Kits and methods for controlled primer grafting
Patent Information
- Application Number
- PCT/US2026/020570
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-26
- Filing Date
- 2026-03-24
- Publication Date
- 2026-10-01
Smart Images

Figure US2026020570_01102026_PF_FP_ABST
Abstract
Description
KITS AND METHODS FOR CONTROLLED PRIMER GRAFTINGCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U. S. Provisional Application S. N.63 / 778,226, filed March 26, 2025, the contents of which is incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING
[0002] The Sequence Listing submitted via Patent Center is hereby incorporated by reference in its entirety. The name of the file is ILI294BPCT_IP-2897-PCT_Sequence_Listing.xml, the size of the file is 17,468 bytes, and the date of creation of the file is March 16, 2026.BACKGROUND
[0003] RNA is an important biological molecule, as its study facilitates understanding of functional biological processes within a cell (i.e., the study of the transcriptome or transcriptom ics) and understanding of regulatory elements (such as long non-coding RNAs (IncRNAs) or microRNAs (miRNAs)). Analysis of RNA can also be useful for detection of infectious agents (such as RNA viruses). A prerequisite for the study of RNA is often conversion of RNA into a DNA copy, as DNA has properties that enhance its chemical stability and make it amenable to manipulation using common molecular biology tools and reagents.SUMMARY
[0004] Some platforms for RNA capture and cDNA conversion include two different types of primers - a first of which is designated for clustering and decoding, and a second of which is designated for RNA capture. The kit and method described herein utilize the surface chemistry of the platform to enable selective attachment of the two different types of primers at two different times during the workflow. As will bedescribed in more detail herein, the kit and method enable the second type of primer to be absent during the clustering and decoding of the first type of primer, which eliminates i) having to block the second type of primer during clustering and decoding, and ii) potential interference from the second type of primer during decoding.BRIEF DESCRIPTION OF THE DRAWINGS
[0005] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0006] Fig. 1 A is a top view of a flow cell;
[0007] Fig. 1 B is an enlarged, perspective, and cut-away view of one architecture of the flow cell of Fig. 1 A, which includes depressions separated by interstitial regions;
[0008] Fig. 1C is an enlarged, perspective, and cut-away view of another architecture of the flow cell of Fig. 1 A, which includes a lane;
[0009] Fig. 1 D is an enlarged, perspective, and cut-away view of another architecture of the flow cell of Fig. 1 A, which includes a flat surface;
[0010] Fig. 2 is a schematic illustration of an example of a linking molecule including orthogonally reactive alkyne groups at opposed ends;
[0011] Fig. 3A is a schematic illustration of one example of a barcoded primer;
[0012] Fig. 3B is a schematic illustration of another example of a barcoded primer;
[0013] Fig. 3C is a schematic illustration of additional sequences that can be part of either of the barcoded primers shown in Fig. 3A or Fig. 3B;
[0014] Fig. 3D is a schematic illustration of an example of an azide terminated capture primer;
[0015] Fig. 4A through Fig. 4F together depict a schematic flow diagram illustrating an example of the method disclosed herein, where Fig. 4A depicts a depression or lane of a flow cell, Fig. 4B depicts the addition of a primer set, Fig. 4C depicts the depression or lane after attachment of a linking molecule and after clustering and decoding of a barcoded primer, Fig. 4D depicts the addition of the capture primer, Fig.4E depicts the capture of mRNA and its conversion to complementary DNA (cDNA), and Fig. 4F depicts the initial bridge amplification of the cDNA;
[0016] Fig. 5 is a bar graph illustrating the Cal Fluor Red (CFR) intensity of tagged flow cell primers before and after different concentrations of a linking molecule, including first and second alkynes, were attached to free azides of a polymeric hydrogel having decoding primers attached thereto and present in depressions of respective flow channels of a flow cell;
[0017] Fig. 6 is a graph depicting several sequencing metrics (P90.A, % ≥ Q30, % Pass Filter, and Density) of the flow cell after decoding was performed in each of the flow channels;
[0018] Fig. 7 is a graph depicting the CFR intensity (Y axis) versus the concentration of linking molecule (X axis) after capture primers were grafted in each of the flow channels post decoding; and
[0019] Fig. 8 is a graph depicting the CFR intensity (Y axis) versus the concentration of capture primers (X axis) introduced into respective flow channels of a different flow cell in different grafting buffers post linking molecule attachment and decoding of the decoding primers.DETAILED DESCRIPTION
[0020] In the examples set forth herein, a flow cell is the platform used for RNA capture, conversion to cDNA, and analysis via sequencing. The kit and method described herein utilize the surface chemistry of the flow cell and the introduction of a linking molecule that is capable of orthogonal click reactions. Strain-promoted azide alkyne cycloaddition (SPAAC) and copper-catalyzed azide alkyne cycloaddition (CuAAC) are orthogonal click reactions because the terminal alkynes used in the CuAAC reaction are inert in the SPAAC reaction. The introduction of the linking molecule occurs prior to clustering and decoding via SPAAC. Thus, clustering and decoding can be performed without interference from the RNA capture primers, and the workflow can be performed without having to deblock the RNA capture primers after clustering and decoding has been performed. The introduction of the linking molecule also provides the flow cell surface with terminal alkynes, which do notparticipate in clustering and decoding, but enable the subsequent CuAAC reaction of azide-term inated RNA capture primers.
[0021] Definitions
[0022] Terms used herein will be understood to take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.
[0023] As used herein, the singular forms “a,” “an,” and “the” refer to both the singular as well as plural, unless the context clearly indicates otherwise. The term “comprising” as used herein is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
[0024] Reference throughout the specification to “one example,” “another example,” “an example,” and so forth, means that a particular element (e.g., feature, structure, composition, configuration, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0025] The terms “substantially” and “about” used throughout this disclosure, including the claims, are used to describe and account for small fluctuations, such as those due to variations in processing. For example, these terms can refer to less than or equal to ±5% from a stated value, such as less than or equal to ±2% from a stated value, such as less than or equal to ±1 % from a stated value, such as less than or equal to ±0.5% from a stated value, such as less than or equal to ±0.2% from a stated value, such as less than or equal to ±0.1% from a stated value, such as less than or equal to ±0.05% from a stated value.
[0026] The term “amplification” refers to the replication of one or more nucleic acid templates. Amplification may use one or more of a bridge amplification reaction, a non-bridge amplification reaction, an isothermal bridge amplification reaction, a rolling circle amplification (RCA) reaction, a modified rolling circle multiple displacementamplification, a helicase-dependent amplification reaction, a recombinase-dependent amplification reaction, a single-stranded DNA binding (SSB) protein mediated Isothermal amplification, a PCR reaction, a strand-displacement reaction, a ligase chain reaction, a transcription-mediated reaction, a loop-mediated amplification reaction, other suitable reactions, and combinations thereof.
[0027] The term “amplification domain sequence” refers to a universal nucleotide sequence, such as a P5 or P7 sequence or a complement thereof, that can serve as a starting point for fragment or template amplification and cluster generation.
[0028] As used herein, the term “attached” refers to the state of two things being joined, fastened, adhered, connected or bound to each other, either directly or indirectly and either physically or chemically. As an example of chemical attachment, a nucleic acid can be attached to a polymeric hydrogel in a flow cell by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of pairs of electrons between atoms. A specific example of covalent attachment includes, for example, those that result from the use of click chemistry techniques. A non-covalent bond is a physical bond that does not involve the sharing of pairs of electrons and can include, for example, non-specific interactions (e.g. hydrogen bonding, ionic bonding, van der Waals interactions etc.) or specific interactions (e.g. affinity interactions, receptor-ligand interactions, antibody-epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin-carbohydrate interactions, etc.). In certain examples, the molecules (e.g., nucleic acids, enzymes) remain immobilized or attached to the polymeric hydrogel under the conditions in which the flow cell is intended to be used, for example in applications requiring cDNA formation, amplification, and / or sequencing. In other examples, the molecules are reversibly immobilized and can be removed from the polymeric hydrogel through the use of cleavable sites, linkers, and the like. The term “attached” is synonymous with the terms “immobilized” and “affixed.”
[0029] As used herein, a “bonding region” refers to an area of a substrate that is to be bonded to another material, which may be, as examples, a spacer layer, a lid, another substrate, etc., or combinations thereof (e.g., a spacer layer and a lid, or a spacer layer and another substrate). The bond that is formed at the bonding regionmay be a chemical bond (as described above), or a mechanical bond (e.g., using a fastener, etc.). The bonding region is free of surface chemistry (e.g., polymeric hydrogel and primers of a primer set).
[0030] The terms “cluster of oligonucleotides,” “cluster,” “oligonucleotide cluster,” or “colony” refer to a localized group or collection of DNA or RNA on a solid support. In particular, a cluster includes tens, hundreds, thousands, or more copies of a cloned or of the same DNA or RNA segment. For example, a cluster includes a grouping of oligonucleotides immobilized in a section of a flow cell or other nucleotide-sample slide. In some examples, clusters are evenly spaced or organized in a systematic structure within a patterned flow cell. By contrast, in other examples, clusters are randomly organized within a non-patterned flow cell. In typical examples, a cluster is the product of an amplification reaction. A cluster of oligonucleotides can be imaged utilizing one or more light signals, changes in pH, changes in conductance, and other signals. For instance, an oligonucleotide-cluster image may be captured by a camera during a sequencing cycle of light emitted by irradiated fluorescent labeled nucleotides incorporated into oligonucleotides, fluorescent labeled nucleotides bound but not incorporated into oligonucleotides, and other fluorescent labeled complexes associated with incorporated or bound nucleotides from one or more clusters on a flow cell. Examples of other sequencing procedures are set forth herein. A cluster can be monoclonal or polyclonal.
