAGGCAGGGGTTGCAATCCTAGTCTCT GATAAAACAGACTTTAAACCAACAAAGATCAAAAGAGAC AAAGAAGGCCATTACATAATGGTAAAGGGATCAATTCAA CAAGAGGAGCTAACTATCCTAAATATTTATGCACCCAAT ACAGGAGCACCCAGATTCATAAAGCAAGTCCTCAGTGAC CTACAAAGAGACTTAGACTCCCACACATTAATAATGGGA GACTTTAACACCCCACTGTCAACATTAGACAGATCAACG AGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCA GCTCTGCACCAAGCAGACCTAATAGACATCTACAGAACT CTCCACCCCAAATCAACAGAATATACATTTTTTTCAGCAC CACACCACACCTATTCCAAAATTGACCACATAGTTGGAA GTAAAGCTCTCCTCAGCAAATGTAAAAGAACAGAAATTA TAACAAACTATCTCTCAGACCACAGTGCAATCAAACTAG AACTCAGGATTAAGAATCTCACTCAAAGCCGCTCAACTA CATGGAAACTGAACAACCTGCTCCTGAATGACTACTGGG TACATAACGAAATGAAGGCAGAAATAAAGATGTTCTTTG AAACCAACGAGAACAAAGACACCACATACCAGAATCTCT GGGACGCATTCAAAGCAGTGTGTAGAGGGAAATTTATAG CACTAAATGCCTACAAGAGAAAGCAGGAAAGATCCAAA ATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAG CAAGAGCAAACACATTCAAAAGCTAGCAGAAGGCAAGA AATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGA CACAAAAAACCCTTCAAAAAATCAATGAATCCAGGAGCT GGTTTTTTGAAAGGATCAACAAAATTGATAGACCGCTAG CAAGACTAATAAAGAAAAAAAGAGAGAAGAATCAAATA GACACAATAAAAAATGATAAAGGGGATATCACCACCGAT CCCACAGAAATACAAACTACCATCAGAGAATACTACAAA CACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATG GATACATTCCTCGACACATACACTCTCCCAAGACTAAACC AGGAAGAAGTTGAATCTCTGAATCGACCAATAACAGGCT CTGAAATTGTGGCAATAATCAATAGTTTACCAACCAAAA AGAGTCCAGGACCAGATGGATTCACAGCCGAATTCTACC AGAGGTACAAGGAGGAACTGGTACCATTCCTTCTGAAAC TATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACT CATTTTATGAGGCCAGCATCATTCTGATACCAAAGCCGGG CAGAGACACAACCAAAAAAGAGAATTTTAGACCAATATC CTTGATGAACATTGATGCAAAAATCCTCAATAAAATACT GGCAAACCGAATCCAGCAGCACATCAAAAAGCTTATCCA CCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGGCTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATATAtorney Docket No. 42256-634.601AAACAGAGCCAAAGACAAAAACCACATGATTATCTCAAT AGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGAC GTATTTCAAAATAATAAGAGCTATCTATGACAAACCCAC AGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATT CCCTTTGAAAACCGGCACAAGACAGGGATGCCCTCTCTC ACCGCTCCTATTCAACATAGTGTTGGAAGTTCTGGCCAGG GCAATCAGGCAGGAGAAGGAAATAAAGGGTATTCAATTA GGAAAAGAGGAAGTCAAATTGTCCCTGTTTGCAGACGAC ATGATTGTTTATCTAGAAAACCCCATCGTCTCAGCCCAAA ATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGG ATACAAAATCAATGTACAAAAATCACAAGCATTCTTATA CACCAACAACAGACAAACAGAGAGCCAAATCATGGGTG AACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCT AGGAATCCAACTTACAAGGGATGTGAAGGACCTCTTCAA GGAGAACTACAAACCACTGCTCAAGGAAATAAAAGAGG AGACAAACAAATGGAAGAACATTCCATGCTCATGGGTAG GAAGAATCAATATCGTGAAAATGGCCATACTGCCCAAGG TAATTTACAGATTCAATGCCATCCCCATCAAGCTACCAAT GACTTTCTTCACAGAATTGGAAAAAACTACTTTAAAGTTC ATATGGAACCAAAAAAGAGCCCGCATTGCCAAGTCAATC CTAAGCCAAAAGAACAAAGCTGGAGGCATCACACTACCT GACTTCAAACTATACTACAAGGCTACAGTAACCAAAACA GCATGGTACTGGTACCAAAACAGAGATATAGATCAATGG AACAGAACAGAGCCCTCAGAAATAATGCCGCATATCTAC AACTATCTGATCTTTGACAAACCTGAGAAAAACAAGCAA TGGGGAAAGGATTCCCTATTTAATAAATGGTGCTGGGAA AACTGGCTAGCCATATGTAGAAAGCTGAAACTGGATCCC TTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTA AAGATTTAAACGTTAAACCTAAAACCATAAAAACCCTAG AAGAAAACCTAGGCATTACCATTCAGGACATAGGCGTGG GCAAGGACTTCATGTCCAAAACACCAAAAGCAATGGCAA CAAAAGACAAAATTGACAAATGGGATCTAATTAAACTAA AGAGCTTCTGCACAGCAAAAGAAACTACCATCAGAGTGA ACAGGCAACCTACAACATGGGAGAAAATTTTTGCAACCT ACTCATCTGACAAAGGGCTAATATCCAGAATCTACAATG AACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCA TCAAAAAGTGGGCGAAGGACATGAACAGACACTTCTCAA AAGAAGACATTTATGCAGCCAAAAAACACATGAAGAAAT GCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAA CCACTATGAGATATCATCTCACACCAGTTAGAATGGCAAT CATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATG CGGAGAAATAGGAACACTTTTACACTGTTGGTGGGACTG TAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTC CTCAGGGATCTAGAACTAGAAATACCATTTGACCCAGCC ATCCCATTACTGGGTATATACCCAAATGAGTATAAATCAT GCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGC ACTATTCACAATAGCAAAGACTTGGAACCAACCCAAATG TCCAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGCCATAAAAAATGATGAAtorney Docket No. 42256-634.601GTTCATATCCTTTGTAGGGACATGGATGAAATTGGAAACC ATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAA CACCGCATATTCTCACTCATAGGTGGGAATTGAACAATG AGATCACATGGACACAGGAAGGGGAATATCACACTCTGG GGACTGTGGTGGGGTCGGGGGAGGGGGGAGGGATAGCA TTGGGAGATATACCTAATGCTAGATGACACATTAGTGGG TGCAGCGCACCAGCATGGCACATGTATACATATGTAACT AACCTGCACAATGTGCACATGTACCCTAAAACTTAGAGT ATAATAAA3 90- GGGGGAGGAGCCAAGATGGCCGAATAGGAACAGCTCCG element GTCTACAGCTCCCAGCGTGAGCGACGCAGAAGACGGGTG consensus ATTTCTGCATTTCCATCTGAGGTACCGGGTTCATCTCACT AGGGAGTGCCAGACAGTGGGCGCAGGCCAGTGTGTGTGC GCACCGTGCGCGAGCCGAAGCAGGGCGAGGCATTGCCTC ACCTGGGAAGCGCAAGGGGTCAGGGAGTTCCCTTTCCGA GTCAAAGAAAGGGGTGACGGACGCACCTGGAAAATCGG GTCACTCCCACCCGAATATTGCGCTTTTCAGACCGGCTTA AGAAACGGCGCACCACGAGACTATATCCCACACCTGGCT CAGAGGGTCCTACGCCCACGGAATCTCGCTGATTGCTAG CACAGCAGTCTGAGATCAAACTGCAAGGCGGCAACGAGG CTGGGGGAGGGGCGCCCGCCATTGCCCAGGCTTGCTTAG GTAAACAAAGCAGCCGGGAAGCTCGAACTGGGTGGAGCC CACCACAGCTCAAGGAGGCCTGCCTGCCTCTGTAGGCTCC ACCTCTGGGGGCAGGGCACAGACAAACAAAAAGACAGC AGTAACCTCTGCAGACTTAAGTGTCCCTGTCTGACAGCTT TGAAGAGAGCAGTGGTTCTCCCAGCACGCAGCTGGAGAT CTGAGAACGGGCAGACTGCCTCCTCAAGTGGGTCCCTGA CCCCTGACCCCCGAGCAGCCTAACTGGGAGGCACCCCCC AGCAGGGGCACACTGACACCTCACACGGCAGGGTATTCC AACAGACCTGCAGCTGAGGGTCCTGTCTGTTAGAAGGAA AACTAACAACCAGAAAGGACATCTACACCGAAAACCCAT CTGTACATCACCATCATCAAAGACCAAAAGTAGATAAAA CCACAAAGATGGGGAAAAAACAGAACAGAAAAACTGGA AACTCTAAAACGCAGAGCGCCTCTCCTCCTCCAAAGGAA CGCAGTTCCTCACCAGCAACAGAACAAAGCTGGATGGAG AATGATTTTGACGAGCTGAGAGAAGAAGGCTTCAGACGA TCAAATTACTCTGAGCTACGGGAGGACATTCAAACCAAA GGCAAAGAAGTTGAAAACTTTGAAAAAAATTTAGAAGAA TGTATAACTAGAATAACCAATACAGAGAAGTGCTTAAAG GAGCTGATGGAGCTGAAAACCAAGGCTCGAGAACTACGT GAAGAATGCAGAAGCCTCAGGAGCCGATGCGATCAACTG GAAGAAAGGGTATCAGCAATGGAAGATGAAATGAATGA AATGAAGCGAGAAGGGAAGTTTAGAGAAAAAAGAATAA AAAGAAATGAGCAAAGCCTCCAAGAAATATGGGACTATG TGAAAAGACCAAATCTACGTCTGATTGGTGTACCTGAAA GTGATGTGGAGAATGGAACCAAGTTGGAAAACACTCTGC AGGATATTATCCAGGAGAACTTCCCCAATCTAGCAAGGC AGGCCAACGTTCAGATTCAGGAAATACAGAGAACGCCAC AAAGATACTCCTCGAGAAGAGCAACTCCAAGACACATAATTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGTAtorney Docket No. 42256-634.601TAAGGGCAGCCAGAGAGAAAGGTCGGGTTACCCTCAAAG GAAAGCCCATCAGACTAACAGCGGATCTCTCGGCAGAAA CCCTACAAGCCAGAAGAGAGTGGGGGCCAATATTCAACA TTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCC AGCCAAACTAAGCTTCATAAGTGAAGGAGAAATAAAATA CTTTATAGACAAGCAAATGCTGAGAGATTTTGTCACCACC AGGCCTGCCCTAAAAGAGCTCCTGAAGGAAGCGCTAAAC ATGGAAAGGAACAACCGGTACCAGCCGCTGCAAAATCAT GCCAAAATGTAAAGACCATCGAGACTAGGAAGAAACTGC ATCAACTAATGAGCAAAATCACCAGCTAACATCATAATG ACAGGATCAAATTCACACATAACAATATTAACTTTAAAT ATAAATGGACTAAATTCTGCAATTAAAAGACACAGACTG GCAAGTTGGATAAAGAGTCAAGACCCATCAGTGTGCTGT ATTCAGGAAACCCATCTCACGTGCAGAGACACACATAGG CTCAAAATAAAAGGATGGAGGAAGATCTACCAAGCCAAT GGAAAACAAAAAAAGGCAGGGGTTGCAATCCTAGTCTCT GATAAAACAGACTTTAAACCAACAAAGATCAAAAGAGAC AAAGAAGGCCATTACATAATGGTAAAGGGATCAATTCAA CAAGAGGAGCTAACTATCCTAAATATTTATGCACCCAAT ACAGGAGCACCCAGATTCATAAAGCAAGTCCTCAGTGAC CTACAAAGAGACTTAGACTCCCACACATTAATAATGGGA GACTTTAACACCCCACTGTCAACATTAGACAGATCAACG AGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCA GCTCTGCACCAAGCAGACCTAATAGACATCTACAGAACT CTCCACCCCAAATCAACAGAATATACATTTTTTTCAGCAC CACACCACACCTATTCCAAAATTGACCACATAGTTGGAA GTAAAGCTCTCCTCAGCAAATGTAAAAGAACAGAAATTA TAACAAACTATCTCTCAGACCACAGTGCAATCAAACTAG AACTCAGGATTAAGAATCTCACTCAAAGCCGCTCAACTA CATGGAAACTGAACAACCTGCTCCTGAATGACTACTGGG TACATAACGAAATGAAGGCAGAAATAAAGATGTTCTTTG AAACCAACGAGAACAAAGACACCACATACCAGAATCTCT GGGACGCATTCAAAGCAGTGTGTAGAGGGAAATTTATAG CACTAAATGCCTACAAGAGAAAGCAGGAAAGATCCAAA ATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAG CAAGAGCAAACACATTCAAAAGCTAGCAGAAGGCAAGA AATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGA CACAAAAAACCCTTCAAAAAATCAATGAATCCAGGAGCT GGTTTTTTGAAAGGATCAACAAAATTGATAGACCGCTAG CAAGACTAATAAAGAAAAAAAGAGAGAAGAATCAAATA GACACAATAAAAAATGATAAAGGGGATATCACCACCGAT CCCACAGAAATACAAACTACCATCAGAGAATACTACAAA CACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATG GATACATTCCTCGACACATACACTCTCCCAAGACTAAACC AGGAAGAAGTTGAATCTCTGAATAGACCAATAACAGGCT CTGAAATTGTGGCAATAATCAATAGTTTACCAACCAAAA AGAGTCCAGGACCAGATGGATTCACAGCCGAATTCTACC AGAGGTACAAGGAGGAACTGGTACCATTCCTTCTGAAAC TATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGAGGCCAGCATCATTCTGATACCAAAGCCGGGAtorney Docket No. 42256-634.601CAGAGACACAACCAAAAAAGAGAATTTTAGACCAATATC CTTGATGAACATTGATGCAAAAATCCTCAATAAAATACT GGCAAACCGAATCCAGCAGCACATCAAAAAGCTTATCCA CCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGGCTG GTTCAATATACGCAAATCAATAAATGTAATCCAGCATAT AAACAGAGCCAAAGACAAAAACCACATGATTATCTCAAT AGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGAC GTATTTCAAAATAATAAGAGCTATCTATGACAAACCCAC AGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATT CCCTTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTC ACCGCTCCTATTCAACATAGTGTTGGAAGTTCTGGCCAGG GCAATCAGGCAGGAGAAGGAAATAAAGGGTATTCAATTA GGAAAAGAGGAAGTCAAATTGTCCCTGTTTGCAGACGAC ATGATTGTTTATCTAGAAAACCCCATCGTCTCAGCCCAAA ATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGG ATACAAAATCAATGTACAAAAATCACAAGCATTCTTATA CACCAACAACAGACAAACAGAGAGCCAAATCATGGGTG AACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCT AGGAATCCAACTTACAAGGGATGTGAAGGACCTCTTCAA GGAGAACTACAAACCACTGCTCAAGGAAATAAAAGAGG ACACAAACAAATGGAAGAACATTCCATGCTCATGGGTAG GAAGAATCAATATCGTGAAAATGGCCATACTGCCCAAGG TAATTTACAGATTCAATGCCATCCCCATCAAGCTACCAAT GACTTTCTTCACAGAATTGGAAAAAACTACTTTAAAGTTC ATATGGAACCAAAAAAGAGCCCGCATTGCCAAGTCAATC CTAAGCCAAAAGAACAAAGCTGGAGGCATCACACTACCT GACTTCAAACTATACTACAAGGCTACAGTAACCAAAACA GCATGGTACTGGTACCAAAACAGAGATATAGATCAATGG AACAGAACAGAGCCCTCAGAAATAATGCCGCATATCTAC AACTATCTGATCTTTGACAAACCTGAGAAAAACAAGCAA TGGGGAAAGGATTCCCTATTTAATAAATGGTGCTGGGAA AACTGGCTAGCCATATGTAGAAAGCTGAAACTGGATCCC TTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTA AAGATTTAAACGTTAGACCTAAAACCATAAAAACCCTAG AAGAAAACCTAGGCATTACCATTCAGGACATAGGCGTGG GCAAGGACTTCATGTCCAAAACACCAAAAGCAATGGCAA CAAAAGCCAAAATTGACAAATGGGATCTAATTAAACTAA AGAGCTTCTGCACAGCAAAAGAAACTACCATCAGAGTGA ACAGGCAACCTACAACATGGGAGAAAATTTTCGCAACCT ACTCATCTGACAAAGGGCTAATATCCAGAATCTACAATG AACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCA TCAAAAAGTGGGCGAAGGACATGAACAGACACTTCTCAA AAGAAGACATTTATGCAGCCAAAAAACACATGAAGAAAT GCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAA CCACTATGAGATATCATCTCACACCAGTTAGAATGGCAAT CATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATG TGGAGAAATAGGAACACTTTTACACTGTTGGTGGGACTG TAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTAGAAATACCATTTGACCCAGCCAttorney Docket No. 42256-634.601ATCCCATTACTGGGTATATACCCAAAGGACTATAAATCAT GCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGC ACTATTCACAATAGCAAAGACTTGGAACCAACCCAAATG TCCAACAATGATAGACTGGATTAAGAAAATGTGGCACAT ATACACCATGGAATACTATGCAGCCATAAAAAATGATGA GTTCATATCCTTTGTAGGGACATGGATGAAATTGGAAACC ATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAA CACCGCATATTCTCACTCATAGGTGGGAATTGAACAATG AGATCACATGGACACAGGAAGGGGAATATCACACTCTGG GGACTGTGGTGGGGTCGGGGGAGGGGGGAGGGATAGCA TTGGGAGATATACCTAATGCTAGATGACACATTAGTGGG TGCAGCGCACCAGCATGGCACATGTATACATATGTAACT AACCTGCACAATGTGCACATGTACCCTAAAACTTAGAGTATAATAAA* LI consensus sequences are cited from Brouha. B et al., Hot Lis account for the bulk of retrotransposition in the human population. Proc Natl Acad Sci USA. 2003 Apr 29;100(9):5280-5.doi: 10.1073 / pnas.0831042100.

