Micro-RNA 7b for heart failure

WO2026206907A1PCT designated stage Publication Date: 2026-10-01TEMPLE UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/020483
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-24
Filing Date
2026-03-24
Publication Date
2026-10-01

Smart Images

  • Figure IMGF000077_0001_TABLE
    Figure IMGF000077_0001_TABLE
  • Figure IMGF000077_0002_TABLE
    Figure IMGF000077_0002_TABLE
  • Figure IMGF000077_0003_TABLE
    Figure IMGF000077_0003_TABLE
Patent Text Reader

Abstract

Although several miRs have been shown to be important in the heart including after injury, there are probably still several yet to be identified that play crucial roles. Thus, there is a need in the art for improved compositions and methods for treating or preventing cardiomyopathies and heart failure (HF). In one aspect, the invention provides methods and compositions for treating or preventing HF in a subject in need thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney Docket No. 206017-0295-00WO

[0002] TITLE OF THE INVENTION MICRO-RNA 7B FOR HEART FAILURE

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No.

[0004] 63 / 776,493, filed March 24, 2025, which is hereby incorporated herein by reference in its entirety.

[0005] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0006] This invention was made with government support under P01 HL 134608 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0007] BACKGROUND OF THE INVENTION

[0008] Micro RNAs (miRNAs) are small non-coding RNAs (typically 22-nucleotides in length) and are found throughout chromatin and these molecules regulate transcripts by binding to the 3 ’-untranslated regions of mRNAs causing their degradation prior to translation or blocking translation, therefore playing a role in fine-tuning protein levels. Of note, miRs are becoming increasingly studied in the heart and several miRs have been implicated in HF pathology. Importantly, miRs and miR inhibitors (known as antagomirs) are moving towards the clinic in heart failure (HF). Although several miRs have been shown to be important in the heart including after injury, there are probably still several yet to be identified that play crucial roles. Thus, there is a need in the art for improved compositions and methods for treating or preventing cardiomyopathies and heart failure. This invention satisfies this unmet need.

[0009] SUMMARY OF THE INVENTION

[0010] In various aspects, the present invention provides methods of treating or preventing heart failure (HF) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of microRNA 7b-3p (miR-7b-3p) or a miR- 7b-3p mimic. In one embodiment, the miR-7b-3p or miR-7b-3p mimic is comprised in an adeno-associated virus 9 (AAV9) vector. In one embodiment, the administration comprises intracoronary catheter-based AAV9 gene delivery. In one embodiment, the administration comprises administration before, during, or after HF. In one embodiment, the administration occurs via intra-coronary delivery or infusion for a period of minutes. In one embodiment, the miR-7b-3p or miR-7b-3p mimic is comprised within AAV9 vector and administered at a concentration of about IxlO12vector genomes (vg’s) to about 5xl014vg’s via intra-coronary or intravenous delivery. In one embodiment, the miR-7b-3p or miR-7b-3p mimic are administered with an acceptable pharmaceutical carrier. In one embodiment, the miR-7b-3p or miR-7b-3p mimic comprises a sequence at least 90% identical to a sequence set forth in SEQ ID NOs: 1-5.

[0011] In one embodiment, the present invention provides compositions for treating or preventing heart failure (HF) in a subject in need thereof, the composition comprising a therapeutically effective amount of microRNA 7b-3p (miR-7b-3p) or a miR-7b-3p mimic. In one embodiment, the composition is comprised in an adeno-associated virus 9 (AAV9) vector. In one embodiment, the composition further comprises a pharmaceutically acceptable carrier. In one embodiment, the miR-7b-3p or miR-7b-3p mimic is comprised within AAV9 vector and administered at a concentration of about IxlO12vector genomes (vg’s) to about 5xl014vg’s via intra-coronary or intravenous delivery.

[0012] In one embodiment, the HF comprises cardiac hypertrophy, heart dysfunction from pressure overload, failure of contractility, cardiomyocyte apoptosis, ischemic injury, stress-induced cardiomyopathy, adverse heart remodeling related to myocardial infarction, HF resulting from valvular injury, HF resulting from insufficiency, and HF resulting from viral infection.

[0013] BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1, comprising Figure 1A through 1G, present representative data depicting expression level of miR 7b-3p in blood EVs and heart tissue after injury. (Fig 1A and IB) Bar graph of miR 7b-3p of mouse with Iso infusion by osmotic pump for 2 and 8 weeks. (Fig 1C, ID, and IE) graph of miR 7b-3p of mouse with transverse aorticconstriction (TAC) for 2, 4 and 8 weeks. (Fig IF) Bar graph of miR 7b-3p of mouse with myocardial infarct (MI) for 2 (Fig IF) and 4 weeks (Fig 1G). Mean ± SEM. n=4~5.

[0015] Figure 2, comprising Figure 2A through 2E, present representative data depicting changes of mouse heart with Isoproterenol infusion (ISO). (Fig 2A and 2B) Bar graphs of heart weight (HW) / body weight (BW) ratio and HW / tibia length (TL). (Fig 2C and 2D) Bar graphs of ANF and BNP in heart tissue for 2 weeks ISO infusion and for 8 weeks. (Fig 2E) Ejection fraction (EF) measured by echocardiography for 8 weeks with ISO infusion (n=4~5, mean ± SEM).

[0016] Figure 3, comprising Figure 3A through 3F, present representative data depicting changes of mouse heart with transvers aortic constriction (TAC) surgery. (Fig 3 A and 3B) Bar graphs of heart weight (HW) / body weight (BW) ratio and HW / tibia length (TL). (Fig 3C and 3D) Bar graphs of ANF and BNP in heart tissue at 2, 4 and 8 weeks after TAC. (Fig 3E) Ejection fraction (EF) and (Fig 3F) fraction shortening (FS) measured by echocardiography for 8 weeks after TAC (n=4~5, mean ± SEM).

[0017] Figure 4, comprising Figure 4A through Figure 4E, present representative data depicting changes of mouse heart with acute myocardial infarction (MI) surgery. (Fig 4A and 4B) Bar graphs of heart weight (HW) / body weight (BW) ratio and HW / tibia length (TL) at 2 and 4 weeks after MI. (Fig 4C and 4D) Bar graphs of ANF and BNP in heart tissue at 2 and 4 weeks after MI. (Fig 4E) Ejection fraction (EF) and fraction shortening (FS) measured by echocardiography for 4 weeks with ISO infusion (n=4~5, mean ± SEM).

[0018] Figure 5, comprising Figure 5A through Figure 5D, present representative data depicting anti-hypertrophy effect of miR 7b-3p in neonatal rat ventricle myocyte (NRVM). (Fig 5A and 5B) Bar graph of ANF and BNP transcription level. In NRVMs, miR 7b-3p mimic (miR7b) and scramble miRNA (SC) were transfected for 24 hours and then lOpM phenylephrine (PE) and lOpM isoproterenol (ISO) were treated for 24 hours. (Fig 5C and 5D) Bar graph of NRVM area, PE treatment for 48 Hours after miR 7b-3p and SC mimic. Mean ± SEM. (Fig 5 A and 5B) n=4, and (Fig 5C and 5D) n=3.

[0019] Figure 6, comprising Figure 6A through Figure 6H, present representative data depicting that miR7b overexpression delayed an initiation of heart dysfunction via pressure overload. (Fig 6A) Time schemed of experiment. miR 7b and SC were deliveredinto heart by jugular vein injection at 4weeks prior TAC surgery. Heart function were serially measure by echocardiography at every 2 weeks for 12 weeks after transverse aortic constriction (TAC). (Fig 6B) Serial measures of cardiac ejection fraction (EF) and (Fig 6C) fraction shortening (FA), (Fig 6D) left ventricular internal dimension at enddiastole (LVIDd) and (Fig 6E) at end-systole (LVIDs) measured. (Fig 6F) and (Fig 6G) (Fig 6H) Bar graphs of heart weight / body weight ratio and hearts weight / tibia length ratio. Mean + / - SEM, n=4~5 ANOVA test p value of all results is <0.001 or <0.005 and ANOVA followed by Tukey’s multiple comparison test. * p<0.005 and **<0.001.

[0020] Figure 7, comprising Figure 7A through Figure 7C, present representative data depicting that miR7b restored a contractility of failed heart. (Fig 7A) Time scheme of experiment. miR 7b and SC were delivered into heart by jugular vein injection at 6 weeks after TAC. Heart function were serially measure by echocardiography at 1st and 2nd week after AAV delivery. (Fig 7B) Serial measures of cardiac ejection fraction (EF) and (Fig 7C) fraction shortening (FS). Animal number is Sham-PBS (10), Sham -miR SC (6), Sham -miR7b (6), TAC-PBS (12), TAC-miR SC (13) and TAC-miR 7b (13), Mean ± SEM, ANOVA test p value of all results is <0.001 or <0.005 and ANOVA followed by Tukey‘s multiple comparison test. * p< 05, **<0.01 and ****<0.001.

[0021] Figure 8, comprising Figure 8A through Figure 8E, present representative data depicting that miR7 b attenuated a heart remodeling. (Fig 8A and 8B) Bar graphs of heart weight / body weight ratio and heart weight / tibia length ratio which heart was exposure for 8 weeks after TAC with AAV-GFP-miR7b. PBS and AAV-GFP Scramble (SC) were used as control and sham surgery was used as control for TAC. (Fig 8C) Bar graph of BNP transcription level in the heart tissue. (Fig 8D) Bar graph of myocyte area measured by WGA staining method in the heart and (Fig 8D) representative pictures of WGA stain heart section. (Fig 8E) Representative pictures of heart tissue section with WGA staining. Representative pictures of WGA stain heart section. Scale bar set to 50um. Animal number is Sham-PBS (10), Sham-miRSC (6), Sham-miR7b (6), TAC-PBS (12), TAC-miRSC (13) and TAC-miR7b (13), Mean ± SEM, ANOVA test p value of all results is <0.001 or <0.005 and ANOVA followed by Tukey‘s multiple comparison test. *p<0.05, **<0.01 and ****<0.001.Figure 9, comprising Figure 9A and Figure 9B, present representative data depicting binding activity analysis of miR7b and Scramble nucleotide sequences inserted in GFP-miR7b AAV vector and miRGFP Scramble AAV vector. Individual dots is a ratio of Luciferase signal. Three kinds of luciferase vector (LV) including the two kinds of target sequence for miR7b-3p (5’-ACTTGTTG-3’), for miR7b-5p (5’-TCTTCCA-3’) and without target sequences was cloned (luciferase vector (LV) with miR7b-3p binding sequence (3p-Luc), luciferase vector with miR7b-5p binding sequence (5p-Luc) and luciferase vector(Luc). To overexpress the miR7b and scramble sequence (SC), the AAV inserted miR7b and scramble sequence was each cloned into micro RNA overexpression vector (p-MiRGlo). (Fig 9A) Scheme of experiment (Fig 9B) Graph of luciferase activity ratio of miR7b to SC after normalization.. Mean ± SEM. n=6.

[0022] Figure 10, comprising Figure 10A through Figure 10D, present representative data depicting miR7b treatment on gene expression profiling of the heart tissue with TAC. RNA-seq was performed to determine the DETs in heart tissue from each group. (Fig 10A-10C) Volcano plots were used to compare gene expression profiles (|fold change|>2,p<0.05). (Fig 10D) hierarchical clustering plots. n=3 for each group.

[0023] Figure 11, comprising Figure 11 A through Figure 1 IF, present representative GO enrichment analysis. GO enrichment analysis was performed based on the DETs from both comparisons of (Fig 11A) up regulated genes from miR7b treatment in sham operation mouse (Sham-miR7b) vs. PBS treatment in Sham (Sham-PBS) and (Fig 1 ID) down regulated genes. (Fig 1 IB) Up regulated genes from comparison of PBS treated TAC heart (TAC -PBS) vs. Sham-PBS (Fig 1 IE) down regulated genes. (Fig 11C) Up regulated genes from comparison of miR7b treatment in TAC heart (TACmiR7b) vs. TAC -PBS and (Fig 1 IF) down regulated genes.

[0024] Figure 12, comprising Figure 12A through Figure 12C, present representative data depicting miR7b transduction by AAV virus. (Fig 12A) Bar graph of GFP expression level at heart with jugular vein injection of PBS, AAV-GFP-Scramble miRNA AAV and GFP-mir7b AAV, at 1, 2 and 4 weeks later. (Fig 12B) Bar graph of mature mi RNA7b-3p and (Fig 12C) Bar graph of precursor miRNA7b. Mean ± SD. n=3.

[0025] Figure 13, comprising Figure 13 A through Figure 13G, present representative data depicting different effects of miR7b for heart at before myocardialinfarction (MT) induction and during MI. The miR7b treatment during MI restored the heart contractility but miR7b overexpression in heart before MI heart increased the mortality. (Fig 13 A) The miR7b restored contractility of failed heart. (Fig 13 A) Time scheme of experiment. miR7b and SC were delivered into heart by jugular vein injection at 2 weeks after MI. Heart function were serially measure by echocardiography at 1 stand 2nd week after AAV delivery. (Fig 13B) Serial measures of cardiac ejection fraction (EF) and (Fig 13C) fraction shortening (FS). Animal number is Sham-PBS (15), MI-PBS (9), MI-miRSC (10) and MI-miR7b (12), Mean ±SEM, ANOVA test p value of all results is <0.001 or <0.005 and ANOVA followed by Tukey‘s multiple comparison test. * p<0.05 . (Fig 13F) Time scheme of experiment. miR7b and SC were delivered into heart by jugular vein injection at 4 weeks prior MI surgery. Mouse was under an observation for 4 weeks. (Fig 13G) Survival line graph. n=5.

[0026] Figure 14, comprising Figure 14A through Figure 14C, present representative comparisons of expression level of mature miRNA 7b-3p and precursor miRNA 7b at GRK 2 cardiac specific expression TG mouse (BK12 TG) heart. (Fig 14A and 14B) Bar graph of relative expression level of mir 7b-3p and precursor miRNA 7b). (Fig 14C) Representative picture of western blot analysis to characterize the GRK2 expression in the heart. NLS; wild type mouse (n=6~7, mean ± SEM), * p<0.05 vs NLC.

[0027] Figure 15, comprising Figure 15A through Figure 15F, present representative data depicting MiR21a-5p expression level in heart of ISO, TAC and MI heart and in blood extracellular vesicle of those. (Fig 15 A) Bar graph of miR21a-5p expression in heart and blood EV of mouse with ISO infusion for 2weeks and (Fig 15B) for 8 weeks. (Fig 15C) Bar graph of miR21a-5p expression in heart and blood EV of mouse at post TAC 2weeks and (Fig 15D) 4 weeks. (Fig 15E) Bar graph of miR21a-5p expression in heart and blood EV of mouse at post MI 2weeks and (Fig 15F) 4 weeks. Mean± SEM, n=4~5.

[0028] Figure 16, depicts a representative schematic of aims and goals of this study. This study is focused on investigating the therapeutic (Example 3), mechanistic (Example 4) and translational (Example 5) aspects of miR-7b gene therapy in the heart after injury. Example 3 determines if gene delivery of miR-7b can improve the functionof the failing mouse heart in vivo after different modes of injury including pressure overload HF (section 3.1), ischemic HF (section 3.2) and catecholamine toxicity induced HF (section 3.3). Example 4 determines the targets and pathways responsible for the effect of miR-7b in injured myocytes utilizing transcriptomic (4.1), proteomic (4.2) and cellular mechanistic (4.3) approaches, which include studies of mitochondrial function. Example 5 determines the translational potential of miR-7b gene delivery in a pre-clinical large animal (porcine) ischemic HF model. miR; microRNA, HF; heart failure. Created with BioRender.

[0029] Figure 17, comprising Figure 17A through Figure 17D, depict representative data demonstrating that miR- 7b (miR-7b-3p) is down-regulated in the heart after cardiac injury / stress with ISO, TAC and MI and blood EV / exosomes (Exo) After ISO. Mice (male WT C57BL / 6J) were treated with isoproterenol (ISO - 10 mg / kg / day or saline-PBS) using ALZET mini-osmotic pumps implanted S.C. for either 2 weeks (Fig 17A) or 8 weeks ((Fig 17B). ((Fig 17A and 17B) Exosomes (Exo) were isolated from whole body blood after sacrifice and purified and counted by Nanosight as described (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320:H1276-H1289) and levels of miR-7b-3p determined by RT-PCR. Levels of miR-7b-3p also determined by RT-PCR from heart samples. Data shown as Mean±SEM (n=4-5 per group). **,p<0.05 vs. PBS-Blood Exo, *,p<0.05 vs PBS-heart (t-test). ((Fig 17C) Mice were Sham treated or treated with transverse aortic constriction (TAC) as has been recently described (Coleman et al., 2021, Sci Signal 14:eabb5968) (n=4-5 per group) and shown is 8-week post-TAC (or Sham) data for miR-7b-3p RT-PCR data in heart samples or EVs collected from blood as in A-B. **,p<0.05 vs. Sham. ((Fig 17D) Mice were Sham treated or coronary artery ligated as has been recently done (de Lucia et al., 2022, Cardiovasc Res 118:169- 183; Gao et al., 2010, Circ Res 107:1445-53) to induce MI and 4 weeks later blood EVs were prepared as in A-B and EV RNA and heart RNA prepared to determine levels of miR-7b-3p (n=4-5 per group). *,p<0.05 vs. Sham.

[0030] Figure 18, comprising Figure 18A and 18B, depict representative data demonstrating that miR-7b-3p Treatment of myocytes prevents cardiac hypertrophy and in vivo gene delivery of miR- 7b reverse cardiac dysfunction post-TAC. (Fig 18A and 18B) Anti-hypertrophic effect of miR-7b-3p mimic in neonatal rat ventricular myocytes(NRVMs). (Fig 18 A) Representative NRVMs stained for actin (green) and nuclei DAPI-blue treated with vehicle (PBS) or PE (lOmM for 48hrs) and treated with scrambled (SC) miR mimic or miR-7b-3p mimic for 48hrs, with miR-7b-3p mimic showing less surface area and actin stress fibers and with myocyte area quantitated in (Fig 18B)

[0031] p<0.05 vs. SC-PE (n=3).

[0032] Figure 19, comprising Figure 19A and Figure 19B, presents representative data demonstrating the successful delivery of AAV9-cTnT-GFP into the mouse heart and preliminary therapeutic success of AAV9-cTnT-miR-7b in mice post-TAC. (Fig 19A) Male C57BL / 6J (C57) mice were treated with 5xlOnGenome Copies (GC) AAV9-cTnT-GFP or Saline (PBS) in lOOpl via a retro-orbital (RO) injection. Hearts were harvested 2-weeks post-gene delivery. Shown is a Western blot for GFP and GAPDH. (Fig 19B) Male C57 mice were subjected to TAC or Sham procedure and then 6-weeks later treated with 5xlOuGC of AAV9-cTnT-miR-7b, AAV9-cTnT-miR-SC, or Saline (PBS) in lOOpl via a RO injection. Mice were assessed via Echo right before TAC (or sham), again before AAV injection and then at 1- and 2-weeks post-gene delivery.

[0033] Shown is the LV ejection fraction (EF%) with increased function post-miR-7b delivery. *,p<0.05, **,p<0.01 (in Green) vs. SC-TAC at 1- and 2-weeks. **, p<0.01, ****, p<0.001 (in black) vs. PBS-TAC at 1- and 2-weeks (n=9-l 1), ANOVA followed by Tukey’s multiple comparisons.

[0034] Figure 20 presents representative data demonstrating that two weeks of miR- 7b treatment decreased cardiac hypertrophy after TAC. Mice were treated as in Figure 19B 6-weeks post-TAC with AAV9-miR-7b, PBS or AAV9-SC and sacrificed 2 weeks later (8-weeks post-TAC). Shown are labeled groups (n=6 each), mean ± SEM of heart weight-to body weight (HW / BW) ratios in mg / g analyzed with ANOVA followed by Tukey’s multiple comparison test, (ns, not significant, ****, p<0.001, **, p<0.01.

[0035] Figure 21, comprising Figure 21A and Figure 21B, depicts representative data demonstrating IPA and DAVID analysis of significantly altered proteins in TgGRK5 LV Samples Vs. NLC samples in ischemic HF. (Fig 21 A) Most significant IPA selected IPA networks at 8-weeks post MI due to GRK5 overexpression with size of circles represented by number or distinct proteins (x-axis) of pathway and color code represents p-value (both coded on right). (Fig 2 IB) Major pathways found with DAVID analysiscoded by GO terms. Size of balls represent number of proteins (x-axis and scale on right) and “The Group Enrichment Score”, a measurement of cluster significance, is color coded via scale on right.

[0036] Figure 22 depicts representative data demonstrating myocardial transcript changes due to overexpression of miR-7b 2-weeks after AAV9-mediated delivery to post-TAC hearts. WT C57 mice 6-weeks after TAC were injected with AAV9-cTnt-miR-7b or PBS as detailed for Fig. 19B and 2-weeks later, hearts removed and global cardiac RNA-Seq performed. Shown is a Volcano Plot for comparing gene expression profiles with 1228 transcripts significantly up-regulated (red, p<0.05) miR-7b compared to PBS and 1317 transcripts significantly down-regulated (green, p<0.05) with miR-7b.

[0037] Figure 23, comprising Figure 23A through Figure 23C, depicts representative data demonstrating enriched pathways associated with differentially expressed genes from the hearts of TAC or sham mice treated with AAV9-miR-7b or saline. (Fig 23 A) AAV9-miR-7b Sham hearts showed up-regulation in transcripts associated with mitochondrial inner membrane, organelle inner membrane and inner mitochondrial membrane protein complex (Top 3 regulated pathways). (Fig 23B) These pathways were down-regulated in TAC vs. Sham hearts (treated with saline-PBS). (Fig 23C) These pathways were up-regulated again in AAV9-miR-7b treated TAC hearts vs. TAC-PBS hearts, indicating that miR-7b up-regulates expression of these mitochondrial pathways that are impaired during HF. Statistically enriched terms were identified and p-values calculated and hierarchically clustered using gene ontology (GO) analysis.

[0038] Figure 24, comprising Figure 24A and Figure 24B, depicts representative data demonstrating successful intracoronary catheter-based AAV9 gene delivery to pigs. (Fig 24A) AAV9 gene delivery (5xl013-IxlO14viral particles) were injected into 30-40 kg Yorkshire swine either via direct intra-myocardial injection after a thoracotomy (IM), direct let main coronary artery infusion (IC, direct LM), or intracoronary perfusion down the distal left anterior descending (LAD) artery with balloon occlusion into the mid-LAD (IC:Balloon). Four weeks later, hearts were removed after animals were sacrificed and in vivo transduction efficiency and volume calculated. The IC: Balloon methods achieved highest tissue transduction in the targeted areas. Shown is the viral DNA amounts in ventricular regions at risk and non-risk in a LAD infarct model using the different AAVdelivery methods. Note the use of the logarithmic axis as the data is normalized to virus dose. Taken from (Vekstein et al., 2022, Front. Cardiovasc. Med. 9:833335). (Fig 24B) Representative cardiac section from a pig heart 4-weeks after IC:Balloon delivery of AAV9-GFP.

[0039] Figure 25, comprising Figure 25A and Figure 25B, depicts representative data demonstrating MiR-7b prevents and reverses cardiac hypertrophy in N VMs. Figure 25A depicts NRVMs that were transfected with vehicle (Lipofectamine RNAiMAX), miR-7b mimic or scramble mimic for 24 hours, followed by treatment with PE (lOuM) for 48 hours. Figure 25B depicts NRVMs that were treated with PE (lOuM) for 48 hours followed by transfection with vehicle, miR-7b mimic or scramble mimic for 24 hours. Following treatment, cells were stained with wheat germ agglutinin (WGA) conjugated to Alexa Fluor 594 to visualize cardiomyocyte membranes using an EVOS M7000 Imaging System and cell surface area was quantified in Imaged. Data are mean ± SEM, N=3 imaging experiments, n=186-504 cells (counted from 5 fields per technical replicate. P -values represent statistical significance after 2-way ANOVA with Bonferroni post-hoc test. In Figure 25APE Treatment: p<0.0001, Mimic Treatment: p<0.0001, Interaction: pO.OOOl. In Figure 25B PE Treatment: pO.OOOl, Mimic Treatment: p=0.0764, Interaction: pO.OOOl Representative images of Vehicle and miR-7b treated with PE are shown, with scale bar set to 100pm.