[0031] “Complementary DNA” (cDNA) is a synthetic deoxyribonucleic acid strand made from an RNA strand using a reverse transcriptase.
[0032] The term “depositing,” as used herein, refers to any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like.Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating / deposition, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.
[0033] As used herein, the term “depression” refers to a discrete recessed feature defined in a substrate and having an opening at a surface of the substrate. In some instances, the surface opening is at least partially surrounded by interstitial region(s) of the substrate. Depressions can have any of a variety of shapes at their opening including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. As examples, the depression can be a well or two interconnected wells.
[0034] When used in reference to a collection of items, the term “each” identifies an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.
[0035] As used herein, the term “flow cell” is intended to refer to a vessel having an enclosed flow channel where a reaction can be carried out, or a vessel having a channel that is open to a surrounding environment and in which a reaction can be carried out. A flow cell with an enclosed flow channel also includes an inlet for delivering reagent(s) to the channel and an outlet for removing reagent(s) from the channel. In some examples, the flow cell enables the detection of the reaction that occurs therein. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.
[0036] As used herein, a “flow channel” or channel” refers to a flow cell area that can selectively receive a liquid sample, reagents, etc. In some examples disclosed herein, the terms refer to an area that is defined between two patterned structures, and the flow channel is in fluid communication with surface chemistry disposed within depressions defined in each of the two substrates. In other examples disclosed herein, the terms refer to an area that is defined between two non-patterned structures, and the flow channel is in fluid communication with surface chemistry disposed within lanes defined in each of the two substrates. In other examples disclosed herein, the flow channel is defined between one substrate and a lid, and the flow channel is in fluid communication with surface chemistry of the one substrate. Instill other examples, the flow channel is defined within a lane that is open to the surrounding environment.
[0037] A “fragment” refers to a portion or piece of cDNA generated from an RNA sample.
[0038] The term “fragmentation,” as described herein, refers to the shearing or fragmenting of nucleic acid into shorter lengths. Fragmentation methods include enzymatic, physical (including sonication, nebulization, needle shearing, microwave, etc.), and chemical (including depurination, hydrolysis, oxidation, etc.). The terms “fragmenting enzymes” or “enzyme-based fragmentation” or “enzyme fragmentation” as used herein refers to enzymes that fragment nucleic acid. The enzymes can be a single enzyme or two or more enzymes that work together to fragment the nucleic acid. Some enzymes work on single stranded nucleic acid whereas others work on double stranded nucleic acid and yet others work on one strand of a double stranded nucleic acid. Fragmenting enzymes can cut randomly or specifically. Examples of fragmenting enzymes include transposase, restriction enzymes, Argonaute, CRISPR -associated nuclease (Cas), endonucleases, exonuclease, topoisomerase, FRAGMENTASE™ (New England Biolabs, Ipswich, MA).
[0039] The term “hydrogel” or “polymeric hydrogel” refers to a semi-rigid polymer that is permeable to liquids and / or gases. The hydrogel can swell when liquid (e.g., water) is taken up and can contract when liquid is removed, e.g., by drying. While a hydrogel may absorb water, it is not water-soluble.
[0040] An “index sequence” refers to a nucleic acid sequence that functions as a barcode for the primer in which it is included, and ultimately for the fragment attached to that primer. Index sequences may range from 7 bases to 15 bases long.
[0041] As used herein, the term “interstitial region” refers to an area, e.g., of a substrate that separates individual depressions from immediately adjacent depressions or from perimeter region(s). The separation provided by an interstitial region can be partial or full separation.
[0042] A “non-patterned structure” refers to a substrate that includes primers that are not present in a pattern.
[0043] A “nucleic acid sample” is typically derived from any organism, including animals, plants, fungi, and microbes. For example, such samples may be derived from one or more biological fluids, cells, tissues, organs, or organisms, comprising a nucleic acid or a mixture of nucleic acids comprising at least one nucleic acid sequence. Such samples may include sputum / oral fluid, amniotic fluid, blood, a blood fraction, or fine needle biopsy samples (such as surgical biopsy, fine needle biopsy, etc.), urine, peritoneal fluid, pleural fluid, and the like. Although the sample is often taken from a human subject (such as a patient), the sample may be from any mammal, including, but not limited to dogs, cats, horses, goats, sheep, cattle, pigs, etc. Alternatively, the sample may be microbial such as bacteria, viral, or fungal. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparing plasma from blood, diluting viscous fluids and so forth.Methods of pretreatment may also involve, but are not limited to, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatment methods are typically such that the nucleic acid(s) of interest remain in the test sample, sometimes at a concentration proportional to that in an untreated test sample (such as namely, a sample that is not subjected to any such pretreatment method(s)). Such “treated” or “processed” samples are still considered to be biological “test” samples with respect to the methods described herein. A “nucleic acid sample” may also include nucleic acid sequence information stored in a memory, and which was originally obtained from a source such as one or more biological fluids, cells, tissues, organs, or organisms.
[0044] As used herein, a “nucleotide” refers to a compound consisting of a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are monomeric units of a nucleic acid sequence. In RNA (ribonucleic acid), the sugar is a ribose, and in DNA (deoxyribonucleic acid), the sugar is a deoxyribose, i.e., a sugar lacking a hydroxyl group that is present at the 2' position in ribose. The nitrogen containing heterocyclic base (i.e., nucleobase) can be a purinebase or a pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to N-1 of a pyrimidine or N-9 of a purine. A nucleic acid analog may have any of the phosphate backbone, the sugar, or the nucleobase modified. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acid (PNA) or locked nucleic acid (LNA).
[0045] In some examples, the term “over” may mean that one component or material is positioned directly on another component or material. When one is directly on another, the two are in physical contact with each other.
[0046] In other examples, the term “over” may mean that one component or material is positioned indirectly on another component or material. By indirectly on, it is meant that a gap or an additional component or material may be positioned between the two components or materials.
[0047] A “patterned structure” refers to a substrate that includes primers in a pattern. In some examples, the patterned structure includes a pattern of depressions separated by interstitial regions, and primers within the depressions. In other examples, the patterned structure a primer density gradient across the surface.
[0048] “PolyA” and “PolyT” respectively refer to a nucleic acid sequence (e.g., a capture nucleotide sequence) including a series of two or more adenine (A) bases and thymine (T) bases, respectively. A polyA or polyT can include at least about 2, 5, 8, 10, 12, 15, 18, 20, 22, 25, 28, 30, 32, 35, 38, 40, or more of the A or T bases, respectively. Alternatively or additionally, a polyA or polyT can include at most about 40, 38, 35, 32, 30, 28, 25, 22, 20, 18, 15, 12, 10, 8, 5, or 2 of the A or T bases, respectively.
[0049] As used herein, the “primer” is defined as a single stranded nucleic acid sequence (e.g., single stranded DNA). Some primers are designated for clustering and decoding. These primers may be referred to as barcoded primers, and include, from the 5’ to 3’ ends, an amplification domain sequence, an index sequence, and a sequencing primer sequence (serves as a starting point for amplification and clustergeneration). Other primers are designated for RNA capture. These primers may be referred to as RNA capture primers, and include, from the 5’ to 3’ ends, an amplification domain sequence and a polyT capture sequence. Still other primers include the amplification domain alone, and thus serve as a starting point for fragment amplification and cluster generation. Still other primers, referred to herein as sequencing primers, serve as a starting point for DNA synthesis. In some instances, the 5’ terminus of the primer may be modified to allow a coupling reaction with a functional group of a polymeric hydrogel or with the terminal alkyne of the linking molecule. The primer length can be any number of bases long and can include a variety of non-natural nucleotides. In an example, the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.
[0050] A “spacer layer,” as used herein, refers to a material that bonds two components together. In some examples, the spacer layer can be a radiationabsorbing material that aids in bonding, or can be put into contact with a radiationabsorbing material that aids in bonding.
[0051] The term “substrate” may be used herein in conjunction with the term “single-layer substrate” or “multi-layer substrate.” A single-layer substrate is one layer of a support material that can be used to form a patterned structure. The multi-layer substrate includes at least two layers, e.g., a base support with an additional layer thereon that can be patterned with depressions.
[0052] “Surface chemistry,” as defined herein, refers to a polymeric hydrogel (as defined herein) with at least one primer attached thereto.
[0053] The term “transparent” when describing a material (e.g., substrate, layer, etc.) means that that the material allows light of a particular wavelength or range of wavelengths to pass through. Transparency may be quantified using transmittance, i.e., the ratio of light energy falling on a body to that transmitted through the body. The transmittance of a transparent material will depend upon the thickness of the material and the wavelength of light. In the examples disclosed herein, the transmittance of the transparent material may range from 0.25 (25%) to 1 (100%). The material may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting material is capable of the desired transmittance. Additionally, dependingupon the transmittance of the material, the time for light exposure and / or the output power of the light source may be increased or decreased to deliver a suitable dose of light energy through the transparent material to achieve the desired effect.