[0036] Described herein are methods for detecting the LI variants. In some embodiments, the LI variant is detected from a subject with Alzheimer’s disease (AD). In some embodiments, the LI variant is detected from a subject without Alzheimer’s disease. In some embodiments, the LI variant is detected in a neuron from a subject with AD. In some embodiments, the LI variant is detected in a non-neuron from a subject with AD. In some embodiments, the LI variant is detected from prefrontal cortex (PFC) sample of a subject with AD. In some embodiments, the LI variant is detected from medial temporal gyrus (MTG) sample of a subject with AD. In some embodiments, the LI variant is detected from RNA in situ from a brain tissue of a subject with AD. In some embodiments, the LI variant is detected from RNA extracted from a brain tissue of a subject with AD.

[0037] Described herein, in some embodiments, is a method for detecting an enzymatic activity. In some embodiments, the enzymatic activity comprises an LI variant enzymatic activity. In some embodiments, the LI variant comprises reverse transcriptase (RT) activity, endonuclease (EN) activity, or both. In some embodiments, the LI ORF2 variant produce variable enzymatic activities. The change in the enzymatic activity can serve as a marker for the diagnosis of a neurodegenerative disease. A variety of assays for detecting the enzymatic activities include direct or indirect assays.

[0038] Reverse transcriptase is an enzyme that converts RNA sequences to cDNA sequences that are capable of being inserted into different areas of the genome. An exemplary method for detecting the level of RT activity is a FPERT assay. RT activity can be measured by first adding the protein lysate to the FPERT cocktail, followed by a qPCR.Attorney Docket No. 42256-634.601

[0039] Endonuclease is an enzyme that breaks the phosphodiester bond present within the polynucleotide chain of a DNA molecule. An exemplary method for detecting the level of EN activity involves the use of agarose gel electrophoresis to resolve intact homogeneous nucleic acid substrate from degradation products resulting from a small number of nucleolytic breaks. In some embodiments, En activity is measured by a y-H2AX labeling assay.

[0040] Described herein, in some embodiments, are methods of detecting enzymatic activity. In some embodiments, the enzymatic activity of a LI variant is detected from homogenized human brain tissue of a subject with AD. In some embodiments, the enzymatic activity of a LI variant is detected from RNA extracted from a brain tissue of a subject with AD. The enzymatic activity is measured by cloning the cDNA of the LI variant into an expression construct, followed by transfection into cells. In some embodiments, the enzymatic activity of the LI variant is detected using a control.Methods of Diagnostics

[0041] Described herein, in some embodiments, are methods for diagnosing a neurodegenerative disease in a subject in need thereof, comprising detecting a change in an enzymatic activity of a Long Interspersed Nuclear Element- 1 (LI) variant in a sample from a subject compared with a reference enzymatic activity of a control subject not having the neurodegenerative disease, wherein the change in the enzymatic activity indicates that the subject has or is at risk of developing the neurodegenerative disease. The change in the enzymatic activity can serve as a marker for the diagnosis of pathological conditions including, for example, neurodegenerative diseases. The enzymatic activity is provided herein for the diagnosis of neurodegenerative diseases. In some embodiments, the sample is a blood sample. In some embodiments, the sample comprises RNA, DNA, or protein. In some embodiments, the disease or disorder is Alzheimer’s disease. In some embodiments, the Alzheimer’s disease is familial Alzheimer’s disease (FAD) or sporadic Alzheimer’s disease.

[0042] In some embodiments, the enzymatic activity is produced by a LI ORF2 protein or peptide that is encoded by a monocistronic intact LI ORF2 variant. In some embodiments, the enzymatic activity is produced by a LI ORF2 protein that is encoded by a monocistronic partial LI ORF2 variant. In some embodiments, the enzymatic activity is produced by a LI ORF2 protein or peptide that is encoded by a bicistronic ORF1+ORF2 variant.

[0043] Described herein, the enzymatic activity comprises a RT activity, a EN activity, or a combination thereof. In some embodiments, the RT activity is produced by a reverse transcriptase that is encoded by a monocistronic intact LI ORF2 variant. In some embodiments, the RT activity is produced by a reverse transcriptase that is encoded by aAttorney Docket No. 42256-634.601monocistronic partial LI ORF2 variant. In some embodiments, the RT activity is produced by a reverse transcriptase that is encoded by a bicistronic ORF1+ORF2 variant. In some embodiments, the EN activity is produced by an endonuclease that is encoded by a monocistronic intact LI ORF2 variant. In some embodiments, the EN activity is produced by an endonuclease that is encoded by a monocistronic partial LI ORF2 variant. In some embodiments, the EN activity is produced by an endonuclease that is encoded by a bicistronic ORF1+ORF2 variant. Exemplary LI variants are illustrated in Table 4.

[0044] In some embodiments, the enzymatic activity is activity level of one LI variant. In some embodiments, the enzymatic activity is activity level of one or more LI variants.

[0045] Measurement of RT activity

[0046] In some embodiments, the methods for diagnosing a neurodegenerative disease in a subject in need thereof, comprising detecting a change in an enzymatic activity of a Long Interspersed Nuclear Element-1 (L-l) variant in a sample from a subject compared with a reference enzymatic activity of a control subject not having the neurodegenerative disease, wherein the change in the enzymatic activity indicates that the subject has or is at risk of developing the neurodegenerative disease. In some embodiments, the enzymatic activity of a LI variant in a sample is a RT activity.

[0047] In some embodiments, the RT activity is measured from a sample from a subject. In some embodiments, the sample comprises polypeptide, RNA, or DNA. In some embodiments, the example comprises polypeptide. In some embodiments, the RT activity is measured with any appropriate technology, including but not limited to RT-PCR, Colorimetric assays (for example EnzChek RT assay), ELISA-based assays, Radioactive nucleotide incorporation, SYBR or fluorescent dye assays, Luminometric assays. An exemplary method for detecting the level of RT activity is a FPERT assay. RT activity can be measured by first adding the protein lysate to the FPERT cocktail, followed by a qPCR. In some embodiments, cell culture supernatants are used for the detection of RT activity. In some embodiments, cell lysates are used to test the activity of RT. In some embodiments, body fluids comprising plasma, serum or urine are used to assess RT activity.

[0048] In some embodiments, the sample comprises polypeptide, RNA, or DNA. In some embodiments, the sample comprises RNA and DNA. In some embodiments, DNA is extracted and purified from the sample. In some embodiments, RNA is isolated, purified, and reverse transcribed from bodily fluids by various methods, including the use of commercial kits. In some embodiments, after RNA or DNA is extracted, the reverse transcribed cDNA or DNA is amplified prior to sequencing. In some embodiments, the nucleotide sequencingAttorney Docket No. 42256-634.601comprises long-read sequencing. Exemplary methods for nucleotide sequencing include, but not limited to, Pacific Biosciences (PacBio) and Oxford Nanopore Technologies (ONT). Long reads are further subjected to alignment with consensus LI and protein coding variant identification. Identified ORFs are then aligned to consensus ORF Ip and ORF2p sequences from UniProt [Q9UN81; 000370] via BLASTp, allowing LI transcripts to be assigned into subcategories: bicistronic (Intact ORF1 and ORF2, Intact ORF1 and partial ORF2 containing EN + RT, Intact ORF1 and partial ORF2 containing EN) and monocistronic (monocistronic ORF1, monocistronic ORF2, partial ORF2 containing EN+RT, and partial ORF2 containing EN). In some embodiments, the LI variant encoding RT is a bicistronic transcript comprising intact ORF1 and ORF2. In some embodiments, the LI variant encoding RT is a bicistronic transcript comprising intact ORF1 and partial ORF2 comprising EN domain and RT domain. In some embodiments, the LI variant encoding RT is a monocistronic transcript comprising intact ORF2. In some embodiments, the LI variant encoding RT is a monocistronic transcript comprising partial ORF2 comparing EN domain and RT domain. In some embodiments, the RT activity of a LI variant can be assessed after cloning the sequence into an expression construct, followed by transfecting construct into cells and collecting protein lysate.

[0049] Measurement of EN activity

[0050] In some embodiments, the methods for diagnosing a neurodegenerative disease in a subject in need thereof, comprising detecting a change in an enzymatic activity of a Long Interspersed Nuclear Element-1 (L-l) variant in a sample from a subject compared with a reference enzymatic activity of a control subject not having the neurodegenerative disease, wherein the change in the enzymatic activity indicates that the subject has or is at risk of developing the neurodegenerative disease. In some embodiments, the enzymatic activity of a LI variant in a sample is a EN activity.

[0051] In some embodiments, the EN activity is measured from a sample from a subject. In some embodiments, the sample comprises polypeptide, RNA, or DNA. In some embodiments, the sample comprises polypeptide. In some embodiments, EN activity is measured with any appropriate technology, including but not limited to gel electrophoresis, fluorescent-based assays, qPCR, FRET -based assays, Comet assays, T7 endonuclease assays, Radioactive assays. In some embodiments, body fluids comprising plasma, serum or urine are used to assess EN activity.

[0052] In some embodiments, the sample comprises polypeptide, RNA, or DNA. In some embodiments, the sample comprises RNA and DNA. In some embodiments, DNA is extracted and purified from the sample. In some embodiments, RNA is isolated, purified, andAttorney Docket No. 42256-634.601reverse transcribed from bodily fluids by various methods, including the use of commercial kits. In some embodiments, after RNA or DNA is extracted, the reverse transcribed cDNA or DNA is amplified prior to sequencing. In some embodiments, the nucleotide sequencing comprises long-read sequencing. During a long-read sequencing reaction, “reads” are generated. In some embodiments, reads are mapped to consensus ORF Ip and ORF2p sequences from UniProt [Q9UN81; 000370] via BLASTp, allowing LI transcripts to be assigned into subcategories: bicistronic (Intact ORF1 and ORF2, Intact ORF1 and partial ORF2 containing EN + RT, Intact ORF1 and partial ORF2 containing EN) and monocistronic (monocistronic ORF1, monocistronic ORF2, partial ORF2 containing EN+RT, and partial ORF2 containing EN). In some embodiments, the LI variant encoding EN is a bicistronic transcript comprising intact ORF1 and ORF2. In some embodiments, the LI variant encoding EN is a bicistronic transcript comprising intact ORF1 and partial ORF2 comprising EN domain and RT domain. In some embodiments, the LI variant encoding EN is a bicistronic transcript comprising intact ORF1 and partial ORF2 comprising EN domain. In some embodiments, the LI variant encoding EN is a monocistronic transcript comprising intact ORF2. In some embodiments, the LI variant encoding EN is a monocistronic transcript comprising partial ORF2 comprising EN domain and RT domain. In some embodiments, the LI variant encoding EN is a monocistronic transcript comprising partial ORF2 comprising EN domain. In some embodiments, EN activity of an individual LI variant can be assessed after cloning the sequence into an expression construct, followed by transfecting the construct into cells. An exemplary method for detecting the level of EN activity is a y-H2AX assay.

[0053] In some embodiments, the methods for diagnosing a neurodegenerative disease in a subject in need thereof, comprising detecting a change in an enzymatic activity of a Long Interspersed Nuclear Element-1 (L-l) variant in a sample from a subject compared with a reference enzymatic activity of a control subject not having the neurodegenerative disease, wherein the change in the enzymatic activity indicates that the subject has or is at risk of developing the neurodegenerative disease. In some embodiments, the enzymatic activity of a LI variant in a sample is a RT activity and a EN activity.

[0054] “ control” or “control sample” provides a reference point for measuring changes in enzymatic activities comprising RT activity, EN activity, or a combination thereof. The control may be a predetermined value based on a group of samples or it may be a single value based on an individual sample. The control may be a sample tested in parallel with the subject sample. A control sample may comprise, for example: (a) any sample from a controlAttorney Docket No. 42256-634.601subject; (b) a serum or plasma sample taken from a control subject; (c) a cerebrospinal fluid sample taken from a control subject; or (d) a urine sample from a control subject.