[0040] Figure 26, comprising Figure 26A and Figure 26B, depicts representative data that MiR-7b prevents cardiac hypertrophy in NRVMs. (Fig 26A) NRVMs were transfected with vehicle (Lipofectamine RNAiMAX), miR-7b mimic or scramble mimic for 24 hours, followed by treatment with PE (lOuM) for 48 hours. Following treatment, cells were stained with wheat germ agglutinin (WGA) conjugated to Alexa Fluor 594 to visualize cardiomyocyte membranes using an EVOS M7000 Imaging System.

[0041] Representative images (two different sets) of Vehicle, Scramble and miR-7b treated without PE (-PE) and with PE (+PE) are shown, with scale bar set to 100pm. (Fig 26B) NRVMs were treated with PE (lOuM) for 48 hours followed by transfection with vehicle, miR-7b mimic or scramble mimic for 24 hours. Following treatment, cells were stained with wheat germ agglutinin (WGA) conjugated to Alexa Fluor 594 to visualize cardiomyocyte membranes using an EVOS M7000 Imaging System. Representativeimages (two different sets) of Vehicle, Scramble and miR-7b treated without PE (-PE) and with PE (+PE) are shown, with scale bar set to 100pm. Corresponds to slide 1, panel B data.

[0042] Figure 27, comprising Figure 27A and Figure 27B, depicts representative data demonstrating MiR-7b prevents cardiac hypertrophy induced by different agonists in NRVMs. Figure 27A depicts NRVMs that were transfected with vehicle (Lipofectamine RNAiMAX), miR-7b mimic or scramble mimic for 24 hours, followed by treatment with PE (lOuM), ANGII (lOuM) or ISO (lOuM) for 48 hours. Following treatment, cells were stained with wheat germ agglutinin (WGA) conjugated to Alexa Fluor 594 to visualize cardiomyocyte membranes using an EVOS M7000 Imaging System and cell surface area was quantified in Imaged. Data are mean ± SEM, P-values represent statistical significance after 2-way ANOVA with Bonferroni post-hoc test. Figure 27B depicts representative images of Vehicle and miR-7b treated with PE are shown, with scale bar set to 100 pm.

[0043] Figure 28 depicts representative data demonstrating that MiR-7b improves cardiac function in mice in a chronic model of TAC. Male C57 mice were subjected to TAC or Sham surgery and 2-weeks later treated with 5xl0nGC of AAV9-cTnT-miR-7b, AAV9-cTnT-SC, or saline (PBS) via RO injection in in lOOpl saline. Mice were assessed via Echo before TAC (or Sham) surgery, before AAV injection (at 2-weeks post-TAC) and serially every two weeks until 12-weeks post-TAC (10-weeks post-gene therapy). LV ejection fraction (EF%) is shown with miR-7b exerting a therapeutic benefit that is sustained for 10-weeks. Data are mean ± SEM, n=4-6 mice per group. P-values represent statistical significance after repeated measures ANOVA with Bonferroni post-hoc test. Time: p<0.0001, Group: p=0.0002, Interaction: p<0.0001. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Comparisons between Sham vs. TAC-SC in Green, Sham vs. TAC-miR-7 in Purple, Sham vs. TAC -PBS in Red; TAC-SC vs. TAC-miR-7b in Grey; TAC -PBS vs. TAC-miR-7b in Black.

[0044] Figure 29, comprising Figure 29A through Figure 29C, depicts representative data demonstrating differential gene enrichment analysis and predicted targets of miR-7b from AAV9-miR-7b mouse hearts post-TAC. In Figure 29A and Figure 29B gene ontology (GO) enrichment analysis of biological processes wasperformed on significantly up- (Figure 29A) and down-(Figure 29B) regulated genes identified by Gene Set Enrichment Analysis (GSEA) comparing miR-7b vs. PBS injected TAC hearts. Adjusted P-value < 0.05, minimum of three gene overlap. The y-axis indicates biological process terms and x-axis displays -Logio Adjusted P-value. Dashed red line indicates significance threshold. Figure 29C depicts heatmap of significantly down-regulated genes predicted to be targets of miR-7b-3p, based on miRDB analysis in AAV9-miR-7b TAC hearts. The prediction score (shown on the right) reflects the confidence of target assignment with scores of >80 indicating very strong predictions and <60 indicating weaker predictions.

[0045] Figure 30, comprising Figure 30A through Figure 30C, depicts representative data demonstrating differential gene enrichment analysis and predicted targets of miR-7b from NRVMs overexpressing miR-7b under PE-induced hypertrophy. In Figure 30A and Figure 30B Gene Ontology (GO) enrichment analysis of biological processes was performed on significantly up- (Figure 30A) and down- (Figure 30B) regulated genes identified by Gene Set Enrichment Analysis (GSEA) comparing miR-7b vs. Vehicle PE treated NRVMs. Adjusted P-value < 0.05, minimum of three gene overlap. The y-axis indicates biological process terms and x-axis displays -Logio Adjusted P-value. Dashed red line indicates significance threshold. Figure 30C depicts heatmap of significantly down-regulated genes predicted to be targets of miR-7b-3p, based on miRDB analysis in miR-7b PE treated NRVMs. The prediction score (shown on the right) reflects the confidence of target assignment with scores of >80 indicating very strong predictions and <60 indicating weaker predictions. NRVMs were transfected with vehicle (Lipofectamine RNAiMAX) or miR-7b mimic for 24hr, followed by PE (10 pM) treatment for 48hr.

[0046] Figure 31, comprising Figure 31 A through Figure 3 ID, depicts representative data demonstrating MiR-7b enhances mitochfondrial respiration, ATP production and sustains Complex V expression under hypertrophic stress. In Figure 31A and Figure 3 IB NRVMs were transfected with vehicle (Lipofectamine RNAiMAX), miR-7b mimic, or antagomir-7b (Anti-7b) for 24hr, followed by phenylephrine (PE, 10 pM) treatment for 24hr. Mitochondrial respiration was assessed using an Agilent Seahorse Extracellular Flux Analyzer. Oxygen consumption rate over time (Figure 31 A)and calculated ATP production (Figure 3 IB) are shown. MiR-7b increased basal and maximal respiration and ATP production, while Anti-7b blunted these responses. Data are mean ± SEM, n=7-8 per group. In Figure 31 A statistical significance was determined after repeated measures ANOVA, Group: p<0.0001. In Figure 3 IB p-values represent statistical significance after 2-way ANOVA with Bonferroni post-hoc test, PE Treatment: p=0.0002, Mimic Treatment: p=0.0001. In Figure 31C and Figure 3 ID NRVMs were transfected with vehicle, miR-7b mimic, or scramble control either before (Figure 31C, prevention) or after (Figure 3 ID, reversal) 48hr PE treatment (10 pM). Complex V expression was assessed by immunoblotting (Total OXPHO S antibody) and normalized to total protein. MiR-7b maintained Complex V expression under hypertrophic stress, whereas vehicle and scramble controls showed reduced levels. Data are mean ± SEM, n=4 per group. P-values represent statistical significance after 2-way ANOVA with Bonferroni post-hoc test, in Figure 31C PE Treatment: p=0.09, in Figure 3 ID PE Treatment: p=0.0002. MiR-7b enhances mitochondrial respiration and ATP production under hypertrophic stress. NRVMs were transfected with vehicle (Lipofectamine RNAiMAX), miR-7b mimic, or antagomir-7b (Anti-7b) for 24hr, followed by phenylephrine (PE, 10 pM) treatment for 24hr. Mitochondrial respiration was assessed using an Agilent Seahorse Extracellular Flux Analyzer. (Fig 31 A) Oxygen consumption rate over time, calculated (Fig 3 IB) ATP production, (Fig 31C) percent spare respiratory capacity, (Fig 3 ID) basal respiration and (Fig 3 IE) maximal respiration are shown. MiR-7b increased basal and maximal respiration and ATP production, while Anti-7b blunted these responses. Data are mean ± SEM, n=7-8 per group. In A statistical significance was determined after repeated measures ANOVA, Group: pO.OOOl. In B-E statistical significance was determined by 2-way ANOVA with Bonferroni post-hoc test. Data in panels A & B corresponds / is the same as slide 9, panels A & B.

[0047] Figure 32, comprising Figure 32A through Figure 32E, depicts representative data demonstrating that MiR-7b enhances mitochondrial respiration and ATP production under hypertrophic stress. NRVMs were transfected with vehicle (Lipofectamine RNAiMAX), miR-7b mimic, or antagomir-7b (Anti-7b) for 24hr, followed by phenylephrine (PE, 10 pM) treatment for 24hr. Mitochondrial respiration was assessed using an Agilent Seahorse Extracellular Flux Analyzer. (Fig 32A) Oxygenconsumption rate over time, calculated (Fig 32B) ATP production, (Fig 32C) percent spare respiratory capacity, (Fig 32D) basal respiration and (Fig 32E) maximal respiration are shown. MiR-7b increased basal and maximal respiration and ATP production, while Anti-7b blunted these responses. Data are mean ± SEM, n=7-8 per group. In A statistical significance was determined after repeated measures ANOVA, Group: p<0.0001. In B-E statistical significance was determined by 2-way ANOVA with Bonferroni post-hoc test.

[0048] Figure 33, comprising Figure 33A through Figure 33D, depicts representative data demonstrating NRVMs were transfected with vehicle, miR-7b mimic, or scramble control either before (A,B prevention) or after (C,D, reversal) 48hr PE treatment (10 pM). Complex V expression was assessed by immunoblotting (Total OXPHOS antibody) and normalized to total protein. MiR-7b maintained Complex V expression under hypertrophic stress, whereas vehicle and scramble controls showed reduced levels. Data are mean ± SEM, n=4 per group. P-values represent statistical significance after 2-way ANOVA with Bonferroni post-hoc test, in B PE Treatment: p=0.09, in D PE Treatment: p=0.0002. MiR-7b enhances mitochondrial respiration, ATP production and sustains Complex V expression under hypertrophic stress. (A,B) NRVMs were transfected with vehicle (Lipofectamine RNAiMAX), miR-7b mimic, or antagomir-7b (Anti-7b) for 24hr, followed by phenylephrine (PE, 10 pM) treatment for 24hr.

[0049] Mitochondrial respiration was assessed using an Agilent Seahorse Extracellular Flux Analyzer. (A) Oxygen consumption rate overtime and (B) calculated ATP production are shown. MiR-7b increased basal and maximal respiration and ATP production, while Anti-7b blunted these responses. Data are mean ± SEM, n=7-8 per group. In A statistical significance was determined after repeated measures ANOVA, Group: p<0.0001. In B p-values represent statistical significance after 2-way ANOVA with Bonferroni post-hoc test, PE Treatment: p=0.0002, Mimic Treatment: p=0.0001. (C,D) NRVMs were transfected with vehicle, miR-7b mimic, or scramble control either before (C, prevention) or after (D, reversal) 48hr PE treatment (10 pM). Complex V expression was assessed by immunoblotting (Total OXPHOS antibody) and normalized to total protein. MiR-7b maintained Complex V expression under hypertrophic stress, whereas vehicle and scramble controls showed reduced levels. Data are mean ± SEM, n=4 per group. P-values represent statistical significance after 2-way ANOVA with Bonferroni post-hoc test, in CPE Treatment: p=0.09, in D PE Treatment: p=0.0002. NRVMs were transfected with vehicle, miR-7b mimic, or scramble control either before (A,B prevention) or after (C,D, reversal) 48hr PE treatment (10 pM). Complex V expression was assessed by immunoblotting (Total OXPHO S antibody) and normalized to total protein. MiR-7b maintained Complex V expression under hypertrophic stress, whereas vehicle and scramble controls showed reduced levels. Data are mean ± SEM, n=4 per group. P-values represent statistical significance after 2-way ANOVA with Bonferroni post-hoc test, in B PE Treatment: p=0.09, in D PE Treatment: p=0.0002. Data in panels B & D corresponds / is the same as slide 9, panels C & D.

[0050] Figure 34 depicts representative transmission electron microscopy (TEM) images from C57 mice subjected to TAC or Sham surgery and 2-weeks later treated with 5x1011 GC of AAV9-cTnT-miR-7b or saline (PBS) via RO injection in in 100ml saline. Mice were euthanized 12-weeks post-TAC (10-weeks post-gene therapy) and sections were processed for TEM. Representative images (two different sets) from each group are shown, with scale bar set to 800nm.

[0051] Figure 35 depicts representative data demonstrating MiR-7b is reduced in failing pig hearts. MiR-7b expression in LV tissue from pigs with HF with reduced ejection fraction (HFrEF) and non-failing controls. MiR-7b gene expression was quantified by RT-qPCR using the 2'AACt(normalized to 5S rRNA and expressed relative to the control group). Data are mean ± SEM, n=2-3 samples per group.

[0052] Figure 36, comprising Figure 36A through Figure 36C, depicts representative data demonstrating MiR-7b is reduced in failing human hearts. Figure 36A depicts MiR-7b expression in LV tissue from patients with ischemic cardiomyopathy (ICM) and matched non- failing (NF) controls (n=7-9 samples per group). Figure 36B depicts MiR-7b expression in LV tissue from patients with hypertrophic cardiomyopathy (HCM) and matched non-failing (NF) controls (n=5 samples per group). Figure 36C depicts MiR-7b expression in LV tissue from patients with heart failure (HF) and matched non- failing (NF) controls (n=l 1-13 samples per group). MiR-7b gene expression was quantified by RT-qPCR using the 2'AACt(normalized to 5S rRNA and expressed relative to the NF group within each cohort). Data are mean ± SEM. P-values represent statistical significance after unpaired two-tailed t-test.The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0053] DETAILED DESCRIPTION

[0054] The present invention is based on the observation that miR-7b-3p has therapeutic properties with regard to heart failure (HF).

[0055] In one aspect, the invention provides methods and compositions for treating or preventing HF in a subject in need thereof.

[0056] In one embodiment, the method comprises administering to the subject a therapeutically effective amount of microRNA 7b-3p (miR-7b-3p) or a miR-7b-3p mimic. In one embodiment the miR-7b-3p) or a miR-7b-3p mimic is comprised in an adeno-associated virus 9 (AAV9) vector. In one embodiment, the administration comprises intracoronary catheter-based AAV9 gene delivery. In one embodiment, the administration comprises administration before, during, or after HF.

[0057] In one embodiment, the composition comprises a therapeutically effective amount of microRNA 7b-3p (miR-7b-3p) or a miR-7b-3p mimic. In one embodiment, the composition is comprised in an adeno-associated virus 9 (AAV9) vector. In one embodiment, the composition further comprises a pharmaceutically acceptable carrier.

[0058] In one embodiment, the HF comprises cardiac hypertrophy, heart dysfunction from pressure overload, failure of contractility, cardiomyocyte apoptosis, ischemic injury, stress-induced cardiomyopathy, adverse heart remodeling related to myocardial infarction, HF resulting from valvular injury, HF resulting from insufficiency, and HF resulting from viral infection.

[0059] Definitions

[0060] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.As used herein, each of the following terms has the meaning associated with it in this section.

[0061] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0062] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0063] The term “abnormal” when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the “normal” (expected) respective characteristic. Characteristics which are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type.

[0064] The term “analog” as used herein generally refers to compounds that are generally structurally similar to the compound of which they are an analog, or “parent” compound. Generally, analogs will retain some characteristics of the parent compound, e.g., a biological or pharmacological activity. An analog may lack other, less desirable characteristics, e.g., antigenicity, proteolytic instability, toxicity, and the like. An analog includes compounds in which a particular biological activity of the parent is reduced, while one or more distinct biological activities of the parent are unaffected in the “analog.” As applied to polypeptides, the term “analog” may have varying ranges of amino acid sequence identity to the parent compound, for example at least about 70%, at least about 80%-85%, at least about 86%-89%„ at least about 90%, at least about 92%, at least about 94%, at least about 96%, at least about 98% or at least about 99% of the amino acids in a given amino acid sequence of the parent or a selected portion or domain of the parent. As applied to polypeptides, the term “analog” generally refers to polypeptides which are comprised of a segment of about at least 3 amino acids that has substantial identity to at least a portion of a binding domain fusion protein. Analogs typically are at least 5 amino acids long, at least 20 amino acids long or longer, at least 50amino acids long or longer, at least 100 amino acids long or longer, at least 150 amino acids long or longer, at least 200 amino acids long or longer, and more typically at least 250 amino acids long or longer. Some analogs may lack substantial biological activity but may still be employed for various uses, such as for raising antibodies to predetermined epitopes, as an immunological reagent to detect and / or purify reactive antibodies by affinity chromatography, or as a competitive or noncompetitive agonist, antagonist, or partial agonist of a binding domain fusion protein function. As applied to polynucleotides, the term “analog” may have varying ranges of nucleic acid sequence identity to the parent compound, for example at least about 70%, at least about 80%-85%, at least about 86%-89%, at least about 90%, at least about 92%, at least about 94%, at least about 96%, at least about 98% or at least about 99% of the nucleic acids in a given nucleic acid sequence of the parent or a selected portion or domain of the parent. As applied to polynucleotides, the term “analog” generally refers to polynucleotides which are comprised of a segment of about at least 9 nucleic acids that has substantial identity to at least a portion of the parent. Analogs typically are at least 15 nucleic acids long, at least 60 nucleic acids long or longer, at least 150 nucleic acids long or longer, at least 300 nucleic acids long or longer, at least 450 nucleic acids long or longer, at least 600 nucleic acids long or longer, and more typically at least 750 nucleic acids long or longer. Some analogs may lack substantial biological activity but may still be employed for various uses, such as for encoding epitopes for raising antibodies to predetermined epitopes, as a reagent to detect and / or purify sequences by hybridization assays, or as a competitive or noncompetitive agonist, antagonist, or partial agonist of a target or modulator of a target.

[0065] “Antisense,” as used herein, refers to a nucleic acid sequence which is complementary to a target sequence, such as, by way of example, complementary to a target miRNA sequence, including, but not limited to, a mature target miRNA sequence, or a sub-sequence thereof. Typically, an antisense sequence is fully complementary to the target sequence across the full length of the antisense nucleic acid sequence.

[0066] The term “body fluid” or “bodily fluid” as used herein refers to any fluid from the body of an animal. Examples of body fluids include, but are not limited to, plasma, serum, blood, lymphatic fluid, cerebrospinal fluid, synovial fluid, urine, saliva, mucous, phlegm and sputum. A body fluid sample may be collected by any suitablemethod. The body fluid sample may be used immediately or may be stored for later use. Any suitable storage method known in the art may be used to store the body fluid sample: for example, the sample may be frozen at about -20°C to about -70°C. Suitable body fluids are acellular fluids. “Acellular” fluids include body fluid samples in which cells are absent or are present in such low amounts that the miRNA level determined reflects its level in the liquid portion of the sample, rather than in the cellular portion. Such acellular body fluids are generally produced by processing a cell-containing body fluid by, for example, centrifugation or filtration, to remove the cells. Typically, an acellular body fluid contains no intact cells however, some may contain cell fragments or cellular debris. Examples of acellular fluids include plasma or serum, or body fluids from which cells have been removed.

[0067] The term “clinical factors” as used herein, refers to any data that a medical practitioner may consider in determining a diagnosis or prognosis of disease. Such factors include, but are not limited to, the patient's medical history, a physical examination of the patient, complete blood count, analysis of the activity of enzymes, examination of cells, cytogenetics, and immunophenotyping of blood cells.

[0068] “Complementary” as used herein refers to the broad concept of subunit sequence complementarity between two nucleic acids. When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position. Thus, two nucleic acids are substantially complementary to each other when at least about 50%, at least about 60% or at least about 80% of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T and G:C nucleotide pairs).

[0069] As used herein, “conjugated” refers to covalent attachment of one molecule to a second molecule.

[0070] A “coding region” of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.A “coding region” of a mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anti-codon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon. The coding region may thus include nucleotide residues comprising codons for amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein export signal sequence).

[0071] The term “comparator” describes a material comprising none, or a normal, low, or high level of one of more of the marker (or biomarker) expression products of one or more the markers (or biomarkers) of the invention, such that the comparator may serve as a control or reference standard against which a sample can be compared.

[0072] As used herein, the term “derivative” includes a chemical modification of a polypeptide, polynucleotide, or other molecule. In the context of this invention, a “derivative polypeptide,” for example, one modified by glycosylation, pegylation, or any similar process, retains binding activity. For example, the term “derivative” of binding domain includes binding domain fusion proteins, variants, or fragments that have been chemically modified, as, for example, by addition of one or more polyethylene glycol molecules, sugars, phosphates, and / or other such molecules, where the molecule or molecules are not naturally attached to wild-type binding domain fusion proteins. A “derivative” of a polypeptide further includes those polypeptides that are “derived” from a reference polypeptide by having, for example, amino acid substitutions, deletions, or insertions relative to a reference polypeptide. Thus, a polypeptide may be “derived” from a wild-type polypeptide or from any other polypeptide. As used herein, a compound, including polypeptides, may also be “derived” from a particular source, for example from a particular organism, tissue type, or from a particular polypeptide, nucleic acid, or other compound that is present in a particular organism or a particular tissue type.

[0073] As used herein, the term “diagnosis” means detecting a disease or disorder or determining the stage or degree of a disease or disorder. Usually, a diagnosis of a disease or disorder is based on the evaluation of one or more factors and / or symptoms that are indicative of the disease. That is, a diagnosis can be made based on the presence, absence or amount of a factor which is indicative of presence or absence of the disease or condition. Each factor or symptom that is considered to be indicative for the diagnosis ofa particular disease does not need be exclusively related to the particular disease; i.e. there may be differential diagnoses that can be inferred from a diagnostic factor or symptom. Likewise, there may be instances where a factor or symptom that is indicative of a particular disease is present in an individual that does not have the particular disease. The diagnostic methods may be used independently, or in combination with other diagnosing and / or staging methods known in the medical art for a particular disease or disorder.

[0074] As used herein, the phrase “difference of the level” refers to differences in the quantity of a particular marker, such as a nucleic acid or a protein, in a sample as compared to a control or reference level. For example, the quantity of a particular biomarker may be present at an elevated amount or at a decreased amount in samples of patients with a disease compared to a reference level. In one embodiment, a “difference of a level” may be a difference between the quantity of a particular biomarker present in a sample as compared to a control of at least about 1%, at least about 2%, at least about 3%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 60%, at least about 75%, at least about 80% or more. In one embodiment, a “difference of a level” may be a statistically significant difference between the quantity of a biomarker present in a sample as compared to a control. For example, a difference may be statistically significant if the measured level of the biomarker falls outside of about 1.0 standard deviations, about 1.5 standard deviations, about 2.0 standard deviations, or about 2.5 stand deviations of the mean of any control or reference group.

[0075] A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.

[0076] In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.A disease or disorder is “alleviated” if the severity of a sign or symptom of the disease or disorder, the frequency with which such a sign or symptom is experienced by a patient, or both, is reduced.

[0077] The term “control or reference standard” describes a material comprising none, or a normal, low, or high level of one of more of the marker (or biomarker) expression products of one or more the markers (or biomarkers) of the invention, such that the control or reference standard may serve as a comparator against which a sample can be compared.

[0078] The terms “dysregulated” and “dysregulation” as used herein describes a decreased (down-regulated) or increased (up-regulated) level of expression of a miRNA present and detected in a sample obtained from subject as compared to the level of expression of that miRNA in a comparator sample, such as a comparator sample obtained from one or more normal, not-at-risk subjects, or from the same subject at a different time point. In some instances, the level of miRNA expression is compared with an average value obtained from more than one not-at-risk individuals. In other instances, the level of miRNA expression is compared with a miRNA level assessed in a sample obtained from one normal, not-at-risk subject.

[0079] By the phrase “determining the level of marker (or biomarker) expression” is meant an assessment of the degree of expression of a marker in a sample at the nucleic acid or protein level, using technology available to the skilled artisan to detect a sufficient portion of any marker expression product.

[0080] The terms “determining,” “measuring,” “assessing,” and “assaying” are used interchangeably and include both quantitative and qualitative measurement, and include determining if a characteristic, trait, or feature is present or not. Assessing may be relative or absolute. “Assessing the presence of’ includes determining the amount of something present, as well as determining whether it is present or absent.