[0054] Kits
[0055] An example kit includes a flow cell including a substrate and a polymeric hydrogel having surface azide groups and being attached to the substrate; a first fluid including a first liquid carrier and a linking molecule including first and second alkynes; a second fluid including a second liquid carrier and a plurality of barcoded primers; and a third fluid including a third liquid carrier; and a plurality of azide terminated capture primers.
[0056] In one specific example, the kit includes a flow cell including a substrate having a lane or a plurality of depressions defined therein, and a polymeric hydrogel having surface azide groups and positioned in the lane or each of the plurality of depressions; a first fluid including a first liquid carrier and a linking molecule including first and second alkynes at opposed ends, the first alkyne having reactivity orthogonal to the second alkyne; a second fluid including a second liquid carrier and a plurality of barcoded primers; and a third fluid including a third liquid carrier and a plurality of azide terminated capture primers.
[0057] Flow Cell
[0058] A top view of the flow cell 10 included in the kit is shown in Fig. 1A, and two different architectures that may be present within the flow channels 12 of the flow cell 10 are shown in Fig. 1 B and Fig. 1 C. Fig. 1 D depicts an alternate architecture of the flow cell 10.
[0059] In the example shown in Fig. 1B, the flow cell 10 includes a patterned structure 14. While not shown, it is to be understood that a lid or a second patterned structure may be attached to the patterned structure 14 (e.g., at a perimeter region 16, which serves as a bonding region). Alternatively, the patterned structure 14 is not bonded to another component, but rather, is open to the surrounding environment.
[0060] In the example shown in Fig. 1 C, the flow cell 10 includes a non-patterned structure 18. While not shown, it is to be understood that a lid or a second non-patterned structure may be attached to the non-patterned structure 18 (e.g., at the perimeter region 16). Alternatively, the non-patterned structure 18 is not bonded to another component, but rather, is open to the surrounding environment.
[0061] In the example shown in Fig. 1 D, the flow cell 10 includes another example of a non-patterned structure 18’. This non-patterned structure 18’ is not bonded to another component, but rather, is open to the surrounding environment.
[0062] The patterned structure 14 and the non-patterned structures 18, 18’ may include a single-layer substrate 20 or a multi-layer substrate 22.
[0063] Examples of suitable materials for the single-layer substrate 20 include epoxy siloxane, glass, modified or functionalized glass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceramics / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e g., boron doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxide(s) (TaOx), hafnium oxide (HfO2), carbon, metals, or the like.
[0064] Examples of the multi-layer substrate 22 include a base support 32 and a material 30 positioned over the base support 32. The base support 32 may be any of the examples set forth herein for the single-layer substrate 20. The material 30 may be any material that is capable of being patterned with the depressions 24 or the lane 26.
[0065] In an example, the material 30 may be an inorganic oxide that is selectively applied to the base support 32, e.g., via vapor deposition, aerosol printing, or inkjet printing, in the desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiC>2), hafnium oxide (e.g., HfO2), etc. In another example, the material 30 may be a resin matrix material that is applied to the base support 32 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating,aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin, a non-polyhedral oligomeric silsesquioxane epoxy resin, a polyethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.
[0066] When the single-layer substrate 20 is used, a plurality of depressions 24 (Fig. 1 B) or a single lane 26 (Fig. 1 C) is defined in a surface of the single-layer substrate 20. When the multi-layer substrate 22 is used, the plurality of depressions 24 (Fig. 1 B) or the single lane 26 (Fig. 1 C) is defined in a surface of the material 30. Regardless of the substrate 20 or 22 that is used, in the patterned structure 14, interstitial regions 28 surround each depression 24, and a perimeter region 16 surrounds each flow channel 12. Also regardless of the substrate 20 or 22 that is used, in the non-patterned structure 18, the perimeter region 16 surrounds each lane 26 and each flow channel 12. The surface of the single-layer substrate 20 or the material 30 defines the interstitial regions 28 and / or the perimeter region 16. When the flow cell 10 includes multiple flow channels 12, the perimeter region 16 may be defined as the perimeter around each individual channel 12 and the perimeter of the substrate 20 or 22 that surrounds all of the channels 12. In some examples, the perimeter region 16 also functions as the bonding region, providing an area where the lid or second patterned or non-patterned substrate can be bonded to the single-layer substrate 20 or the material 30 of the multi-layer substrate 22.
[0067] In an example, the substrate 20 or 22 may be round and have a diameter ranging from about 2 mm to about 300 mm, or may be a rectangular, having its largest dimension up to about 10 feet (~ 3 meters). In an example, the substrate 20 or 22 may be formed from a wafer having a diameter ranging from about 200 mm to about 300 mm. Wafers may subsequently be diced to form the individual substrate 20 or 22. In another example, the substrate 20 or 22 is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to beunderstood that a substrate 20 or 22 with any suitable dimensions may be used. For another example, a rectangular panel may be used, which has a greater surface area than a 300 mm round wafer. These panels may subsequently be diced to form individual substrates 20 or 22.
[0068] Some examples of the flow cell 10 also include the flow channel 12 (shown in Fig. 1A). The flow channel 12 may be an enclosed channel that is defined between the patterned structure 14 or the non-patterned structure 18 and a lid. In an alternate example, the flow channel 12 may be defined between two patterned structures 14 or two non-patterned structures 18 that are bonded together. In enclosed versions of the flow cell 10, a separate material (not shown) may attach the perimeter region 16 of the respective structure 14 or 18 to the lid or to another structure 14 or 18 so that the separate material defines at least a portion of the walls of the flow channel 12.
[0069] When the patterned structure 14 or non-patterned structure 18 is open to the surrounding environment, the flow channel 12 may be defined by a lane in which the depressions 24 are formed, or by the lane 26.
[0070] The flow cell 10 shown in Fig. 1A includes eight flow channels 12. It is to be understood, however, that any example of the flow cell 10 may include any number of flow channels 12 (e.g., one channel, four channels, etc.). With multiple channels 12, it is to be understood that each flow channel 12 may be isolated from each other flow channel 12 so that fluid introduced into any particular flow channel 12 does not flow into any adjacent flow channel 12. Separation may be obtained through the separate material, which can be applied at the perimeter of each flow channel 12 and at the perimeter of the entire flow cell 10.
[0071] The length and width of the flow channel 12 may be smaller, respectively, than the length and width of the patterned or non-patterned structure 14, 18 so that a portion of the structure surface surrounds the flow channel 12 and is available for attachment to another patterned structure or to the lid, or is available to define the perimeter of the open flow channel 12. In some instances, the width of each flow channel 12 can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some instances, the length of each flow channel 12 can be at least about 10 mm, at least about 25 mm, at leastabout 50 mm, at least about 100 mm, or more. The width and / or length of each flow channel 12 can be greater than, less than or between the values specified above. In another example, the flow channel 12 is square (e.g., 10 mm x 10 mm).
[0072] The depth / height of each flow channel 12 can be as small as a few monolayers thick, for example, when microcontact, aerosol, or inkjet printing is used to deposit the separate material that partially defines the flow channel walls. In other examples, the depth / height of each flow channel 12 can be about 1 pm, about 10 pm, about 50 pm, about 100 pm, or more. In an example, the depth / height may range from about 10 pm to about 100 pm. In another example, the depth / height is about 5 pm or less. It is to be understood that the depth / height of each flow channel 12 can also be greater than, less than or between the values specified above. The depth / height of the flow channel 12 in the patterned structure 14 may also vary along the length and width of the flow cell 10, e.g., because of the depressions 24.
[0073] Referring specifically to Fig. 1 B, the patterned structure 14 includes the depressions 24, which are defined in the single-layer substrate 20 or in the patterned material 32 of the multi-layer substrate 22, and that are separated by the interstitial regions 28. Many different layouts of the depressions 24 may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 24 are disposed in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of the depressions 24 and the interstitial regions 28.
[0074] The layout or pattern may be characterized with respect to the density (number) of the depressions 24 in a defined area. For example, the depressions 24 may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 50 million per mm2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the rangesabove, or that other densities (outside of the given ranges) may be used. As examples, a high-density array may be characterized as having depressions 24 separated by less than about 100 nm, a medium-density array may be characterized as having the depressions 24 separated by about 400 nm to about 1 pm, and a low-density array may be characterized as having the depressions 24 separated by greater than about 1 pm.
[0075] The layout or pattern of the depressions 24 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 24 to the center of an adjacent depression 24 (center-to-center spacing) or from the right edge of one depression 24 to the left edge of an adjacent depression 24 (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.1 pm, about 0.5 pm, about 1 pm, about 5 pm, about 10 pm, about 100 pm, or more or less. The average pitch for a particular pattern can be between one of the lower values and one of the upper values selected from the ranges above. In an example, the depressions 24 have a pitch (center-to-center spacing) of about 1.5 pm. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.