[0055] As used herein, an increase of an enzymatic activity is meant the increase in the level of the enzymatic activity in a sample as compared to the level of the corresponding enzymatic activity in a control sample.

[0056] In some embodiments, a LI variant is identified from a subject with AD. in some embodiments, a LI variant from a brain of a subject with AD. In some embodiments, a LI variant is identified in a neuron from a subject with AD. In some embodiments, the RNA is reverse transcribed to cDNA, and a LI variant is identified. In some embodiments, a LI variant is identified from genomic DNA extracted from a neuron of an individual with AD. In some embodiments, the LI variant is identified by in situ hybridization or immunological hybridization. In some embodiments, the probes are used for in situ hybridization. In some embodiments, the LI variant is identified using probes that hybridize to the LI variant. In some embodiments, the probes hybridize to the genomic DNA. In some embodiments, the probes hybridize to the cDNA. In some embodiments, the probes hybridize to the RNA. In some embodiments, the probes hybridize to the polypeptide. In some embodiments, the probes are a single-strand sequence of DNA. In some embodiments, the probes are a singlestrand sequence of RNA. In some embodiments, the probes are an antibody or a binding fragment thereof.

[0057] In some embodiments, a probe is labeled. In some embodiments, a probe is labeled with a radioactive label, a fluorescent label, an enzyme, a chemiluminescent tag, a colorimetric tag, an affinity tag or other labels or tags.

[0058] Exemplary affinity tags include, but are not limited to, biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof. In some embodiments, the affinity tag is recognized by avidin, streptavidin, nickel, or glutathione.

[0059] In some embodiments, the fluorescent label is a fluorophore, a fluorescent protein, a fluorescent peptide, quantum dots, a fluorescent dye, a fluorescent material, or variations or combinations thereof.

[0060] Exemplary fluorophores include, but are not limited to, Alexa-Fluor dyes (e.g., Alexa Fluor® 350, Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 500, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor® 700, and Alexa Fluor® 750), APC, CascadeAttorney Docket No. 42256-634.601Blue, Cascade Yellow and R-phycoerythrin (PE), DyLight 405, DyLight 488, DyLight 550, DyLight 650, DyLight 680, DyLight 755, DyLight 800, FITC, Pacific Blue, PerCP, Rhodamine, and Texas Red, Cy5, Cy5.5, Cy7.

[0061] Examples of fluorescent peptides include GFP (Green Fluorescent Protein) or derivatives of GFP (e.g., EBFP, EBFP2, Azurite, mKalamal, ECFP, Cerulean, CyPet, YFP, Citrine, Venus, YPet).

[0062] Examples of fluorescent dyes include, but are not limited to, xanthenes (e.g., rhodamines, rhodols and fluoresceins, and their derivatives); bimanes; coumarins and their derivatives (e.g., umbelliferone and aminomethyl coumarins); aromatic amines (e.g., dansyl; squarate dyes); benzofurans; fluorescent cyanines; indocarbocyanines; carbazoles; dicyanomethylene pyranes; polymethine; oxabenzanthrane; xanthene; pyrylium; carbostyl; perylene; acridone; quinacridone; rubrene; anthracene; coronene; phenanthrecene; pyrene; butadiene; stilbene; porphyrin; pthalocyanine; lanthanide metal chelate complexes; rare-earth metal chelate complexes; and derivatives of such dyes. In some embodiments, the fluorescein dye is, but not limited to, 5-carboxyfluorescein, fluorescein-5-isothiocyanate, fluorescein-6-isothiocyanate and 6-carboxyfluorescein. In some embodiments, the rhodamine dye is, but not limited to, tetramethylrhodamine-6-isothiocyanate, 5-carboxytetramethylrhodamine, 5 -carboxy rhodol derivatives, tetramethyl and tetraethyl rhodamine, diphenyldimethyl and diphenyldiethyl rhodamine, dinaphthyl rhodamine, and rhodamine 101 sulfonyl chloride (sold under the tradename of TEXAS RED®). In some embodiments, the cyanine dye is Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7, IRDYE680, Alexa Fluor 750, IRDye800CW, or ICG.

[0063] Fluorescent labels are detected by any suitable method. For example, a fluorescent label is detected by exciting the fluorochrome with the appropriate wavelength of light and detecting the resulting fluorescence, e.g., by microscopy, visual inspection, via photographic film, by the use of electronic detectors such as charge coupled devices (CCDs), or photomultipliers. In some embodiments, the one or more probe(s) are labeled with the same fluorescent label. In some embodiments, the one or more probe(s) are labeled with different fluorescent labels.

[0064] In some embodiments, the probe is used for visualization of LI variant in a subject. In some embodiments, the probe is visualized by X-Ray, fluoroscopes, ultrasound, CT-scan, PET scan, magnetic resonance image (MRIs), or electromagnetic field.

[0065] SamplesAttorney Docket No. 42256-634.601

[0066] Described herein, in some embodiments are methods for diagnosing a subject having or suspected of having a neurodegenerative disease by measuring a change in an enzymatic activity of LI variants. In some embodiments, the change in an enzymatic activity is determined by taking a sample from the individual. In some embodiments, the sample comprises RNA or DNA. In some embodiments, the RNA is pre-mRNA. In some embodiments, the RNA is mRNA. In some embodiments, the DNA is nuclear DNA.

[0067] The sample may be derived from any cell, tissue, or biological fluid from the subject. The sample may comprise any clinically relevant tissue, such as, but not limited to, neuron, cerebrospinal fluid, fine needle aspirate, or a sample of body fluid, such as blood, plasma, serum, lymph, ascetic fluid, cystic fluid or urine. The sample used in the methods provided herein will vary based on the assay format, nature of the detection method, and the tissues, cells or extracts which are used as the sample.

[0068] In some embodiments, the sample comprises a bodily fluid, or a neuronal cell from a subject. In some embodiments, the bodily fluid comprises blood plasma, serum, cerebrospinal fluid, urine, saliva, semen, tears, sweat, fecal matter, breast milk, Synovial fluid, pleural fluid, pericardial fluid, peritoneal fluid, or Amniotic fluid. In some embodiments, the sample is from a blood sample. The blood sample is taken, for example, from the individual by a blood draw. In some embodiments, the blood sample is processed by centrifugation such as by density centrifugation. In some embodiments, the blood sample is treated with a red blood cell lysis agent. In some embodiments, the blood sample comprises cells from the Central Nervous System (e.g., neurons, astrocytes, or microglia) that are released during break down of the blood brain barrier. In some embodiments, the sample is from cerebrospinal fluid. In some embodiments, the cerebrospinal fluid comprises cells from the Central Nervous System (e.g., neurons, astrocytes, or microglia) that are released during break down of the blood brain barrier.

[0069] A sample, in some embodiments, comprises exosomes. Exosomes are cell-derived vesicles that are released from many cell types including, but not limited to, dendritic cells (DCs), lymphocytes, platelets, mast cells, epithelial cells, endothelial cells, and neurons. In some embodiments, the exosomes are found in blood. In some embodiments, the exosomes are found in cerebrospinal fluid. In some embodiments, the sample comprises exosomes from the blood. In some embodiments, the sample comprises exosomes from cerebrospinal fluid.

[0070] In some embodiments, protein is isolated from the sample. In some embodiments, cell lysis is required prior to protein isolation. In some embodiments, the protein is stored inAttorney Docket No. 42256-634.601suitable buffer before subsequent analysis. For example, storage is less than 8° C, 4° C, -20° C, or -80° C.

[0071] In some embodiments, nucleic acid is extracted from the sample. In some embodiments, the nucleic acid is DNA. In some embodiments, the DNA is genomic DNA. In some embodiments, the DNA is extrachromosomal DNA. In some embodiments, the DNA is circular DNA. In some embodiments, the nucleic acid is RNA. The nucleic acid, in some embodiments, is extracted using any technique that does not interfere with subsequent analysis. For example, the nucleic acid is extracted using alcohol precipitation using ethanol, methanol, or isopropyl alcohol. In some embodiments, the nucleic acid is extracted using phenol, chloroform, or any combination thereof. In some embodiments, the nucleic acid is extracted using cesium chloride. In some embodiments, the nucleic acid is extracted using sodium, potassium or ammonium acetate or any other salt commonly used to precipitate DNA. In some embodiments, the nucleic acid is extracted using utilizes a column or resin based nucleic acid purification. In some embodiments, after extraction the nucleic acid is stored in water, Tris buffer, or Tris-EDTA buffer before subsequent analysis. For example, storage is less than 8° C, 4° C, -20° C, or -70° C. In some embodiments, the nucleic acid is stored for 1, 2, 3, 4, 5, 6, or 7 days. In some embodiments, the nucleic acid is stored for 1, 2, 3, or 4 weeks. In some embodiments, the nucleic acid is stored for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months.

[0072] Described herein, in some embodiments are methods for diagnosing a neurodegenerative disease in a subject in need thereof, the method comprising detecting a change in an enzymatic activity of a LI variant in a sample from a subject compared with a reference enzymatic activity of a control subject not having the neurodegenerative disease, wherein the change in the enzymatic activity indicates that the subject has or is at risk of developing the neurodegenerative disease. In some embodiments, the change in an enzymatic activity is the increase in the enzymatic activity. In some embodiments, the change in an enzymatic activity is the decrease in the enzymatic activity.

[0073] In some embodiments, determining whether the subject has or is predisposed to a neurodegenerative disease is based on the change in the enzymatic activity of the subject, wherein a likelihood of having or being predisposed to the neurodegenerative disease is increased when the enzymatic activity is elevated compared to a reference enzymatic activity derived from a cohort of control subjects. In some embodiments, the change in the enzymatic activity is the increase in the enzymatic activity. In some embodiments, the change in the enzymatic activity is the increase in the RT activity. In some embodiments, the individual isAttorney Docket No. 42256-634.601diagnosed with a neurodegenerative disease when the RT activity level is at least or about 50%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, or more than 700% increased or elevated as compared to the RT activity level from the cohort of control subjects. In some embodiments, the change in the enzymatic activity is the increase in the EN activity. In some embodiments, the individual is diagnosed with a neurodegenerative disease when the EN activity level is at least or about 50%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, or more than 700% increased or elevated as compared to the EN activity level from the cohort of control subjects.

[0074] In some embodiments, the increase in the enzymatic activity is used to more accurately diagnose or treat a subject having a neurodegenerative disease. In some embodiments, use of the increase in the enzymatic activity is at least or about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95% more accurate at diagnosing the neurodegenerative disease. In some embodiments, use of the increase in the enzymatic activity is at least or about 1.5X, 2X, 2.5X, 3X, 3.5X, 4. OX, 4.5X, 5X, 6X, 7X, 8X, 9X, 10X, or more than 10X more accurate at diagnosing the neurodegenerative disease. In some embodiments, the neurodegenerative disease is Alzheimer’s disease. In some embodiments, methods as described herein for accurately diagnosing or treating Alzheimer’s disease are improved as compared to methods comprising neurological tests, mental exams, orbrain imaging (e.g., MRI, CT, or PET scans).

[0075] In some embodiments, the change in the enzymatic activity is used to monitor the treatment in a subject having a neurodegenerative disease. In some embodiments, the change in the enzymatic activity is associated with Alzheimer’s disease. In some embodiments, a therapeutic agent is administered based on the change in the enzymatic activity. In some embodiments, the therapeutic agent is optimized based on the change in the enzymatic activity. In some embodiments, the change in the enzymatic activity is measured prior to a treatment, during a treatment, or after a treatment. For example, the change in the enzymatic activity is measured at 1 day, 2 days, 3 days, 4 days, 5 days 6 days, 1 week, 2 weeks, 3, weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, or more than 2 years before treatment. In some embodiments, the expression profile or the activity profile is measured at I day, 2 days, 3 days, 4 days, 5 days 6 days, 1 week, 2 weeks, 3, weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, I I months, 1 year, 2 years, or more than 2 years occurs after treatment. In some embodiments, the RT activity is used to monitor the treatment in a subject having aAttorney Docket No. 42256-634.601neurodegenerative disease. In some embodiments, the EN activity is used to monitor the treatment in a subject having a neurodegenerative disease.

[0076] In some embodiments, the change in the enzymatic activity is associated with one LI variant. In some embodiments, the change in the enzymatic activity is associated with two or more LI variants. In some embodiments, the change in the RT activity and the change in the EN activity are associated with the same one or more LI variants. In some embodiments, the change in the RT activity and the change in the EN activity are associated with different LI variants.Method of Treatment

[0077] Disclosed herein, in some embodiments, is a method for treating a subject diagnosed with a neurodegenerative disease described herein. In some embodiments the subject is diagnosed with a method described herein (e.g., by detecting changes in LI variant enzymatic activity). In some embodiments, the subject can be treated by a therapeutic agent after diagnosing a neurodegenerative disease by detecting a change in an enzymatic activity of LI variant. Further disclosed herein, in some embodiments, are methods for treating a subject after diagnosing a neurodegenerative disease in need thereof, comprising: administering to a subject a therapeutically effective amount of a therapeutic agent, wherein the subject has a change in enzymatic activity associated with a LI variant relative to the enzymatic level of LI variant in a control subject not having the neurodegenerative disease, wherein the therapeutic agent targets the change in the enzymatic activity of the LI variant in the subject.

[0078] In some embodiments, the therapeutic agent inhibits the increase in the enzymatic activity by interfering the expression of the enzyme. In some embodiments, the therapeutic agent inhibits the expression of one or more LI variants that are associated with the increase in the enzymatic activity. In some embodiments, the therapeutic agent targets one or more LI variant gene or protein thereof. Exemplary therapeutic agent include, but are not limited to, an antibody, an antigen binding fragment, an RNA interfering agent (RNAi), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), an antisense oligonucleotide (AON), a peptide, a peptidomimetic, a small molecule, or an aptamer.

[0079] In some embodiments, the therapeutic agent inhibits the increase in the RT activity. In some embodiments, the therapeutic agent is a nucleoside reverse transcriptase inhibitor (NRTI). In some embodiments, the NRTI comprises Abacavir, Emtricitabine, Lamivudine, Tenofovir alafenamide, Tenofovir disoproxil fumarate, or Zidovudine. In some embodiments, the therapeutic agent is a non-nucleoside reverse transcriptase inhibitor (NNRTI). In someAttorney Docket No. 42256-634.601embodiments, the NNRII comprises nevirapine, efavirenz, etravirine, doravirine, delavirdine, or rilpivirine.

[0080] In some embodiments, the therapeutic agent is a small molecule. In some embodiments, the small molecule is an antagonist of the LI variant wherein the LI variant is a genomic DNA. In some embodiments, the small molecule is an antagonist of the LI variant wherein the LI variant is an RNA. In some embodiments, the small molecule is an antagonist of the LI variant wherein the LI variant is a protein.