[0081] “Differentially increased expression” or “up regulation” refers to expression levels which are at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% higher or more, and / or 1.1 fold, 1.2 fold, 1.4 fold, 1.6 fold, 1.8 fold, 2.0 fold higher or more, and any and all whole or partial increments there between than a comparator.“Differentially decreased expression” or “down regulation” refers to expression levels which are at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% lower or less, and / or 2.0 fold, 1.8 fold, 1.6 fold, 1.4 fold, 1.2 fold, 1.1 fold or less lower, and any and all whole or partial increments there between than a comparator.

[0082] As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.

[0083] The term “expression” as used herein is defined as the transcription and / or translation of a particular nucleotide sequence.

[0084] “Homologous” as used herein, refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology. By way of example, the DNA sequences 5'-ATTGCC-3' and 5'-TATGGC-3’ share 50% homology.

[0085] As used herein, “homology” is used synonymously with “identity.” “Inhibitors,” “activators,” and “modulators” of the markers are used to refer to activating, inhibitory, or modulating molecules identified using in vitro and in vivo assays of endometriosis biomarkers. Inhibitors are compounds that, e.g., bind to, partially or totally block activity, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity or expression of endometriosis biomarkers. “Activators” are compounds that increase, open, activate, facilitate, enhance activation, sensitize, agonize, or up regulate activity of endometriosis biomarkers, e.g., agonists Inhibitors, activators, or modulators also include genetically modified versions of endometriosis biomarkers, e g., versions with altered activity, as well as naturallyoccurring and synthetic ligands, antagonists, agonists, antibodies, peptides, cyclic peptides, nucleic acids, antisense molecules, ribozymes, RNAi, microRNA, and siRNA molecules, small organic molecules and the like. Such assays for inhibitors and activators include, e.g., expressing endometriosis biomarkers in vitro, in cells, or cell extracts, applying putative modulator compounds, and then determining the functional effects on activity, as described elsewhere herein.

[0086] As used herein, an “instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of a compound, composition, vector, method or delivery system of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein. Optionally, or alternately, the instructional material can describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal. The instructional material of the kit of the invention can, for example, be affixed to a container which contains the identified compound, composition, vector, or delivery system of the invention or be shipped together with a container which contains the identified compound, composition, vector, or delivery system. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.

[0087] As used herein, “isolated” means altered or removed from the natural state through the actions, directly or indirectly, of a human being. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.

[0088] “Measuring” or “measurement,” or alternatively “detecting” or “detection,” means assessing the presence, absence, quantity or amount (which can be an effective amount) of either a given substance within a clinical or subject-derived sample, including the derivation of qualitative or quantitative concentration levels of such substances, or otherwise evaluating the values or categorization of a subject’s clinical parameters.As used herein, “microRNA” or “miRNA” describes small non-coding RNA molecules, generally about 15 to about 50 nucleotides in length, in some instances 17-23 nucleotides, which can play a role in regulating gene expression through, for example, a process termed RNA interference (RNAi). RNAi describes a phenomenon whereby the presence of an RNA sequence that is complementary or antisense to a sequence in a target gene messenger RNA (mRNA) results in inhibition of expression of the target gene. miRNAs are processed from hairpin precursors of about 70 or more nucleotides (pre-miRNA) which are derived from primary transcripts (pri-miRNA) through sequential cleavage by RNAse III enzymes. miRBase is a comprehensive microRNA database located at www.mirbase.org, incorporated by reference herein in its entirety for all purposes.

[0089] A “mutation,” as used herein, refers to a change in nucleic acid or polypeptide sequence relative to a reference sequence (which in some instances is a naturally-occurring normal or “wild-type” sequence), and includes translocations, deletions, insertions, and substitutions / point mutations. A “mutant,” as used herein, refers to either a nucleic acid or protein comprising a mutation.

[0090] “Naturally occurring” as used herein describes a composition that can be found in nature as distinct from being artificially produced. For example, a nucleotide sequence present in an organism, which can be isolated from a source in nature and which has not been intentionally modified by a person, is naturally occurring.

[0091] By “nucleic acid” is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

[0092] Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5'-end;the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5'-direction.

[0093] The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the “coding strand.” Sequences on the DNA strand which are located 5' to a reference point on the DNA are referred to as “upstream sequences.” Sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as “downstream sequences.”

[0094] As used herein, “polynucleotide” includes cDNA, RNA, DNA / RNA hybrid, anti-sense RNA, siRNA, miRNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified to contain non-natural or derivatized, synthetic, or semi-synthetic nucleotide bases. Also, included within the scope of the invention are alterations of a wild type or synthetic gene, including but not limited to deletion, insertion, substitution of one or more nucleotides, or fusion to other polynucleotide sequences.

[0095] As used herein, a “primer” for amplification is an oligonucleotide that specifically anneals to a target or marker nucleotide sequence. The 3' nucleotide of the primer should be identical to the target or marker sequence at a corresponding nucleotide position for optimal primer extension by a polymerase. As used herein, a “forward primer” is a primer that anneals to the anti-sense strand of double stranded DNA (dsDNA). A “reverse primer” anneals to the sense-strand of dsDNA.

[0096] The term “recombinant DNA” as used herein is defined as DNA produced by joining pieces of DNA from different sources.

[0097] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually providedin sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0098] As used herein, the term “providing a prognosis” refers to providing a prediction of the probable course and outcome of endometriosis, including prediction of severity, duration, chances of recovery, etc. The methods can also be used to devise a suitable therapeutic plan, e.g., by indicating whether or not the condition is still at an early stage or if the condition has advanced to a stage where aggressive therapy would be ineffective.

[0099] A “reference level” of a biomarker means a level of the biomarker that is indicative of a particular disease state, phenotype, or lack thereof, as well as combinations of disease states, phenotypes, or lack thereof. A “positive” reference level of a biomarker means a level that is indicative of a particular disease state or phenotype. A “negative” reference level of a biomarker means a level that is indicative of a lack of a particular disease state or phenotype.

[0100] “Sample” or “biological sample” as used herein means a biological material isolated from an individual. The biological sample may contain any biological material suitable for detecting the desired biomarkers, and may comprise cellular and / or non-cellular material obtained from the individual.

[0101] “Standard control value” as used herein refers to a predetermined amount of a particular protein or nucleic acid that is detectable in a biological sample. The standard control value is suitable for the use of a method of the present invention, in order for comparing the amount of a protein or nucleic acid of interest that is present in a biological sample. An established sample serving as a standard control provides an average amount of the protein or nucleic acid of interest in the biological sample that is typical for an average, healthy person of reasonably matched background, e.g., gender, age, ethnicity, and medical history. A standard control value may vary depending on the protein or nucleic acid of interest and the nature of the sample (e.g., serum).

[0102] The terms “subject,” “patient,” “individual,” and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In certain non-limiting embodiments, thepatient, subject or individual is a human.

[0103] The terms “treat,” “treating,” and “treatment,” refer to therapeutic or preventative measures described herein. The methods of “treatment” employ administration to a subject, in need of such treatment, a composition of the present invention, for example, a subject afflicted a disease or disorder or a subject who ultimately may acquire such a disease or disorder, in order to prevent, cure, delay, reduce the severity of, reverse, or ameliorate one or more symptoms of the disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment.

[0104] The terms “underexpress”, “underexpression”, “underexpressed”, or “down-regulated” interchangeably refer to a protein or nucleic acid that is transcribed or translated at a detectably lower level in a biological sample from a woman with endometriosis, in comparison to a biological sample from a woman without endometriosis. The term includes underexpression due to transcription, post transcriptional processing, translation, post-translational processing, cellular localization (e.g., organelle, cytoplasm, nucleus, cell surface), and RNA and protein stability, as compared to a control. Underexpression can be detected using conventional techniques for detecting mRNA (i.e., Q-PCR, RT-PCR, PCR, hybridization) or proteins (i.e., ELISA, immunohistochemical techniques). Underexpression can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or less in comparison to a control. In certain instances, underexpression is 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-fold or more lower levels of transcription or translation in comparison to a control.

[0105] The terms “overexpress”, “overexpression”, “overexpressed”, or “up-regulated” interchangeably refer to a protein or nucleic acid (RNA) that is transcribed or translated at a detectably greater level, usually in a biological sample from a woman with endometriosis, in comparison to a biological sample from a woman without endometriosis. The term includes overexpression due to transcription, post transcriptional processing, translation, post-translational processing, cellular localization (e.g., organelle, cytoplasm, nucleus, cell surface), and RNA and protein stability, as compared to a cell from a woman without endometriosis. Overexpression can be detected using conventional techniques for detecting mRNA (i.e., Q-PCR, RT-PCR, PCR, hybridization)or proteins (i.e., ELISA, immunohistochemical techniques). Overexpression can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a cell from a woman without endometriosis. In certain instances, overexpression is 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-fold, or more higher levels of transcription or translation in comparison to a cell from a woman without endometriosis.

[0106] “Variant” as the term is used herein, is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively, but retains essential properties of the reference molecule. Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Changes in the sequence of peptide variants are typically limited or conservative, so that the sequences of the reference peptide and the variant are closely similar overall and, in many regions, identical. A variant and reference peptide can differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.

[0107] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0108] DescriptionIn one aspect, the invention provides methods and compositions for treating or preventing heart failure (HF) in a subject in need thereof.

[0109] In one embodiment, the HF comprises cardiac hypertrophy, heart dysfunction from pressure overload, failure of contractility, cardiomyocyte apoptosis, ischemic injury, stress-induced cardiomyopathy, and adverse heart remodeling related to myocardial infarction.

[0110] Methods

[0111] In one embodiment, the method comprises administering to the subject a therapeutically effective amount of microRNA 7b-3p (miR-7b-3p) or a miR-7b-3p mimic. In one embodiment the miR-7b-3p) or a miR-7b-3p mimic is comprised in an adeno-associated virus 9 (AAV9) vector. In one embodiment, the administration comprises intracoronary catheter-based AAV9 gene delivery. In one embodiment, the administration comprises administration before, during, or after HF. In one embodiment, the miR-7b-3p or miR-7b-3p mimic comprises a sequence at least 90% identical to a sequence set forth in SEQ ID NOs: 1-5.

[0112] In one embodiments, the method of the invention comprises administering to a subject an effective amount of a composition that activates or increases the expression, activity, or both of miR-7b-3p in a cell of the subject. In one embodiment, the method of the invention comprises administering to a subject an effective amount of a composition that mimics the activity of miR-7b-3p in a cell of the subject. In one embodiment, the method of the invention comprises administering to a subject an effective amount of a composition comprising miR-7b-3p or a miR-7b-3p mimic.

[0113] miR-7b-3p activity can be increased or activated using any method known to the skilled artisan. Examples of methods that increase miR-7b-3p activity, include but are not limited to, increasing the expression of an endogenous gene encoding miR-7b-3p, increasing the expression the miR-7b-3p, and increasing the function, activity, or stability of miR-7b-3p. miR-7b-3p activator may therefore be a compound that increases expression of a gene encoding miR-7b-3p, increases RNA half-life, stability, or increases miR-7b-3p function, activity or stability. In some aspects, the level miR-7b-3p can be increased by decreasing the level or activity of a protein or nucleicacid that degrades or inhibits the miR-7b-3p. A miR-7b-3p activator may be any type of compound, including but not limited to, a peptide, a nucleic acid, an aptamer, a peptidometic, and a small molecule, or combinations thereof.

[0114] Activation of miR-7b-3p may be accomplished either directly or indirectly. For example, miR-7b-3p may be directly activated by compounds or compositions that directly interact with miR-7b-3p, such as proteins. Levels of miR-7b-3p may be directly increased by administering a miR-7b-3p or a miR-7b-3p mimic. Alternatively, miR-7b-3p may be increased or activated indirectly by compounds or compositions that inhibit regulators which inhibit miR-7b-3p expression.

[0115] Modulating expression of an endogenous gene includes providing a specific modulator of gene expression. Decreasing expression of mRNA or protein includes decreasing the half-life or stability of mRNA or decreasing expression of mRNA.

[0116] Methods of increasing expression or activity of miR-7b-3p include, but are not limited to, methods that use an siRNA, a miRNA, an antisense nucleic acid, CRISPR guide RNA, a ribozyme, an expression vector encoding a transdominant negative mutant, a peptide, a small molecule, and combinations thereof.

[0117] Administration of a composition described herein in a method of treatment can be achieved in a number of different ways, using methods known in the art. It will be appreciated that a composition of the invention may be administered to a subject either alone, or in conjunction with another therapeutic agent.

[0118] The administration of the compositions may be carried out in any suitable manner, including by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i. v.) injection, or intraperitoneally. In one embodiment, the compositions of the present invention are administered to a patient by intradermal or subcutaneous injection. In some embodiments, the injection comprises injection directly into cardiac tissue. In some embodiments, the injection comprises injection directly into cardiac myocytes. In some embodiments, the injection comprises injection directly into one or more cells of the heart, wherein the one or more cells of the heart comprise atrial cardiomyocytes, ventricular cardiomyocytes, fibroblasts (FBs), endothelial cells (ECs),pericytes, smooth muscle cells (SMCs), immune cells (myeloid and lymphoid), adipocytes, mesothelial cells or neuronal cells. In another embodiment, the compositions of the present invention are preferably administered by i.v. injection. The compositions may administered via intra-coronary delivery or infusion for a period of minutes. In some embodiments, the administration comprises intracoronary catheter-based delivery.

[0119] Dosing

[0120] In one embodiment, a composition is administered to a subject. The composition may also be a hybrid or fusion to facilitate, for instance, delivery to target cells or efficacy. In one embodiment, a hybrid composition may comprise a tissuespecific targeting sequence. For example, in one embodiment, the composition is targeted to uterine cell.

[0121] The therapeutic and prophylactic methods of the invention thus encompass the use of pharmaceutical compositions comprising a modulator described herein, or a combination thereof to practice the methods of the invention. The pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of from about 1 ng / kg / day to about 100 mg / kg / day. In one embodiment, the invention envisions administration of a dose which results in a concentration of the compound of the present invention from about 1 pM to about 10 pM in a mammal.

[0122] Typically, dosages which may be administered in a method of the invention to a mammal, for example a human, range in amount from 0 about.5 pg to about 50 mg per kilogram of body weight of the mammal, while the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of mammal and type of disease state being treated, the age of the mammal and the route of administration. In one embodiment, the dosage of the compound will vary from about 1 pg to about 10 mg per kilogram of body weight of the mammal. In one embodiment, the dosage will vary from about 3 pg to about 1 mg per kilogram of body weight of the mammal.

[0123] In one embodiment, the composition of the present invention is administered to a subject via an AAV vector, wherein the AAV vector is AAV9. In oneembodiment, the AAV9 is administered at about 1x1012viral genomes (vg’s) to about 5xl014vg per patient via intra-coronary infusion.

[0124] The compound may be administered to a mammal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the mammal, etc.

[0125] One exemplary approach provided by the disclosure involves administration of a recombinant therapeutic, such as a recombinant miRNA molecule, variant, or fragment thereof, either directly to the site of a potential or actual disease-affected tissue or systemically (for example, by any conventional recombinant administration technique). The dosage of the administered miRNA depends on a number of factors, including the size and health of the individual patient. For any particular subject, the specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.

[0126] A miRNA or miRNA mimic may be administered in dosages between about 1 and about 100 mg / kg (e.g., 1, 5, 10, 20, 25, 50, 75, and 100 mg / kg).

[0127] In one embodiment, the miRNA or miRNA mimic is administered for a period of about 2 weeks. In one embodiment, the miRNA or miRNA mimic is administered for a period of about 3 weeks. In one embodiment, the miRNA or miRNA mimic is administered for a period of about 4 weeks. In one embodiment, the miRNA or miRNA mimic is administered for a period that ranges from about 2 weeks to about 4 weeks.

[0128] In one embodiment, the miRNA or miRNA mimic is administered before a subject experiences HF. In one embodiment, the miRNA or miRNA mimic is administered 30-60 minutes before a subject experiences HF. In one embodiment, the miRNA or miRNA mimic is administered 1-2 hours before a subject experiences HF. In one embodiment, the miRNA or miRNA mimic is administered for a period of about 2 weeks before a subject experiences. In one embodiment, the miRNA or miRNA mimic isadministered for a period of about 3 weeks before a subject experiences HF. In one embodiment, the miRNA or miRNA mimic is administered for a period of about 4 weeks before a subject experiences HF. In one embodiment, the miRNA or miRNA mimic is administered for a period that ranges from about 2 weeks to about 4 weeks before a subject experiences HF.

[0129] In one embodiment, the miRNA or miRNA mimic is administered after a subject experiences myocardial infarction. In one embodiment, the miRNA or miRNA mimic is administered 30-60 minutes after a subject experiences myocardial infarction. In one embodiment, the miRNA or miRNA mimic is administered 1-2 hours after a subject experiences myocardial infarction. In one embodiment, the miRNA or miRNA mimic is administered for a period of about 2 weeks after a subject experiences myocardial infarction. In one embodiment, the miRNA or miRNA mimic is administered for a period of about 3 weeks after a subject experiences myocardial infarction. In one embodiment, the miRNA or miRNA mimic is administered for a period of about 4 weeks after a subject experiences myocardial infarction. In one embodiment, the miRNA or miRNA mimic is administered for a period that ranges from about 2 weeks to about 4 weeks after a subject experiences myocardial infarction.

[0130] In one embodiment, the miRNA or miRNA mimic is administered at a concentration of about 30pmol / lxl06cells. In one embodiment, the cells comprise cardiomyocytes. In one embodiment, the cells comprise human ventricular cardiomyocytes. In one embodiment, the cells comprise neonatal rat ventricular cardiomyocytes (N VMs).

[0131] Compositions

[0132] In one embodiment, the composition comprises a therapeutically effective amount of microRNA 7b-3p (miR-7b-3p) or a miR-7b-3p mimic. In one embodiment, the composition is comprised in an adeno-associated virus 9 (AAV9) vector. In one embodiment, the composition further comprises a pharmaceutically acceptable carrier. In one embodiment, the miR-7b-3p or miR-7b-3p mimic comprises a sequence at least 90% identical to a sequence set forth in SEQ ID NOs: 1-5.microRNA (miRNA) based therapies

[0133] The disclosure provides compositions comprising miR-7b-3p or a miR-7b-3 mimic. A miRNA mimic is a synthetic RNA that mimics the function of endogenous miRNAs. A recombinant miRNA or a nucleic acid molecule encoding such a miRNA may be administered to treat or prevent a cardiomyopathy and / or heart failure (HF) in a subject in need thereof. In one approach, the miRNA is administered as a naked RNA molecule. In another approach, it is administered in an expression vector suitable for expression in a mammalian cell.

[0134] A nucleic acid of the disclosure may be administered in combination with a carrier or lipid to increase cellular uptake. For example, the oligonucleotide may be administered in combination with a cationic lipid. Examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE, and DOTAP. The publication of W00071096, which is specifically incorporated by reference, describes different formulations, such as a DOTAP: cholesterol or cholesterol derivative formulation that can effectively be used for gene therapy. Other disclosures also discuss different lipid or liposomal formulations including nanoparticles and methods of administration; these include, but are not limited to, U.S. Patent Publication 20030203865, 20020150626, 20030032615, and 20040048787, which are specifically incorporated by reference to the extent they disclose formulations and other related aspects of administration and delivery of nucleic acids. Methods used for forming particles are also disclosed in U.S. Pat. Nos.

[0135] 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972,900, which are incorporated by reference for those aspects.

[0136] The nucleic acids may also be administered in combination with a cationic amine such as poly (L-lysine). Nucleic acids may also be conjugated to a chemical moiety, such as transferrin and cholesteryls. In addition, oligonucleotides may be targeted to certain organelles by linking specific chemical groups to the oligonucleotide.

[0137] Polynucleotide therapy featuring a nucleic acid molecule encoding a miRNA is another therapeutic approach for treating or preventing endometriosis in a subject. Expression vectors encoding the miRNAs can be delivered to cells of a subject for the treatment or prevention of endometriosis. The nucleic acid molecules must bedelivered to the cells of a subject in a form in which they can be taken up and are advantageously expressed so that therapeutically effective levels can be achieved.

[0138] Methods for delivery of the nucleic acid molecules to the cell according to the disclosure include using a delivery system, such as liposomes, polymers, microspheres, gene therapy vectors, and naked DNA vectors. In one embodiment the compositions of the present invention are delivered via AAV9.

[0139] miRNAs may be encoded by a nucleic acid molecule comprised in a vector. The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., BACs and YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Sambrook et al., 2012 and Ausubel et al., 2003, both incorporated herein by reference. Transducing viral (e.g., retroviral, adenoviral, lentiviral and adeno-associated viral) vectors can be used for somatic cell gene therapy, especially because of their high efficiency of infection and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al, Current Eye Research 15:833-844, 1996; Bloomer et al, Journal of Virology 71 :6641-6649, 1997; Naldini et al, Science 272:263-267, 1996; andMiyoshi et al, Proc. Natl. Acad. Sci. U.S.A. 94: 10319, 1997). For example, a nucleotide sequence encoding a miRNA molecule can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from a promoter specific for a target cell type of interest. Other viral vectors that can be used include, for example, a vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus (also see, for example, the vectors of Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244: 1275-1281, 1989; Eglitis et al, BioTechniques 6:608-614, 1988; Tolstoshev et al, Current Opinion in Biotechnology 1 : 55-61 , 1990; Sharp, The Lancet 337: 1277-1278, 1991; Cometta et al, Nucleic Acid Research andMolecular Biology 36:31 1- 322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991; Miller et al, Biotechnology 7:980-990, 1989; Le Gal La Salle et al, Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995).

[0140] Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al, N. Engl. J. Med 323:370, 1990; Anderson et al, U.S. Pat.

[0141] No.5,399,346).

[0142] Other suitable methods for nucleic acid delivery to effect expression of compositions of the present disclosure are believed to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art.

[0143] The administration of a nucleic acid or peptide inhibitor of the invention to the subject may be accomplished using gene therapy. Gene therapy, which is based on inserting a therapeutic gene into a cell by means of an ex vivo or an in vivo technique. Suitable vectors and methods have been described for genetic therapy in vitro or in vivo, and are known as expert on the matter; see, for example, Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813; Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res 77 (1995), 1077-1086; Wang, Nature Medicine 2 (1996), 714-716; WO94 / 29469; W097 / 00957 or Schaper, Current Opinion in Biotechnology 7 (1996), 635-640 and the references quoted therein. The polynucleotide of the invention can be designed for direct insertion or by insertion through liposomes or viral vectors (for example, adenoviral or retroviral vectors) in the cell. In one embodiment, the cell is a cell of the germinal line, an embryonic cell or egg cell or derived from the same. In one embodiment, the cell is a core cell. Suitable gene distribution systems that can be used according to the invention may include liposomes, distribution systems mediated by receptor, naked DNA and viral vectors such as the herpes virus, the retrovirus, the adenovirus and adeno-associated viruses, among others. The distribution of nucleic acids to a specific site in the body for genetic therapy can also be achieved by using a biolistic distribution system, such as that described by Williams (Proc. Natl. Acad. Sci. USA, 88 (1991), 2726-2729). The standard methods for transfecting cells with recombining DNA are well known by an expert on thesubject of molecular biology, see, for example, WO94 / 29469; see also supra. Genetic therapy can be carried out by directly administering the recombining DNA molecule or the vector of the invention to a patient or transfecting the cells with the polynucleotide or the vector of the invention ex vivo and administering the transfected cells to the patient.

[0144] A variety of methods can be used to express nucleic acids in a cell.

[0145] Nucleic acids can be cloned into a number of types of vectors. However, the present invention should not be construed to be limited to any particular vector. Instead, the present invention should be construed to encompass a wide variety of vectors which are readily available and / or known in the art. For example, the nucleic acid of the invention can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0146] In specific embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector and a mammalian cell vector. Numerous expression vector systems exist that comprise at least a part or all of the compositions discussed above. Prokaryote- and / or eukaryote-vector based systems can be employed for use with the present invention to produce polynucleotides, or their cognate polypeptides. Many such systems are commercially and widely available.