[0076] The size of each depression 24 may be characterized by its volume, opening area, depth, and / or diameter or length and width. For example, the volume can range from about 1×10-3µm3to about 100 pm3, e.g., about 1×10-2µm3, about 0.1 pm3, about 1 pm3, about 10 pm3, or more, or less. For another example, the opening area can range from about 1×10-3µm2to about 100 pm2, e.g., about 1×10-2µm2, about 0.1 pm2, about 1 pm2, at least about 10 pm2, or more, or less. For still another example, the depth can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less. It is to be understood that the depth is sufficient to house at least the polymeric hydrogel 34. Thus, as shown in Fig. 1 B, the polymeric hydrogel 34 covers the entire bottom surface of each depression 24, and has a thickness that is equal to or less than the depth of such depression 24. For yet another example, the diameter or each of the length and width can range from about0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less.
[0077] Each example of the flow cell 10 also includes the polymeric hydrogel 34, which has surface azide groups. As shown in Fig. 1B, the polymeric hydrogel 34 is positioned within each of the depressions 24 in the patterned structure 14.
[0078] In an example, the polymeric hydrogel 34 is an acrylamide copolymer having structure (I):wherein:RAis an azide;RBis H or an optionally substituted alkyl;Rc, RD, and REare each independently selected from the group consisting of H and an optionally substituted alkyl;each of the -(CH2)P- can be optionally substituted;p is an integer in the range of 1 to 50;n is an integer in the range of 1 to 50,000; andm is an integer in the range of 1 to 100,000.
[0079] One of ordinary skill in the art will recognize that the arrangement of the recurring “n” and “m” features in structure (I) are representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination thereof).
[0080] In other examples, the polymeric hydrogel 34 may be a variation of structure (I). In one example, the acrylamide unit may be replaced with A / , A / -dimethylacrylamide). In this example, the acrylamide unit in structure (I) may be replacedwith, where RD, RE, and RFare each H or a C1-C6 alkyl, and RGand RHare each a C1-C6 alkyl (instead of H as is the case with the acrylamide). In this example, q may be an integer in the range of 1 to 100,000. In another example, the N, N-dimethylacrylamide may be used in addition to theacrylamide unit. In this example, structure (I) may include in addition to the recurring “n” and “m” features, where RD, RE, and RFare each H or a C1-C6 alkyl, and RGand RHare each a C1-C6 alkyl. In this example, q may be an integer in the range of 1 to 100,000.
[0081] As another example of the polymeric hydrogel(s) 34, the recurring “n” feature in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):wherein R1is H or a C1-C6 alkyl; R2 is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.
[0082] As still another example, the polymeric hydrogel 34 may include a recurring unit of each of structure (III) and (IV):wherein each of R1a, R2a, R1band R2bis independently selected from hydrogen, an optionally substituted alkyl or optionally substituted phenyl; each of R3aand R3bis independently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl, or an optionally substituted C7-C14 aralkyl; and each of L1and L2is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.
[0083] The molecular weight of structure (I) or the other forms of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa. In a specific example, the molecular weight of the acrylamide copolymer is about 312 kDa.
[0084] In some examples, structure (I) and other forms of the acrylamide copolymer are linear polymers. In some other examples, structure (I) and other forms of the acrylamide copolymer are lightly cross-linked polymers.
[0085] It is to be understood that another polymeric hydrogel 34 may be used, provided that the hydrogel includes the surface azide groups. Some additional examples of suitable materials for the polymeric hydrogel 34 include azido silane or an azidolyzed version of silane free acrylamide (SFA) or other acrylamide derivatives.
[0086] Referring specifically to Fig. 1 C, the non-patterned structure 18 may include the lane 26 defined in the substrate 20 or the material 30. The lane 26 defines theflow channel 12, and thus any of the length and width dimensions set forth herein for the flow channel 12 are suitable for the lane 26.
[0087] In this example architecture, the polymeric hydrogel 34 (having surface azide groups) is positioned within the lane 26. As such, the depth of lane 26 is large enough to house at least the polymeric hydrogel 34. As shown in Fig. 1 C, the polymeric hydrogel 34 covers the entire bottom surface of the lane 26, and has a thickness that is equal to or less than the depth of the lane 26. In an example, the lane depth may be at least about 0.1 pm, at least about 0.5 pm, at least about 1 pm, at least about 10 pm, at least about 100 pm, or more, and the polymeric hydrogel thickness may be equal to or less than the lane depth. Alternatively or additionally, the lane depth can be at most about 1×103μm, at most about 100 pm, at most about 10 pm, or less, and the polymeric hydrogel thickness may be equal to or less than the lane depth. In some examples, the lane depth is about 0.4 pm. The depth of the lane 26 can be greater than, less than or between the values specified above.
[0088] Referring specifically to Fig. 1 D, the non-patterned structure 18’ includes the substrate 20 or 22 without any recessed feature defined therein. In these examples, the substrate 20 or 22 has a flat surface and the polymeric hydrogel 34 is positioned over the flat surface (see Fig. 4A through Fig. 4F). This example architecture may not include a defined channel 12 for fluid flow, but rather may have fluid deposited thereon or directed thereover as is desired in a given application.
[0089] The flow cell 10 included in the kit may include the architecture as it shown in Fig. 1 B or Fig. 1 C or Fig. 1 D. As such, in this kit, the flow cell 10 is devoid of any of the primers described herein. In addition to the fluids mentioned herein, this kit further includes a fourth fluid including a fourth liquid carrier and alkyne terminated first and second primers 36, 38 (as shown in Fig. 4B). The fourth fluid is further described below.
[0090] In other examples, the flow cell 10 included in the kit further includes an amplification primer set attached to the polymeric hydrogel 34. The amplification primer set include the alkyne terminated first and second primers 36, 38, whose amplification domain sequences are used together in sequential paired end sequencing. As examples, the amplification domain sequences of the primers 36, 38set may include P5, P7, and / or Gz sequences, P15 and P7 sequences, or any combination of the PA sequence, the PB sequence, the PC sequence, and the PD sequence set forth herein. As examples, the amplification domain sequences of the primers 36, 38 may include any combination of one PA sequence and one PB, PC, or PD sequence, or any combination of one PB sequence and one PC or PD sequence, or any combination of one PC sequence and one PD sequence.
[0091] Specific examples of suitable amplification domain sequences for the primers 36, 38 include P5 and P7 sequences used on the surface of commercial flow cells sold by Illumina Inc.
[0092] The P5 sequence (shown as a cleavable sequence due to the cleavable nucleobase uracil, inosine, or alkene-thymidine) is:P5#1: 5’ — ► 3’AATGATACGGCGACCACCGAGAUCTACAC (SEQ. ID. NO. 1); orP5 #2: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 2)where “n” is inosine in the sequence; orP5 #3: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 3)where “n” is alkene-thymidine (i.e., alkene-dT) in the sequence.The P7 sequence 36, 38 (also shown as cleavable sequences) may be any of the following:P7 #1: 5’ — > 3’CAAGCAGAAGACGGCATACGAnAT (SEQ. ID. NO. 4); orP7 #2: 5’ 3’CAAGCAGAAGACGGCATACnAGAT (SEQ. ID. NO. 5); orP7 #3: 5’ 3’CAAGCAGAAGACGGCATACnAnAT (SEQ. ID. NO. 6),where each instance of “n” is 8-oxoguanine.The Gz sequence is:Gz: 5’ 3’ ACAT / ideoxyU / / ideoxyU / / ideoxyU / CAATCTCAACACTCTCTACTCTATCATAGCAA (SEQ. ID. NO. 7)where ideoxyll is deoxyuridine.The P15 sequence (shown as a cleavable sequence) is:P15: 5’ - 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 8)where “n” is allyl-T (a thymine nucleotide analog having an allyl functionality).The other sequences (PA-PD, shown as non-cleavable sequence) mentioned above include:PA 5’ 3’GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ. ID. NO. 9)PB 5’ 3’CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ. ID. NO. 10)PC 5’ 3’ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ. ID. NO. 11)PD 5’ 3’GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO. 12)While not shown in the example sequences for PA-PD, it is to be understood that any of these primers may include a cleavage site, such as uracil, 8-oxoguanine, allyl-T, etc. at any point in the strand. The cleavages sites of the primers 36, 38 may be orthogonal so that one cleavage site is not susceptible to the agent or technique used to cleave other cleavage site, and vice versa.
[0093] The 5’ end of each amplification domain sequence, and thus the 5’ end of each primer 36, 38, includes an alkyne functional group. The alkyne functional group may be a terminal alkyne, such as hexynyl. Alternatively, the alkyne functional group may be an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN) or dibenzocyclooctyne (DBCO)). In either instance, the alkyne reacts with a respective surface azide group of the polymeric hydrogel 34.
[0094] In some examples, the 3’ end of one of the primers (e.g., primer 38) includes a sequencing primer complement sequence attached to the amplification domain sequence. In these examples, the sequencing primer complement sequence is complementary to the sequence primer sequence 50 of the barcoded primer 44B (see Fig. 3B). In this example, the barcoded primer 44B does not include the amplification domain sequence 46A, and thus the amplification domain sequence of the surface bound primer, e.g., 38, is not used for seeding. Rather, the sequencing primer complement sequence of the surface bound primer, e.g., 38, can be used with the barcoded primer 44B to seed the barcoded primer 44B to the flow cell surface.