[0081] In some embodiments, the therapeutic agent is an antibody. Exemplary antibodies include, but are not limited to, a monoclonal antibody, a polyclonal antibody, a bi-specific antibody, a multispecific antibody, a grafted antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a single-chain Fvs (scFv), a single chain antibody, a Fab fragment, a F(ab') fragment, disulfide-linked Fvs (sdFv), an intrabody, an anti -idiotypic (anti-Id) antibody, or ab antigen-binding fragments thereof. In some embodiments, the antibody comprises immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, e.g., molecules that contain an antigen binding site. Immunoglobulin molecules are of any type, class (e.g., IgG, IgE, IgM, IgD, IgA and IgY), or subclass (e.g., IgGl, IgG2, IgG3, IgG4 IgAl and IgA2). In some embodiments, the antibody selectively binds to a protein encoded by the LI variant.“Selectively binds” refers to the preference of an antibody to interact with one molecule as compared to another. In some embodiments, the antibody binds to a polypeptide encoded by the one or more LI variants. In some embodiments, the antibody binds to a polypeptide encoded by LI ORF1 variant. In some embodiments, the antibody binds to a polypeptide encoded by LI ORF2 variant. In some embodiments, the antibody is an intracellular antibody or the binding fragments selectively binding to a peptide encoded by a LI ORF1 or LI ORF2 variant. In some embodiments, the antibody does not bind to wide-type protein. Examples of delivery an intracellular antibody targeting peptide encoded by LI ORF1 or LI ORF2, include, but are not limited to, gene therapy, direct administration, cell penetrating peptides, physical delivery, chemical delivery, viral and virus like nanocarriers.

[0082] In some embodiments, the therapeutic agent that inhibits the expression of one or more LI variants comprises an antisense RNA wherein the antisense RNA hybridizes to a target RNA and inhibits the activity. In some embodiments, the antisense RNA stringently hybridizes to the target RNA and inhibits the activity. In some embodiments, the target RNA is one or more LI variants. In some embodiments, the target RNA is a bicistronic ORF1 and ORF2 variant. In some embodiments, the target RNA is a monocistronic ORF1 variant. InAttorney Docket No. 42256-634.601some embodiments, the target RNA is a monocistronic ORF2 variant. In some embodiments, the therapeutic agent is an antisense RNA molecule. Exemplary antisense RNA molecules include, but are not limited to, RNAi, siRNA, shRNA, or miRNA. In some embodiments, the antisense RNA is double stranded or single stranded. In some embodiments, the antisense RNA comprises about 1 to about 50 nucleotides. In some embodiments, the antisense RNA comprises about 5 to about, about 5 to about 30, about 10 to about 30, about 15 to about 25, or about 20 to about 25 nucleotides. In some embodiments, the antisense RNA is at least or about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the target RNA.

[0083] In some embodiments, the antisense RNA is a double-stranded antisense RNA molecule that down-regulates expression of LI variant, wherein each strand of the antisense RNA molecule comprises about 15 to 25, 18 to 24, or 19 to about 23 nucleotides, and wherein each strand comprises at least about 14, 17, or 19 nucleotides that are complementary to the nucleotides of the other strand. In some embodiments, the antisense RNA is a double-stranded antisense RNA molecule that down-regulates expression of LI variant, wherein each strand of the antisense RNA molecule comprises about 19 to about 23 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand. In some embodiments, the RNA interfering activity occurs within a cell. In other embodiments, the RNA interfering activity occurs in a reconstituted in vitro system.

[0084] In some embodiments, the antisense RNA is a single-stranded antisense RNA molecule that down-regulates expression of the LI variant, wherein the single-stranded antisense RNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of the LI variant or RNA encoded by the LI variant or a portion thereof. In some embodiments, antisense RNA is a single-stranded antisense RNA molecule that down-regulates expression of the LI variant, wherein the antisense RNA molecule comprises about 15 to 25, 18 to 24, or 19 to about 23 nucleotides. In some embodiments, antisense RNA molecule is a single-stranded antisense RNA molecule that down-regulates expression of the LI variant, wherein the antisense RNA molecule comprises about 19 to about 23 nucleotides. In some embodiments, the RNA interfering activity occurs within a cell. In other embodiments, the RNA interfering activity occurs in a reconstituted in vitro system.

[0085] In some embodiments, the antisense RNA molecule is a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to aAttorney Docket No. 42256-634.601nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. In some embodiments, the antisense RNA molecule is assembled from two separate polynucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (e.g., each strand comprises a nucleotide sequence that is complementary to the nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or doublestranded structure, for example wherein the double-stranded region is about 19, 20, 21, 22, 23, or more base pairs); the antisense strand comprises a nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. In some embodiments, the antisense RNA molecule is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the antisense RNA molecule are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).

[0086] In some embodiments, the antisense RNA molecule is a polynucleotide with a duplex, asymmetric duplex, hairpin, or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. In other embodiments, the antisense RNA molecule is a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide is processed either in vivo or in vitro to generate an active antisense RNA molecule capable of mediating RNA interfering activity. In additional embodiments, the antisense RNA molecule also comprises a single-stranded polynucleotide having a nucleotide sequence complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof, wherein the single stranded polynucleotide further comprises a terminal phosphate group, such as a 5 '-phosphate, or 5', 3 '-diphosphate.

[0087] In some embodiments, an asymmetric duplex is a linear antisense RNA molecule comprising an antisense region, a loop portion that comprises nucleotides or non-nucleotides,Attorney Docket No. 42256-634.601and a sense region that comprises fewer nucleotides than the antisense region to the extent that the sense region has enough complimentary nucleotides to base pair with the antisense region and form a duplex with loop. For example, an asymmetric hairpin antisense RNA molecule comprises an antisense region having length sufficient to mediate RNA interfering activity in a cell or in vitro system (e.g., about 19 to about 22 nucleotides) and a loop region comprising about 4 to about 8 nucleotides, and a sense region having about 3 to about 18 nucleotides that are complementary to the antisense region. In some embodiments, the asymmetric hairpin the antisense RNA molecule also comprises a 5 '-terminal phosphate group that is chemically modified. In additional embodiments, the loop portion of the asymmetric hairpin antisense RNA molecule comprises nucleotides, non-nucleotides, linker molecules, or conjugate molecules.

[0088] In some embodiments, an asymmetric duplex is an antisense RNA molecule having two separate strands comprising a sense region and an antisense region, wherein the sense region comprises fewer nucleotides than the antisense region to the extent that the sense region has enough complimentary nucleotides to base pair with the antisense region and form a duplex. For example, an asymmetric duplex antisense RNA molecule comprises an antisense region having length sufficient to mediate RNA interfering activity in a cell or in vitro system (e.g., about 19 to about 22 nucleotides) and a sense region having about 3 to about 18 nucleotides that are complementary to the antisense region.

[0089] In some embodiments, an antisense RNA inhibits activity of a target RNA in a cleavage-dependent process. For example, the cleavage-dependent process involves the RNA-induced silencing complex (RISC). In some embodiments, the antisense RNA (e.g., siRNA) comprises a passenger strand and guide strand. The guide strand pairs with a complementary sequence in a mRNA molecule and induces cleavage by an RNase H endonuclease of the RISC complex. In some embodiments, the RNase H endonuclease is Argonaute. In some embodiments, an antisense RNA inhibits activity in a cleavageindependent process. For example, the antisense RNA (e.g., miRNA) comprises nucleotide mismatches with their targets and effect gene silencing through translational repression of the target gene.

[0090] In some embodiments, an antisense RNA inhibits the one or more LI variants. In some embodiments, the antisense RNA inhibits pre-mRNA. In some embodiments, the antisense RNA inhibits mRNA. In some embodiments, the antisense RNA alters various functions of the target RNA. In some embodiments, the antisense RNA alters splicing of the RNA to yield one or more mRNA species. In some embodiments, the antisense RNA altersAttorney Docket No. 42256-634.601translation of protein from RNA. In some embodiments, the antisense RNA alters translocation of the RNA to the site of protein translation. In some embodiments, the antisense RNA alters a catalytic activity of the RNA or which is facilitated by the RNA. Alternatively, or in combination, the antisense RNA reduces an amount of pre-mRNA.

[0091] In some embodiments, the therapeutic agent is a sense RNA molecule. In some embodiments, the sense RNA is double stranded or single stranded. In some embodiments, the sense RNA comprises about 1 to about 50 nucleotides. In some embodiments, the sense RNA comprises about 5 to about, about 5 to about 30, about 10 to about 30, about 15 to about 25, or about 20 to about 25 nucleotides. In some embodiments, the sense RNA is at least or about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the target RNA.

[0092] In some embodiments, the therapeutic agent is an antisense oligonucleotide (AON). In some embodiments, the AON comprises antisense oligonucleotide strands. In some embodiments, the AON comprises sense oligonucleotide strands. In some embodiments, the AON comprises antisense oligonucleotide strands and sense oligonucleotide strands. In some embodiments, the AON targets RNA of the one or more LI variants. In some embodiments, the RNA is pre-mRNA. In some embodiments, the RNA is mRNA. In some embodiments, the AON targets DNA of the one or more LI variants. In some embodiments, the DNA is genomic DNA.

[0093] In some embodiments, the AONs inhibit the expression of one or more LI variants. In some embodiments, the AONs inhibit the expression by targeting RNA of one or more LI variants for degradation. In some embodiments, antisense oligonucleotides (AONs) inhibit a gene of a protein involved in transcription of LI gene. An exemplary protein is a transcription factor, coactivator, corepressor, chromatin modifying enzyme, histone acetyltransferase, histone deacetylase, kinase, or methylase, or any other protein involved in a signal transduction pathway that results in transcription of LI. In some embodiments, the AONs inhibit the gene of a protein involved in transcription of LI to inhibit generation of the one or more LI variants.

[0094] In some embodiments, the AONs result in an insertion, deletion, duplication, or alteration in an incorrectly processed transcript of the LI. In some embodiments, the AONs induce exon skipping. In some embodiments, the AON is a short nucleic acid sequence that binds to specific mRNA or pre-mRNA sequences to induce exon skipping. In some embodiments, the AON is a short nucleic acid sequence that binds to specific DNA sequences to induce exon skipping. In some embodiments, the AON binds splice sites orAttorney Docket No. 42256-634.601exonic enhancers. In some embodiments, binding of the AON to specific mRNA or pre-mRNA sequences generates double-stranded regions. In some embodiments, formation of double-stranded regions occurs at sites where the spliceosome or proteins associated with the spliceosome would normally bind and causes exons to be skipped. In some embodiments, the AONs induce exon inclusion. In some embodiments, the AON binds to at least one of a splice site, a site near a splice site, and a site distant to a splice site. In some embodiments, the AON binds at site in the RNA to prevent disruption of an exon splice enhancer or intron splice enhancer. In some embodiments, the AON binds at site in the RNA to prevent creation of an exon splice silencer or intron splice silencer.

[0095] In some embodiments, the antisense oligonucleotide (AON) comprises natural, synthetic, or artificial nucleotide analogues or bases. In some embodiments, the AON comprises DNA, RNA, or nucleotide analogues. In some embodiments, the synthetic or artificial nucleotide analogues or bases comprise modifications at one or more of ribose moiety, phosphate moiety, nucleoside moiety, or a combination thereof.

[0096] In some embodiments, the antisense oligonucleotide (AON) comprises a nucleobase that is unmodified such as adenine, guanine, cytosine, thymine, and uracil or any synthetic or modified nucleobase. Examples of modified nucleobases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethoylcytosine.

[0097] In some embodiments, the antisense oligonucleotide (AON) comprises a backbone that connects components of the AON. In some embodiments, the backbone comprises a 3’-5’ phosphodiester linkage connecting sugar moi eties of the AON. Examples of a backbone structure or linkages of the AON, include, but are not limited to, phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodi selenoate, phosphoroanilothioate, phosphoraniladate, and phosphoramidate. In some embodiments, the backbone structure of the AON does not comprise phosphorous but comprises peptide bonds, for example in a peptide nucleic acid (PNA), or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups. In some embodiments, the backbone modification is a phosphorothioate linkage. In some embodiments, the backbone modification is a phosphoramidate linkage.

[0098] In some embodiments, the antisense oligonucleotide (AON) comprises an unmodified sugar moiety such as ribose or deoxyribose or a modified sugar moiety or sugar analog, including a morpholino ring. Non-limiting examples of modified sugar moieties include 2’ substitutions such as 2’-O-methyl (2'-O-Me), 2’-O-methoxyethyl (2’MOE), 2’-O-aminoethyl,Attorney Docket No. 42256-634.6012’F; N3’->P5’ phosphoramidate, 2’dimethylaminooxyethoxy, 2’dimethylaminoethoxyethoxy, 2’-guanidinidium, 2’-0-guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars. In some embodiments, the sugar moiety modification is an extra bridge bond, such as in a locked nucleic acid (LNA). In some embodiments the sugar analog contains a morpholino ring, such as phosphorodiamidate morpholino (PMO). In some embodiments, the sugar moiety comprises a ribofuransyl or 2’deoxyribofuransyl modification. In some embodiments, the sugar moiety comprises 2’ 4’ -constrained 2’0-methyloxyethyl (cMOE) modifications. In some embodiments, the sugar moiety comprises cEt 2’, 4’ constrained 2’-0 ethyl BNA modifications. In some embodiments, the sugar moiety comprises tricycloDNA (tcDNA) modifications. In some embodiments, the sugar moiety comprises ethylene nucleic acid (ENA) modifications. In some embodiments, the sugar moiety comprises MCE modifications.

[0099] In some embodiments, the antisense oligonucleotide (AON) comprises an artificial nucleotide analogue. Exemplary artificial nucleotide analogues include 2’-O-methyl, 2’-O-methoxy ethyl (2’-O-MOE), 2’-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-0-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-O- dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2’-fluoro N3-P5’-phosphoramidites, or combinations thereof. In some embodiments, the modified nucleotide analogue is a constrained ethyl (cEt) nucleotide.

[0100] In some embodiments, the antisense oligonucleotide (AON) comprises a number of nucleobases. In some embodiments, the number of nucleobases comprises a range of about 8 to 50, 8 to 40, 8 to 35, 8 to 30, 8 to 25, 8 to 20, 8 to 15, 9 to 50, 9 to 40, 9 to 35, 9 to 30, 9 to 25, 9 to 20, 9 to 15, 10 to 50, 10 to 40, 10 to 35, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 11 to 50, 11 to 40, 11 to 35, 11 to 30, 11 to 25, 11 to 20, 11 to 15, 12 to 50, 12 to 40, 12 to 35, 12 to 30, 12 to 25, 12 to 20, 12 to 15, 13 to 50, 13 to 40, 13 to 35, 13 to 30, 13 to 25, 13 to 20, 14 to 50, 14 to 40, 14 to 35, 14 to 30, 14 to 25, 14 to 20, 15 to 50, 15 to 40, 15 to 35, 15 to 30, 15 to 25, 15 to 20, 20 to 50, 20 to 40, 20 to 35, 20 to 30, 20 to 25, 25 to 50, 25 to 40, 25 to 35, or 25 to 30 nucleobases. In some embodiments, the sequence of the antisense oligonucleotide (AON) is at least or about 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to a target sequence. In some embodiments, the target sequence is a sequence of the one or more LI variant. In some embodiments, the targetAttorney Docket No. 42256-634.601sequence is an RNA sequence. In some embodiments, the target sequence is a DNA sequence.