[0147] Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2012), and in Ausubel et al. (1999), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In some embodiments, a murine stem cell virus (MSCV) vector is used to express a desired nucleic acid. MSCV vectors have been demonstrated to efficiently express desired nucleic acids in cells. However, the invention should not be limited to only using a MSCV vector, rather any retroviral expression method is included in the invention. Other examples of viral vectors are those based upon Moloney Murine Leukemia Virus (MoMuLV) and HIV. In some embodiments, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No. 6,326,193).Additional regulatory elements, e.g., enhancers, can be used modulate the frequency of transcriptional initiation. A promoter may be one naturally associated with a gene or nucleic acid sequence, as may be obtained by isolating the 5’ non-coding sequences located upstream of the coding segment and / or exon. Such a promoter can be referred to as “endogenous.” Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.

[0148] Alternatively, certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not “naturally occurring,” e.g., containing different elements of different transcriptional regulatory regions, and / or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and / or nucleic acid amplification technology, including PCR, in connection with the compositions disclosed herein (U.S. Pat. No. 4,683,202, U.S. Pat. No. 5,928,906). Furthermore, it is contemplated the control sequences that direct transcription and / or expression of sequences within non-nuclear organelles such as mitochondria, and the like, can be employed as well.

[0149] Naturally, it will be important to employ a promoter and / or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know how to use promoters, enhancers, and cell type combinations for protein expression, for example, see Sambrook et al. (2012). The promoters employed may be constitutive, tissue-specific, inducible, and / or useful under the appropriate conditions to direct high-level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and fragments thereof.

[0150] An example of a promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequencecapable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, Moloney virus promoter, the avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the muscle creatine promoter. Further, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter in the invention provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter. Further, the invention includes the use of a tissue-specific promoter or cell-type specific promoter, which is a promoter that is active only in a desired tissue or cell. Tissue-specific promoters are well known in the art and include, but are not limited to, the promoters that are functional in cells of any tissue of the mammalian heart or organs related thereto. In some embodiments, the promoter comprises the troponin T (cTnT) promoter.

[0151] In order to assess the expression of the nucleic acids, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In other embodiments, the selectable marker may be carried on a separate nucleic acid and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are known in the art and include, for example, antibioticresistance genes, such as neo and the like.

[0152] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. Reporter genes that encode foreasily assayable proteins are well known in the art. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.

[0153] Suitable reporter genes may include genes encoding luciferase, betagalactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (see, e.g., Ui-Tei et al., 2000 FEBS Lett. 479:79-82). Suitable expression systems are well known and may be prepared using well known techniques or obtained commercially. In general, the construct with the minimal 5' flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter-driven transcription.

[0154] Methods of introducing and expressing nucleic acids into a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast or insect cell by any method in the art. For example, the expression vector can be transferred into a host cell by physical, chemical or biological means.

[0155] Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, laserporation and the like. Methods for producing cells comprising vectors and / or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al. (2012) and Ausubel et al. (1999).

[0156] Biological methods for introducing a nucleic acid of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.

[0157] Chemical means for introducing a nucleic acid into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules,microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle). The preparation and use of such systems is well known in the art.

[0158] Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the nucleic acid of the present invention, in order to confirm the presence of the recombinant DNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.

[0159] Gene transfer can also be achieved using non-viral means involving transfection in vitro. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA into a cell. miRNA expression for use in polynucleotide therapy methods can be directed from any suitable promoter (e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element. For example, if desired, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid. The enhancers used can include, without limitation, those that are characterized as tissue- or cell-specific enhancers. For any particular subject, the specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.

[0160] In various embodiments, the composition comprises an oligonucleotide that contains the nucleotide sequence of miR-7b-3p. In certain embodiments, the oligonucleotide comprises the nucleotide sequence of miR-7b-3p in a pre -microRNA, mature or hairpin form. In other embodiments, a combination of oligonucleotides comprising a sequence of miR-7b-3p, any pre -miRNA, any fragment, or any combination thereof is envisioned.miRNAs can be synthesized to include a modification that imparts a desired characteristic. For example, the modification can improve stability, hybridization thermodynamics with a target nucleic acid, targeting to a particular tissue or cell -type, or cell permeability, e.g., by an endocytosis-dependent or -independent mechanism.

[0161] Modifications can also increase sequence specificity, and consequently decrease off-site targeting. Methods of synthesis and chemical modifications are described in greater detail below. If desired, miRNA molecules may be modified to stabilize the miRNAs against degradation, to enhance half-life, or to otherwise improve efficacy. Desirable modifications are described, for example, in U.S. Patent Publication Nos. 20070213292, 20060287260, 20060035254. 20060008822. and 2005028824, each of which is hereby incorporated by reference in its entirety. For increased nuclease resistance and / or binding affinity to the target, the single- stranded oligonucleotide agents featured in the disclosure can include 2'-O-methyl, 2'-fluorine, 2'-O-methoxyethyl, 2'-O-aminopropyl, 2'-amino, and / or phosphorothioate linkages. Inclusion of locked nucleic acids (LNA), ethylene nucleic acids (ENA), e.g., 2'-4'-ethylene- bridged nucleic acids, and certain nucleotide modifications can also increase binding affinity to the target. The inclusion of pyranose sugars in the oligonucleotide backbone can also decrease endonucleolytic cleavage. A oligonucleotide can be further modified by including a 3' cationic group, or by inverting the nucleoside at the 3 '-terminus with a 3 -3' linkage. In another alternative, the 3 '-terminus can be blocked with an aminoalkyl group. Other 3' conjugates can inhibit 3 '-5' exonucleolytic cleavage. While not being bound by theory, a 3' may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 3' end of the oligonucleotide. Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (D-ribose, deoxyribose, glucose etc.) can block 3'-5'-exonucleases.

[0162] In one embodiment, the miRNA includes a 2'-modified oligonucleotide containing oligodeoxynucleotide gaps with some or all intemucleotide linkages modified to phosphorothioates for nuclease resistance. The presence of methylphosphonate modifications increases the affinity of the oligonucleotide for its target RNA and thus reduces the ICsQ. This modification also increases the nuclease resistance of the modified oligonucleotide. It is understood that the methods and reagents of the presentdisclosure may be used in conjunction with any technologies that may be developed to enhance the stability or efficacy of an inhibitory nucleic acid molecule.

[0163] miRNA molecules include nucleotide oligomers containing modified backbones or non-natural internucleoside linkages. Oligomers having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this disclosure, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone are also considered to be nucleotide oligomers. Nucleotide oligomers that have modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriest- ers, and boranophosphates. Various salts, mixed salts and free acid forms are also included. Representative United States patents that teach the preparation of the above phosphorus- containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243;

[0164] 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.

[0165] Nucleotide oligomers having modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyl eneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0166] Representative United States patents that teach the preparation of the aboveoligonucleotides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561 ,225; 5,596,086; 5,602,240;

[0167] 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference. Nucleotide oligomers may also contain one or more substituted sugar moieties. Such modifications include 2'-O-methyl and 2'- methoxyethoxy modifications. Another desirable modification is 2'-dimethylaminooxyethoxy, 2'-aminopropoxy and 2'-fluoro. Similar modifications may also be made at other positions on an oligonucleotide or other nucleotide oligomer, particularly the 3' position of the sugar on the 3' terminal nucleotide. Nucleotide oligomers may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,1 18,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,81 1 ; 5,576,427; 5,591,722; 5,597,909; 5,610,300;

[0168] 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incorporated by reference in its entirety.

[0169] In other nucleotide oligomers, both the sugar and the internucleoside linkage, i.e., the backbone, are replaced with groups. Methods for making and using these nucleotide oligomers are described, for example, in "Peptide Nucleic Acids (PNA):

[0170] Protocols and Applications" Ed. P. E. Nielsen, Horizon Press, Norfolk, United Kingdom, 1999. Representative United States patents that teach the preparation of PNAs include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331 ; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497- 1500.

[0171] In other embodiments, a single stranded modified nucleic acid molecule (e.g., a nucleic acid molecule comprising a phosphorothioate backbone and 2'-0Me sugar modifications is conjugated to cholesterol.

[0172] A miRNA described herein, which may be in the mature or hairpin form, may be provided as a naked oligonucleotide that is capable of entering a tumor cell. In some cases, it may be desirable to utilize a formulation that aids in the delivery of amiRNA or other nucleotide oligomer to cells (see, e g., U.S. Pat. Nos. 5,656,61 1, 5,753,613, 5,785,992, 6,120,798, 6,221,959, 6,346,613, and 6,353,055, each of which is hereby incorporated by reference).

[0173] In some examples, the miRNA composition is at least partially crystalline, uniformly crystalline, and / or anhydrous (e.g., less than 80, 50, 30, 20, or 10% water). In another example, the miRNA composition is in an aqueous phase, e.g., in a solution that includes water. The aqueous phase or the crystalline compositions can be incorporated into a delivery vehicle, e.g., a liposome (particularly for the aqueous phase), or a particle (e.g., a microparticle as can be appropriate for a crystalline composition). Generally, the miRNA composition is formulated in a manner that is compatible with the intended method of administration. A miRNA composition can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes an oligonucleotide agent, e.g., a protein that complexes with the oligonucleotide agent. Still other agents include chelators, e.g., EDTA (e.g., to remove divalent cations such as Mg ), salts, and RNAse inhibitors (e.g., a broad specificity RNAse inhibitor). In one embodiment, the miRNA composition includes another miRNA, e.g., a second miRNA composition (e.g., a microRNA that is distinct from the first). Still other preparations can include at least three, five, ten, twenty, fifty, or a hundred or more different oligonucleotide species.

[0174] In certain embodiments, the composition comprises an oligonucleotide composition that mimics the activity of miR-7b-3p, described herein. In certain embodiments, the composition comprises oligonucleotides having nucleobase identity to the nucleobase sequence of miR-7b-3p, and are thus designed to mimic the activity of miR-7b-3p. In certain embodiments, the oligonucleotide composition that mimics miRNA activity comprises a double-stranded RNA molecule which mimics the mature miRNA hairpins or processed miRNA duplexes

[0175] In one embodiment, the oligonucleotide shares identity with endogenous miRNA or miRNA precursor nucleobase sequences. An oligonucleotide selected for inclusion in a composition of the present invention may be one of a number of lengths. Such an oligonucleotide can be from 7 to 100 linked nucleosides in length. For example, an oligonucleotide sharing nucleobase identity with a miRNA may be from 7 to 30 linkednucleosides in length. An oligonucleotide sharing identity with a miRNA precursor may be up to 100 linked nucleosides in length. In certain embodiments, an oligonucleotide comprises 7 to 30 linked nucleosides. In certain embodiments, an oligonucleotide comprises 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 28, 29, or 30 linked nucleotides. In certain embodiments, an oligonucleotide comprises 19 to 23 linked nucleosides. In certain embodiments, an oligonucleotide is from 40 up to 50, 60, 70, 80, 90, or 100 linked nucleosides in length.

[0176] In certain embodiments, an oligonucleotide has a sequence that has a certain identity to a miRNA or a precursor thereof. Nucleobase sequences of mature miRNAs and their corresponding stem-loop sequences described herein are the sequences found in miRBase, an online searchable database of miRNA sequences and annotation. Entries in the miRBase Sequence database represent a predicted hairpin portion of a miRNA transcript (the stem-loop), with information on the location and sequence of the mature miRNA sequence. The miRNA stem-loop sequences in the database are not strictly precursor miRNAs (pre-miRNAs), and may in some instances include the pre-miRNA and some flanking sequence from the presumed primary transcript. The miRNA nucleobase sequences described herein encompass any version of the miRNA, including the sequences described in Release 10.0 of the miRBase sequence database and sequences described in any earlier Release of the miRBase sequence database. A sequence database release may result in the re-naming of certain miRNAs. A sequence database release may result in a variation of a mature miRNA sequence. The compositions of the present invention encompass oligomeric compound comprising oligonucleotides having a certain identity to any nucleobase sequence version of a miRNAs described herein.

[0177] In certain embodiments, an oligonucleotide has a nucleobase sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the miRNA over a region of 7, 8, 9, or 10 nucleobases. Accordingly, in certain embodiments the nucleobase sequence of an oligonucleotide may have one or more non-identical nucleobases with respect to the miRNA. For example, in one embodiment, the oligonucleotide has a nucleobase sequence at least 60%, 65%, 70%, 75%, 80%, 85%,90%, 95%, 97%, 98% or 99% identical to the one of SEQ ID NOs: 1-5 over a region of 7, 8, 9, or 10 nucleobases.

[0178] In certain embodiments, the composition comprises a nucleic acid molecule encoding a miRNA, precursor, mimic, or fragment thereof. For example, the composition may comprise a viral vector, plasmid, cosmid, or other expression vector suitable for expressing the miRNA, precursor, mimic, or fragment thereof in a desired mammalian cell or tissue.

[0179] In other related aspects, the invention includes an isolated nucleic acid. In some instances, the activator is an siRNA, antisense molecule, or CRISPR guide RNA, which activates miR-7b-3p. In one embodiment, the nucleic acid comprises a promoter / regulatory sequence such that the nucleic acid is capable of directing expression of the nucleic acid. Thus, the invention encompasses expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (2008, Current Protocols in Molecular Biology, John Wiley & Sons, New York) and as described elsewhere herein. In one embodiment, siRNA is used to increase the level of miR-7b-3p. RNA interference (RNAi) is a phenomenon in which the introduction of double-stranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. In the cell, long dsRNAs are cleaved into short 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease known as Dicer. The siRNAs subsequently assemble with protein components into an RNA-induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. Soutschek et al. (2004, Nature 432:173-178) describe a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G / C content, C / T content at the termini, Tm and the nucleotide content of the 3’ overhang. See, for instance, Schwartz et al., 2003, Cell, 115:199-208 and Khvorova et al., 2003, Cell 115:209-216. In some aspects, the level of miR-7b-3p can be increased by decreasing thelevel or activity of a protein or nucleic acid that degrades or inhibits the miR-7b-3p. Therefore, the present invention also includes methods of increasing levels of miR-7b-3p using RNAi technology.

[0180] In another aspect, the invention includes a vector comprising an siRNA or antisense polynucleotide. In one embodiment, the siRNA or antisense polynucleotide is capable of inhibiting the expression of a target polypeptide. In one embodiment, the siRNA or antisense polynucleotide is capable of increasing the expression of a target miRNA. The incorporation of a desired polynucleotide into a vector and the choice of vectors is well-known in the art as described in, for example, Sambrook et al., supra, and Ausubel et al., supra, and elsewhere herein.

[0181] In certain embodiments, the expression vectors described herein encode a short hairpin RNA (shRNA). shRNA are well known in the art and are directed against the mRNA of a target, thereby decreasing the expression of the target. In certain embodiments, the encoded shRNA is expressed by a cell, and is then processed into siRNA. For example, in certain instances, the cell possesses native enzymes (e.g., dicer) that cleaves the shRNA to form siRNA.

[0182] The siRNA, shRNA, or antisense polynucleotide can be cloned into a number of types of vectors as described elsewhere herein. For expression of the siRNA or antisense polynucleotide, at least one module in each promoter functions to position the start site for RNA synthesis.

[0183] In order to assess the expression of the siRNA, shRNA, or antisense polynucleotide, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected using a viral vector. In other embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are known in the art and include, for example, antibiotic-resistance genes, such as neomycin resistance and the like.

[0184] Therefore, in another aspect, the invention relates to a vector, comprising the nucleotide sequence of the invention or the construct of the invention. The choice ofthe vector will depend on the host cell in which it is to be subsequently introduced. In a particular embodiment, the vector of the invention is an expression vector. Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. In specific embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector and a mammalian cell vector. Prokaryote- and / or eukaryotevector based systems can be employed for use with the present invention to produce polynucleotides, or their cognate polypeptides. Many such systems are commercially and widely available.

[0185] Further, the expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., and in Ausubel et al., and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No. 6,326,193.

[0186] Vectors suitable for the insertion of the polynucleotides are vectors derived from expression vectors in prokaryotes such as pUC18, pUC19, Bluescript and the derivatives thereof, mpl8, mp!9, pBR322, pMB9, ColEl, pCRl, RP4, phages and “shuttle” vectors such as pSA3 and pAT28, expression vectors in yeasts such as vectors of the type of 2 micron plasmids, integration plasmids, YEP vectors, centromere plasmids and the like, expression vectors in insect cells such as vectors of the pAC series and of the pVL, expression vectors in plants such as pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series and the like, and expression vectors in eukaryotic cells based on viral vectors (adenoviruses, viruses associated to adenoviruses such as retroviruses and, particularly, lentiviruses) as well as non-viral vectors such as pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1 / hyg, pHMCV / Zeo, pCR3.1, pEFI / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTRACER-HCMV, pUB6 / V5-His, pVAXl, pZeoSV2, pCI, pSVL and PKSV-10, pBPV-1, pML2d and pTDTl.

[0187] By way of illustration, the vector in which the nucleic acid sequence isintroduced can be a plasmid which is or is not integrated in the genome of a host cell when it is introduced in the cell. Illustrative, non-limiting examples of vectors in which the nucleotide sequence of the invention or the gene construct of the invention can be inserted include a tet-on inducible vector for expression in eukaryote cells.

[0188] The vector may be obtained by conventional methods known by persons skilled in the art (Sambrook et al.). In a particular embodiment, the vector is a vector useful for transforming animal cells.

[0189] In one embodiment, the recombinant expression vectors may also contain nucleic acid molecules which encode a peptide or peptidomimetic of invention, described elsewhere herein.

[0190] Additional promoter elements, i.e., enhancers, regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.

[0191] A promoter may be one naturally associated with a gene or polynucleotide sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and / or exon. Such a promoter can be referred to as “endogenous.” Similarly, an enhancer may be one naturally associated with a polynucleotide sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a polynucleotide sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a polynucleotide sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not “naturallyoccurring,” z.e., containing different elements of different transcriptional regulatory regions, and / or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and / or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (U.S. Patent 4,683,202, U.S. Patent 5,928,906). Furthermore, it is contemplated the control sequences that direct transcription and / or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.

[0192] Naturally, it will be important to employ a promoter and / or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know how to use promoters, enhancers, and cell type combinations for protein expression, for example, see Sambrook et al. The promoters employed may be constitutive, tissue-specific, inducible, and / or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and / or peptides. The promoter may be heterologous or endogenous.

[0193] A promoter sequence exemplified in the experimental examples presented herein is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, Moloney virus promoter, the avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the muscle creatine promoter. Further, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter in the invention provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operativelylinked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter. Further, the invention includes the use of a tissue specific promoter, which promoter is active only in a desired tissue (e.g., skin). Tissue specific promoters are well known in the art and include, but are not limited to, the keratin 14 promoter and the fascin promoter sequences.

[0194] In a particular embodiment, the expression of the nucleic acid is externally controlled. In a more particular embodiment, the expression is externally controlled using the doxycycline Tet-On system.

[0195] The recombinant expression vectors may also contain a selectable marker gene which facilitates the selection of transformed or transfected host cells. Suitable selectable marker genes are genes encoding proteins such as G418 and hygromycin which confer resistance to certain drugs, P-galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin such as IgG. The selectable markers may be introduced on a separate vector from the nucleic acid of interest.

[0196] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. Reporter genes that encode for easily assayable proteins are well known in the art. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.

[0197] Suitable reporter genes may include genes encoding luciferase, betagalactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (see, e.g., Ui-Tei et al., 2000 FEBS Lett. 479:79-82). Suitable expression systems are well known and may be prepared using well known techniques or obtained commercially. Internal deletion constructs may be generated using unique internal restriction sites or by partial digestion of non-unique restriction sites. Constructs may then be transfected into cells that display high levels of siRNApolynucleotide and / or polypeptide expression. In general, the construct with the minimal 5' flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter-driven transcription.

[0198] Recombinant expression vectors may be introduced into host cells to produce a recombinant cell. The cells can be prokaryotic or eukaryotic. The vector of the invention can be used to transform eukaryotic cells such as yeast cells, Saccharomyces cerevisiae, or mammal cells for example epithelial kidney 293 cells or U2OS cells, or prokaryotic cells such as bacteria, Escherichia coli or Bacillus subtilis, for example. Nucleic acid can be introduced into a cell using conventional techniques such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofectin, electroporation or microinjection. Suitable methods for transforming and transfecting host cells may be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory textbooks.

[0199] Following the generation of the siRNA polynucleotide, a skilled artisan will understand that the siRNA polynucleotide will have certain characteristics that can be modified to improve the siRNA as a therapeutic compound. Therefore, the siRNA polynucleotide may be further designed to resist degradation by modifying it to include phosphorothioate, or other linkages, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and the like (see, e.g., Agrwal et al., 1987 Tetrahedron Lett. 28:3539-3542; Stec et al., 1985 Tetrahedron Lett. 26:2191-2194; Moody et al., 1989 Nucleic Acids Res. 12:4769-4782; Eckstein, 1989 Trends Biol. Sci. 14:97-100; Stein, In: Oligodeoxynucleotides. Antisense Inhibitors of Gene Expression, Cohen, ed., Macmillan Press, London, pp. 97-117 (1989)).

[0200] Any polynucleotide may be further modified to increase its stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and / or 3' ends; the use of phosphorothioate or 2' O-methyl rather than phosphodiester linkages in the backbone; and / or the inclusion of nontraditional bases such as inosine, queosine, and wybutosine and the like, as well as acetyl- methyl-, thio-and other modified forms of adenine, cytidine, guanine, thymine, and uridine.In one embodiment of the invention, an antisense nucleic acid sequence which is expressed by a plasmid vector is used to increase the level of miR-7b-3p. The antisense expressing vector is used to transfect a mammalian cell or the mammal itself, thereby causing increased endogenous expression of miR-7b-3p.

[0201] Antisense molecules and their use for inhibiting gene expression are well known in the art (see, e.g., Cohen, 1989, In: Oligodeoxyribonucleotides, Antisense Inhibitors of Gene Expression, CRC Press). Antisense nucleic acids are DNA or RNA molecules that are complementary, as that term is defined elsewhere herein, to at least a portion of a specific mRNA molecule (Weintraub, 1990, Scientific American 262:40). In the cell, antisense nucleic acids hybridize to the corresponding mRNA, forming a doublestranded molecule thereby inhibiting the translation of genes.

[0202] The use of antisense methods to inhibit the translation of genes is known in the art, and is described, for example, in Marcus-Sakura (1988, Anal. Biochem.

[0203] 172:289). Such antisense molecules may be provided to the cell via genetic expression using DNA encoding the antisense molecule as taught by Inoue, 1993, U.S. Patent No.

[0204] 5,190,931.

[0205] Alternatively, antisense molecules of the invention may be made synthetically and then provided to the cell. In one embodiment, an antisense oligomer comprises between about 10 to about 30 nucleotides. In one embodiment, an antisense oligomer comprises about 15 nucleotides. Antisense oligomers comprising 10-30 nucleotides are easily synthesized and introduced into a target cell. Synthetic antisense molecules contemplated by the invention include oligonucleotide derivatives known in the art which have improved biological activity compared to unmodified oligonucleotides (see U.S. Patent No. 5,023,243).

[0206] Compositions and methods for the synthesis and expression of antisense nucleic acids are as described elsewhere herein.

[0207] Ribozymes and their use for inhibiting gene expression are also well known in the art (see, e.g., Cech et al., 1992, J. Biol. Chem. 267:17479-17482; Hampel et al., 1989, Biochemistry 28:4929-4933; Eckstein et al., International Publication No. WO 92 / 07065; Altman et al., U.S. Patent No. 5,168,053). Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manneranalogous to DNA restriction endonucleases. Through the modification of nucleotide sequences encoding these RNAs, molecules can be engineered to recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, 1988, J. Amer. Med. Assn. 260:3030). A major advantage of this approach is the fact that ribozymes are sequence-specific.

[0208] There are two basic types of ribozymes, namely, tetrahymena-type (Hasselhoff, 1988, Nature 334:585) and hammerhead-type. Tetrahymena-type ribozymes recognize sequences which are four bases in length, while hammerhead-type ribozymes recognize base sequences 11-18 bases in length. The longer the sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species.

[0209] Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating specific mRNA species, and 18-base recognition sequences are preferable to shorter recognition sequences which may occur randomly within various unrelated mRNA molecules.

[0210] In one embodiment of the invention, a ribozyme is used to increase the level of miR-7b-3p. Ribozymes useful for inhibiting the expression of a target molecule which degrades or inhibits miR-7b-3p may be designed by incorporating target sequences into the basic ribozyme structure which are complementary, for example, to the mRNA sequence encoding a protein which inhibits or degrades miR-7b-3p. Ribozymes which increase or activate miR-7b-3p, may be synthesized using commercially available reagents (Applied Biosystems, Inc., Foster City, CA) or they may be genetically expressed from DNA encoding them.