[0095] Fluids
[0096] As mentioned, the flow cell 10 may be included in the kit with three or four different fluids. When the flow cell 10 in the kit includes the alkyne terminated first and second primers 36, 38 grafted to the polymeric hydrogel 34, the kit does not includethe fourth fluid. Alternatively, when the flow cell 10 in the kit does not include the alkyne terminated first and second primers 36, 38, the kit further includes the fourth fluid.
[0097] The first fluid in the kit includes a first liquid carrier and a linking molecule 40 (see Fig. 2) including first and second alkynes Ai, A2 at opposed ends, the first alkyne A1 having reactivity orthogonal to the second alkyne A2.
[0098] The first liquid carrier may be an aqueous or non-aqueous solvent, or mixtures thereof, in which the linking molecule 40 is soluble. In one example, the first liquid carrier is water. A neutral buffer and / or salt may be added to the first liquid carrier for reaction between the first alkyne A1 and the surface azide groups. Example of neutral buffers include Tris(hydroxymethyl) aminomethane (Tris or TRIS) buffers, such as Tris-HCI or Tris-EDTA, or a carbonate buffer (e.g., 0.25 M to 1 M). Sodium sulfate (e.g., 1 M to 2 M) is a suitable salt that may be used. In another example, the first liquid carrier is a 1:1 mixture (per volume) of water and dimethyl sulfoxide (DMSO).
[0099] The linking molecule 40 includes orthogonally reactive alkynes A1 and A2 at opposed ends of a linker 42. The first alkyne A1 is capable of the strain-promoted azide alkyne cycloaddition (SPAAC), which is a metal free reaction. The first alkyne A1 reacts with at least some of the available surface azide groups to attach the linking molecule 40 to the polymeric hydrogel 34 in the depressions 24 or in the lane 26 or across the non-patterned structure 18’. The second alkyne A2 is inert in the conditions used for SPAAC. The linker 42 is any molecule that is inert during both click reactions, and that also does not participate in clustering, decoding, RNA capture, or any of the other reactions taking place within the flow cell 10.
[0100] In an example, the linking molecule 40 includes the linker 42 positioned between the first and second alkynes A1, A2; the linker 42 is selected from the group consisting of polyethylene oxide), polyvinyl alcohol, poly(acrylic acid), and polyvinylpyrrolidone; the first alkyne A1 is selected from the group consisting of cyclooctyne, a monofluorinated cyclooctyne, difluorocyclooctyne, bicyclononyne, 6,7-dimethoxyazacyclooct-4-yne (), benzocyclooctyne, dibenzocyclooctyne, dibenzocyclooctynol, dibenzoazacyclooctyne,biarylazacyclooctynone, and 3,3,6,6-tetramethylthiacycloheptyne (and the second alkyne A2 is a terminal alkyne. One specific example of the linking molecule is structure (V):where the linker 42 is poly(ethylene oxide), the first alkyne Ai is bicyclononyne, and the second alkyne A2 is a terminal alkyne. This example may be synthesized using bicyclononyne, amine-PEG4-0H, and propargyl alcohol.
[0101] It is to be understood that derivatives of some examples of the first alkyne A1 may also be used. Examples of suitable derivatives include:a. a cyclooctyne derivative of structure (VI):wherein R is selected from the group consisting of a C1-C3 alkyl, a hydroxyethyl group, a tert-butyl group, a cyclichydrophobic group, a polar or charged group, or an aromatic or electron-donating group;b. a monofluorinated cyclooctyne derivative of structure (VII):wherein R is selected from the group consisting of a C1-C3 alkyl, a hydroxyethyl group, a tert-butyl group, a cyclic hydrophobic group, a polar or charged group, or an aromatic or electron-donating group;c. a difluorocyclooctyne derivative of structure (VIII):wherein R is selected from the group consisting of a C1-C3 alkyl, a hydroxyethyl group, a tert-butyl group, a cyclic hydrophobic group, a polar or charged group, or an aromatic or electron-donating group;d. a benzocyclooctyne derivative of structure (IX):wherein R is selected from the group consisting of a C1-C3 alkyl, a hydroxyethyl group, a tert-butyl group, a cyclic hydrophobic group, a polar or charged group, or an aromatic or electron-donating group (e.g., carboxymethylmonobenzocyclooctyne when R - a methyl group);e. a dibenzocyclooctyne derivative of structure (X):wherein R is selected from the group consisting of a C1-C3 alkyl, a hydroxyethyl group, a tert-butyl group, a cyclic hydrophobic group, a polar or charged group, or an aromatic or electron-donating group;f. a dibenzoazacyclooctyne derivative of structure (XI):wherein R is selected from the group consisting of a C1-C3 alkyl, a hydroxyethyl group, a tert-butyl group, a cyclic hydrophobic group, a polar or charged group, or an aromatic or electron-donating group;g. a biarylazacyclooctynone of structure (XII):wherein R is selected from the group consisting of a C1-C3 alkyl, a hydroxyethyl group, a tert-butyl group, a cyclic hydrophobic group, a polar or charged group, or an aromatic or electron-donating group;h. a bicyclononyne derivative of structure (XIII):
[0102] wherein R is selected from the group consisting of a C1-C3 alkyl, a hydroxyethyl group, a tert-butyl group, a cyclic hydrophobic group, a polar or charged group, or an aromatic or electron-donating group. The C1-C3 alkyl may be a methyl group (-CH3), an ethyl group (-CH2CH3), or any propyl group (e.g., propyl (-CH2CH2CH3), isopropyl (-CH(CH3)2). Examples of the cyclic hydrophobic group include a benzyl (e.g., -CH2C6H5) or a cyclohexyl group (e.g., -C6H11). Examples of the polar or charged group include carboxyl groups (e.g., -CH2COOH), amino groups (e.g., -CH2NH2 or -NHCH3), or polyethylene glycol (e.g., -CH2(CH2O)nCH3). Examples of the aromatic or electron-donating group include a phenyl (e.g., -CeHs), p-Methoxyphenyl (-C6H4OCH3), or naphthyl (-C10H7). The linking molecule 40 may be present in the first fluid at a concentration ranging from about 1 pm to about 1 mM.
[0103] The second fluid in the kit includes a second liquid carrier and a plurality of barcoded primers 44A (see Fig. 3A) or44B (see Fig. 3B). The barcoded primers 44A, 44B may collectively be referred to using reference numeral “44.”
[0104] The second liquid carrier may be water. A buffer may be added to the second liquid carrier for aiding in the hybridization of the barcoded primers 44 to the complementary primers 38. An example of a suitable buffer is saline-sodium citrate (SSC).
[0105] An example of the barcoded primer 44A is schematically illustrated in Fig.3A. Each of the plurality of barcoded primers 44A includes, in order, from the 5’ end to the 3’ end: an amplification domain sequence 46A, a sequencing primer sequence 50, an index sequence 48, and a decode / bridge sequence 58. As will be described in reference to Fig. 4A through Fig. 4F, upon introduction into the flow cell 10, the barcoded primers 44A hybridize to one of the primers 38 or 36 via the amplification domain sequence 46A. As such, in this example, the amplification domain sequence46A is a complement of the amplification domain sequence of the primer 38 or 36 to which the barcoded primer 44A is to hybridize. In the example of Fig. 4A through Fig.4F, the amplification domain sequence 46A is a complement of the amplification domain sequence of the primer 38. The sequencing primer sequence 50 may bind a sequencing primer that primes synthesis of a new strand used for reading the cDNA fragments that are generated and amplified during the method. The index sequence 48 is any sequence that provides a unique barcode to the barcoded primers 44A and the cDNA ultimately attached thereto. The decode / bridge (D / B) sequence 58 can serve as a decoding primer that primes synthesis of a new strand along the index sequence 48 after the barcoded primers 44A are amplified. The decode / bridge sequence 58 is also used to generate a sequence (e.g., D / B complement sequence 58’ in Fig. 4C) that can hybridize to an adapter 57 that is added to the cDNA strand 59 generated during the method (see Fig. 4E).
[0106] Another example of the barcoded primer 44B is schematically illustrated in Fig. 3B. Each of the plurality of barcoded primers 44B includes, in order, from the 5’ end to the 3’ end: the sequencing primer sequence 50, the index sequence 48, and the decode / bridge sequence 58. As mentioned herein, this barcoded primer 44B can be used with the primer set that includes the sequencing primer complement sequence at the 3’ end of one of the primers 38 or 36. Upon introduction into the flow cell 10, the barcoded primers 44B hybridize, via their sequencing primer sequences 50, to the primers 38 or 36 that include the sequencing primer complement sequence. Thus, in this example, the sequencing primer sequence 50 is used for seeding the barcoded primers 44B. It is to be understood that the remainder of the method involving the barcoded primers 44B shown and described in reference to Fig. 4A through Fig. 4F may be performed as described herein.
[0107] The barcoded primers 44A or 44B may be present in the second fluid at a concentration ranging from about 10 nM to about 100 pM.