[0101] In some embodiments, the therapeutic agent inhibits transcription of the LI variant. In some embodiments, the therapeutic agent inhibits a protein in a signal transduction pathway involved in the transcription of LI gene. In some embodiments, the protein is extracellular. Exemplary extracellular proteins include cell membrane receptors including, but not limited to, G protein-coupled receptors, integrin receptors, Notch receptors, cadherin receptors, receptor tyrosine kinase receptors, chemokine receptors, cytokine receptors, death receptors, T-cell receptors, and any combination thereof. In some embodiments, the therapeutic agent targets a signaling molecule that signals through the extracellular proteins. Exemplary signaling molecules include, but are not limited to, hormones, neurotransmitters, cytokines, growth factors, cell adhesion molecules, and vitamins. In some embodiments, the therapeutic agent targets a signaling molecule of an extracellular protein receptor to prevent binding of the signaling molecule and the extracellular protein to subsequently inhibit transcription of the LI variant. In some embodiments, the therapeutic agent mimics a signaling molecule of an extracellular protein receptor to inhibit signaling and subsequent transcription of the LI variant. In some embodiments, the therapeutic agent inhibits transcription of the LI variant by inhibiting an intracellular protein involved in transcription of LI gene. In some embodiments, the protein is cytosolic. In some embodiments, the protein is nuclear. In some embodiments, the protein modulates transcription of LI gene. In some embodiments, the protein is a transcription factor, coactivator, corepressor, chromatin modifying enzyme, histone acetyltransferase, histone deacetylase, kinase, or methylase that modulates transcription of LI gene. Exemplary signal transduction pathways involved in transcription of LI include, but are not limited to, JAK / STAT signaling pathway.

[0102] In some embodiments, the therapeutic agent edits a nucleic acid of one or more LI variants, in some embodiments, the therapeutic agent edits DNA. In some embodiments, the therapeutic agent edits RNA. An exemplary system for nucleic acid editing comprises Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and a CRISPR-associated (Cas) protein. When expressed or transferred into cells alongside a guide RNA (gRNA), a Cas protein allows for the targeted introduction or deletion of genetic information via a complex with CRISPR sequence of mRNA. Generally, the gRNA comprises a target sequence region, a protospacer-adjacent motif (PAM) region, and a hairpin region. In a CRISPR / Cas process, a gRNA shepherds the Cas enzyme to a specific stretch of nucleic acid. In some embodiments, the gRNA is a single stranded guide RNA (sgRNA). In someAttorney Docket No. 42256-634.601embodiments, the gRNA is a dual stranded guide RNA (dgRNA). Cas then cleaves the nucleic acid to disable or repair a gene. In some embodiments, the nucleic acid is DNA. In some embodiments, the nucleic acid is RNA.in some embodiments, the CRISPR / Cas system targets DNA of the one or more LI variants. In some embodiments, CRISPR / Cas system targets RNA of the one or more LI variants. In some embodiments, the one or more LI variants comprise a portion or all of an exon of LI gene. In some embodiments, a nuclease for use in the CRISPR / Cas system is from a species of, but not limited to, Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Camobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Desulfurococcus, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium, Natronobacterium, Flavobacterium, Saccharomyces, Chlamydomonas, Thermus, Pyrococcus, Mycoplasma, or Acidaminococcus. Exemplary Cas proteins include, but are not limited to, Cpfl, C2cl, C2c2, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (Csnl or Csxl2), CaslO, Casl3, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologues thereof, and modified versions thereof. In some embodiments, the Cas protein targets DNA. In some embodiments, the Cas protein targets RNA. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas protein is Casl3. Cas proteins include, but are not limited to, wild-type Cas and derivatives, chimeras, or mutants thereof.

[0103] In some embodiments, the therapeutic agent modulates generation of one or more LI variants as a result of strand breaks. In some embodiments, the therapeutic agent modulates generation of one or more LI variants as a result of single stranded breaks. In some embodiments, the therapeutic agent modulates generation of one or more LI variants as a result of double stranded breaks (DSBs). In some embodiments, the therapeutic agent inhibits formation of DSBs. In some embodiments, the therapeutic agent inhibits formation of DSBs by inhibiting the cause of DSBs including, but not limited to, V(D)J recombination, class switch recombination, meiosis, ionizing radiation, oxidative free radicals, replication across a nick, and inadvertent enzyme actions. In some embodiments, alteration in a DNA repair pathway results in an inability or reduced ability to repair DSBs. In some embodiments,Attorney Docket No. 42256-634.601therapeutic agent for treating a disease or disorder can be characterized by unwanted accumulation of amyloid beta protein modulate a DNA repair pathway. Exemplary DNA repair pathways include, but are not limited to, non-homologous end joining (NHEJ), microhomology -mediated end joining (MMEJ), homologous recombination, mismatch repair, nucleotide excision repair, or DNA strand cross-link repair. In some embodiments, therapeutic agent for treating a disease or disorder can be characterized by unwanted accumulation of amyloid beta protein modulate a DNA DSB repair activity. In some embodiments, the therapeutic agent targets a gene involved in a DNA repair pathway. In some embodiments, the therapeutic agent inhibits a protein involved in a DNA repair pathway, wherein the DNA repair pathway is non-homologous end joining (NHEJ). In some embodiments, the therapeutic agent is an inhibitor of a protein involved in NHEJ. Exemplary inhibitors of DNA-PKcs include, but are not limited to, wortmannin, LY294002, NU7026, NU7441, KU-0060648, MSC2490484A, CC-122, and CC-115. Exemplary inhibitors of Ligase IV include, but are not limited to, LI 89 and SCR7. In some embodiments, the therapeutic agent inhibits a protein involved in a DNA repair pathway, wherein the DNA repair pathway is homologous recombination. In some embodiments, the therapeutic agent inhibits CHK1, MRE1, RAD51, or RAD54. In some embodiments, the inhibitor of CHK1 is UCN-01. In some embodiments, the inhibitor of MRE11 is mirin. In some embodiments, the inhibitor of RAD51 is RI-1 or RI-2. In some embodiments, the inhibitor of RAD54 is streptonigrin.

[0104] In some embodiments, the therapeutic agent inhibits a protein involved in one or more DNA repair pathways. For example, the inhibitor inhibits a protein involved in homologous recombination and non-homologous end joining (NHEJ). Exemplary proteins involved in homologous recombination and NHEJ include, but are not limited to, ATM and ATR. In some embodiments, the inhibitor of ATM is KU55933. In some embodiments, the inhibitor of ATR is caffeine, VE-821, or NU6027.

[0105] In some embodiments, the therapeutic agent inhibits a protein involved in a DNA repair pathway, wherein the DNA repair pathway comprises repair of single stranded breaks. In some embodiments, the therapeutic agent inhibits PARPL Exemplary PARP1 inhibitors include, but are not limited to, Olaparib (AZD2281), Iniparib (BSI 201), Rucaparib (AG014699), Velparib (ABT-888), Talazoparib (BMN-673), CEP 9722, MK 4827, BMN-673, NU1025, E7016, BGB-290, and 3 -aminobenzamide.

[0106] In other embodiments, the therapeutic agent does not directly target the LI variant and the increase of the enzymatic activity thereof. In some embodiments, the therapeuticAttorney Docket No. 42256-634.601agent is an N-methyl-D-aspartate (NMD A) receptor antagonist, or an anti -amyloid beta antibody. In some embodiments, the cholinesterase inhibitor is selected from the group consisting of Donepezil, Galantamine, and Rivastigmine. In some embodiments, the NMDA receptor antagonist is memantine. In some embodiments, the anti -amyloid beta antibody is selected from the group consisting of Bapineuzumab, Solanezumab, Gantenerumab, Crenezumab, BAN2401, Ponezumab, and Aducanumab. In some embodiments, the N-methyl-D-aspartate (NMDA) receptor antagonist, or an anti-amyloid beta antibody is administered in conjunction with a therapeutic agent that targets one or more LI variants. In some embodiments, the cholinesterase inhibitor is administered in conjunction with a therapeutic agent that targets one or more LI variants.Kits

[0107] Described herein is a kit for identifying one or more LI variants. In some embodiments, the kit is provided for detecting a portion or all of the LI variant. In some embodiments, the kit comprises nucleic acid or polypeptide isolation reagents. In some embodiments, the kit comprises one or more probes for hybridization or amplification of a target nucleic acid encoding LI variant associated with the change in the enzymatic activity. In some embodiments, kits include one or more probes for control genes, such as housekeeping genes. In some embodiments, the probes for control genes are used, for example, in ACt calculations. In some embodiments, the probes are labeled with an enzyme, a radioactive isotope, or a fluorescent label. In some embodiments, the probes are labeled using an affinity tag. Exemplary affinity tags include, but are not limited to, biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof. In some embodiments, the affinity tag is recognized by avidin, streptavidin, nickel, or glutathione. In some embodiments, the kit comprises a detecting reagent that binds to the one or more probe(s). In some embodiments, the detecting reagent comprises a radioactive isotope or a fluorescent label. In some embodiments, the kit comprises a therapeutic agent described herein.

[0108] In some embodiments, kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) including one of the separate elements to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In other embodiments, the containers are formed from a variety of materials such as glass or plastic.Attorney Docket No. 42256-634.601

[0109] In some embodiments, kits comprise one or more additional containers, each with one or more of various materials (such as reagents, optionally in concentrated form, and / or devices) desirable from a commercial and user standpoint for use of described herein. Nonlimiting examples of such materials include, but not limited to, buffers, primers, enzymes, diluents, filters, carrier, package, container, vial and / or tube labels listing contents and / or instructions for use and package inserts with instructions for use. A set of instructions is optionally included. In some embodiments, a label is on or associated with the container. In some embodiments, a label is on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert. In some embodiments, a label is used to indicate that the contents are to be used for a specific therapeutic application. In some embodiments, a label also indicates directions for use of the contents, such as in the methods described herein.

[0110] Use of absolute or sequential terms, for example, “will,” “will not,” “shall,” “shall not,” “must,” “must not,” “first,” “initially,” “next,” “subsequently,” “before,” “after,” “lastly,” and “finally,” are not meant to limit scope of the present embodiments disclosed herein but as exemplary.

[0111] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”

[0112] As used herein, the phrases “at least one”, “one or more”, and “and / or” are open-ended expressions that are both conjunctive and disjunctive in operation. For example, each of the expressions “at least one of A, B and C”, “at least one of A, B, or C”, “one or more of A, B, and C”, “one or more of A, B, or C” and “A, B, and / or C” means A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B and C together.

[0113] As used herein, “or” may refer to “and”, “or,” or “and / or” and may be used both exclusively and inclusively. For example, the term “A or B” may refer to “A or B”, “A but not B”, “B but not A”, and “A and B”. In some cases, context may dictate a particular meaning.

[0114] Any systems, methods, software, and platforms described herein are modular.Accordingly, terms such as “first” and “second” do not necessarily imply priority, order of importance, or order of acts.Attorney Docket No. 42256-634.601

[0115] The term “about” when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and the number or numerical range may vary from, for example, from 1% to 15% of the stated number or numerical range. In examples, the term “about” refers to ±10% of a stated number or value.

[0116] The terms “increased”, “increasing”, or “increase” are used herein to generally mean an increase by a statically significant amount. In some aspects, the terms “increased,” or “increase,” mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, standard, or control. Other examples of “increase” include an increase of at least 2-fold, at least 5 -fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 1000-fold or more as compared to a reference level.

[0117] The terms “decreased”, “decreasing”, or “decrease” are used herein generally to mean a decrease by a statistically significant amount. In some aspects, “decreased” or “decrease” means a reduction by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g., absent level or non-detectable level as compared to a reference level), or any decrease between 10-100% as compared to a reference level. In the context of a marker or symptom, by these terms is meant a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given disease.

[0118] The term “genomic cDNA” or “gencDNA” as used herein refers to a genomic variant lacking introns. In some embodiments, the gencDNA comprises intraexonic junctions between exons. In some embodiments, the gencDNA comprises inverted exons. In some embodiments, the gencDNA is generated by reverse transcription of a non-classical RNA variant. In some embodiments, the gencDNA is incorporated into genomic DNA.

[0119] The term “single nucleotide variant (SNV)” as used herein refers to a nucleotide sequence variation that occurs when a single nucleotide in a DNA or RNA sequence is altered. Single nucleotide variants may be rare or common in a population. Sometimes singleAttorney Docket No. 42256-634.601nucleotide variants are referred to as single nucleotide polymorphisms if they are present in at least 1% of the population.

[0120] The term “single amino acid variant (SAV)” as used herein refers to single-base changes that lead to a change in the amino acid sequence of the encoded protein, termed a single amino acid variant (SAV) or missense variant. SAVs can also be caused by multiple nucleotide substitutions. The amino acid change can potentially influence the entire protein structure or function, as well as its binding affinity.

[0121] The term “RNAi” as used herein refers to an RNA molecule that induces RNA interference (RNAi). In some embodiments, the RNAi molecule is a dsRNA molecule that will generate a siRNA molecule or miRNA molecule following contact with Dicer (i.e., an RNAi molecule precursor). In some embodiments, the RNAi molecule is a siRNA duplex, a siRNA sense molecule, a siRNA antisense molecule, a miRNA duplex, a miRNA sense molecule, a miRNA antisense molecule, and analogues thereof.

[0122] The term “antisense oligonucleotides (AONs)" used herein refers to short, synthetic, single-stranded oligonucleotides that can alter RNA and reduce, restore, or modify protein expression through several distinct mechanisms.

[0123] The terms “binding fragment,” “antibody fragment,” or “antigen binding fragment” are used herein, for purposes of the specification and claims, to mean a portion or fragment of an intact antibody molecule, preferably wherein the fragment retains antigen-binding function. Examples of antibody fragments include Fab, Fab', F(ab')2, Fd, Fd’ and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, single-chain binding polypeptides, scFv, bivalent scFv, tetravalent scFv, and bispecific or multispecific antibodies formed from antibody fragments.

[0124] “Fab” fragments are typically produced by papain digestion of antibodies resulting in the production of two identical antigen-binding fragments, each with a single antigen-binding site and a residual “Fc” fragment. Pepsin treatment yields a F(ab')2 fragment that has two antigen-combining sites capable of cross-linking antigen. An “Fv” is the minimum antibody fragment that contains a complete antigen recognition and binding site. In a two-chain Fv species, this region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. In a single-chain Fv (scFv) species, one heavy- and one lightchain variable domain are covalently linked by a flexible peptide linker such that the light and heavy chains associate in a “dimeric” structure analogous to that in a two-chain Fv species. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH — VL dimer. Collectively, the sixAttorney Docket No. 42256-634.601CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although usually at a lower affinity than the entire binding site.