[0211] Pharmaceutical Compositions

[0212] The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.Although the description of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts.

[0213] Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.

[0214] Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, intratumoral, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.

[0215] A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0216] The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w / w) active ingredient.In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents, including, for example, chemotherapeutics, immunosuppressants, corticosteroids, analgesics, and the like.

[0217] Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.

[0218] As used herein, “parenteral administration” of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, intratumoral, and kidney dialytic infusion techniques.

[0219] Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen free water) prior to parenteral administration of the reconstituted composition.The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally acceptable diluent or solvent, such as water or 1,3 butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems.

[0220] Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

[0221] A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers, for example, from about 1 to about 6 nanometers. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent / powder dispensing container such as a device comprising the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container. For example, such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. For example, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers. Dry powder compositions may include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.Low boiling propellants generally include liquid propellants having a boiling point of below 65°F at atmospheric pressure. Generally the propellant may constitute 50 to 99.9% (w / w) of the composition, and the active ingredient may constitute 0.1 to 20% (w / w) of the composition. The propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (e.g., having a particle size of the same order as particles comprising the active ingredient).

[0222] Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen free water) prior to parenteral administration of the reconstituted composition.

[0223] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally acceptable diluent or solvent, such as water or 1,3 butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations that are useful include those that comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer system.Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

[0224] Additionally, the molecules may be delivered using a sustained-release system, such as semipermeable matrices of solid polymers containing the therapeutic agent. Various forms of sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the molecules for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the chimeric molecules, additional strategies for molecule stabilization may be employed.

[0225] Nucleic acids may be included in any of the above-described formulations as the free acids or bases or as pharmaceutically acceptable salts. Pharmaceutically acceptable salts are those salts that substantially retain the biologic activity of the free bases and which are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous and other protic solvents than are the corresponding free base forms.

[0226] In addition to the formulations described previously, the molecules may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the molecules may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

[0227] Alternatively, other pharmaceutical delivery systems may be employed. Liposomes and emulsions are well-known examples of delivery vehicles that may be used to deliver nucleic acids of the disclosure.

[0228] AAV

[0229] In one embodiment, the method of the present invention comprises administering to the subject an effective amount of miR-7b-3p or miR-7b-3 mimic via adeno-associated virus 9 (AAV9) vector via intravenous (IV) delivery. In one aspect, theinvention provides compositions for treating or preventing a cardiomyopathy and / or HF in a subject in need thereof. In one embodiment, the compositions comprise miR-7b-3p or a miR-7b-3 mimic. In one embodiment, the miR-7b-3p or a miR-7b-3 mimic are comprised within an AAV9 vector.

[0230] In one embodiment, the composition includes a vector derived from an adeno-associated virus (AAV). The term "AAV vector" means a vector derived from an adeno-associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, and AAV-9. In one embodiment, the composition comprises AAV9 vector.

[0231] AAV vectors have become powerful gene delivery tools for the treatment of various disorders. AAV vectors possess a number of features that render them ideally suited for gene therapy, including a lack of pathogenicity, minimal immunogenicity, and the ability to transduce postmitotic cells in a stable and efficient manner. Expression of a particular gene contained within an AAV vector can be specifically targeted to one or more types of cells by choosing the appropriate combination of AAV serotype, promoter, and delivery method. In some embodiments, the AAV serotype is myoAAV-4A.

[0232] AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, preferably the rep and / or cap genes, but retain functional flanking ITR sequences. Despite the high degree of homology, the different serotypes have tropisms for different tissues. The receptor for AAV1 is unknown; however, AAV1 is known to transduce skeletal and cardiac muscle more efficiently than AAV2. Since most of the studies have been done with pseudotyped vectors in which the vector DNA flanked with AAV2 ITR is packaged into capsids of alternate serotypes, it is clear that the biological differences are related to the capsid rather than to the genomes. Recent evidence indicates that DNA expression cassettes packaged in AAV 1 capsids are at least 1 log 10 more efficient at transducing cardiomyocytes than those packaged in AAV2 capsids. In one embodiment, the viral delivery system is an adeno-associated viral delivery system. The adeno-associated virus can be of serotype 1 (AAV 1), serotype 2 (AAV2), serotype 3 (AAV3), serotype 4 (AAV4), serotype 5 (AAV5), serotype 6 (AAV6), serotype 7 (AAV7), serotype 8 (AAV8), or serotype 9 (AAV9).Desirable AAV fragments for assembly into vectors include the cap proteins, including the vpl, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells. Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source. An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid. Thus, exemplary AAVs, or artificial AAVs, suitable for expression of one or more proteins, include AAV2 / 8 (see U.S. Pat. No. 7,282,199), AAV2 / 5 (available from the National Institutes of Health), AAV2 / 9 (International Patent Publication No. W02005 / 033321), AAV2 / 6 (U.S. Pat. No. 6,156,303), and AAVrh8 (International Patent Publication No. W02003 / 042397), among others. In some embodiments, the AAV serotype selected shows greater tropism for cardiac tissues. In some embodiments, the AAV serotype is myoAAV-4A.

[0233] It will be understood by one skilled in the art, based upon the disclosure provided herein, that modulating a miRNA encompasses modulating the level or activity of a miRNA including, but not limited to, modulating the transcription, processing, nuclear export, splicing, degradation, binding activity, or combinations thereof. Thus, increasing or activating the level or activity of a miRNA includes, but is not limited to, increasing transcription, processing, nuclear export, splicing, or binding activity, or binding activity or decreasing degradation or combinations thereof; and it also includes modulating the level of any nucleic acid or protein that modulates the miRNA level or activity.

[0234] EXPERIMENT AU EXAMPLESThe invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0235] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples therefore are not to be construed as limiting in any way the remainder of the disclosure.

[0236] Example 1 : mmu-mir7b-3p restored the contractile function of a failed heart

[0237] G protein-coupled receptor kinase 2 evokes a desensitization of adrenergic receptor and acerate a loss of heart contractility in heart failure. It was reported microRNA-7b-3p was up regulated in extracellular vesicle secreted from cardiac progenitor cells upon G protein-coupled receptor kinase 2 inhibitor peptide (PARKct) expression. The aim of this study was to investigate a miR7n expression profdes in heart failure animal models and to study the function and more detail basal mechanisms of miR7b-3p in heart disease.

[0238] Methods and results. On three kinds of heart injury animal models were used to this study which are an isoproterenol infusion, a transverse aortic constriction (TAC) and a myocardial infarction. MiR-7b-3p was measured in blood extracellular vesicle and in heart tissue. Downregulation of miR-7b-3p was detected in hearts of the three all compared to those control. In blood EVs, only ISO infusion decreased the expression of mir7b-3p. Next, it was tested whether miR-7b could affect cardiomyocytes against hypertrophic stimulation. As results, in neonatal rat ventricular cardiomyocytes (NRVMs), miR-7b-3p mimic prevented the NRVMs hypertrophy. It was confirmed by measuring of cardiomyocyte area after PE and by restoration of transcription level of BNP after PE and ISO treatment. In vivo study, miR7b overexpression using a viral vector was performed at two time points of before and after TAC surgery. MiR 7boverexpression showed beneficial effect at both. The before miR7b treatment delayed the onset of heart failure in TAC mouse model for 4 weeks. Furthermore, the miR7b treatment at post TAC six weeks restored the contractility of heart accompany with attenuation of heart remodeling compared to PBS. Next, to find biological pathways regulated by miR7b, heart tissue NGS analysis using the post TAC 8 weeks was performed. In GO enrichment analysis, the upregulated differential expressed genes (DEGs) by miR7b in sham heart were enriched in 'mitochondrial inner membrane, 'organelle inner membrane, mitochondrial protein complex, inner mitochondrial membrane protein complex ' and mitochondrial membrane part’. Correspondingly, the downregulated DEGs were enriched in the ‘collagen-containing extracellular matrix’, ‘extracellular matrix’, ‘extracellular matrix’ structural constituent.’ Notably, some of them were indicated constantly in TAC heart.

[0239] In summary, miR-7b-3p was a down-regulated miR in injured heart broadly like as a beta-adrenergic stimulation, a pressure over load and an ischemia.

[0240] Notably, the restoration for it showed the beneficial effects both to recovery a contractility of failed heart and also like as an attenuation of heart remodeling.

[0241] Conclusively, these results strongly supported the function of miR7b may be a physiologically functional anti-hypertrophic effector.

[0242] Introduction

[0243] MicroRNA is a group of small single-stranded noncoding RNA (ncRNA) with approximately 18-22 nucleotides. miR contributes to regulate gene expression by posttranscriptional binding the 3’ untranslated region (UTR) of mRNA of target gene, enhancing its degradation and / or inhibiting protein translation (Yoshida et al., 2021, NonCoding Rna 7; O'Brien et al., 2018, Front Endocrinol 9). Numerous studies have shown that miRNA plays essential role in cardiovascular diseases regulating a plethora of processes including cell death, cell proliferation, inflammation, and angiogenesis (Kansakar et al., 2022, Celis-Basel 11). One of them, mir-7b is highly expressed in the paraventricular nucleus (PVN) and its expression is upregulated after chronic osmotic stress, indicating a role in fluid, electrolyte balance (Lee et al., 2006, Proc Natl Acad Sci U S A 103: 15669-15674) and mouse spinal cord injury (SCI). At SCI, miR7b-3p mimicexerts dual role by supporting plasticity and neuroprotection at cortical level (Ghibaudi et al., 2021, Front Mol Biosci 8:618869). Chronic heart failure (CHF) rat model, the infusion of agomir-7b into PVN produced CHF-like changes with increased left ventricular diameter and reduced EF and decreased mean arterial blood pressure (MAP) in same model 6 (Wang et al., 2016, Circ Heart Fail 9, e002261.) Also, antagomir-7b injection in vivo decreased the MAP. On cardiomyocyte, miR-7b expression is downregulated after ischemic / reperfusion (I / R) injury in mice and miR-7b also inhibits apoptosis in H9C2 cells by targeting the HIFla / p-p38 pathway (Sheng et al., 2019, J Cell Biochem 120: 9947-9955). Authors previously have found the elevation of miR7b -3p in extracellular vesicles (EVs) secreted form GRK2 inhibition peptide (0ARKct) overexpressing mouse cardiac progenitor cell (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320: H1276-H1289). The pARKct CP had led to improvements in cell proliferation, survival and metabolism (Khan’s paper) and the those EVs showed a cardiac protection against catecholamine toxicity (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320: H1276-H1289). GRK2 is regarded as a regulator of beta-adrenergic receptor desensitization and mediator of sympathetic and parasympathetic nerve system. However, the function of mir7b have been not known in cardiomyocyte completely and the detail molecular mechanism is also. In the present study an expression level of miR-7b-3p in three kinds of mouse heart failure model and investigated the influence of restoration of miR-7b at injured cardiomyocyte and heart was validated.

[0244] Materials and Methods

[0245] Measurement of miRNA-7b expression in heart failure animal models

[0246] All surgical procedures and animal care protocols were approved by the Temple University Animal Care and Use Committee. Male mice, C57BL / 6 at 8 weeks age old were purchased from The Jackson Laboratories (Bar Harbor, ME). Isoproterenol (ISO) infusion, transverse aortic constriction (TAC) and myocardial infarction (Na et al., 2021, Celis-Basel 10) were used to do this experiment. ISO infusion heart failure model was made using osmotic pump (Alzet, MODEL 1007D). The ISO (3mg / kg) was dissolved in 0.002% ascorbic acid in PBS and the PBS contained 0.002% ascorbic acid was used to vehicle group. TAC and MI mouse model was performed as describedpreviously (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320: H1276-H128; Schumacher et al., 2016, Sci Signal 9, ra30). Briefly, to TAC model, under anesthetic condition, chest of mouse with artificial respiration using mouse ventilator and partially constrict a transverse aorta was opened. To MI model, the left anterior descending (LAD) coronary artery was ligated under closed chest condition during anesthesia. Sham operation was made as same procedure without constriction and ligation. All mice had base line echocardiography at before surgery and at every two weeks after surgery.

[0247] miR7b-3p mimic transfection in NRVMs

[0248] Neonatal rat ventricle cardiomyocytes (NRVMs) were isolated from neonatal rat ventricles (1- to 2-days-old) by as previously described (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320: H1276-H1289). The isolated cells were cultured in Ham’s F10 Medium (Corning) supplemented with 10% horse serum, 5% FBS and 1% PS as 6 well plate for molecular work and on cover glass for morphometric analysis. The day after plating, a miR-7b-3p mimic (Qiagen, MSY0017071) and a mimic scramble using RNAiMAX (Invitrogen) were transfected as described by manufacturers. Next day, treatment was performed with lOpM isoproterenol and lOpM phenylephrine for 24 hours to detect a gene expression level of ANF and BNP. To measure a cardiomyocyte area, I OpM PE has been treated for 48 hours.

[0249] Effect of miR-7b against cardiac hypertrophy in heart failure animal model In vivo mir7b overexpression and time scheme in heart failure animal model

[0250] Recombinant AAV9 vectors encoding green fluorescent protein (GFP), mouse miRNA-7b nucleotide or scramble nucleotide under the control of the cardiomyocyte-specific troponin T (cTnT) promoter were generated by Vector Biolabs (Malvern, PA, USA). To deliver miR7b AAV virus systemically, the right side jugular vein was used. Briefly, under anesthetic by isoflurane, skin was cut and dissected connected tissue to exposure jugular vein. To functional study using heart failure mouse model, AAV 5 x io11genome copies (GC) / mouse was injected into jugular vein mouse and injection volume was lOOpl. For the titration of AAV, 3 1011GC was usedseparately prior to in vivo studies. In TAC and MI model were used to check a miR7b function against heart failure. As described at Figure 6A, three kinds of animal model used. At TAC model, functional study of miR7b was conducted in prior TAC surgery and at 6 weeks after TAC. At MI model, at two weeks after MI surgery, mir7b-AAV virus was treated.

[0251] Echocardiography

[0252] To measure a contractility of heart, echocardiography was performed using the Vevo 2100 imaging system from Fujifdm VisualSonics, Inc as described (Schumacher et al., 2015, Sci Transl Med., 7(277): 277ra31). Briefly, two-dimensional echocardiographic views of the midventricular short axis were obtained at the level of the papillary muscle tips below the mitral valve. M-mode measurements were determined at the plane bisecting the papillary muscles according to the American Society of Echocardiography’s leading-edge method.

[0253] Tissue and cell preparation for histology and molecular work Measurement of cardiomyocyte area and detection of fibrosis formation To measurement of NRVM area in, cells were fixed using 4% PF A after PBS washing and performed to immunostaining. 10% BSA blocking For Immunofluorescence staining, cells were fixed and were washed three times for 5 min with PBS followed by blocking using 10% BSA for one hour and incubated with a-sarcomeric actin primary antibody (1:100) (Sigma, A7811) for overnight. The secondary antibody was conjugated to Alexa Fluor 488 (1 : 100 in PBS) for one hour at room temperature in a humidified chamber in the dark. Slide was again washed three times for 5 min with PBS followed by mounting with coverslips using Fluoromount-G with DAPI mounting media (Southern Biotech). Myocyte area was measured using Nis-Element software (Version 4.0).

[0254] In vivo study, mouse was euthanized under anesthesia using isoproterenol and collected blood from cutting carotid artery. And mouse heart collected immediately, washed by cold PBS and weighted. On study using TAC model, the heart was divided as half horizontally. The upper piece was placed into 4% PFA to do a histology analysis,and the bottom piece was storage at -70 °C for further study. On study using MT model, whole heart was placed into 4% PFA to do a histology analysis.

[0255] Heart for histologic analysis was embedded in paraffin and sectioned to histology analysis. The Microm STP 120 (Thermo Fisher Scientific), HistoStar apparatus (Thermo Fisher Scientific), and Microm HM 325 (Thermo Fisher Scientific) were used to do this. Tissue sections were stained with wheat germ agglutinin (WGA) and cardiomyocyte area was measured using Nis-Element (Version 4.0) from over 30 myocytes at least 3 points of one heart section and three or four sections were used to make average for one mouse heart. The bottom piece of heart was used to NGS study and other molecular works. Masson's and Trichrome staining was performed according to the manufacturing guide. (Sigma-Aldrich)

[0256] RNA preparation and real time PCR

[0257] Total RNA isolation from heart and cell was performed using the miRNEasy kit (Qiagen) and the concentration was measured using the NanoDrop 2000 (Thermo Fisher Scientific). To evaluate miRNAs, Ipg total RNA was used to make cDNA by miScript II RT kit (Qiagen) using both HiFlex buffer. For qPCR of miRNA, diluted 2 pl cDNA as 50 times was subjected by RT-qPCR using miRScript SYBR kit (Qiagen). Expression levels of miR-7b-3p was quantitatively compared using the ACt method with mean Ct values of SNORD95, SNORD96 and RNU6-2 as reference genes. Four miRNA PCR primer were purchased from Qiagen. To measure ANF, BNP and GFP gene transcription level, using primer sequences shown below (Sigma Aldrich) and synthesized cDNA samples were subjected to real time RT-qPCR (Bio-Rad CFX96 Touch) using iQ SYBR Green Supermix (Bio-Rad). Expression levels between the various groups were quantitatively compared using the AACt method with mouse glyceraldehyde -3 -phosphate dehydrogenase (GAPDH) as reference gene. PCR primer information was provided as Table 1 and 2.

[0258] NGS study

[0259] Total RNA was isolated from six experimental groups, Sham-PBS, Sham-miR SC, Sham-miR 7b, MI -PBS, MI-miR SC and MI-miR 7b and each group has threehearts. The RNA samples, which were prepared as described above and were sent to Novogen, Inc for RNA next generation sequencing (NGS). Novogene did the qualification of the RNA, manufacture of cDNA, the sequence read, data cleaning and data analysis.

[0260] Statistics

[0261] For experiments in mice results are presented as mean ± SEM and in cell experiments using NRVMs results are represented as mean ± SD, computed from the average measurement obtained from each 3 or 4 repeat experiments. Comparison of 3 or more groups is performed by 1-way or 2-way ANOVA with Tukey’s multiple comparisons test and non-paired t-test. P < 0.05 is considered statistically significant. Statistical analysis was performed using Graph Pad prism version 8.0 and 9.0 software.

[0262] Results

[0263] miR7b-3p was downregulated in injured heart and partially in their blood EVs.

[0264] To validate a miR 7b-3p under hypertrophy and heart failure condition, three heart failure animal model which are ISO chronic infusion through osmotic pump, TAC and MI, were made. As a result, at heart tissue and blood EVs, miR7b-3p was decreased by either hypertrophy and heart failure. In detail, downregulation of miR7b-3p occurred at both time points, at 2 and 8 weeks after ISO infusion, in heart tissue and blood EVs (Figure 1 A, and IB). ISO infusion caused hypertrophy with increment of an ejection fraction (EF %) for 4 weeks and a decrease of EF at 8 weeks (Figure 2A, 2B and 2E). Also, elevation of ANF and BNP level were observed only at 8 weeks (Figure 2C and 2D). At TAC model in time dependent, there was two phases of cardiac hypertrophy. The adaptation phase was observed after 2 weeks of TAC and heart failure phase was observed from 6 weeks of TAC as by loss of contractility. (Figure 3). miR7b-3p level in TAC heart tissue consistently was down regulated from 2 weeks and till 8 weeks of TAC surgery (Figure 1 C, ID and IE). In case of MI injury, heart tissue showed a decrease of mir7b-3p both 2 and 4 weeks after MI injury (Figure IF and 1G). These two time points was undergoing hypertrophy (Figure 4A and 4B) accompany with elevation of either ANF and BNP transcription level (Figure 4C and 4D). At echocardiography analysisshowed even decrease of contractility (Figure 4E and 4F) and an enlargement (Figure 4G). However, blood EVs of two TAC and MI model did not show the difference compared with sham operation group.

[0265] miR7b-3p mimic inhibited hypertrophy of NRVMs against ISO and PE treatment.

[0266] Next, to confirm the functional effect of miR7b-3p against hypertrophic stimulation, miR7b-3p mimic at NRVMs was transfected and treated with ISO and PE for 24 hours. As seen Figure 5A and 5B, ISO and PE treatment increased ANF and BNP gene compared with PBS control and miR7b-3p mimic prevented the elevation of both genes but miR scramble (SC) did not. For the morphometric change of NRVM, PE treatment for 48 hours occurred an enlargement of NRVM but miR7b-3p prevented completely the change against PE (Figure 5C and 5D).

[0267] miR7b restored cardiac contractility against heart failure and attenuated hypertrophy.

[0268] Consequently, it was confirmed whether the miR7b is functional in vivo system. The cardiac specific miR7b overexpression has been made by adeno associated viral vector, and those either scramble and PBS used as control. First of all, to determine a titer of AAV-GFP-mmu-miR 7b virus and a safe delivery route with effectiveness in mouse, either AAV-GFP-mmu-miR 7b and AAV-GFP-miR scramble by two ways which the ways are a systemic delivery using jugular vein and an epicardial direct injection were injected. As seen Figure 4, GFP and precursor miRNA 7b were detected as high from one week later till 4 weeks after injection and miR7b-3p showed significant increase at 4 weeks later. Both methods were useful but vein injection was chosen as more convenient way and to avoid multiple chest open surgery.

[0269] To investigate an miR7b prevention effect and cure effect two different time points of miR7b transduction were used. To the measure of prevention effect, as seen figure 3A, AAV-miR7b was injected at 4 weeks before TAC surgery. And after surgery shown as Day 0, a heart function using echocardiography (Echo) was evaluated. Decrement of heart contractility caused by TAC surgery was not showed till 4 weeks in AAV-miR7b group but either PBS and AAV-miR SC group showed a decrease ofcontractility indicated as EF and FS (Figure 6B and 6C). The prevention effect by AAV pretreatment was maintained for 4weeks (Figure 6). These prevention effect disappeared 8 weeks later. Sequentially, the cure effect of miR7b was investigated. At 6 weeks after TAC surgery, AAV-miR7b was injected and heart function was measured for 2 weeks (Figure 4A). One weeks later, AAV-miR7b dramatically restored the FS compared with AAV-GFP and PBS treatment group and then this sustained this effect one week more (Figure 7A). Sequentially, to morphometric analysis, heart for the mice at 2 weeks was isolated. As seen Figure 8A and 8B, the mean of heart weight of all three TAC surgery groups were increased compared to their sham group. However, AAV-miR7b significantly decreased the heart weight (HW7BW ratio and HW / TL ratio) compared to TAC-PBS group, but TAC-miR SC did not. The attenuation effect by AAV treatment after heart dysfunction was maintained for 2 weeks (Figure 7). Also, As seen Figure 8C and 8D, myocyte area caused was significantly decreased by miR7b treatment (TAC-miR 7b) compared to PBS but not to scramble (TAC-miR SC). The hypertrophic maker gene, BNP gene was decreased in TAC-miR7b group compared to TAC-PBS group in partial (Figure 8E). The scramble group showed similar decreasing pattern with no significant.

[0270] However, in TAC-miR SC group, BNP and heart weight result was questionable even there are less significant. Since, measurement of the binding activity using luciferase vector plasmid including with target sequence of mmu-miR 7b and miR scramble sequence. As results, Figure 9 showed that AAV-miR scramble has a moderate binding activity for target nucleotide sequence for miR7b-5p. This is not a surprise because the scramble sequence was designed by algorism base on knowledge for miRNA maturation but inevitably the scramble vector has a some of them except when not to use empty vector, like as 17 same nucleotides of 28 original nucleotides. For this reason, it was decided that PBS treatment would be used as real control to do NGS analysis even though TAC-SC group was conducted to the next NGS experiment.

[0271] miR7b changed significantly oxidative stress pathway and focal adhesion pathway in NGS study.