[0108] The barcoded primers 44A, 44B shown in Fig. 3A and Fig. 3B may be used for non-bridging amplification. Alternatively, either of the barcoded primers 44A, 44B may include additional sequences 45 (shown in Fig. 3C) at the 3’ end, for example, when they are to be used for bridge amplification. The additional sequences 45include, from the 5’ to the 3’ end, a restriction endonuclease site 47, an optional anchor sequencing (not depicted), and a second amplification domain 46B, which has the same sequence as one of surface bound primers 36. The restriction endonuclease site 47 is capable of hybridizing to a restriction enzyme that will cut the additional sequences 45 from the remainder of the barcoded primer 44A, 44B after the decoding process is performed and before a sample containing RNA is introduced. When the additional sequences 45 are included, the complement strand 44’ (i.e., barcoded primer complement 44’) that is generated during the method (see Fig. 4C) includes a second amplification domain complement (not shown) that is capable of hybridizing to the amplification domain sequence of the surface bound primer 36, and thus is used to initiate bridge amplification.
[0109] The third fluid in the kit includes a third liquid carrier and a plurality of azide terminated capture primers 52.
[0110] The third liquid carrier of the third primer fluid may be water. A buffer and / or salt may be added to the third liquid carrier for grafting azide terminated capture primers 52 to the second alkyne A2 of the linking molecule 40. An alkaline buffer may be added to the third primer fluid for the copper-assisted grafting that will take place between the azide of the azide terminated capture primers 52 and the second alkyne A2 of the linking molecule 40. The third liquid carrier may also include a copper catalyst. Examples of suitable alkaline buffers include Tris(hydroxymethyl) aminomethane (CHES), 3-(Cyclohexylamino)-1-propanesulphonic acid (CAPS), and alkaline buffer solution (from Sigma-Aldrich). Other buffers that may be used include carbonate or (2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid) (HEPES) buffer. One example of a suitable copper catalyst is copper sulfate with sodium ascorbate and PMDTA (N, N, N’, N”, N”-pentamethyldiethylenetriamine).
[0111] An example of the azide terminated capture primer 52 is schematically illustrated in Fig. 3D. Each of the plurality of azide terminated capture primers 52 includes, in order, from the 5’ end to the 3’ end: a terminal azide (shown as N3), an amplification domain sequence 46B, and a polyT sequence 54. Because the azide terminated capture primer 52 is grafted through its terminal azide and not through hybridization of the amplification domain sequence 46B, and because the amplificationdomain sequence 46B is used to generate adapters for the amplified cDNA fragments, the (second) amplification domain sequence 46B has a different sequence than the (first) amplification domain sequence 46A, but has the same amplification domain sequence as one of the primers 36, 38. In the example of Fig. 4A through Fig. 4F, the amplification domain sequence 46B is the same amplification domain sequence of the primer 36. The polyT sequence 54 is used to capture polyA tailed RNA strands 56 (see Fig. 4E). The polyT sequence 54 may be composed of 20 to 30 deoxythymidine residues, or may include from 8 to 80 nucleotides, where at least 8 at the 3’ end are deoxythymidine residues.
[0112] The azide terminated capture primers 52 may be present in the third fluid at a concentration ranging from about 1 pM to about 100 pM.
[0113] As mentioned in reference to the flow cell 10, some examples of the kit include the fourth fluid. The fourth fluid is included when the flow cell 10 does not include the alkyne terminated first and second primers 36, 38. The fourth fluid includes a fourth liquid carrier and the alkyne terminated first and second primers 36, 38 described herein. When the barcoded primer 44B is to be used, one of the primers 36, 38 includes the sequencing primer complement sequence at its 3’ end.
[0114] The fourth liquid carrier may be any of the examples set forth herein for the first fluid or the third fluid, depending upon the type of alkyne at the 5’ terminal end of the primers 36, 38 and the type of click reaction that is to be performed.
[0115] Methods
[0116] An example of a method that utilizes an example of the kit disclosed herein is shown in Fig. 4A through Fig. 4F. The method includes initiating a strain-promoted azide alkyne cycloaddition reaction between an available azide group (shown as N3 in Fig. 4A) of a polymeric hydrogel 34 positioned in a lane 26 or each of a plurality of depressions 24 of a flow cell 10 and a first alkyne A1 at a first end of a linking molecule 40, the linking molecule 40 including a second alkyne A2 at a second end that is opposed to the first end and that has reactivity orthogonal to the first alkyne A1 (Fig. 4C); initiating amplification of a barcoded primer 44A or 44B using at least one primer 38 of an amplification primer set (primers 36, 38) attached to the polymeric hydrogel34 (Fig. 4C); and initiating a copper-catalyzed azide alkyne cycloaddition reaction between the second alkyne A2 and an azide terminated capture primer 52 (Fig. 4D). The method may alternatively be performed using the flow cell 10 that includes the non-patterned structure 18’.
[0117] The flow cell 10 shown in Fig. 4A through Fig. 4F is an example that includes a flat surface that is open to the external environment (i.e., the non-patterned structure 18’). It is to be understood, however, that the flow cell 10 used in the method may include an array of depressions 24 within a single flow channel 12 and one or more of these flow channels 12, or may include the single lane 26 in the flow channel 12 and one or more of these flow channels 12.
[0118] To form the flow cell 10 with depressions 24 or the lane 26, the depressions 24 or lane 26 are defined in the substrate 20 or the material 30 of the substrate 22. The depressions 24 or lane 26 may be formed using any suitable patterning technique, such as nanoimprint lithography, photolithography, etching, etc. The patterning technique that is used will depend, in part, upon the material used for the substrate 20 or the material 30 of the substrate 22. In a specific example, the substrate 20 or the material 30 includes a resin material, and the method involves imprinting the resin with a working stamp (including a negative replica of the depressions 24 or the lane 26) while the resin is soft. The resin may be cured and / or dried, e.g., via exposure to actinic radiation, heat, or other suitable conditions while the working stamp is in place or after the working stamp has been removed. Removal of the working stamp forms the desired recessed feature(s).
[0119] Prior to the introduction of the polymeric hydrogel 34, the substrate 20 or material 30 may be activated via silanization and / or plasma ashing.
[0120] Silanization involves the application of a silane or silane derivative over the surface of the substrate 20 or the material 30. Silanization may be performed by exposing the material 20 or layer 30 to the silane / silane derivative in a solvent. Some example silane derivatives include a cycloalkene unsaturated moiety, such as norbornene, a norbornene derivative (e.g., a (hetero)norbornene including an oxygen or nitrogen in place of one of the carbon atoms), transcyclooctene, transcyclooctene derivatives, transcyclopentene, transcycloheptene, trans-cyclononene,bicyclo[3.3.1]non-1-ene, bicyclo[4.3.1]dec-1 (9)-ene, bicyclo [4.2.1]non-1(8)-ene, and bicyclo[4.2.1]non-1-ene. Any of these cycloalkenes can be substituted, for example, with an R group, such as hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicyclyl, aralkyl, or (heteroalicyclyl)alkyl. An example of the norbornene derivative includes [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane. Other example silane derivatives include a cycloalkyne unsaturated moiety, such as cyclooctyne, a cyclooctyne derivative, or bicyclononynes (e.g., bicyclo[6.1,0]non-4-yne or derivatives thereof, bicyclo[6.1,0]non-2-yne, or bicyclo[6.1,0]non-3-yne). These cycloalkynes can be substituted with any of the R groups described herein. The method used to apply the silane or silane derivative may vary depending upon the silane or silane derivative that is being used. Examples of suitable silanization methods include vapor deposition (e.g., a YES method), spin coating, or other deposition methods.
[0121] Plasma ashing involves the generation of -OH groups at a surface via exposure of the surface to oxygen plasma.
[0122] Following activation of the substrate 20 or material 30, the polymeric hydrogel 34 is introduced to the depressions 24 or the lane 26. In some instances, the polymeric hydrogel 34 is incorporated into a mixture, which is applied to the substrate 20 or material 30, and is subsequently dried or cured to form the polymeric hydrogel 34. The polymeric hydrogel mixture may include any of the hydrogel materials disclosed herein in a suitable solvent, such as water or ethanol and water.
[0123] The polymeric hydrogel mixture may be blanketly deposited over the substrate 20 or material 30 using any suitable deposition technique that deposits the mixture both in the depressions 24 and on the interstitial regions 28 and perimeter regions 16 or in the lane 26 and on the perimeter regions 16 (e.g., spin coating, dip coating, etc.). The mixture is dried or cured to form the polymeric hydrogel 34, and then removed from the interstitial regions 28 and / or perimeter regions 16. Removal may be performed via a polishing process that removes the polymeric hydrogel 34 from the interstitial regions 28 and / or perimeter regions 16 and leaves the polymeric hydrogel 34 in the depressions 24 or lane 26. Alternatively, the polymeric hydrogel mixture may be selectively applied (e.g., via inkjet printing, microcontact printing, etc.)directly into the depressions 24 or lane 26 so that subsequent removal is not performed.
[0124] When the architecture shown in Fig. 4A is used, the polymeric hydrogel 34 is deposited and cured over the (activated) substrate 20 or 22 as described. As the surface is flat, no additional polishing is used to remove the polymeric hydrogel from undesired areas.
[0125] The alkyne terminated first and second primers 36, 38 may be pre-grafted to some of the surface azide groups of the polymeric hydrogel 34. In these instances, the primers 36, 38 are mixed with the polymeric hydrogel mixture and the mixture is brought to a suitable grafting temperature (e.g., from about 55°C to about 65°C) for a time ranging from about 20 minutes to about 60 minutes. In these instances, the flow cell 10 at the outset of the method would be similar to that shown in Fig. 4B.