[0125] The Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain. Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxy terminus of the heavy-chain CHI domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments that have hinge cysteines between them. Other chemical couplings of antibody fragments are also suitable.

[0126] The term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, / .< ., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that are present in minor amounts. In some embodiments, monoclonal antibodies are made, for example, by the hybridoma method. In some embodiments, monoclonal antibodies are isolated from phage antibody libraries.

[0127] The antibodies herein include monoclonal, polyclonal, recombinant, chimeric, humanized, bi-specific, grafted, human, and fragments thereof including antibodies altered by any means to be less immunogenic in humans. Thus, for example, the monoclonal antibodies and fragments herein include “chimeric” antibodies and “humanized” antibodies. In general, chimeric antibodies include a portion of the heavy and / or light chain that is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, so long as they exhibit the desired biological activity. For example, a chimeric antibody contains variable regions derived from a mouse and constant regions derived from human in which the constant region contains sequences homologous to both human IgG2 and human IgG4. “Humanized” forms of nonhuman (e.g., murine) antibodies or fragments are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab’, F(ab’)2 or other antigenbinding subsequences of antibodies) which contain minimal sequence derived from nonhuman immunoglobulin. Humanized antibodies include grafted antibodies or CDR grafted antibodies wherein part or all of the amino acid sequence of one or more complementarity determining regions (CDRs) derived from a non-human animal antibody is grafted to anAttorney Docket No. 42256-634.601appropriate position of a human antibody while maintaining the desired binding specificity and / or affinity of the original non-human antibody. In some embodiments, corresponding non-human residues replace Fv framework residues of the human immunoglobulin. In some embodiments, humanized antibodies comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In some embodiments, the humanized antibody comprises substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The term “intracellular antibody” refers to the targeted intracellular delivery of antibodies, their fragments, or antibody -like molecules.

[0128] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the invention be limited by the specific examples provided within the specification. While the invention has been described with reference to the aforementioned specification, the descriptions and illustrations of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. Furthermore, it shall be understood that all aspects of the invention are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is therefore contemplated that the invention shall also cover any such alternatives, modifications, variations, or equivalents. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.EXAMPLES

[0129] The following examples are given for the purpose of illustrating various embodiments of the disclosure and are not meant to limit the present disclosure in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the disclosure. Changes therein and other uses which are encompassed withinAttorney Docket No. 42256-634.601the spirit of the disclosure as defined by the scope of the claims will occur to those skilled in the art.Example 1. LI ORF2 and ORF1 RNA are discordantly expressed in human cortical neurons

[0130] In situ hybridization of frozen human cortical tissue sections (n=31, AD and ND prefrontal cortex and medial temporal gyrus, ages 46-94) utilized custom-designed RNAscope probes against the functional domains of LI ORF1 (RNA binding domain) and ORF2 (RT domain) (FIG. 1A and Table 2). A third probe for neuron-specific MAP2 identified neuronal vs. non-neuronal (MAP2-) cells (FIG. IB). Expression of both ORF1 and ORF2 were assessed qualitatively and then further quantified across tissue sections by fluorescence intensity to determine the H-score (FIG. IB and FIG. 1C). LI ORF1 and ORF2 probe signals were significantly increased in neuronal nuclei (MAP2+, nuclei denoted by DAPI), a result that was corroborated by increased signal in grey vs. white matter (FIG. IB, FIG. ID, FIG. IE, and FIG. 6A). Individual neurons showed statistically significant discordance in ORF2 / ORF1 expression compared to non-neurons, with higher ratios of ORF2 / ORF1 and spatially non-overlapping signals, a result that was maintained when reversing fluorophores (FIG. IF, FIG. 6B and FIG. 6C). Specific signals were absent following RNase treatment (FIG. 6D). Furthermore, cytoplasmic ORF1, but not ORF2, was detected across samples (FIG. IB). Neuronal ORF2 expression was slightly decreased in the AD medial temporal gyrus (MTG) compared to ND MTG (FIG. 6E-6G). While targeted against the functional domains of ORF1 and ORF2, RNAscope probes detect both coding and non-coding variants, requiring the use of additional technologies to identify the diversity and prevalence of coding bicistronic and monocistronic ORF1 and ORF2.Table 2. Human post-mortem brain tissue samplesID Brain Bank Sex PMI Braak Age at PFC PFC MT (hours) score death TG RIN G (years) RINAD I Emory F 4.5 N / A 64 X X 8.1 7.4AD 2 Southwest F 12 6 65 X 6.7DementiaAtorney Docket No. 42256-634.601ID Brain Bank Sex PMI Braak Age at PFC PFC MT (hours) score death TG RIN G (years) RINADJ UCSD F 12 6 88 X 7.9AD 4 Wash. Uni. F 2.3 4 93 X 9AD 5 Emory F 4 4 94 X 6.7ADJ Emory M 4 N / A 55 X X 6.1 7.5ADJ Emory M 8 N / A 59 X 6.4ADJ Emory M 4 N / A 61 X 6.6ADJ Sepulveda M 7.5 N / A 65 X 7.6AD 10 UCSD M 6 6 66 X 6.9AD ll Emory M 6 6 71 X 6.5AD 12 Emory M 6.5 N / A 90 X 8.1AD 13 Emory M 4 4 93 X 6.8ND_1 Emory F 6.5 N / A 46 X 8ND_2 NeuroBioBank F 14.6 N / A 56 X 6.5ND 3 Emory F 6 2 61 X X 8.1 7.8ND_4 Emory F 3 N / A 74 X X 7.7 7.4ND 5 Dalhousie F 5.5 N / A 80 X 7.1ND_6 Southwest F 13.5 3 85 X 6.7DementiaND_7 Emory M 10 N / A 57 X X 7 7.2ND_8 Emory M 6 N / A 59 X 6.6Attorney Docket No. 42256-634.601ID Brain Bank Sex PMI Braak Age at PFC PFC MT (hours) score death TG RIN G (years) RINND_9 Emory M 6 N / A 69 X 6.5ND_10 NeuroBioBank M 11 N / A 76 X 7ND-ll UCSD M Unkno N / A 83 X 7wnND_12 Emory M 5.5 2 94 X X 7.6 6.8AD - Alzheimer's disease; F - female; M - male; MTG - medial temporal gyrus; N / A - not available; ND - non-diseased; PFC - prefrontal cortex; PMI - post-mortem interval; RIN - RNA integrity numberExample 2. Diverse monocistronic ORF2 and ORF1 are expressed in the near absence of full length LI

[0131] RNA for sequencing was isolated from adjacent tissue sections of the same 31 AD and ND human post-mortem prefrontal cortex (PFC) and MTG samples utilized in the RNAscope experiments. PolyA+ cDNA libraries were synthesized for PacBio long-read sequencing, which can generate long-read DNA sequences of up to tens of kilobases in length, allowing resolution of complex genomic regions and identification of structural variants. Mapping of the publicly available PacBio AD bulk Iso-Seq dataset against an LI consensus sequence revealed that LI sequences comprise -2.56% of the transcriptome. To obtain greater long-read sequencing depth, custom Twist Bioscience LI pulldown probes were used, resulting in a -10-fold enrichment of LI positive reads.

[0132] Truncated LI transcripts lacking coding potential

[0133] Alignment of sequences against an LI consensus sequence identified on-target, Ll-containing PacBio HiFi reads (FIG. 2A) with a mean read length of 3541bp (FIG. 2C). Full-length bicistronic LI transcripts are -6 kilobases(kb). However, on average only -0.77% of LI -containing reads were >6 kb, which was nonetheless consistent with virtually undetectable full-length LI in the human brain, as determined by Northern blot. Most LI transcripts were 5’ truncated. To assess possible preparative fragmentation as a source of the truncations, off-target reads were assessed for annotation as incomplete-splice matches viaAttorney Docket No. 42256-634.601SQANTI3. Minimal fragmentation was identified, indicating that truncated LI reads originated from expression of genuine truncated sequences rather than preparative artefact (FIG. 2D) Moreover, LI reads had significant sense strand enrichment, supporting active LI transcription (74.55% of reads; ****p-value<0.0001, paired t-test; FIG. 7A). An average of 45.28% of LI reads included a 5’UTR, which contains both the internal RNA polymerase II promoter and important regulatory sites for LI repression, such as a YY1 binding site (FIG. 7B). The YY1 binding region is involved in the methylation and regulation of LI, with sequences missing YY1 binding motifs more likely to be expressed via repression evasion. On average, 19.38% of LI sequences contained an intact YY1 binding region (FIG. 7B), consistent with active LI expression and LI repression evasion.

[0134] Intergenic LI transcripts predominate

[0135] Using the bioinformatics tool Censor, coding and non-coding LI transcripts were assessed as either intragenic (arising via read-through transcription) or intergenic (expressed off the 5’UTR internal promoter). On average, 44.2% of reads showed flanking sites aligning to the human genome, indicating that they were intragenic and likely co-expressed with another gene. The remainder were likely expressed from their own promoter (FIG. 7C).

[0136] Abundance of young Lis in the LI transcriptome

[0137] Quantification of LI subfamilies via Censor revealed that a majority of individual LI reads were, unexpectedly, annotated for multiple LI subfamilies, with an average of 1.86 subfamily annotations per read. LIPA was most common (39.22%), principally composed of L1HS, the youngest and most active LI subfamily (FIG. 7D and FIG. 7E). Other reads were annotated as either uncategorical LI or belonging to other evolutionarily older subfamilies (FIG. 7D)

[0138] Protein coding potential of truncated LI RNA sequences

[0139] Open reading frames were identified in LI -containing sequences and aligned to the consensus ORFlp and ORF2p amino acid sequences [Uniprot Q9UN81; 000370] to assess the diversity of fully and partially intact ORFlp and ORF2p open reading frames (FIG. 2B), including bicistronic intact LI vs. monocistronic transcripts containing either intact ORF1 or ORF2. A majority of brain samples lacked any full-length bicistronic sequences encoding both ORFlp and ORF2p, and >80% of the total LI transcriptome was non-coding (FIG. 2E).Full-length bicistronic LI coding sequences accounted for <0.01% of all LI transcripts (median 0.0005%) (FIG. 2E and FIG. 7F), with variants identified in -38.7% of brain samples. In contrast, monocistronic transcripts encoding either full-length ORFlp or ORF2p were detected in all brain samples, with intact ORF1 representing -6.3% of transcripts, andAttorney Docket No. 42256-634.601intact 0RF2 representing -0.03% of transcripts (FIG. 2E). A vast majority of coding ORF2 open reading frames were truncated with intact RT domains and / or intact endonuclease domain (-0.4% and -13%, respectively) (FIG. 2E). Monoci stronic, intact ORF1 and ORF2 transcripts have been identified in the LI transcriptome via Northern blot and 5 ’RACE (5’ Rapid Amplification of cDNA Ends) short-read sequencing. Previously, equivalent percentages were reported (-0.12% each) for bicistronic intact LI, monocistronic intact ORF1, and monocistronic intact ORF2 via short read sequencing. Long-read sequencing, without reliance on mapping back to the reference genome, reveals that expression of bicistronic, protein-encoding LI is far less prevalent than monocistronic ORF1 and ORF2.

[0140] High interindividual variability of LI coding mRNA

[0141] Many ORF1 and ORF2 variants were expressed within each brain sample, ranging from rare bicistronic transcripts to prevalent monocistronic transcripts, however their actual identity was most often unique to a given sample. Full-length, bicistronic ORF1 and ORF2 variants (n=16) were identified, with 87.5% detected in single samples (FIG. 2F and FIG.7G). Intact ORF2 variants (n=48) were identified, with 83.3% of those variants detected in single samples (FIG. 2F and FIG. 7H). More prevalent, partial ORF2 variants containing an intact RT domain (n=554) were identified, with 73.5% detected in single samples (FIG. 2F and FIG. 71). LI enrichment was analyzed in PacBio long-read RNA sequencing across Alzheimer’s disease (AD), non-diseased (ND), prefrontal cortex (PFC), and medial temporal gyrus (MTG) samples. The results showed that no significant differences in LI enrichment between the groups. Additionally, the percentage of LI reads classified as a bicistronic, full-length ORF1 and ORF2, monocistronic intact ORF1, monocistronic intact ORF2, partial ORF2 (intact EN + RT domain), or partial ORF2 (intact EN domain) was examined for AD, ND, PFC, and MTG samples (FIGs. 7J-7P). These results revealed similarities in LI transcriptome between AD and ND in a limited cohort.

[0142] The high percentage of variants only seen in single samples is consistent with SGM, which varies amongst brain cells and brain regions, and somatic LI variability as reported in human lymphoblastoid cell lines. These data suggest that discordance of ORF1 and ORF2 results from monocistronic expression. Short-read sequencing may misidentify monocistronic ORF1 and ORF2 reads as arising from full-length bicistronic LI transcripts, highlighting the advantages of long-read sequencing technologies.Attorney Docket No. 42256-634.601Example 3. ORF2 variants show sequence diversity not present in reference genomes

[0143] Over 91% of unique ORF2-encoding mRNA variants from the neural transcriptome were absent from the human reference genomes, hg38 and T2T. Few variants were exact matches and fewer still (~1%) mapped to both reference genomes (Table 3). The reference genome contains examples of monocistronic ORF1 and ORF2, as well as partial proteincoding ORF2 sequences, suggesting a possible genomic source for the observed monocistronic brain transcripts. However, more monocistronic partial ORF2 coding variants (n=554) were identified within the neural transcriptome than would have been expected based on the reference genome (n=173, hg38). Myriad SNVs were identified across the ORF2 coding variants, with many producing SAVs, including within the RT and EN domains. Of note, several SAVs were conserved in most variants while differing from the reference sequence.Table 3. Variant alignment to human reference genome hg38 and T2TCategory hg38 T2 hg38 & incompletely Total T T2T aligned varian variants ts Full-length bicistronic ORF1 and 0 2 0 14 16 ORF 2Monocistronic intact ORF2 3 1 1 45 48 Partial ORF2 (EN and RT) 24 31 5 504 554Coding variant transcripts aligned to hg38 and T2T - mapping 100%Example 4. Endogenous RT activity in the human brain is associated with LI ORF2 expression