[0272] To explore the underlying mechanisms of miR7b on heart failure, RNA-seq was performed to identify the differentially expressed transcripts (DETs) in TACheart tissues among different groups. Three mice heart for each group and six experimental groups were analyzed, Sham (S)_PBS, S miR SC, S_miR7b, TAC PBS, TAC miRSC and TAC miR7b was named to six groups. For this analysis, since the heart used in the project to detect the therapeutic effect of miR7b was reused, the heart was exposed to TAC injury for a total of 8 weeks, including AAV-miR7b overexpression for the last end 2 weeks. As shown volcano plots and hierarchical clustering plots of Figure 10, in sham heart, miR7b significantly upregulated the expression of 875 transcripts and downregulated the expression of 900 transcripts in heart tissue of mice, compared to the PBS group. In PBS groups, TAC injury (TAC PBS) significantly upregulated the expression of 2171 transcripts and downregulated the expression of 2078 transcripts compared to the S-PBS group. Interestingly, the with TAC impairment, miR7b (TAC-miR7b) significantly upregulated the expression of 1228 transcripts and downregulated the expression of 1317 transcripts compared to the TAC -PBS group. GO enrichment analysis based on the three comparing sets which are between S_miR7b and S PBS groups, between TAC PBS and S PBS group and between TAC_miR7b and TAC PBS groups revealed multiple predicted potential functions of miR7b original function, TAC injury and the miR7b function in environment with TAC injury. As shown in Figure 11 A, GO analysis showed that up regulated expression transcripts by miR7b were mainly associated with mitochondrial inner membrane, organelle inner membrane and inner mitochondrial membrane protein complex. The three functions were revealed in Figure 1 IE which is functions predicted in down regulated genes by TAC and surprisingly, duplicate in upregulated transcripts of miR7b treating heart (Figure 11C, red underlines). On the other hands, as shown in Figure 1 ID, GO analysis showed that down regulated expression transcripts by miR7b were mainly associated with extracellular matrix, extracellular organization and collagen-containing extracellular matrix. The three functions were revealed in Figure 1 IB which is functions predicted in up regulated genes by TAC and surprisingly, duplicate in upregulated transcripts of miR7b treating heart (Figure 11C, blue underlines). From all these findings, inherited function of miR7b would recovery both mitochondrial functions and extracellular matrix components to be impaired during TAC.Discussion

[0273] In this study, a function of mmu-miR-7b-3p and a relative expression level in failed heart was investigated. Interestingly, miR 7b was a down regulated miR in heart injured by ISO stimulation, by pressure overload and myocardial infarction. In vitro study, treatment miR7b-3p mimic resulted in a significant reduction of hypertrophy in NRVM co-incubated with PE alpha adrenergic receptor agonist. In vivo study, restoration of miR7b using cardiac specific miR 7b expression delayed the initiation of dysfunction and transiently rescued the heart from a pressure over-road induced heart failure. Taken together, this finding indicates that miR7b probably played a pivotal role through regulation of hypertrophic signaling during the progression of heart failure. Among the numerous miRNAs, miR7b-3p have gotten an attention in previous report 8. In the previous study, miRNA 7b was upregulated in extracellular vesicles (EVs) secreted from cardiac c-kit positive cells with beta adrenergic receptor kinase inhibition peptide (PARKct) overexpression. Of note, correction to dysregulation of GRK2 pathway by PARKct expression is effective to protect cardiomyocyte against ischemic injury (Brinks , et al., 2010, Circ Res 107: 1140-1149) and to increase a contractility of heart (Salazar et al., 2013, Cell Commun Signal 11). This intriguing result puzzles of previous results were sufficient to test the hypothesis that miR-7b might be essential for the progression of heart failure. And in this study, miR7b showed the effective role in heart. In the study, the underlining pathway for the cardioprotective association of miR-7b in heart failure (HF) was investigated. Notably, in GO analysis (Figure 1 IE), down regulated DEGs by TAC injury were enriched in a structure and a respiratory of mitochondria. The heart is a highly energy-dependent organ, and most of its energy is provided by mitochondrial oxidative phosphorylation. Surprisingly, miR7b replaced their position at upregulated gene category (Figure 11 C). This is obvious evidence that the miR7b can restore the mitochondria dysfunction caused in injured heart.

[0274] Another interesting finding is that down regulated DEGs by miR7b positioned mainly in extracellular matrix (ECM) process. The decomposition of ECM is a major cause during cardiac remodeling. In this study, authors did not prove it whether the gene involved at ECM pathway is a direct target for miR7b-3p. However, miR7b interestingly sowed the same result in sham heart. In fact, the inherent role of miR7bwould be closely related with extracellular matrix process and even under pathologic condition the role was kept. Therefore, after NGS study, a study was conducted to find triple positive gene like as down-regulated genes by miR7b in sham, up-regulated genes and target gene predicted by web base meta-analysis tool to miR7b-3p (Figure 14A). As seen Figure 14B, four genes were found by the analysis, clathrin heavy chain (CLTC), CAMP Responsive Element Binding Protein 3 Like 2 (CREB3L2), Interleukin 6 Cytokine Family Signal Transducer (IL6ST) and histone-lysine N-methyltransferase 2A (Kmt2a). Further experiment to confirm that four gene are an effective target for miR 7b are planned.

[0275] In these experiments, miR7b did not show long-term effects. Short protective effects of 2 and 4 weeks after and before miR 7b treatment against TAC were shown. Although there may be numerous hypotheses, it is thought that miR7b may have a pin-down target than expected. It is not just speculation, as seen Figure 13A, 13B, 13C, 13D and 13E, the post miR7b treatment after MI surgery restored the contractility of heart. But the miR7b overexpression before MI surgery later showed higher mortality compared to PBS (Figure 13F and 13G). Three kinds heart injury model have been used to mimic a heart failure in this study. However, there are obviously a distinguished process to develop each pathologic condition. Despite TAC and ISO stimulation, MI indues sudden cell death like necrosis. In this context, miR 7b would not work for cardiomyocyte to block their cell death accompany with apoptosis. As these results, it can be reasonably inferred that anti -hypertrophy pathway should be a major target of miR7b-3p and miR7b would not contribute to correct a cell death containing apoptosis. The feature may enable combination therapy with other miRNAs targeting different working pathways, such as miRNA-1, and -133. Of note, both miR-1 and -133 were identified to mediate components of apoptosis pathways in injured cardiomyocytes during ischemia reperfusion in rat (He et al., 2011, J Biomed Sci 18(22)). Both miRs directly inhibits the anti-apoptotic protein Bcl-2, HSP60, HSP70 and caspase-9 in cardiomyocytes (He et al., 2011, J Biomed Sci 18(22); Li et al., 2015, Mol Cell Biochem 400: 173-181). In addition, mmu-miR7b-3p has a homology of 21 for 22 nucleotides with Homo sapiens (hsa) miR-7-1 (MI0000263) / miR-7-l-3p. This shows a possibility to expend the result of this study to human research. In previous human patient study, miR-7 was downregulated in blood of patients with a clinically isolated syndrome (CIS) 15 or relapsingremitting multiple sclerosis (RRMS) including next-generation sequencing (NGS) (Keller et al., 2014, Mult Scler 20: 295-303). In animal study using mouse, downregulation of miR-7 in brain with diet-obese mouse had impaired an insulin sensitivity (Femandez-de Frutos et al., 2019, Mol Cell Biol 39). But there should approach carefully to develop it as treatment because precursor hsa-miR-7 and has-miR-7-1 were known as tumor suppressor gene in gastric tumor cell (Kong et al., 2012, Oncogene 31 : 3949-3960). In the study, ISO treatment induced hypertrophy with no loss of contractility at 2 weeks and with loss of contractility at 8 weeks. However, miR7b-3p was down regulated in both time points. Thus, it indicated that down regulation of miR7b present once before pathological dysfunction. In addition, miR7b-3p and precursor miR7b in heart tissue of GRK2 cardiac specific expression transgenic mouse was measure. As seen Figure 15, miR7b-3p (Figure 14A) and precursor miR 7b (Figure 14B) were down regulated compared to wild type mouse. Even, the GRK2 TG mouse (12 weeks age old) did not show a heart malfunction in echocardiography and a hypertrophy sign like increment of heart weight / body weight (data not shown). Of these contexts, it may be worthful to consider the miR7b as early detector to find a disease before initiating of functional abnormality at organ.

[0276] A known upregulated miRNA-21 in ischemic and myocarditis hearts was used to determine how well the heart tissue samples in this study were managed. As shown Figure 15, miR 21 significantly was upregulated in all heart samples of ISO, TAC and MI, only except post TAC 4weeks showed an increasing trend (p=0.063). There is one more interesting finding that is blood EV’s miR21 level of post MI 4 weeks mouse showed a significant down regulation compared to Sham blood EVs. As MI can cause a large loss of cardiomyocytes, this may be a reflection of a decrease in cardiac cell-derived EVs in the blood, despite cardiac tissue maintaining high miR7b levels.

[0277] In summary, miR-7b-3p was a down-regulated miR in heart by various injuries accompany with hypertrophy and ischemia. This may be a very promising finding to cure a HF since the restoration for miR7b was beneficial to a failing heart. Conclusively, the miR7b-3p as biomarker and their signaling networks may warrant further investigation as novel therapeutic targets in HF.Table 1: PCR Primers

[0278] Name Forward Reverse

[0279] ANF (Mouse) TGCCGGTAGAAGATGAGGTC TGCTTTTCAAGAGGGCA (SEQ TD NO: 6) GAT (SEQ ID NO: 7) BNP (Mouse) CTGAAGGTGCTGTCCCAGAT CCTTGGTCCTTCAAGAG (SEQ ID NO: 8) CTG(SEQ ID NO: 9) GAPDH(Mouse) CCCTTAAGAGGGATGCTGCC TACGGCCAAATCCGTTC (SEQ ID NO: 10) ACA (SEQ ID NO: 11) BNP (Rat) TGACGGGCTGAGGTTGTTTT ACACTGTGGCAAGTTTG (SEQ ID NO: 12) TGC (SEQ ID NO: 13) GAPDH(Rat) GGCAAGTTCAATGGCACAGT TGGTGAAGACGCCAGTA (SEQ ID NO: 14) GACTC (SEQ ID NO: 15) GFP(AAV) GGTGAACTTCAAGATCCGCC CTTGTACAGCTCGTCCA

[0280]

[0281] (SEQ ID NO: 16) TGC (SEQ ID NO: 17)

[0282] Table 2: PCR Primers

[0283] miRNA PCR primers CatNumber Company

[0284] miR7b-3p MS00033075 Qiagen

[0285] SNORD95 MS00033726

[0286] SNORD96A MS00033733

[0287]

[0288] RNU6 MS00033740

[0289] Table 3: Sequences

[0290] miR7b-3p SEQ ID NO: 1 5'CAACAAGUCACAGCCAGCCUCA miR-7b-3p mimic MSY0017071 Qiagen

[0291] hsa-let-7b-3p SEQ ID NO: 2 GGAAGGCAGTAGGTTGTATA miRCURY LNA

[0292] miRNA Inhibitor

[0293] hsa-let-7b-3p SEQ ID NO: 3 AGGCAGTAGGTTGTATA miRCURY LNA

[0294] miRNA Detection

[0295] probe

[0296] mmu-miR-7b-3p SEQ ID NO: 4 GAGGCTGGCTGTGACTTGTT miRCURY LNA

[0297] miRNA Inhibitor

[0298] mmu-miR-7b-3p SEQ ID NO: 5 TGAGGCTGGCTGTGACTTGTT miRCURY LNA

[0299] miRNA Detection

[0300]

[0301] probeExample 2: miR-7b is a critical miR in myocytes that is dysregulated after cardiac stress / injury and its targets include those involved in cardiac functional regulation, which when overexpressed can result in reparative pathways that can improve cardiac function, and this gene therapy approach can be translated for therapeutic benefit.

[0302] Over the last three decades, a study of the role of adrenergic signaling in the heart with a focus on G protein-coupled receptor (GPCR) kinases (GRKs) has been carried out. These kinases regulate adrenergic signaling via receptor phosphorylation and have been shown to be important in cardiac physiology and in disease states. One GRK in particular, GRK2, has been proven to be pathogenic in the heart after its up-regulation that occurs soon after cardiac stress / injury. Early research focused on the role of this enzyme in GPCR dysfunction in heart failure (HF), primarily P-adrenergic receptor (PAR)-mediated contractility. Indeed, GRK2 inhibition or lowering its expression has reversed PAR down-regulation in several HF models restoring inotropic reserve, and limiting GRK2 in the failing heart appears to be translationally significant. This has included molecular approaches using a peptide inhibitor of GRK2, the pARKct, which inhibits the G protein (via GPy subunits) mediated membrane translocation of GRK2 to activated GPCRs. In several animal models of HF using mouse transgenesis or viral gene transfer of the pARKct, this peptide has proven to be a robust therapeutic molecule. In a previous study trying to uncover overall mechanisms of pARKct-mediated cardioprotection, it was determined that the micro-RNA (miR) content of extracellular vesicles (EVs) secreted from cardiac cells overexpressing the PA Kct via RNA sequencing. It was found that one miR, miR-7b-3p (miR-7b) significantly elevated in these EVs, which caught interest since there is not much known about this specific miR, especially in the heart. MiRs are gaining attention recently as potential therapeutics both as mimics and also antagonists or antagomirs. Indeed, an antagomir to a specific miR (miR-132) is currently in a Phase II clinical trial for HF. Specific targets for miR- 7b in the myocardium are not well defined although a study has shown the HIFla pathway may be a target in H9C2 cells (rat myoblast cell line) in vitro. The goal in this proposal is to define specific targets in the heart after miR- 7b delivery, during cardiac injury and repair. Importantly, in contrast to miR- 7b seemingly correlating to PARKct expression in cells, it is presented in this application preliminary data in multiple mouse HF modelsshowing that myocardial miR-7b expression is down -regulated compared to non-failing hearts including after myocardial infarction (MI), transverse aortic constriction (TAC) and catecholamine toxicity with chronic isoproterenol (ISO) treatment. Moreover, it was found that chronic treatment of mice with ISO causes levels of miR-7b to go down in circulating blood EVs. Interestingly, these three models of cardiac injury and dysfunction all induce myocardial GRK2 up-regulation. Thus, low levels of miR-7b appear to correlate with high levels of GRK2 in the heart when there is significant cardiac dysfunction. These studies determine that cardiac function can be improved by supplementing the injured heart with miR-7b and determine the specific targets to explain the mechanisms for the actions of miR-7b in failing myocytes. Key preliminary data in the post-TAC HF model in mice to support that AAV9-miR-7b-3p delivery in vivo does result in a beneficial response is available and a pre-clinical large animal pig model is included to begin to translate this interesting miR towards clinical application. The key finding is that miR-7b is a critical miR in myocytes that is dysregulated after cardiac stress / injury and its targets include those involved in cardiac functional regulation, which when overexpressed can result in reparative pathways that can improve cardiac function, and this gene therapy approach can be translated for therapeutic benefit. Further, studying failing hearts after miR- 7b delivery uncovers novel mechanistic targets in HF.

[0303] Heart disease remains the leading cause of death in the U.S. and >6.5 million Americans have heart failure (HF) with over 8 million estimated to have HF by 2030 (Martin et al., 2024, Circulation 149:e347-e913). Despite advances in treatment, including P-adrenergic receptor (PAR) blockers and renin-angiotensin-aldosterone system (RAAS) modulators, 5-yr mortality for HF remains ~40% (Martin et al., 2024, Circulation 149:e347-e913). Thus, there are still several barriers in HF management that provide research opportunities. For several years, gene therapy has held promise as a novel therapeutic approach for HF but it still has not been realized clinically due to several reasons, including the lack of a fully safe and cardiac trophic vector and efficient myocardial delivery methodology. More recently, attention has turned to the promise of small non-coding RNAs, including micro-RNA’s (miRs), as potential therapeutics and biomarkers for cardiovascular diseases including HF (lacobescu et al., 2024, Cureus 16:e64100; Viereck et al., 2014, Nature 508:531-535). Over the last three decades, therole of G protein-coupled receptor (GPCR) kinases (GRKs) in the heart has been studied and have been found to be critical to not only myocardial homeostasis but also cardiac pathology. Data have implicated GRKs as key molecules in HF development following cardiac injury and GRKs are emerging as potential therapeutic targets (Pfleger et al., 2019, Nat Rev Cardiol 16:612-622; , Sato et al., 2015, Science Trans Med 7:277ra31). GRK2 and GRK5 are the most abundant GRKs in the heart and are of (patho)-physiological significance since both are increased in failing human myocardium (Dzimiri et al., 2002, Clin Exp Pharmacol Physiol 29:181- 188; Dzimiri et al., 2004, Eur J Pharmacol 489:167-177; laccarino et al., 2005, Eur Heart J 26:1752-1758; Ungerer et al., 2022, Front. Cardiovasc. Med. 9:833335). GRK2 in particular has been targeted the most in animal models of HF and its inhibition appears therapeutic (Raake et al., 2013, Eur Heart J 34:1437-1447; Rengo et al., 2009, Circulation 119:89-98; Rockman et al., 1998, Proc Natl Acad Sci USA 95:7000-7005; Schumacher et al., 2015, Science Trans Med 7:277ra31; Shah et al., 2001, Circulation 103:1311-1316). This has included gene therapy approaches with a peptide inhibitor (known as pARKct) in pre-clinical models using adenoviral and adeno-associated viral vectors (Raake et al., 2013, Eur Heart J 34:1437-1447; Rengo et al., 2009, Circulation 119:89-98). Interestingly, as detailed below, in a study trying to understand how inhibition of GRK2 with the ARKct supports protection of hypoxic cells, significant up-regulation of a specific miR, miR-7b-3p (miR-7b) was found (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320:H1276-H1289). This miR appears to have unique properties in the heart and miR-7b is not well studied, especially in myocardium, however data presented in this application supports a critical role for this specific miR in cardiac injury and repair. Thus, GRK2 / pARKct studies led us to novel studies with this therapeutic miR. Accordingly, this proposal focusing on the therapeutic potential of miR-7b in the heart after injury including in a large animal model and its targets in failing myocytes that provide novel insight into its mechanism is timely and of significance.

[0304] Classically, GRK2 regulates GPCR signaling in the heart via phosphorylation of agonist-occupied receptors initiating the process of desensitization (Pfleger et al., 2019, Nat Rev Cardiol 16:612-622; Sato et al., 2015, Science Trans Med 7:277ra31). Signaling through GPCRs in the heart is critical for normal function as wellas during injury and stress (Pfleger et al., 2019, Nat Rev Cardiol 16:612-622; Sato et al., 2015, Science Trans Med 7:277ra31). For example, ARs, which are GPCRs that control beat-to-beat cardiac contractile function are dysfunctional in chronic HF primarily through sympathetic nervous system (SNS) hyper-activity and elevated levels of the SNS catecholamine neurotransmitters norepinephrine and epinephrine. GRK2 regulates signaling through these receptors via phosphorylation and desensitization leading to loss of G protein-coupling and downstream signaling (Liu et al., 2024, Circ Res 135:174-197). Following GRK2 action, P-arrestins bind to phosphorylated receptors and induce desensitization through G protein blockade and receptor internalization (Liu et al., 2024, Circ Res 135:174-197). GRK2 can also be regulated in the cell due to specific domains of this kinase. For example, its carboxyl-terminus (the ARKct) binds to free GPy subunits after GPCR activation and targets GRK2 to membrane-bound receptors (Koch et al., 1993, J Biol Chem 268:8256-8260; Koch et al., 1995, Science 268: 1350-1353). The PARKct has been extensively used to prevent PAR desensitization in the failing heart, and this peptide has rescued several animal models of HF (Raake et al., 2013, Eur Heart J 34:1437-1447; Rengo et al., 2009, Circulation 119:89-98; Rockman et al., 1998, Proc Natl Acad Sci USA 95:7000-7005; Schumacher et al., 2015, Science Trans Med 7:277ra31; Shah et al., 2001, Circulation 103:1311-1316).

[0305] MiRs are small non-coding RNAs (typically 22-nucleotides in length) and are found throughout chromatin and these molecules regulate transcripts by binding to the 3 ’-untranslated regions of mRNAs causing their degradation prior to translation or blocking translation, therefore playing a role in fine-tuning protein levels (Gonzalez-Candia et al., 2024, Biochem Pharmacol 25:116318). Of note, miRs are becoming increasingly studied in the heart and several miRs have been implicated in HF pathology (Creemers et al., 2016, Circ Res 118:108-118; Duisters et al., 2009, Circ Res 104:170-178; Garg et al., 2020, Eur J Heart Fail 22:1366-1377; Guan et al., 2016, J Mol Cell Cardiol 99:207-217; Sun etal., 2015, Scientific Rep 5:18351; Wahlquist et al., 2014, Nature 508:531-535; Yang et al., 2016, Exp Therap Med 12:1556-1562). Importantly, miRs and miR inhibitors (known as antagomirs) are moving towards the clinic in HF (lacobescu et al., 2024, Cureus 16:e64100; Viereck et al., 2014, Nature 508:531-535). In fact, one antagomir against miR-132 is in Phase II clinical trial for HF (Bauersachs et al.,2024, Eur J Heart Fail 26:674-682). Although several miRs have been shown to be important in the heart including after injury, there are probably still several yet to be identified that play crucial roles. Indeed, this appears to be the case for miR-7b (specifically miR-7b-3p). MiR-7b is part of the miR-7 family (and not the let-7 family) but is a specific family member and has its own targeting sequence distinct from miR-7 and miR-7a (Gupta et al., 2021, Sci Rep 11:22018).

[0306] The pARKct peptide inhibitor of GRK2 not only rescues HF but also protects myocytes from dying when exposed to acute ischemia / reperfusion (I / R) injury (Brinks et al., 2010, Circ Res 107: 1140-1149). It is also shown that protection of cardiac precursor cells exposed to hypoxia and other stressors could improve when the pARKct is overexpressed (Khan et al., 2014, Mol Ther 22:178-285). Further, in secreted extracellular vesicles (EVs) from these cardiac precursor cells overexpressing the PARKct, a pattern of increased miRs in these EVs associated with cardioprotection was found (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320:H1276-H1289). One of these miRs was miR-7b-3p, which previously was shown to be down-regulated in the diabetic cardiomyopathic heart (Mathur et al., 2023, Mol Cell Biochem 478:229-240). This also caught attention because miR-7b was in a data set of down-regulated miRs in the heart after chronic isoproterenol (ISO) treatment, which is a model of catecholamine induced HF (Figure 17). Thus, examination of miR-7b and how lower levels appears to correlate with cardiac dysfunction and be higher in protective states associated with improved cardiac function (i.e. PARKct expression) was started. Of note, very little is known about miR-7b, especially in the heart as it is not an abundant miR in this tissue (Mathur et al., 2023, Mol Cell Biochem 478:229-240). There are less than 40 papers published in total with this miR and less than 5 dealing with it in cardiovascular tissue. Most studies dealing with miR- 7b are in the brain but do show it associated with cytoprotection such as in spinal cord injury (Ghibaudi et al., 2021, Front Mol Biosci 8:618869). Consistent with this, miR- 7b was found to attenuate apoptosis in simulated ischemia / reperfusion (I / R) injury in H9C2 cells (rat myoblast cell line) in vitro and in wild-type (WT) C57 mice in vivo, miR-7b expression was down-regulated after I / R (Sheng et al., 2019, J Cell Biochem 120:9947-9955). This study uncovered evidence inH9C2 cells that HIFla appears to be a targeted pathway (via up-regulation) (Sheng et al., 2019, J Cell Biochem 120:9947-9955).

[0307] In this study, it is determined that gene delivery of miR-7b (the miR-7b-3p strand) using adeno-associated viral vector (serotype 9) - (AAV9) and a cardiomyocytespecific promoter can prevent and reverse left ventricular (LV) dysfunction in the mouse after cardiac injury induced by different stressors since as detailed below is of interest, these injuries all caused miR-7b to down-regulate in the mouse heart (Example 3) (Figure 17). This appears critical since there is preliminary data presented in Example 3 that delivery of miR-7b to the injured mouse has therapeutic potential (Figure 16).

[0308] Mechanistic studies in Example 4 examine the targets for this miR in the failing myocyte using both RNA-Seq and proteomics since the specific targets for miR-7b are not known, especially in the context of HF. Examining the full range of gene expression changes as well as protein levels after miR- 7b is added back to the failing heart adds novel information on how it is providing its potential beneficial effects. These studies importantly elucidate mechanisms involved in the apparent therapeutic effect of miR-7b as understanding targets and pathways involved in its cardiac repair could uncover novel strategies to treat HF beyond using miR- 7b (Figure 16). Finally, since it is believed that miR- 7b has novel therapeutic properties in HF, studies in Example 5 looks at its true translational potential using intracoronary delivery of AAV9-miR-7b to a large animal pre-clinical (pig) ischemic HF model (Figure 16).