[0126] Alternatively, at the outset of the method, the alkyne terminated first and second primers 36, 38 (i.e., the amplification primer set) may be grafted to the polymeric hydrogel 34 already present over the substrate 20 or material 30, or in the depressions 24 or lane 26. In this example, the fourth fluid described herein is introduced into the flow cell 10 and is allowed to incubate. Primer grafting may be performed at a temperature ranging from about 55°C to about 65°C for a time ranging from about 20 minutes to about 60 minutes. In one example, grafting is performed at 60°C for about 30 minutes or 60 minutes. It is to be understood that a lower temperature and a longer time or a higher temperature and a shorter time may also be used. During grafting, the alkyne at the 5’ ends of the primers 36, 38 respectively attaches to the azide surface groups of the polymeric hydrogel 34 and has no affinity for the interstitial regions 28 and / or perimeter regions 16. In this particular example of the method, the grafting of the amplification primer set (primers 36, 38) to the polymeric hydrogel 34 occurs prior to initiating the strain-promoted azide alkyne cycloaddition reaction.
[0127] It is to be understood that primer 36, 38 grafting is controlled so that some of the surface azide groups remain free / available for attachment of the linking molecule 40. In some examples, less than 5% of the surface azide groups are used to graft the primers 36, 38. In one example, from about 1 % to about 4% of the surface azidegroups are grafted to primers 36, 38, and thus, from about 96% to about 99% of the surface azide groups are available for subsequent reaction with the linking molecule 40.
[0128] Once the flow cell 10 includes the primers 36, 38, the method continues with the strain-promoted azide alkyne cycloaddition reaction between an available surface azide group and the first alkyne A1 of the linking molecule 40. Initiating the strain-promoted azide alkyne cycloaddition reaction involves introducing the linking molecule 40 (via introduction of the first fluid) to the flow cell 10 and increasing a temperature of the flow cell 10 to about 60°C. The reaction may be allowed to occur for any time ranging from about 3 minutes to about 3 hours. In one example, the reaction takes place for about 2 hours. The second alkyne A2 of the linking molecule 40 is non-reactive in the SPAAC conditions, and thus the first alkyne A1 attaches to the surface azide group, and following the reaction, the second alkyne A2 is available for a subsequent orthogonal click reaction.
[0129] Following the SPAAC reaction, a wash cycle may be performed to remove any unattached linking molecules 40 and the remainder of the first fluid.
[0130] The second fluid is then introduced into the flow cell 10. As mentioned, the second fluid includes the barcoded primers 44A or 44B. In the example shown in Fig.4A, the amplification domain sequence 46A of the barcoded primers 44A or 44B is capable of hybridizing to one of the primers, e.g., 38. The hybridized barcoded primer 44A is shown in Fig. 4B. Alternatively, the barcoded primers 44B are used. In these alternate examples, the sequencing primer sequence 50 is capable of hybridizing to the complementary sequence that is located at the 3’ end of the surface bound primer, e.g., 38.
[0131] An extension reaction is then initiated to form a complement strand 44’ of the barcoded primer 44A or 44B that is directly attached to the surface-bound primer 38. To initiate the extension reaction, an extension amplification mix is introduced into the flow cell 10. An example of the extension mix includes nucleotides, a polymerase, and accessory proteins. The extension amplification mix may also include a buffer agent (e.g., Tris), enzymes, stabilizers, a metal co-factor (e.g., Mg2+), a surfactant(e.g., TWEEN polysorbates), and / or a co-solvent (e.g., glycerol, dimethylformamide, etc.).
[0132] For the extension reaction, the temperature of the flow cell 10 may range from about 25°C to about 75°C when the extension mix is introduced. In one example, the temperature of the flow cell 10 is about 38°C during the extension reaction.
[0133] The extension reaction involves the addition of nucleotides in a template dependent fashion from the 3’ ends of the primer 38 using the barcoded primer 44A or 44B as the template strand. The resulting nascent strand is the barcoded primer complement strand 44’. This complement strand 44’ is used for non-bridging amplification. When the additional sequences 45 are included at the 3’ end of either of the barcoded primers 44A, 44B, the resulting complement strand 44’ will include complements of the additional sequences 45, which can be used for bridging amplification.
[0134] The complement strand 44’ includes a D / B complement sequence 58’ that is complementary to the decode / bridge sequence 58. This provides a binding site for a primer (not shown) that can be used for non-bridging amplification (referred to herein as a “NBA primer”). In this example, the NBA primer is introduced into the flow cell 10 and hybridized to the binding site, and extension of the complement strand 44’ is performed. This extension mix includes a recombinase. A complex between primers and the recombinase interrogates double stranded DNA seeking a homologous sequence and promotes strand invasion and extension by the surface primer 38 at the cognate site, thereby resulting in clustering (amplification) of the complement strands 44’. In this example, the double stranded DNA includes the hybridized surface bound primers 38 and sequences 46A or 50. The homologous sequence is the sequence of the surface bound primer 38. Fig. 4C depicts the amplified complement strands 44’.
[0135] In another example method, the complement strand 44’ includes, at the 3’ end, a sequence complementary to the additional sequences 45. In this example, isothermal bridge amplification may be used to amplify the complement strand 44’. With this technique, the strand 44’ loops over and the complement of the amplification domain sequence 46B hybridizes to an adjacent, complementary oligonucleotide (e.g., surface primer 36), and a polymerase copies the copied templates to form doublestranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary oligonucleotides and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create dense clonal clusters. Each cluster of double stranded bridges is denatured. Reverse strands can be removed via the cleavage site present in the primer 36.
[0136] Prior to initiating the copper-catalyzed azide alkyne cycloaddition and after the barcoded primer 44A, 44B is amplified to form the cluster of complement strands 44’, the method further comprises initiating sequencing by synthesis of at least a portion of the complement strands 44’, thereby decoding the index sequence 48 of the barcoded primer 44A, 44B. The sequencing by synthesis reaction may be performed in the same manner as the extension reaction without the recombinase. Decoding is illustrated in Fig. 4D, where a decoding primer 51 is hybridized to the D / B complement sequence 58’, and extension of the complement strand 44’ is initiated. When the restriction endonuclease site 47 (described below) is included, the decoding primer 51 may hybridize to the restriction endonuclease site 47 and a portion of the D / B complement sequence 58’. The nascent strands that are generated during the decoding process are dehybridized from the complement strands 44’ and removed from the flow cell 10. As mentioned, decoding reads a complement of the index sequence 48 and thus reveals the index sequence 48, and thus enables a cDNA strand ultimately attached thereto to be identified.
[0137] After the index sequence 48 is revealed and when the barcoded primer 44A, 44B includes the additional sequences 45, the method also includes removing the additional sequence complements from the barcoded primer complement strands 44’. This may be accomplished by introducing a restriction enzyme to which the restriction endonuclease site 47 is sensitive. As examples, the restriction enzyme is selected from the group consisting of a 4 base cutter restriction endonuclease, a 5 base cutter restriction endonuclease, a 6 base cutter restriction endonuclease. Some example 4 base cutters include Dpnll, Fatl, MIuCI, BfuCI, Mbol, Sau3AI, Bfal, Bstlll, Pmll, Kasl, and others that are commercially available, for example, from New England BioLabs Inc., ThermoFisher Scientific, etc. Some example 5 base cutters include BssKI,StyD41, MaeIII, PspGI, DdeI, FmuI, PspGI, TfiI, and others that are commercially available, for example, from New England BioLabs Inc., ThermoFisher Scientific, etc. Some example 6 base cutters include Acll, Afel, Nspl, Haell, Tati, and others that are commercially available, for example, from New England BioLabs Inc., ThermoFisher Scientific, etc. The restriction endonuclease site 47 is positioned such that after cleavage / digestion with a restriction enzyme, the last base of the D / B complement sequence 58’ is exposed for the introduction of the sample containing RNA.
[0138] The third fluid is then introduced into the flow cell 10. As mentioned, the third fluid includes the azide terminated capture primer 52. The copper-catalyzed azide alkyne cycloaddition reaction is initiated between the second alkyne A2 (see Fig.4C) and an azide terminated capture primer 52 (see Fig. 4D). Initiating the copper-catalyzed azide alkyne cycloaddition reaction involves introducing the azide terminated capture primer 52 (in the third fluid) to the flow cell 10; and introducing a copper(l) catalyst to the flow cell 10. The copper(l) catalyst may be introduced with the third fluid or separately from the third fluid. The second alkyne A2 reacts with the azide at the 5’ end of the capture primer 52 to immobilize one or more capture primers 52 within the depressions 24 or randomly across the lane 26 or the non-patterned structure 18’.
[0139] Referring now to Fig. 4E, the method further includes introducing an RNA sample to the flow cell 10 including the azide terminated capture primer 52.
[0140] A sample containing RNA may be obtained from a human, a rat, a mouse, and / or bacteria. Gross samples may be obtained, such as blood, tissue, cells, fixed tissues, etc. One specific example of a gross sample is an oncology sample, which includes tumor cells. Other examples of the sample containing RNA may be obtained from an organism contained in the human microbiome. The human microbiome sample may be obtained from an adult gut, an infant gut, an oral cavity, or a vaginal cavity. The sample containing RNA may be extracted via any suitable technique.