[0144] To examine the relationship between ORF2 transcriptomic expression and endogenous RT activity, cerebral cortical protein lysates from tissue sections adjacent to those analyzed by spatial transcriptomics were examined using the fluorescence product-enhanced RT (FPERT) assay (FIG. 3A, 31 brain samples). A vast majority of samples had detectable endogenous RT activity, regardless of brain region or disease state (FIG. 3B). To assess endogenous RT activity in regions of high neuronal vs. high non-neuronal composition, cortical tissue sections were microdissected for grey matter (estimated at 1.5:1 neurons:glia) vs. white matter (estimated at 1:10 neurons:glia) (n=3) and lysates examined for RT activity. Overall, RT activity was higher in grey compared to white matter in each sample examined, correlating with the increased expression of ORF2 in neurons (FIG. IE and FIG.3C). RT activity showed a statistically significant correlation with neuronal (MAP2+) ORF2Attorney Docket No. 42256-634.601H-score, but not ORF1 H-score (FIG. 3D and FIG. 3E), consistent with a major RT activity contribution from neuronal monocistronic ORF2. RT activity in post-mortem human brain samples relative to ORF1 H-score or ORF2 H-score in MAP2- nuclei was analyzed. A correlation was observed between RT activity and (MAP2-) ORF2, but not (MAP2-) ORF1 (FIGs. 8A-8B). Additionally, RT activity was analyzed relative to the percentage of LI reads containing bicistronic, full-length ORF1 and ORF2 transcripts, monocistronic intact ORF2 transcripts, or a partial ORF2 transcript (intact EN + RT domain). These results showed that partial ORF2 transcripts are more prevalent for RT activity than full-length ORF1 and ORF2 transcripts, or monocistronic intact ORF2 transcripts. (FIGs. 8C-8E)Example 5. ORF2 transcriptomic variants can produce variable RT and EN activities

[0145] To access ORF2 variant functionality through RT and EN activities, twelve variants representative of monocistronic intact and partial ORF2 sequences were selected (intact ORF2p - 7 sequences; truncated ORF2p with intact RT and EN domain - 5 sequences; FIG.4A, FIG. 9, and Table 4). These variants were identified in both ND and AD brains including PFC and MTG (FIG. 9). Constructs encoding the 12 ORF2 variants were commercially synthesized and sequence validated, then transiently transfected as CMV-promoter expression constructs into LN229 (a human glioblastoma-derived cell line with low basal levels of endogenous RT activity), controlled for transfection efficiency by concurrent EGFP transfection. Samples were then assayed for RT activity by the FPERT assay with duplicate samples analyzed for EN activity by y-H2AX labeling in formaldehyde-fixed cell cultures.Table 4. Exemplary LI variants with varied RT and EN activities.SEQ ID Name DescriptionNO:4 LI ORF2 consensus Labeled as LI ORF2 con in FIG. 95 L1RP ORF2 Labeled as L1RP ORF2 in FIG. 96 Variant #1 Labeled as 1 in FIG. 97 Variant #2 Labeled as 2 in FIG. 98 Variant #3 Labeled as 3 in FIG. 99 Variant #4 Labeled as 4 in FIG. 910 Variant #5 Labeled as 5 in FIG. 911 Variant #6 Labeled as 6 in FIG. 912 Variant #7 Labeled as 7 in FIG. 913 Variant #8 Labeled as 8 in FIG. 914 Variant #9 Labeled as 9 in FIG. 915 Variant #10 Labeled as 10 in FIG. 916 Variant #11 Labeled as 11 in FIG. 917 Variant #12 Labeled as 12 in FIG. 9Attorney Docket No. 42256-634.601

[0146] Seven of the 12 variants showed statistically significant RT activity above baseline, with a dynamic range of ~50X over control (FIG. 4B; One-way ANOVA, EGFP control vs. variant Cq). Truncated ORF2s also showed RT activity, although at lower levels than those of intact ORF2s (FIG. 4B). However, some ORF2 variants, including full-length variants, lacked functional RT activity, despite the presence of an intact coding RT domain. EN activity was assessed by employing y-H2AX immunolabelling that is a robust marker of DSBs in cells and tissues. All 12 ORF2 variants showed increased y-H2AX signals vs. the EGFP transfection control, with labelling that varied ~1.3-fold across the samples (FIG. 4C and FIG. 4D). Interestingly, y-H2AX labelling was greatest in a partial variant that lacked RT activity (#8) (FIG. 4E), suggesting roles for the many partial ORF2 variants with intact EN domains in generating DSBs in the brain, independent of RT activity. A non-linear relationship between EN and RT activities was observed, with the highest DSB burden caused by a variant with low levels of RT activity (#8), yet another variant demonstrated relatively high EN and RT activities (#7) (FIG. 4E). Notably, the similar range of EN activity (-1.3X) sharply contrasted with that of RT activity (~50X) in the same cell line populations, thus controlling for artifactual explanations of the marked RT activity in view of relatively stable and concomitant EN activity and supporting the functional relevance of variable RT activity associated with monocistronic ORF2 variants.

[0147] Recent structural analyses of ORF2p identified several essential amino acid residues required for recognition of the poly(A) tracts. Mutations of these residues decrease target-primed reverse transcription (TPRT) but not EN or RT activities. Of the eight amino acids that make hydrogen bonds with the poly(A) tract, six were conserved across all monocistronic ORF2 variants, with mutations for two others being present in a minority of variants (1.69% and 18.64%). As such, a majority of the ORF2 intact monocistronic variants are predicted to be capable of TPRT. By comparison, partial ORF2 variants had substantially more heterogeneity in these regions, with SAVs and truncations leading to substitutions or complete loss of these amino acids. The 12 variants in the functional assay contained a range of SAVs produced by SNVs across functional domains (FIG. 5). Full-length ORF2 variants produced significantly more RT activity than partial variants. However, RT activity was still produced by even the most truncated predicted protein (#9) that contained numerous SAVs, indicating that loss of poly(A) tract binding does not necessarily eliminate RT activity.Further functional analyses of the hundreds of unassayed variants should be instructive in future studies.Atorney Docket No. 42256-634.601Example 6. Methods for analysis of LINE-1 RNA variants

[0148] Human post-mortem brain tissues

[0149] Frozen human brain tissue samples from Brodmann area (BA) 8 / 9 (prefrontal cortex - PFC) and BA 21 (medial temporal gyrus - MTG) were obtained from multiple brain banks and stored at -80°C. Brain bank tissues sources included: Dalhousie, Emory University, Neurobiobank (Sepulveda), Southwest Dementia Brain Bank, University of California San Diego ADRC, and Washington University. Samples were sectioned in a -20°C cryostat with serial sections taken: six 10pm sections for RNAscope, three 100 pm sections for RT activity analysis and PacBio Iso-Seq, and one 20pm section for RNA integrity number (RIN) measurement. Age, sex, postmortem interval (PMI), and RNA integrity number (RIN) matched samples were selected from ND and AD donors from prefrontal (n=8;8) and temporal cortices (n=8;7) (Table 2; FIG. 6H-6J).

[0150] Cell culture

[0151] LN229s were originally purchased from ATCC. Cells were maintained in Dulbecco’s modified Eagle’s medium (Invitrogen) containing 5% fetal bovine serum (Invitrogen) and lOOU / ml Penicillin-Streptomycin (Gibco) at 37°C under 5% CO2. Cell line authenticity was confirmed via short tandem repeat (STR) profiling and cells were confirmed mycoplasma free via InvivoGen MycoStrip Mycoplasma detection kit.

[0152] RNA in situ hybridization - ACD RNAscope

[0153] To detect single mRNA molecules, RNAscope was performed on fresh-frozen ND and AD PFC and MTG sections. 10pm sections were cut from frozen biopsies, mounted on Superfrost Gold PLUS slides, dried for 1 hour at -20 °C, and stored at -80 °C. In this study, one 3-plex negative control probe (DapB; ACD, Cat. # 320871) and 3 different probes against genes of interest were used. Each set of experiments included a negative control slide in order to check probe signal versus background. In situ hybridization (ISH) was performed according to the manufacturer's protocol for RNAscope Multiplex Fluorescent Reagent Kit v2 (ACD, Cat. # 320293) with minor modifications.

[0154] Briefly, dried slides from frozen brains were incubated in cold 4% PFA for 15 min. Slides were then dehydrated in 50%, 70%, and 100% (2x) ethanol for 5 min each at RT. After drying the slides for 5 min at RT, hydrophobic barriers were added to reduce reagent use and allowed to dry. H2O2 was added for 10 min at RT and then washed 2x with lx PBS at RT. For antigen accessibility, slides were treated with Protease IV for 10 min at RT. C3 and C2 probes were diluted in Cl probes at a 1:1:50 ratio and incubated on the slides for 2hrs at 40 °C. Signal was amplified according to protocol. Cl probes were detected with Opal 520Attorney Docket No. 42256-634.601(Akoya, FP1487001KT), C2 probes with Opal 570 (Akoya, FP1488001KT), and C3 probes with Opal 650 (Akoya, FP1496001KT). Before mounting the slices, DAPI was added to label the nuclei. Coverslips were then mounted with Prolong Gold Antifade Mountant (Invitrogen, P36930) and allowed to dry at RT overnight. Slides stored at 4°C and imaged within 2 weeks of processing. RNAscope Probes (Gene; zz-probe #; Target region (bp); Cat #): MAP2; 20; 3996-5120;415721-C3. LI-ORF1; 18; 4-1014; Custom. L1-ORF2; 20; 1194-2208; Custom.

[0155] RNA extraction

[0156] Total cellular RNA was isolated from 100pm sections of human postmortem brain tissue using the RNeasy Mini Kit (Qiagen, Valencia, CA), and subjected to RNase-free DNase treatment (Qiagen, Valencia, CA) for 15 minutes at room temperature. RNA quality was assessed during initial sample selection using 20pm sections on an Agilent 4200 TapeStation, with only samples with a RIN >6 utilized to control for tissue integrity.

[0157] Library preparation for long-read sequencing

[0158] cDNA from RNA was prepared using NEBNext® Single Cell / Low Input RNA Library Prep Kit for Illumina® (E6421), which utilizes poly-DT primed cDNA synthesis to enrich poly-adenylated transcripts. Fragment analysis of cDNA revealed average peak lengths of 2402 bp (mean, Std Dev 297bp), which is in keeping with previously reported average transcript length of human cortical mRNA via PacBio Iso-Seq (2-3kb in length, mean length of 2.46kb) and corresponding to the mean length of mRNA in the human genome. 130-200 ng of total RNA was used for cDNA synthesis followed by 14 cycles of cDNA amplification. Libraries were then enriched for LI using custom designed probes against the 146 full-length Lis in the annotated human genome and the Twist Standard Hyb and Wash Kit v2 (Twist Bioscience, San Francisco, CA, 104446) followed by 24 cycles of postpulldown amplification. Tiling frequency for Twist probes was reduced to ~0.15x to minimize shearing of longer cDNAs. Samples were cleaned up with 1.3X ProNex beads (Promega, Cat#: NG2001). After purification, amplified cDNA went into the SMRTbell library construction according to protocol - “Preparing SMRTbell libraries using PacBio barcoded overhang adapters for multiplexing amplicons” (PacBio, Cat# PN-101-791-700). Primer annealing and polymerase binding was performed using the Sequel II binding kit 2.0 (PacBio, Cat# PN-101789500) and samples were barcoded to allow for sequencing of 4 samples per SMRTcell. Finally, the samples were sequenced on Sequel II using Sequel® II Sequencing Plate 2.0. An average of 2.8 million polymerase reads were obtained per SMRTcell. ~23 million long reads were obtained - sequences were then processed to isolate ~16 million high-quality reads (72.3% of reads).Attorney Docket No. 42256-634.601

[0159] Long-read sequencing quality control

[0160] Long reads obtained from the PacBio Sequel II were used to generate high quality consensus reads using ccs (v6.4.0) and — min-rq 0.9. Barcoded adapters were removed, and proper read orientation was determined using lima (v2.6.0). isoseq3 refine (v3.7) was used to generate full-length non-concatemeric reads.

[0161] Censor identification ofTEs

[0162] Full-length non-concatemeric reads were used as the input to Censor (v4.2.29) using the censor.ncbi script and ncbi-blast (2.2.9) with the provided human reference library of repeats, perlcensor.ncbi SAMPLE flnc.fasta -lib hum.

[0163] Alignment with consensus LI

[0164] Full-length non-concatemeric reads were aligned to the consensus LI sequence using minimap2 (v2.17-r941) using the parameters -ax splice (to allow for large mid-sequence deletions) and — cs=long. Data identified as being LI in this manner were identified as “L1+ sequences”.

[0165] Protein coding variant identification

[0166] L1+ sequences were uploaded to the Galaxy web platform, and the public server at usegalaxy.org was used to analyze the data. Open reading frames within L1+ sequences were identified via GetORF. Identified ORFs were then aligned to consensus ORF Ip and ORF2p sequences from UniProt [Q9UN81; 000370] via BLASTp, allowing L1+ transcripts to be assigned into subcategories: no intact ORFs, ORF1+ORF2, monocistronic ORF1, monocistronic ORF2, partial ORF2 (EN+RT), and partial ORF2 (EN). Variants were called if supported by >3 reads.

[0167] YY1 and 5’UTR analysis

[0168] To investigate whether the expressed elements contained an intact YY1 binding site, the number of L1+ sequences was quantified with an exact match to the YY 1 binding motif (CAAGATGGCCG) via blastn in the Galaxy web platform. A similar approach was taken in identifying the number of 5’UTR containing L1+ sequences.

[0169] Identification of fragmented cDNAs

[0170] Off-target genes were examined to determine the level of fragmentation present in the cDNA libraries. Full-length, non-concatemeric reads were clustered using isoseq3 cluster (v3.7) and mapped to the GRCh38 reference genome using minimap2 (v2.17-r941) -ax splice -uf — secondary=no -C5. Redundant isoforms were collapsed using cDNA Cupcake (v29.0.0) [https: / / github.com / Magdoll / cDNA_Cupcake], The isoforms were classified and filteredAttorney Docket No. 42256-634.601using SQANTI3 [https: / / github.com / ConesaLab / SQANTI3], and the number of reads associated with incomplete-splice match and full-splice match isoforms were extracted.

[0171] Identification of genomic LI variants in hg38

[0172] LI -annotation bed files for the human reference genome (hg38) were downloaded from LlBase2 and Repeatmasker via UCSC and collated to remove redundant annotations. Bam files were uploaded to the Galaxy web platform, and the public server at usegalaxy.org was used to analyze the data. Reads were then extracted via bedtools getfasta, and open reading frames were identified via GetORF.

[0173] Identified ORFs were then aligned to consensus ORF Ip and ORF2p sequences from UniProt [Q9UN81; 000370] via BLASTp, allowing assignment and quantification as bicistronic (Intact ORF1 and ORF2, Intact ORF1 and partial ORF2 - EN + RT, Intact ORF1 and partial ORF2 - EN) and monocistronic (monoci stronic ORF1, monocistronic ORF2, partial ORF2 - EN+RT, and partial ORF2 - EN) LI sequences.

[0174] Aligning LI variants to the reference genome

[0175] Fasta files containing reads supporting full-length bicistronic LI, monocistronic intact ORF2, and partial ORF2 variants were aligned to the GROG 8 and T2T reference genomes using BLAST (blastn; 2.15.0+). 100% identical matches were identified by filtering out reads that didn’t meet the criteria that the entire length of the variant read sequence mapped with no gaps or mismatches.