[0309] Data over the last couple of decades has clearly shown the importance of microRNAs in cardiac homeostasis and during disease processes. Regulation of mRNA and protein levels during hypertrophy and HF progression by different miRs has gained much attention and up-regulating specific miRs as well as antagonizing miRs have begun translation to human HF. Interestingly, miR- 7b is one miR found in the heart that appears to correlate well with the state of cardiac function, being higher in protective and higher functioning states and lower after injury and stress when the heart is dysfunctional including when the heart is hypertrophic. This miR is not well understood and certainly under-studied, especially in the heart where its targets are not known, including what is happening when miR- 7b is delivered and overexpressed in the injured / stressed myocyte. It is believed that there is innovation in studying how miR-7b-3p can rescue the failingheart after different modes of injury in the mouse (Example 3), especially when this miR is added back in myocytes when it is significantly down-regulated. Further, there is innovation in studying the targets of miR- 7b when it is delivered to failing mouse hearts. Accordingly, a significant opportunity exists to discover its full range of targets during HF (Example 4). This can provide novel mechanistic information for how miR- 7b produces beneficial reparative properties in myocytes. This also has the potential to uncover novel targets for HF therapy since new pathways that lead to reversal of LV dysfunction and remodeling are uncovered (Example 4). This is an innovative aspect of the proposal since not much is known about the targets of miR-7b in the heart as very few studies have been published to date and its significance is not known, however the preliminary data clearly shows its significance. The final example of innovation is in Example 5, where clinical translation with miR-7b-3p gene therapy in a post-MI HF model in pigs to determine if replacement and increases in this miR can reverse LV remodeling in this large animal model and add to its potential clinical applicability is pursued. Further, in target discovery, it is determined if gene expression in the pig hearts mirror changes found in the mouse. Importantly, experience with coronary balloon injury and MI in pigs as well as viral gene delivery to these animals and all reagents and models are in place to significantly advance these 3 significant transformative studies in this new proposal (Figure 16).

[0310] Key Experimental Data: As mentioned above, miR-7b-3p levels were elevated in EVs from pARKct-loaded cells (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320:H1276-H1289). This stood out since this miR was found to be down-regulated in a larger data set from circulating EVs in mice treated chronically with ISO (Kwon et al., 2021, Cells 10: 1211). It is found that miR- 7b is down in the heart after chronic ISO as well as circulating EVs when compared to saline treated control mice (Figure 17A and 17B). Moreover, it was found that it significantly down-regulated in two other distinct cardiac injury models in the mouse (Figure 17C and 17D). Specifically, it was found that cardiac levels of miR-7b significantly down-regulated in the heart after maladaptive hypertrophy and HF induced by chronic transverse aortic constriction (TAC) (Figure 17C) and ischemic HF after myocardial infarction (MI) (Figure 17D). These data suggest that when the heart is injured, miR-7b is significantly down and correlates withcardiac dysfunction and cardiac hypertrophy, which is clearly evident in ISO, TAG and MI models of injury.

[0311] Example 3 : Gene delivery of miR-7b can improve the function of the failing mouse heart in vivo after different modes of injury and HF,

[0312] These studies include delivery of AAV9-miR-7b-3p and a control miR using a cardiac-specific promoter to multiple models of mouse HF including pressureoverload stress via TAC, ischemic injury after MI and ISO-induced toxicity. Studies involve male and female mice to study any sex-specific differences.

[0313] Without wishing to be bound by any theory, it is hypothesized that downregulation of miR- 7b (specifically, miR-7b-3p) in myocytes correlates with cardiac dysfunction and its delivery via AAV9 and overexpression in cardiomyocytes in vivo to the injured mouse heart can induce reparative signals and act as a novel molecular therapeutic agent in different HF models.

[0314] Rationale: Studies under Example 3 are based on a recent and novel discovery where alterations in the miR content of EV / exosomes secreted from cardiac precursor cells (CPCs) expressing the PARKct were found, and among miRs up-regulated in CPC-PARKct EV / exosomes was miR-7b-3p (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320:H1276-H1289). Since the PARKct itself (Brinks et al., 2010, Circ Res 107:1140-1149), CPCs expressing this peptide (Khan et al., 2014, Mol Ther 22: 178-285) and PARKct containing exosomes (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320:H1276-H1289) all display cardioprotective properties, whether miR- 7b plays a major mechanistic role in this response is explored and whether this miR is therapeutic in in vivo models of cardiac injury and HF is investigated. It is hypotehsized that miR-7b is part of a reparative gene expression program induced by PARKct expression and GRK2 inhibition. However, miR- 7b may not be linked to GRK2 / pARKct and be regulated differently. Nevertheless, it appears to be a significant miR to be studied. Interestingly, it is found miR-7b-3p significantly down-regulated in circulating blood EV / exosomes as well as the myocardium after chronically treating mice with ISO (Figure 17A and 17B), which may indicate that it has a reciprocal relationship with cardiac function. This is further strengthened by data in Figure 17C and 17Dshowing miR-7b also down in the mouse heart after TAC and MT. Thus, it appears that decreased miR-7b in the heart is strongly linked to cardiac injury and dysfunction and its levels are translated to secreted EV / exosomes in blood. MiR-7b may be linked to GRK2 levels since stressors that cause miR-7b to go down increase GRK2, and it was previously shown up-regulated GRK2 is a biomarker for ventricular dysfunction (Bonita et al., 2010, Clin Trans Sci 3:14-18; Hata et al., 2006, J Card Fail 12:360-368; laccarino et al., 2005, Eur Heart J 26:1752-1758; Rengo et al., 2014, Eur J Prev Cardiol 21 :4-l 1; Rengo et al., 2016, Circ Res 118:1116-1124). For example, miR-7b was shown to be down-regulated in myocytes after I / R injury in mice (Sheng et al., 2019, J Cell Biochem 120:9947-9955). Interestingly, miR-7b has been implicated in other diseases as it has been reported to be increased in a model of mouse spinal cord injury (Ghibaudi et al., 2021, Front Mol Biosci 8:618869), and it has been found to be important in the paraventricular nucleus in regulating blood pressure in rats (Wang et al., 2016, Circ Heart Fail 9:e002261). Overall, the goal in this study is to determine if miR-7b (using the 3p seed sequence in an AAV9 construct) is a potential therapeutic agent and if so, what gene expression programs it regulates to rescue HF (see Example 4). Importantly, its potential therapeutic effects in three different mouse models of HF - TAC, MI, and catecholamine induced toxicity using chronic ISO is studied. This comprehensively determines miR-7b’ s potential as a novel therapeutic miR.

[0315] Experimental design:

[0316] Section 3.1 - Determining the Effects of In Vivo miR- 7b Delivery on Pressure-Overload HF: The goal of these experiments is to determine the specific effect of miR- 7b gene therapy using a pressure-overload model of HF. The TAC model of maladaptive hypertrophy has been used extensively over the last 3 decades, where interestingly, GRK2 expression and activity is induced (Choi et al., 1997, J Biol Chem 272:17223-17229) and 0ARKct expression prevents the HF associated with the maladaptive hypertrophy associated with TAC (Tachibana et al., 2005, Circulation 111:591-597). Since miR- 7b is down after cardiac hypertrophy post-TAC as shown in Figure 17C, and associated with pARKct expression in EVs (Kwon et al., 2021, Am J Physiol Heart Circ Physiol 320:H1276-H1289), it is hypothesized that it also has atherapeutic effect on maladaptive cardiac hypertrophy and HF using this model. As an initial proof of concept, an in vitro study in neonatal rat ventricular myocytes (NRVMs) was carried out where hypertrophy was induced with the al-adrenergic agonist phenylephrine (PE) and treated myocytes with a scrambled miR or miR-7b-3p mimic and found complete attenuation of hypertrophy (Figure 18). The mature mouse miR- 7b cDNA (stem loop sequence of miR-7b-3p) was cloned into AAV9 with the cardiomyocyte-specific cardiac troponin-T (cTnT) promoter (AAV-cTnT-miR-7b) and a cTnT-scrambled miR as a control (AAV9-cTnT-miR-SC or AAV9-SC). The cTnT-GFP virus is another control (AAV9-GFP) if needed. The cTnT promoter is quite effective at myocyte-specific expression coupled with AAV9 in mice (Ma et al., 2022, J Am Coll Cardiol Basic Trans Science 7:223-243; Zhao et al., 2021, Circulation 144:694-711). The dose of virus is 5xl0ngenome copies (GC) or particles delivered IV via a retro-orbital (RO) injection in lOOpl saline (PBS). Success has been obtained with this dose and delivery method in mice as shown for cardiac GFP expression 2-weeks after RO delivery of AAV9-cTnT-GFP in Figure 19A.

[0317] Experiments in this sub-section are carried out in a translationally relevant manner with gene transfer occurring after hypertrophic stress (TAC) has been applied. Importantly, TAC is a different form of cardiac stress compared to ischemic HF (subsection 3.2), or ISO (sub-section 3.3) and it contributes novel information regarding the molecular signature of miR-7b gene expression patterns (see Example 4) and help elucidate the general mechanisms of miR-7b’s therapeutic effect if it rescues cardiac dysfunction in all models or if there are differences in rescue between the two models (e.g. such as only hypertrophy reversal or an effect on fibrosis). In the lab, mice that undergo TAC do not typically develop HF until at least 8-weeks as detailed above. In these studies, Sx lO11GC of the viruses (miR-7b and negative controls) is delivered at 6-weeks post-TAC and followed for another 6-8 weeks after gene delivery. Importantly, a Pilot experiment has been carried out where a model of TAC was used with delivery of AAV9-miR-7b or miR-SC (or saline) at 6 weeks post-TAC and studied the mice via echocardiography (Echo) for only 2 weeks. In mice treated with AAV9-miR-7b, there was already significantly improved cardiac function (Figure 19B). This is a very exciting result but very preliminary since it is only 2-weeks but does show the translationallyrelevant potential of miR-7b for post-TAC HF and also potentially for post-MI HF and ISO experiments below. At the end of this preliminary study, 2-weeks after gene delivery and 8-weeks after TAC, miR-7b treated hearts, were significantly smaller compared to PBS treated post-TAC mouse hearts as measured by heart-weight-to-body-weight (HW / BW ratios) (Figure 20).

[0318] Specifically, in these experiments, adult C57BL / 6J mice (10-12 weeks of age) are used. ~20 mice per group are enrolled since mice are taken at early time-points for gene expression / proteomic profiles (for studies described in Example 4). Equal number of male and female mice are studied for sex-specific effects in response to miR-7b and also any genomic or proteomic responses in Example 4, below. All mice undergo a baseline assessment via Echo and then undergo TAC or Sham procedures described previously over the last several decades (Akhter et al., 1998, Science 280:574-577; Choi et al., 1997, J Biol Chem 272:17223-17229; Coleman et al., 2021, Sci Signal 14:eabb5968; Tachibana et al., 2005, Circulation 111:591-597). Another Echo is done in the first week to measure the aortic pressure gradient and mice that do not have a pressure gradient of at least 50 mmHg are removed from the study (Coleman et al., 2021, Sci Signal 14:eabb5968). All mice are then followed via Echo serially at 2-, 4-, and 6-weeks post-TAC (or Sham) and mice that underwent Sham or TAC are randomly assigned for treatment with either AAV9-miR-7b, AAV9-SC, or PBS as in Figure 19B. Some mice from each group (n=3-4 male and female) are sacrificed at this time-point for pre-gene therapy (post-TAC or Sham) gene expression and proteomic studies (in Example 4). After gene delivery, mice are followed by serial Echo as in Figure 19B every 2-weeks for another 6-8 weeks, which allows for full determination of altered hypertrophy and LV dysfunction. This is assessed with conventional Echo as well as with strain Echo as described to obtain longitudinal strain and other regional measurements (de Lucia et al., 2022, Cardiovasc Res 118:169- 183; de Lucia et al., 2019, J Gerontol A Biol Sci Med Sci 74:455-461). At the end of the study period, hemodynamics is assessed and then the mice are sacrificed to study the hearts at the morphological level (assessing markers of hypertrophy and fibrosis) and stain for infiltrating immune cells as done in the past in mouse HF (de Lucia et al., 2022, Cardiovasc Res 118: 169-183). The goal of this study is to determine if a therapeutic effect of mir-7b continues past 2 weeks as in Figure 19B toconfirm it is sustained and if after the study period, decreased hypertrophy at the myocyte level is seen. This is done using wheat-germ agglutinin (WGA) to stain cardiac sections for cross-sectional area for myocyte size and Masson’s tri chrome is used for assessing fibrosis. These are all routine for all lab for TAC studies in mice (Coleman et al., 2021, Sci Signal 14:eabb5968). Some hearts are taken to assess molecular markers including ANT, BNP, GRK2 and measure miR-7b levels with RT-PCR. Hearts (n=3-4 in each group - male and female) are taken for RNA and protein collections for the studies in Example 4 to combine with baseline and 6-weeks post-TAC (pre-gene therapy) hearts.

[0319] Section 3.2 - Determining Whether miR-7b can Attenuate HF After Ischemic Injury: It is believed that the loss of miR-7b-3p expression after cardiac injury is significant and a marker of LV dysfunction, which includes ischemic injury after MI (Figure 17D) In this sub-section, miR-7b delivery in vivo to the post-MI heart is tested to determine whether it is therapeutic. The coronary artery ligation model in the mouse where the left anterior descending artery (LAD) is completely ligated is utilized, a model used successfully is several studies in the lab (de Lucia et al., 2022, Cardiovasc Res 118:169-183; Schumacher et al., 2015, Science Trans Med 7:277ra31). This model causes severe LV dysfunction, adverse LV remodeling and HF within 1-2 weeks (de Lucia et al., 2022, Cardiovasc Res 118:169- 183; Gao etal., 2010, CircRes 107:1445-53; Schumacher et al., 2015, Science Trans Med 7:277ra31). The vectors as in section 3.1 of Example 3 are used and a similar experimental plan using WT C57BL / 6J mice (adult mice and equal numbers of males and females - -20 per group) is followed. A baseline Echo is carried out a before randomly assigning mice to MI or Sham surgeries and then Echo the mice at 2-weeks post-MI before randomly assigning treatment (AAV9-miR-7b, AAV9-SC or Saline) to the Sham and MI groups. Cohorts (3-4 per groups) are sacrificed at baseline and 2-weeks post-MI (pre-gene therapy) for RNA and protein studies (described in Example 4). After gene treatment (5xl0nGC in lOOpl IV), cardiac function of all mice is assessed by serial Echo every 2-weeks out to 6-8 weeks post-MI (4-6 weeks post-gene therapy). At the end of the study, terminal hemodynamics is carried out to assess adrenergic capacity before sacrificing. Overall, the effect of miR-7b on post-MI remodeling, including fibrosis and cardiac hypertrophy is assessed (Schumacher et al., 2015, Science Trans Med 7:277ra31). Hearts are saved for RNA and proteins studies atthe study end-point (as described as above in section 3.1 for use in Example 4). Hearts are used for histological assessment and are analyzed for HF markers (e.g. ANP, BNP) as well as GRK2 and miR-7b levels. Physiological rescue of HF is determined and also reversal of adverse LV remodeling and whether there was a decrease in LV scar expansion, which is done by histology (using TTC staining) as done previously with GRK2 inhibition studies (Schumacher et al., 2015, Science Trans Med 7:277ra31).

[0320] Section 3.3 - Determining the Therapeutic Effect of miR-7b on Catecholamine-Induced HF: It is found that miR-7b is down in circulating EVs of mice after chronic treatment with the catecholamine PAR agonist ISO, which can cause HF in mice (Figure 17A) (Kwon et al., 2021, Cells 10:1211). This also caused miR-7b to decrease in the heart after 8-weeks of treatment (Figure 17A and 17B). Thus, to comprehensively determine the therapeutic efficacy of miR-7b in mouse HF, the goal of this sub-section is to determine the specific effect of AAV9-miR-7b therapy using a catecholamine toxicity HF model induced by chronic administration of ISO. This is a standard model, which has been extensively used to induce cardiac hypertrophy, LV remodeling and HF (Kwon et al., 2021, Cells 10:1211; Ren et al., 2019, J Vis Exp 152:10.3791 / 59646; Wang et al., 2022, Circulation 145:1067-1083). As typically done with chronic drug studies (Schumacher et al., 2015, Science Trans Med 7:277ra31), and as described for chronic ISO studies in mice (Ren et al., 2019, J Vis Exp 152:10.3791 / 59646), ALZET mini-osmotic pumps implanted under the skin of the backs (subQ) of WT C57BL / 6J mice are used. 10 mg / kg / day ISO (dissolved in saline) is delivered for 4 weeks to induce HF using 4-week ALZET pumps. Control mice are implanted with pumps filled with saline. A recent study used this model and found significant hypertrophy and LV dysfunction, cardiac fibrosis and HF at 4 weeks (Wang et al., 2022, Circulation 145:1067-1083). Significant hypertrophy is seen using 10 mg / kg / day of ISO within 7 days (Kwon et al., 2021, Cells 10:1211). miR-7b after ISO-induced injury is delivered to see if HF can be reversed. These experiments proceed as above with baseline Echo’s in WT C57 adult male and female mice prior to ISO pump (or PBS pump) implantation. Serial Echo occur at 2- and 4-weeks and at 4-weeks, mice are randomized to receive 5xl0uGC of AAV9-miR-7b, AAV9-SC or Saline via a RO injection in lOOpl. At this time mice also receive a second 4-week pump with ISO orsaline. All mice are then followed for another 4 weeks (Echo’s at 2- and 4-weeks post gene therapy). At the end of 4 weeks terminal hemodynamics is conducted to assess LV pressures and inotropic reserve.

[0321] Overall, without wishing to be bound by any theory it is hypothesized that miR-7b attenuates the pathological effects of chronic ISO administration including loss of contractile reserve, hypertrophy and LV remodeling including myocardial fibrosis. In failing hearts, Masson’s Trichrome is used to assess cardiac fibrosis and WGA to measure myocyte size and hypertrophy. Fetal gene expression (e.g. ANF, BNP and PMHC via RT-PCR - as markers of maladaptive hypertrophy and HF) is quantitated for determination of HF and rescue. GRK2 levels are assessed via Western blot as a measure of cardiac dysfunction and reversal and miR-7b levels are quantified by RT-PCR as above. Staining for immune cell infiltrates is performed at the latter time-points to determine whether overexpressing miR-7b also blocks infiltration of these important cell factors in LV remodeling (de Lucia et al., 2022, Cardiovasc Res 118:169- 183).

[0322] Experience exists with ISO, MI and TAC models of HF in mice and delivering viruses to rodents (Choi et al., 1997, J Biol Chem 272:17223-17229; Coleman et al., 2021, Sci Signal 14:eabb5968; DeGeorge et al., 2008, Circulation 117:1378-1387; Fan et al., 2013, PLoS One 8:e66234; Gao et al., 2010, Circ Res 107:1445-53; Jean-Charles et al., 2017, JCI Insight 2:95998; Rengo et al., 2009, Circulation 119:89-98). Assessment of acute cardioprotection with miR-7b is not planned but it may be useful to first deliver AAV9-miR-7b to mice, then induce ischemic injury and assess protection by measuring 24hr infarct size and levels of cardiomyocyte cell death. This could be important since miR-7b has been implicated in apoptosis in H9c2 cells by regulating HIFla (Sheng et al., 2019, J Cell Biochem 120:9947-9955). Further, although proper expression of miR-7b and a therapeutic effect in preliminary in vivo experiments is observed (Figure 19B), how long expression endures needs to be checked to ensure there is ample expression out to 12-weeks needed for chronic TAC study. AV9 typically supports expression for several months (Pleger et al., 2011, Science Trans Med 3:92ra64; Rengo et al., 2009, Circulation 119:89-98). Finally, expression of miR-7b in myocytes is assessed and targeted in these cells of the hearts. It is found that GRK2 and pARKct is crucial in the fibroblast as well and attention is turned to this cell (Eguchi et al., 2021,Proc Natl Acad Sci USA 118:e2012854118; Woodall et al., 2016, Circ Res 119:1116-1127). How any potential beneficial effect in HF after miR-7b overexpression compares to standard of care in HF such as P-blocker therapy in mouse models is addressed in additional studies as the grant progresses in one of the models, such as MI, since experience exists with this model using a P-blocker along with other experimental treatments such as a GRK2 inhibitor (Schumacher et al., 2015, Science Trans Med 7:277ra31). This allows comparison of miR-7b overexpression with current HF therapies alone or in combination with metoprolol for example, which is important to eventual translation. A potential correlation is discussed between miR-7b GRK2 levels in the heart, however this could be a “true-true unrelated” relationship and not a direct correlation. Thus, it could have been a serendipitous finding based on the GRK2 work. Determination of a direct relationship is attempted, however there does not have to be for miR-7b to be translationally significant.

[0323] Example 4: Determination of miR-7b-dependent targets and pathways responsible for its effects in hypertrophic and ischemic myocytes to uncover mechanisms of its potential therapeutic responses in HF.

[0324] These studies involve studying global myocardial RNA-sequencing and cardiac proteomic data sets from Sham and post-TAC and post-MI mouse hearts treated with AAV9-miR-7b-3p (vs. controls) at different time-points to elucidate novel gene and protein targets as well as signaling pathways that uncovers potential mechanisms linking miR-7b to the phenotypic changes seen after its delivery in HF models. Specific targets and pathways are studied to link miR-7b mechanistically to the physiological effects found in vivo.

[0325] Without wishing to be bound by any theory, it is hypothesized that delivery of miR-7b to hypertrophic and ischemic myocytes in vivo allows, using RNA-Seq and proteomics, determination of its full-range of gene and protein targets as well as coordinated pathways in failing myocardium, uncovering its mechanism of action in HF. Further, the overexpression of miR-7b to the failing heart induces reparative pathwaysthat uncover novel therapeutic targets for HF based on gene expression and proteomic profdes.

[0326] Rationale: Studies under Example 4 utilize hearts procured from the TAC and MI studies in sub-sections 3.1 and 3.2 of Example 3, above. These include pre-injury hearts, post-injury hearts prior to gene therapy and then HF samples treated with miR-7b and controls (in both male and female hearts to address sex-specific differences). Global myocardial RNA-Seq data was performed in post-MI mouse hearts with GRK5 overexpression (de Lucia et al., 2022, Cardiovasc Res 118: 169- 183). The Duke Genomic Core is used to carry out the proposed studies with miR-7b expression. For the proteomic data set, the Duke Proteomic Core analyze samples as they have recently carried out a study with the GRK5 transgenic hearts post-MI. This yet to be published study is a follow-up to a previous study with the global myocardial gene expression profile. This new proteomic data set assessed proteomic profiles from 8-week post-MI hearts from cardiac-specific GRK5 overexpressing mice (TgGRK5) and their non-transgenic littermate control (NLC) mice. Figure 21 shows an example of the type of data generated in this study. Analyses of the proteins differentially altered in the LV samples of TgGRK.5 hearts post-MI vs. NLC showed several pathways altered (via assessment by Integrated Pathway Analysis - IP A) (Figure 21A). Several networks (Integrated Discovery Analysis - DAVID) were also altered in the LV tissue from TgGRK5 mice compared to NLCs at 8-weeks post-MI with the most significant involving CV system development / function (Figure 2 IB). In this study, proteomic changes in the post-TAC and post-MI failing heart due to miR-7b overexpression are determined where it is believed there is reversal of dysfunction and a beneficial effect.

[0327] As detailed above, global cardiac RNA-Seq analysis is performed as recently described (de Lucia et al., 2022, Cardiovasc Res 118:169- 183). In the Pilot study done delivering AAV9-miR-7b to post-TAC mice in Figure 19B, preliminary RNA-Seq at the 2-weeks post gene delivery time-point at the end of the study is performed. As shown in in the Volcano Plot from this initial RNA-Seq data set in Figure 22, 2-weeks after AAV9-miR-7b treatment in post-TAC mice compared to PBS treated post-TAC mice, miR-7b expression induced the significant up-regulation of 1228 transcripts and the down-regulation of 1317 transcripts. Interestingly, using geneontology (GO) enrichment analysis, alterations were found in major pathways induced by miR-7b expression in the post-TAC hearts 2-weeks after gene delivery (Figure 23). These include mitochondrial pathways that have interestingly, been previously shown to be regulated by GRK2 overexpression and mitochondrial accumulation (Pfleger et al., 2018, J Mol Cell Cardiol 123:108- 117; Sato et al., 2015, JMol Cell Cardiol 89:360-364). Initial mitochondrial function assays in vitro with myocytes with miR-7b overexpression are carried out in section 4.3 below to begin mechanistic studies from this data. Further, it is determined if these findings from the 2-week post-gene delivery time-point are consistent with the chronic time-points in the current set of experiments below, or if there are changes in gene expression that are unveiled by chronic injury and extension of treatment with miR-7b.