[0176] Multiple Sequence alignment (MSA)

[0177] Single amino acid variants (SAVs) and single nucleotide variants (SNVs) were identified by aligning identified ORF2 sequences (codon based amino acid sequences or nucleotide sequences) with the ORF2 sequence from the LI consensus via BLAST.Alignments were then uploaded and visualized via the NCBI MSA viewer and annotated to show differences compared to consensus.

[0178] Fluorescence Product-Enhanced RT (FPERT) assay

[0179] FPERT assay was adapted from previously described method, see Ma, YK. Et al. , Evaluation of different RT enzyme standards for quantitation of retroviruses using the singletube fluorescent product-enhanced reverse transcriptase assay. J Virol Methods. 2009 May; 157(2): 133-140. Duplicate human brain tissue sections (100pm) or triplicated cell transfections were homogenized and incubated for 30 minutes on ice in RT lysis buffer (RTLB) containing 25mM Tris, 50mM KC1, 0.25mM EDTA, 50% glycerol, 0.5% TX-100, 5mM DTT, and lx cOmplete, EDTA-free protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO)). Lysates were centrifuged at 21,000 rpm at 4°C for 5 minutes to remove lipidAttorney Docket No. 42256-634.601rich cell debris. Supernatant was then collected and supernatant protein concentration quantified using Bio-Rad Bradford Protein assay (Bio-Rad, #5000001). Protein lysates were diluted to 1 pg / pl and aliquoted to reduce freeze-thaw cycles. FPERT reaction mastermix was created containing lx PCR buffer, 3mM MgC12, 0.26mM dNTPs, 0.6mM DTT, O.lU / pl RNase OUT, 0.085% NP-40, Primer / Probe mix, and annealed PrimerA / MS2 RNA. 1.6pg of protein lysate was added to 53.4ul of the FPERT cocktail and then assayed in quintuplets of lOpl in a 384-well plate by qPCR in a CFX-384. After brief centrifugation of the plate, the reaction was carried out according to the following program: RT reaction: 45 minutes at 37°C, polymerase activation: 5 minutes at 95°C, amplification: 50 cycles of (5 seconds at 95°C; 5 seconds at 60°C; 15 seconds at 72°C). Serial dilutions of Recombinant HIV- 1 RT protein (Abeam #AB63979-1001) at concentrations of 102-107 pU were run in parallel in each assay and values were extrapolated from the obtained Cq values, with 40 cycles as the cut off for background. Heat inactivated lysates (15 minutes at 70 °C) were utilized as background controls and RTLB as no RT, negative controls. MS2 Primer a: GCC TTA GCA GTG CCC TGT T; MS2 Primer b: AAC ATG CTC GAG GGC CTT A; MS2 probe: / 56-FAM / CCC GTG GGA T / ZEN / G CTC CTA CAT GTC AGIABkFQ / .

[0180] Plasmids

[0181] ORF2p Variants (FIG. 9) were synthesized and inserted into pTWIST CMV PURO expression vectors (high copy number) using Twist gene synthesis services (Twist Bioscience, San Francisco, CA). Sequence accuracy was confirmed via NGS. The 12 variant sequences are listed in Table 4.

[0182] Transient cell transfections

[0183] LN229s were seed in 12 well plates for RT activity assessments and 8-well chamber slides for examination of EN activity via y-H2AX. At 70-80% confluency, cells were transiently transfected with Lipofectamine LTX PLUS according to protocol (ThermoFisher, #A12621). A PCXN2.1_EGFP construct was utilized as a control. Cells were collected (plates) or fixed (chamber slides) for downstream analyses 24 hours post-transfection, with transfection efficiency of -75% confirmed in EGFP positive cells via Cell countess.

[0184] Immunocytochemistry (ICC)

[0185] Cells were plated on cell-culture treated slides, transfected 24 hours later and then fixed 48 hours post plating using 10% NBF for 5 minutes at room temperature. Samples were permeabilized with PBS + 0.1% Triton X for 15 minutes then blocked using DAKO Universal Antibody Diluent for 1 hour (Agilent #S302283-2). Slides were incubated with Anti-phospho-Histone H2A.X (Serl39) Antibody, clone JBW301 primary antibodyAttorney Docket No. 42256-634.601(Millipore-Sigma # 05-636-1; 1:250) overnight in DAKO + 0.1% Tween-20. Slides were washed 3x10 minutes with PBS + 0.1% Tween. Alexa Fluor 647 anti-mouse secondary antibodies (ThermoFisher # A-21237; 1 : 10,000) were applied at 1 : 1000 dilutions in DAKO + 0.1% Tween-20 and incubated at room temperature for 1 hour before being washed as previously described. Samples were mounted in VECTAShield hardset antifade mounting medium with DAPI (Vector # H-1500) and imaged on a Keyence BZ-X810 at 20x.

[0186] Image acquisition and pre-processing

[0187] Entire tissue images were acquired to examine global patterns using a Keyence BZ-X810 at lOx. For all imaging experiments, exposure settings were established during the first acquisition, with thresholds based on signal intensity in negative controls, and not modified afterward. Images for single-cell RNA expression analysis were acquired using a Zeiss microscope at 20x objective. For tissue sections, 5 regions from cortical sections were selected at random and z-stacks collected (5; 1.4 pm interval). For quantification of signal intensity, conventional fluorescence was utilized with z-stacks collapsed into the orthogonal projection. Ten images per well (with biological triplicates for each condition) for ICC analysis were acquired using a Keyence BZ-X810 at 20x.

[0188] RNAscope and ICC quantification

[0189] QuPath analysis software was utilized to identify discrete cells based on DAPI nuclear stain (FIG. 6K). For RNAscope in human brain sections, cell types were then identified due to the absence or presence of >3 puncta of the cell-specific markers (MAP2). Median signal intensity for ORF1 and ORF2 was quantified per cell, controlling for nuclear size and probe number. Background signal intensity was quantified per slide and controlled for in order to compare between samples. Changes in probe median fluorescence intensity (MFI) were independent of fluorophore (FIG. 6B). ORF1 and ORF2 expression could not be distinguished as discrete puncta, so MFI was quantified to determine expression level (FIG.6L). MFI was then utilized to determine an H-score for each tissue section, allowing us to take into consideration heterogeneous expression across cells in a tissue (FIG. 1C).

[0190] In functional assays examining yH2AX, nuclei were identified based on DAPI signal and sum signal intensity / area quantified per cell for yH2AX. Cells were quantified across triplicate experiments, with 10 images per experiment. Fold change calculated for each cell based on median signal intensity / area for all cells in EGFP control, normalizing EGFP control to 1 (increased expression >1, decreased expression <1). 8201-13420 nuclei quantified per condition.Attorney Docket No. 42256-634.601

[0191] While the foregoing disclosure has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the disclosure. For example, all the techniques and apparatus described above can be used in various combinations. All publications, patents, patent applications, and / or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and / or other document were individually and separately indicated to be incorporated by reference for all purposes.

Claims

Attorney Docket No. 42256-634.601CLAIMS WHAT IS CLAIMED IS:

1. A method of diagnosing a neurodegenerative disease in a subject in need thereof, the method comprising:detecting a change in an enzymatic activity of a Long Interspersed Nuclear Element- 1 (LI) variant in a sample obtained from a subject compared with a reference enzymatic activity of a control subject not having the neurodegenerative disease, wherein the change in the enzymatic activity indicates that the subject has or is at risk of developing the neurodegenerative disease.

2. The method of claim 1, wherein the LI variant comprises a bicistronic open reading frame 1 (0RF1) and open reading frame 2 (0RF2) variant, a monocistronic ORF1 variant, or a monocistronic ORF2 variant.

3. The method of claim 1, wherein the LI variant is a monocistronic ORF2 variant.

4. The method of any one of claims 2-3, wherein the monocistronic ORF2 variant comprises an intact ORF2 variant or a partial ORF2 variant.

5. The method of claim 4, wherein the intact ORF2 variant comprises or encodes a reverse transcriptase (RT) domain, an endonuclease (EN) domain, or a combination thereof.

6. The method of claim 4, wherein the partial ORF2 variant comprises or encodes a RT domain, an EN domain, or a combination thereof.

7. The method of claim 1, wherein the enzymatic activity comprises a reverse transcriptase (RT) activity, an endonuclease (EN) activity, or both.

8. The method of claim 1, wherein the change in the enzymatic activity of the LI variant comprises an increase or a decrease in the enzymatic activity.

9. The method of claim 8, wherein the change in the enzymatic activity is the increase in the enzymatic activity.

10. The method of claim 9, wherein the increase in the enzymatic activity comprises an increase in the reverse transcriptase (RT) activity, an increase in the endonuclease (EN) activity, or an increase in both.

11. The method of any one of claims 1-10, wherein the change in the enzymatic activity is associated with one LI variant.

12. The method of any one of claims 1-10, wherein the change in the enzymatic activity is associated with two or more LI variants.

13. The method of claim 1, wherein the LI variant comprises a synonymous mutation compared with a nucleotide sequence set forth in SEQ ID NO: 1.Attorney Docket No. 42256-634.60114. The method of claim 1, wherein the LI variant comprises a non-synonymous mutation compared with the nucleotide sequence set forth in SEQ ID NO: 1.

15. The method of any one of claims 1-14, wherein the LI variant is a genomic cDNA (gencDNA).

16. The method of any one of claims 1-14, wherein the LI variant is an RNA.

17. The method of any one of claims 1-14, wherein the LI variant is a mRNA.

18. The method of any one of claims 1-14, wherein the LI variant is a polypeptide.

19. The method of claim 1, wherein the LI variant is identified by in situ hybridization or immunological hybridization.

20. The method of claim 1, wherein the LI variant is identified by a probe binding to the LI variant.

21. The method of claim 20, wherein the probe comprises a polynucleotide probe or a polypeptide probe.

22. The method of claim 20, wherein the polynucleotide probe comprises a single-strand sequence of DNA.

23. The method of claim 20, wherein the polynucleotide probe comprises a single-strand sequence of RNA.

24. The method of claim 20, wherein the polypeptide probe comprises an antibody or an antigen binding fragment thereof.

25. The method of any one of claims 20-24, wherein the probe is labeled using a fluorochrome or a radioactive isotope.

26. The method of any one of claims 20-25, wherein the probe is labeled using an affinity tag.

27. The method of claim 26, wherein the affinity tag comprises biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof.

28. The method of claim 1, wherein the neurodegenerative disease comprises Alzheimer’s disease.

29. The method of claim 28, wherein the Alzheimer’s disease comprises familial Alzheimer’s disease or sporadic Alzheimer’s disease.

30. The method of claim 1, wherein the subject is a human.

31. The method of claim 1, wherein the sample comprises a bodily fluid or a cell.

32. The method of claim 31, wherein the bodily fluid comprises blood plasma, serum, cerebrospinal fluid, urine, saliva, semen, tears, sweat, fecal matter, breast milk, synovial fluid, pleural fluid, pericardial fluid, peritoneal fluid, or amniotic fluid.Attorney Docket No. 42256-634.60133. The method of claim 31, wherein the cell comprises a neuronal cell.

34. The method of any one of the preceding claims, further comprising administering the subject a therapeutic agent targeting the change in the enzymatic activity.

35. A method of treating a neurodegenerative disease in a subject in need thereof, the method comprising:administering to a subject a therapeutic agent, wherein the subject has a change in an enzymatic activity associated with a LI variant relative to the enzymatic level of LI variant in a control subject not having the neurodegenerative disease, wherein the therapeutic agent decreases the change in the enzymatic activity of the LI variant in the subject.

36. The method of claims 34 or 35, wherein the therapeutic comprises a nucleoside reverse transcriptase inhibitor (NRTI) or a non-nucleoside reverse transcriptase inhibitor (NNRTI).

37. The method of claim 36, wherein the therapeutic agent is the nucleoside reverse transcriptase inhibitor (NRTI).

38. The method of claim 36, wherein the nucleoside reverse transcriptase inhibitor (NRTI) comprises Abacavir, Emtricitabine, Lamivudine, Tenofovir alafenamide, Tenofovir disoproxil fumarate, or Zidovudine.

39. The method of claim 35, wherein the therapeutic is the non-nucleoside reverse transcriptase inhibitor (NNRTI).

40. The method of claim 39, wherein the non-nucleoside reverse transcriptase inhibitor (NNRTI) comprises Nevirapine, Efavirenz, Etravirine, Doravirine, Delavirdine, or Rilpivirine.

41. The method of claim 34 or 35, wherein the therapeutic agent comprises an antisense oligonucleotide (AON), an RNA interfering agent (RNAi), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a peptide, a peptidomimetic, a small molecule, an aptamer, or a combination thereof.

42. The method of claim 41, wherein the antisense oligonucleotide targets the LI variant comprising a LI ORF1, a LI ORF2, or both.

43. The method of claim 41, wherein the therapeutic agent is a small molecule.

44. The method of claim 34 or 35, wherein the therapeutic agent comprises an antibody or an antigen binding fragment thereof.

45. The method of claim 44, wherein the antibody or the antigen binding fragment thereof binds to a polypeptide encoded by the LI variant.

46. A kit comprising:(a) a probe for detecting at least one LI variant; andAttorney Docket No. 42256-634.601(b) a detecting reagent for detecting binding of the probe with the at least one LI variant.

47. The kit of claim 46, wherein the at least one LI variant comprises a bicistronic LI 0RF1 and ORF2 variant, a monocistronic LI ORF1 variant, a monocistronic intact LI ORF2 variant, or a monocistronic partial LI ORF2 variant.

48. The kit of claim 46, wherein the at least one LI variant is associated with a change in an enzymatic activity comprising a reverse transcriptase (RT) activity, an endonuclease (EN) activity, or a combination thereof.

49. The kit of any one of claims 46-48, wherein the at least one LI variant is an RNA.

50. The kit of any one of claims 46-48, wherein the at least one LI variant is a genomic cDNA (gencDNA).

51. The kit of any one of claims 46-48, wherein the at least one LI variant is a polypeptide.

52. The kit of any one of claims 46-51, wherein the probe comprises a polynucleotide probe or a polypeptide probe.

53. The kit of any one of claims 46-52, wherein the probe comprises a single-strand sequence ofDNA.

54. The kit of any one of claims 46-52, wherein the probe comprises a single-strand sequence of RNA.

55. The kit of any one of claims 46-51, wherein the probe comprises an antibody or an antigen binding fragment thereof.

56. The kit of any one of claims 46-55, wherein the probe is labeled using a fluorochrome or a radioactive isotope.

57. The kit of any one of claims 45-56, wherein the probe is labeled using an affinity tag.

58. The kit of claim 57, wherein the affinity tag is biotin, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, glutathione S transferase (GST), or derivatives thereof.

59. The kit of claim 46, wherein the detecting reagent binds to the probe.

60. The kit of claim 46, wherein the detecting reagent comprises a fluorescent or a radioactive label.

Images