[0328] Experimental design:

[0329] Section 4.1 - Determining the Global Myocardial Gene Expression Changes in Post-TAC and Post-MI HF due to miR-7b Delivery: In this sub-section, the hearts from sections 3.1 and 3.2 of Example 3 are utilized to isolate RNA and determine transcriptome changes using global RNA-Seq. The sequencing and initial analysis is done by the Duke Genomic Core. Experience exists with analyzing gene expression data as prior data sets have been published (de Lucia et al., 2022, Cardiovasc Res 118:169-183) and as evidenced with preliminary data with miR-7b delivery in post-TAC WT mice 2-weeks after gene delivery (Figs. 7-8). The goal in the TAC studies is to analyze 3-4 samples from baseline hearts, 6-week post-TAC hearts (pre-gene delivery) and then 12-14-week post-TAC hearts (6-8-post-gene delivery), which is the study end-point. Equal number of Sham and TAC hearts are analyzed as well as equal number of male and female hearts and all of these groups include hearts treated with either AAV9-miR-SC, AAV9-miR-7b or PBS. Thus, even Sham groups receive the viruses for comparison of gene expression data as shown in Figure 23. Overall, there are 6 groups for each sex analyzed. All data are analyzed as has been detailed previously (de Lucia et al., 2022, Cardiovasc Res 118: 169-183) and as exemplified above (Figures 22 and 23). Importantly, for the TAC data, the 2-week post-gene delivery data is collected for additional comparison to determine if these gene are still differentially regulated by miR-7bchronically in HF or if other pathways are now altered. Comparisons are not only be made between miR-7b and control treated hearts but between male and female hearts to specifically address whether miR-7b provides the same effect in both sexes and to determine any sex-specific effects of this miR in TAC (pressure-overload) induced HF. This is valuable information no matter what the outcome and provides crucial mechanistic information for the ultimate therapeutic potential of miR- 7b. Top down-regulated genes are validated by RT-PCR and importantly, their 3 ’-un-tran slated sequences searched to determined if they are direct targets for miR-7b. This is key since nothing is known about the targets for miR-7b, especially in the heart. The data in Figure 23 suggests mitochondrial pathways are significantly regulated by miR- 7b and these are studied in section 4.3 below, however, this sub-section allows uncovering specific gene targets.

[0330] A similar experimental strategy is utilized for the pre- and post-MI samples from section 3.2 of Example 3. For these groups global myocardial RNA (transcript) expression from baseline hearts, 2-week post-MI hearts before gene delivery and then 6-weeks post-MI hearts that are 4-weeks after treatment (with either PBS, AAV9-miR-SC or AAV9-miR-7b) are analyzed. Included as above are sham treated hearts and male and female for all groups. Thus, gene expression changes induced by MI are elucidated and changes after miR- 7b overexpression are assessed. As described above, how miR- 7b overexpression changes myocardial gene expression in the uninjured heart are also assessed. As in the post-TAC study, how miR- 7b changes gene expression in the post-MI male vs. female hearts to study any sex-specific changes is compared. Analyses proceeds as above in the post-TAC studies and significant down-regulated transcripts are validated and analyzed for direct miR- 7b targets and pathways are studied for being involved in the therapeutic mechanism of miR-7b in ischemic-induced HF.

[0331] Section 4.2 - Determining Proteomic Changes in Post-MI and Post-TAC Myocardium due to miR- 7b Overexpression: This sub-section complements the gene expression changes above and specifically addresses protein changes in the failing heart after pressure-overload and ischemic injury and how miR- 7b overexpression alters this. As in section 4.1, both male and female hearts (including Sham and post-injured hearts)are studied. Specifically, samples are identical to the ones above in section 4.1.

[0332] Myocardial lysates from these samples (n=3-4 each) are prepared in a urea buffer for trypsin digestion before liquid chromatography-tandem mass spectrometry (LC-MS / MS) is done using the Duke Proteomics Core. For the TAC samples, this is baseline, 6-week post-TAC and 12-14-week post-TAC hearts (the latter being the treated hearts). These include both Sham and TAC groups, male and female. For the MI groupings this includes baseline, 2-week post-MI and 6-week post-MI (treated mice) with Sham and MI and male and females included. After the data is collected and initial analysis is done including calculation of the false discovery rate (FDR), Perseus and MaxQuant software is used as above to quantify significantly up- and down-regulated proteins (Cox et al., 2012, MBC Bioinformatics 13 Suppl 16:S12; Tyanova et al., 2016, NatProtoc 11:2301-2319).

[0333] Comparisons are be made between all three time-points, Sham and MI (HF), male and female and control and miR-7b treated for both injury models. Heat maps are generated to elucidate top proteins significantly up- and down-regulated by miR-7b in the post-TAC and post-MI failing heart to correlate with the physiological phenotypes discovered in Example 3. DAVID and IPA analyses are used to elucidate pathways significantly altered in the failing heart by miR-7b delivery and study their significance below in sub-section 4.3. This type of analyses is shown in Figure 21. This determines significant information on how miR-7b mechanistically alters the function of the failing heart. It is especially important in both the gene expression studies as well as these proteomic studies to assess overlapping proteins (and genes above) altered between the two different HF models. For example, one question to address is whether top significantly targeted down-regulated proteins due to miR-7b delivery in post-MI failing hearts also down-regulated in post-TAC hearts. This provides confidence that miR-7b has consensus targets in HF and these are mechanistically critical for its beneficial effects and provide experimental directions for in vitro studies.

[0334] Section 4.3 - Mechanistic Studies with miR-7b in Myocytes. This subsection elucidates the cellular mechanisms involved in cardiac protection and HF rescue by miR-7b in vitro. As shown in preliminary RNA-Seq data from the 2-week post-AAV9-miR-7b treatment in post-TAC mice (Figure 23), alterations were found in major mitochondrial pathways that were upregulated with miR-7b overexpression in both Shamand TAC hearts compared to saline treated groups. Utilizing neonatal rat ventricular myocytes (NRVMs), experiments are performed assessing mitochondrial function and structure with miR-7b overexpression. Since the mitochondrial inner membrane is the active site for the electron transport chain (ETC) and oxidative phosphorylation Seahorse Extracellular Flux assays are performed to assess mitochondrial respiratory chain function as done previously in myocytes with manipulation of GRK2 levels (Pfleger et al., 2018, J Mol Cell Cardiol 123:108- 117; Sato et al., 2015, J Mol Cell Cardiol 89:360-364). Hypertrophy is induced in NRVMs with phenylephrine (PE) and cardiomyocytes are treated with a miR-7b-3p mimic or miR-SC as a negative control (as done in Figure 18). The Seahorse Analyzer is located in the Duke Cardiovascular Research Center Core (Pfleger et al., 2018, J Mol Cell Cardiol 123:108- 117; Sato et al., 2015, J Mol Cell Cardiol 89:360-364). Assessing mitochondrial function determines whether overexpression of miR-7b alters energetic demand under hypertrophic stimuli and if specific mitochondrial complexes are regulated by miR-7b. The expression of mitochondrial ETC complexes is assessed by protein immunoblotting and RT-PCR.

[0335] Since there is a strong indication there are alterations in mitochondrial membrane proteins with increased miR-7b (Figure 23), Transmission Electron Microscopy (TEM) is performed with the Electron Microscopy Core at Duke. NRVMs are treated with PE and miR-7b (and a scrambled miR as described above), fixed and then sectioned and imaged by the Core. Mitochondrial ultrastructure is then quantified, including mitochondrial area and cristae dimensions to evaluate the effect of miR-7b on mitochondrial structure. Since GO analysis (Figure 23) reveals there are alterations in inner membrane proteins, the inner mitochondrial membrane fusion protein optic atrophy 1 (OPA1) by Western blotting and RT-PCR is assessed. Additionally, mitochondria is quantified utilizing the fluorescent dye MitoTRACKER, which assesses the therapeutic effect of miR-7b overexpression in cardiomyocytes under other pathological stimuli, such as ISO-induced hypertrophy or cardiomyocyte apoptosis to further evaluate the mechanistic role of miR-7b in the myocyte. As shown in Figure 18, miR- 7b completely attenuates cardiac hypertrophy. Therefore, in vitro anti-hypertrophic effects, including assessment of ANF, BNP and P-MHC and potential anti-fibrotic effects mediated through ERK1 / 2, SMAD 2 / 3 and JAK2-STAT1 / 3 signaling pathways by Western blotting andRT-PCR to assess molecular pathways modulated by miR-7b overexpression is investigated.

[0336] Following sub-sections 4.1 and 4.2, the new transcriptomic and proteomic data sets are utilized from two injury models, pressure overload (collected in section 3.1 of Example 3) and Mi-induced HF (collected in section 3.2 of Example 3) to evaluate significant gene and protein targets that are unveiled at each of the specific timepoints (baseline, pre-gene delivery and post-gene delivery). If the gene expression findings are consistent with the 2-week post gene delivery data, assessment of mitochondrial function and structure as described above continues. If data reveals new gene expression patterns and proteomic profiles, cellular mechanistic assays is adjusted to evaluate these pathways (e.g. apoptotic assays if targets suggest an anti-apoptotic effect mediated by HIFa).

[0337] The transcriptomics and proteomics experiments above generate large data sets that involve in-depth analysis. Global RNA-Seq on murine hearts from GRK5 transgenic hearts was carried out (de Lucia et al., 2022, Cardiovasc Res 118: 169- 183), and proteomic data set from these hearts was obtained as well from a manuscript in preparation that include sample data in Figure 21 for proof of principle. In addition to global RNA-Seq, single-nucleus RNA-sequencing, which the lab is currently doing in other mouse models, is carried out. This determines cellular composition within the hearts of these mice, which would add additional valuable information. It is believed that because of the cell-specific promoters used, the gene expression data is clear in terms of cell origin. If not, myocytes and fibroblasts are isolated from the hearts before isolating the RNA and carry out the RNA-Seq from cultured cells if warranted. Finally, mechanistic studies in myocytes based on the RNA-seq data are outlined. Different targets or pathways are seen as more data in sections 4.1 and 4.2 are generated, and as stated above, these mechanistic experiments are designed based on these new elucidated targets. However, it does appear miR-7b is altering mitochondrial pathways.

[0338] Example 5: AAV9-miR-7b in vivo delivery can be effective as a translationally significant gene therapy using a pre-clinical large animal porcine HF model.These studies involve intra-coronary delivery of AAV9-miR-7b to post-MI pigs to determine whether this miR can be effective in a pre-clinical model of HF and provide crucial data to support potential additional translation.

[0339] Without wishing to be bound by any theory, it is hypothesized that safe and efficient intracoronary AAV9-miR-7b-mediated gene delivery to the adult pig heart in vivo after a MI allows for pre-clinical testing and the beginning of additional clinical translation of miR-7b-3p for improving the performance of the failing heart.

[0340] Rationale: Studies under Example 5 have a translational goal and determine that miR- 7b improves LV dysfunction and remodeling in a pig model of ischemic HF. Gene therapy for human HF is still not a reality but it is getting closer and although AAV9 may not be the vector that makes it across the finish line, it is a viable vector for pre-clinical testing. The vectors are delivered to a pig MI model of HF that is estblished (Yan et al., 2023, Cell Stem Cell 30:1-16). Importantly, the pig is appropriate for pre-clinical HF studies as it has cardiac anatomy and physiology similar to humans. Of note, experience exists with large animals as well as studies with pigs including viral-mediated gene delivery (Emani et al., 2003, Molecular Therapy 8:306-313; Fields et al., 2005, Ann Vase Surg 19:712-718; Raake et al., 2013, Eur Heart J 34:1437-1447). This includes a pre-clinical study in a balloon injury post-MI HF model in pigs using AAV6-PARKct, which is similar to what is done here (Raake et al., 2013, Eur Heart J 34: 1437-1447). The difference in the current study is the gene delivery method which is an intracoronary infusion with balloon occlusion (IC:BO), which has successfully been employed (Figure 24). Importantly, experience exists with the Yorkshire pig for inducing ischemia / reperfusion (I / R) injury and HF using balloon injury (Yan et al., 2023, Cell Stem Cell 30:1-16). It was also successfully delivered AAV9 transgenes to these pigs using the IC:BO method (Vekstein et al., 2022, Front. Cardiovasc. Med. 9:833335) (Figure 24). In these studies, MI is induced and then after 2-weeks deliver AAV9-cTnT-miR-7b with intracoronary gene delivery and follow the pigs for 4 weeks. Cardiac function is followed by Echo and cardiac magnetic resonance imaging (MRI) with previous pig studies (Mendiola et al., 2024, PloS One 19:e0304588; Vekstein et al., 2022, Front. Cardiovasc. Med. 9:833335; Williams etal., 2013, Circulation, 127:213-223; Williams et al., 2013, J Am Heart Assoc. 2:el40; Yan et al., 2023, Cell Stem Cell 30:1-16). Thus, the collaboration between the labs for the translational testing of AAV9-miR-7b is a powerful one and should yield crucial data on clinical testing of miR-7b.

[0341] Experimental design:

[0342] Specifically, Yorkshire pigs with initial weight of 20-25 kg are used. These pigs are screened for neutralizing antibody titers against AAV9 using serum and a luciferase-based assay as described (Vekstein et al., 2022, Front. Cardiovasc. Med.

[0343] 9:833335). Only pigs with minimal titers of these antibodies are enrolled in the study. 16 pigs are enrolled (either sex is used for these studies) with 8 to receive AAV9-cTnT-GFP and 8 to receive AAV9-cTnT-miR-7b. Pigs first undergo a baseline Echo and MRI and then MI is induced by a clinically relevant closed-chest balloon injury model using an angioplasty balloon inflated in the mid-LAD location for 90 min as recently described (Yan et al., 2023, Cell Stem Cell 30:1-16). Two weeks later, pigs have a repeat Echo and a MRI done with gadolinium to assess cardiac function, morphology and scar and then randomly assigned treatment group to receive IxlO14genome copies (GC) of AAV9-GFP or AAV9-miR-7b via the IC:BO method (see Figure 24), which is infused in 5ml of saline over 60-90sec (Vekstein et al., 2022, Front. Cardiovasc. Med. 9:833335). At 6-weeks post-MI or 4-weeks post-gene delivery the pigs receive an Echo and then a final gadolinium MRI to assess whether miR-7b treated animals have signs of increased function and reverse LV remodeling and any signs of reduced scar size on MRI compared to GFP-treated post-MI pigs that have significant LV dysfunction and HF. The MRI data is also analyzed to assess temporal changes between baseline, 2-weeks and 6-weeks for LV ejection fraction and myocardial volumes. These all point towards miR-7b as having translational potential as a gene therapy for HF. It is believed miR-7b has a beneficial effect in this large animal pre-clinical HF model if gene transfer is sufficient, which is confirmed at the end of the study (see below).

[0344] At the end of the study, hearts are removed from the pigs and histology is done on some sections to assess fibrosis comparing GFP and miR-7b treated post-MI hearts and assess scar size and collagen expression. Cardiomyocyte size is assessed with WGA staining and capillary density with CD31 staining of cardiac sections. Taking the area at risk targeted by the LAD, RT-PCR is used to assess transgene expression and alsoassess GFP expression with PCR, Western blots and staining of sections as in Figure 24B. Importantly, global myocardial RNA-Seq is carried out from GFP -treated vs. miR-7b treated post-MI pig hearts (n=3-4 each) to assess the transcriptome of the failing pig hearts to determine the targets and pathways altered by miR-7b. Importantly, this allows comparison of pathways targeted by miR-7b in the failing pig heart to the failing mouse heart in Example 4 to analyze overlapping targets and also any novel ones.

[0345] Significant overlap in gene expression patterns and pathways effected by miR-7b overexpression in the failing pig heart versus the mouse is expected, however it is crucial to verify to aid in additional translation of this potential gene therapy.

[0346] For any large animal gene delivery protocol in HF, there is always concern that transduction efficiency is not be high enough to alter global cardiac function. Success has been seen with IxlO14GC using the IC:BO method to be effective for ample expression at the site of injury (Yan et al., 2023, Cell Stem Cell 30:1-16) and also at the LAD targeted site (Vekstein et al., 2022, Front. Cardiovasc. Med. 9:833335). IxlO13GC for AAV6-PARKct is used in a previous study and in 4-weeks post-MI saw improved cardiac function, however this was with retrograde intra-coronary gene delivery through the coronary sinus with a balloon in the LAD (Raake et al., 2013, Eur Heart J 34: 1437-1447). This higher dose is chosen because of the experience with the IC:BO method. Expression is closely monitored and this is why 2-weeks was chosen for gene delivery and 4-weeks for the study end-point. It may be worthwhile to eventually go another 3-4 weeks if there is indeed ample expression and can certainly try more pigs at this later study end-point. In addition to these issues, large animal pre-clinical model have been designed with just miR-7b alone without adding any standard of care treatment regimens. This was done to first find the true potential beneficial effect of miR-7b in a large animal model of HF. A P-blocker is added to mouse studies in Example 3 and miR-7b’s effects are determined with standard of care regimens before additional pigs are done for pre-clinical work with miR-7b plus standard of care.

[0347] For all mouse studies, typically adult mice at least 10-12 weeks of age are used. All mice used in all studies described are from the C57BL / 6J genetic background. There are several recent examples of this practice of rigor in the lab for in vivo experiments (Coleman et al., 2021, Sci Signal 14:eabb5968; Sato et al., 2018, Sci Signal11(560) pii: eaau0144; Schumacher et al., 2015, Science Trans Med 7:277ra31; Woodall et al., 2019, JCI Insight 5 :pii: 123848; Woodall et al., 2016, CircRes 119:1116-1127). Additionally, all in vitro assays are tightly controlled with appropriate positive and negative controls as has been done for over 3 decades with recent published examples (Chen et al., 2013, Circ Res 112:1121-1134; Pfleger et al., 2018, J Mol Cell Cardiol 123:108- 117; Pfleger et al., 2020, Circulation 142:882-898; Sato et al., 2015, J Mol Cell Cardiol 89:360-364).

[0348] Importantly, for the last 30 years, male mice are typically used for studies but in the last several years, both male and female mice (with enough N-sizes for both) are used for experiments in order to investigate sex-specific differences and effects. If differences are found, these are further explored mechanistically. For current experiments, the same is done. Since ischemic cardiac injury is a model used herein, there could be differences in outcomes with female mice as estrogen signaling can alter cardiac ischemic repair (Mackie et al., 2013, J Biol Chem 288: 18022-18034). For pigs, typically both sexes are used for pre-clinical studies.

[0349] For all experiments presented above, appropriate statistical tests are used as done over the last 3+ decades. Experiments comparing two groups utilize the Student’s t-test while experiments comparing multiple groups utilize a one-way ANOVA with post-hoc test. For planned animal experiments, estimation of sample size is done using nQuery Advisor 3.0 software. The sample size is equal in each group and based on Power Analysis and previous publications. For mouse studies, separate cohorts of animals are typically used for biochemical and physiological studies. The reported experience is 20% mortality due to MI or TAC.

[0350] Example 6: Micro-RNA 7b for Heart Failure

[0351] MiRs are small non-coding RNAs (typically 22-nucleotides in length) and are found throughout chromatin and these molecules regulate transcripts by binding to the 3 ’-untranslated regions of mRNAs causing their degradation prior to translation or blocking translation, therefore playing a role in fine-tuning protein levels. Of note, miRs are becoming increasingly studied in the heart and several miRs have been implicated in HF pathology.Importantly, miRs and miR inhibitors (known as antagomirs) are moving towards the clinic in heart failure (HF). Although several miRs have been shown to be important in the heart including after injury, there are probably still several yet to be identified that play crucial roles. Indeed, this appears to be the case for miR- 7b (specifically, miR-7b-3p). MiR- 7b is part of the miR-7 family (and not the let-7 family) but is a specific family member and has its own targeting sequence distinct from miR-7 and miR-7a. Over the last 3 decades, G protein-coupled receptor (GPCR) kinase 2 (GRK2) in the heart and how this kinase is pathological in the heart when it is up-regulated after the heart is injured and during HF has been studied. It was found that in conditions when GRK2 is high miR-7b is significantly down in the heart and when GRK2 is inhibited, miR-7b is elevated, at least in secreted vesicles of cardiac cells. It was hypothesized that miR- 7b may correlate with cardiac dysfunction and be associated with HF and found in down in 3 separate and distinct HF models. It was then delivered to 2 mouse models of HF via an adeno-associated viral vector (AAV9) using IV delivery and it had beneficial effects when delivered after injury. Thus, miR-7b has novel therapeutic properties in HF. The present invention is used for heart failure gene therapy and as a biomarker for HF.

[0352] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

CLAIMSWhat is claimed is:

1. A method of treating or preventing heart failure (HF) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of microRNA 7b-3p (miR-7b-3p) or a miR-7b-3p mimic.

2. The method of claim 1, wherein the miR-7b-3p or miR-7b-3p mimic is comprised in an adeno-associated virus 9 (AAV9) vector.

3. The method of claim 1, wherein the administration comprises intracoronary catheter-based AAV9 gene delivery.

4. The method of claim 1, wherein the administration comprises administration before, during, or after HF.

5. The method of claim 1, wherein the HF comprises cardiac hypertrophy, heart dysfunction from pressure overload, failure of contractility, cardiomyocyte apoptosis, ischemic injury, stress-induced cardiomyopathy, adverse heart remodeling related to myocardial infarction, HF resulting from valvular injury, HF resulting from insufficiency, and HF resulting from viral infection.

6. The method of claim 1, wherein the administration occurs via intra-coronary delivery or infusion for a period of minutes.

7. The method of claim 1, wherein the miR-7b-3p or miR-7b-3p mimic is comprised within AAV9 vector and administered at a concentration of about IxlO12vector genomes (vg’s) to about 5xl014vg’s via intra-coronary or intravenous delivery.

8. The method of claim 1, wherein the miR-7b-3p or miR-7b-3p mimic are administered with an acceptable pharmaceutical carrier.

9. The method of claim 1, wherein the administration occurs for about 2 weeks to about 4 weeks.

10. The method of claim 1, wherein preventing HF in a subject in need thereof is maintained for about 4 weeks following administration.

11. The method of claim 1, wherein HF is attenuated in the subject following administration for about 2 weeks.

12. The method of claim 1, wherein the miR-7b-3p or miR-7b-3p mimic is comprised within AAV9 vector and administered at a concentration of about 30pmol / lxl06cells.

13. The method of claim 1, wherein the miR-7b-3p or miR-7b-3p mimic comprises a sequence at least 90% identical to a sequence set forth in SEQ ID NOs: 1-5.

14. A composition for treating or preventing heart failure (HF) in a subject in need thereof, the composition comprising a therapeutically effective amount of microRNA 7b-3p (miR-7b-3p) or a miR-7b-3p mimic.

15. The composition of claim 14, wherein the composition is comprised in an adeno-associated virus 9 (AAV9) vector.

16. The composition of claim 14, wherein the composition further comprises a pharmaceutically acceptable carrier.

17. The composition of claim 14, wherein the HF comprises cardiac hypertrophy, heart dysfunction from pressure overload, failure of contractility, cardiomyocyte apoptosis, ischemic injury, stress-induced cardiomyopathy, adverse heart remodeling related to myocardial infarction, HF resulting from valvular injury, HF resulting from insufficiency, and HF resulting from viral infection.

18. The composition of claim 14, wherein the miR-7b-3p or miR-7b-3p mimic is comprised within AAV9 vector and administered at a concentration of about IxlO12vector genomes (vg’s) to about 5xl014vg’s via intra-coronary or intravenous delivery.

19. The composition of claim 14, wherein the miR-7b-3p or miR-7b-3p mimic is at a concentration of about 30pmol / lxl06cells.

20. The composition of claim 15, wherein the miR-7b-3p or miR-7b-3p mimic comprises a sequence at least 90% identical to a sequence set forth in SEQ ID NOs: 1-5.