[0141] The extracted sample containing RNA may be exposed to any suitable rRNA depletion technique prior to undergoing the additional processes described herein. This will increase the concentration of polyA tailed mRNA strands within the sample.
[0142] The sample containing RNA is introduced into the flow cell 10 as shown in Fig. 4E. At least some of the mRNA strands are naturally polyA tailed RNA strands 56. In one example, the polyA tailed RNA strands 56 are polyA tailed mRNA strands.
[0143] In an example, from about 1 ng to about 1 pg of the strands of the RNA containing sample that are introduced into the flow cell 10 are polyA tailed RNA strands 56. This can help to ensure that the input is sufficient to capture enough polyA tailed RNA strands 56 for capture and subsequent processing. In an example, about 1 pg of the RNA containing sample includes from about 10 ng to about 100 ng of the polyA tailed RNA strands 56.
[0144] When the sample including the polyA tailed RNA strands 56 is introduced into the flow cell 10, the flow cell 10 is at or is brought to a suitable hybridization temperature (e.g., from about 55°C to about 62°C). At this temperature, the polyA tails of the RNA strands 56 respectively hybridize to the polyT sequences 54 of at least some of the capture primers 52. The hybridized strands 56 are shown in Fig. 4E.
[0145] The remainder of the sample, which includes RNA fragments that are not A-tailed, will remain in solution, and can be flushed from the flow cell 10 with a washing solution.
[0146] A composition that enables on-flow cell preparation of cDNA from the captured polyA tailed RNA strand 56 is then introduced into the flow cell 10. In this example, this composition includes a reverse transcriptase and a plurality of deoxynucleotide trisphosphates (dNTPs). The polyT containing capture probes 52 serve as the priming site for the reverse transcriptase after it is added to the flow cell 10. The reverse transcriptase can generate a first strand of cDNA from the polyA tailed RNA strands 56 using the dNTPs. As such, the reverse transcriptase is a polymerase with RNA-dependent DNA polymerase activity, such as Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (with no or severely reduced RNA nickase activity), a reverse transcriptase derived from a retrotransposon, or a Group II intron reverse transcriptase.
[0147] The condition to initiate formation of the cDNA is temperature, and thus the flow cell 10 and its contents are at or are brought to a temperature ranging from about 25°C to about 49°C. The condition may also include holding the flow cell 10 at thetemperature for a predetermined time (e.g., from about 15 minutes to about 30 minutes). The formation of the cDNA strand is performed via an isothermal reaction.
[0148] The reverse transcriptase used for cDNA generation is also capable of adding an adapter 57 (shown in Fig. 4E and Fig. 4F) to the 3’ end of the generated cDNA strand 59 (shown in Fig. 4F). The adapter 57 is ligated to the cDNA strand 59. The adapter 57 can hybridize to the D / B complement sequence 58’.
[0149] The polyA tailed RNA strand 56 is then dehybridized and removed from the flow cell 10.
[0150] Hybridization of the adapter 57 at the 3’ end of the cDNA strand 59 to the D / B complement sequence 58’ is shown in Fig. 4F. An extension reaction is performed both along the barcoded primer complement strands 44’ and along the strands containing the adapter 57, the cDNA strand 59, and the capture primer 52. This generates two strands with the amplification domain sequences 46B and 46A from primer 38 at opposed ends. Bridge amplification can then be performed to amplify the cDNA strands 59.
[0151] Another example method includes initiating amplification of a barcoded primer 44A or 44B using at least one primer 38 of an amplification primer set (primers 36, 38) attached to the polymeric hydrogel 34; initiating a strain-promoted azide alkyne cycloaddition reaction between an available azide group of a polymeric hydrogel 34 positioned over a substrate 20 or material 30, or in a lane 26, or in each of a plurality of depressions 24 of a flow cell 10 and a first alkyne Ai at a first end of a linking molecule 40, the linking molecule 40 including a second alkyne A2 at a second end that is opposed to the first end and that has reactivity orthogonal to the first alkyne A1; and initiating a copper-catalyzed azide alkyne cycloaddition reaction between the second alkyne A2 and an azide terminated capture primer 52. In this example, amplification of the barcoded primer 44A or 44B takes place prior to the introduction of the linking molecule 40, and the barcode primer complement strands 44’ are sequenced (decoded) after introduction of the linking molecule 40. Each of these processes may be performed as described herein. Introduction of the sample containing RNA and the adapter 57, followed by amplification and sequencing, may then be performed as described herein.
[0152] To further illustrate the present disclosure, examples are given herein. It is to be understood that these examples are provided for illustrative purposes and are not to be construed as limiting the scope of the present disclosure.NON-LIMITING WORKING EXAMPLES
[0153] Example 1
[0154] An example flow cell including eight fluidically isolated flow channels was used in this example. Depressions were defined in each of the flow channels, and poly A / -(5-azidoacetamidylpentyl)acrylamide-co-acrylamide was the polymeric hydrogel in each of the depressions.
[0155] A grafting solution containing 7.5 pM P5 and P7 primers with orthogonal cleavage sites (uracil and 8-oxoguanine) was introduced into each of the flow channels for grafting the primers within the depressions.
[0156] Barcoded primers were introduced into each of the flow channels. A solution containing 45 pM of the barcoded primers was introduced into each of the flow channels, and hybridization and extension were performed to generate barcode primer complements attached to one of the primers. These complements were amplified using bridging clustering. Fluorescently tagged sequencing primers were introduced and hybridized to the sequencing primer sequences of the amplified barcoded primers. The fluorescence intensity was detected post hybridization, which was indicative of the clustering efficiency. The results are shown in Fig. 5 as the bar labeled “clustering intensity.”
[0157] BCN-PEG-alkyne linking molecules were then introduced into six of the eight flow channels. Two of the flow channels were used as control lanes. The fluids respectively introduced into each flow channel are shown in Table 1.TABLE 1Flow Channel Fluid ID in Fig. 6 ID1 (Control) Water H2O2 (Control) 1:1 Water: CH3CN H2O / CH3CN3 1:1 Water: CH3CN with 10 pM 10 μMlinking molecule4 1:1 Water: CH3CN with 20 pM 20 μMlinking molecule5 1:1 Water: CH3CN with 30 pM 30 μMlinking molecule6 1:1 Water: CH3CN with 40 pM 40 μMlinking molecule7 1:1 Water: CH3CN with 60 pM 60 μMlinking molecule8 1:1 Water: CH3CN with 80 pM 80 μMlinking moleculeThe respective fluids were flowed into the respective lanes and allowed to incubate for 2 hours at 60°C, which enabled the strain-promoted azide alkyne cycloaddition of the first alkyne (BCN) of the linking molecule to the azides of the polymeric hydrogel. The fluids were then removed using an extra wash.
[0158] Sequencing by synthesis was performed after the linking molecules were introduced. Fig. 5 sets forth the intensity from SBS (the bar labeled “SBS Intensity after Capping”), as well as the clustering intensity results. As depicted, the addition of the linking molecules does not impact the intensity of the barcode primer complements.
[0159] Several of the sequencing metrics, including density, %pass filter, %>=Q30, and P90. A were recorded from the SBS that was performed after the additional of the linking molecules. Each of these results is shown in Fig. 6.
[0160] The density refers to the clusters detected by image analysis (in thousands per mm2or k / mm2).
[0161] Passing filter (PF) is the metric used to describe clusters which pass a chastity threshold and are used for further processing and analysis of sequencing data. The %PF calculation involves the application of a chastity filter to each cluster. “Chastity” is defined as the ratio of the brightest base intensity divided by the sum ofthe brightest and second brightest base intensities. Clusters “pass filter” if no more than 1 base call has a chastity value below 0.6 in the first 25 cycles. This filtration process removes the least reliable clusters from the image analysis results. As such, a higher %passing filter (%PF) result indicates an increased yield of usable sequencing data.
[0162] Q30 is equivalent to the probability of an incorrect base call 1 in 1000 times. This means that the base call accuracy (i.e., the probability of a correct base call) is 99.9%. A lower base call accuracy of 99% (Q20) will have an incorrect base call probability of 1 in 100, meaning that every 100 base pair sequencing readswill likely contain an error. When sequencing quality reaches Q30, virtually all of the reads will be perfect, having zero errors and ambiguities.
[0163] P90. A is the base A intensity read from sequencer for cycle 1.
[0164] As noted, all of these results are shown in Fig. 6. The results indicate that the presence of the linking molecule on the surface of the flow cell does not impact the barcode primer complements (i.e., decoding matrix).
[0165] Example 2
[0166] Two of the same flow cells as described in Example 1 were used in this example. The P5 and P7 primers and the barcoded primers were introduced and grafted in each of the flow cells in the same manner as described in Example 1.
[0167] For the first flow cell, BCN-PEG-alkyne linking molecules were then introduced into seven of the eight flow channels. One of the flow channels was used as a control lane. The fluids respectively introduced into each flow channel are shown in Table 2.TABLE 2Flow Channel ID Fluid1 (Control) 1:1 Water: CH3CN2 1:1 Water:CH3CN with 20 μM linking molecule3 1:1 Water:CH3CN with 20 μM linking molecule4 1:1 Water:CH3CN with 20 μM linking molecule5 1:1 Water:CH3CN with 40 μM linking molecule6 1:1 Water:CH3CN with 40 μM linking molecule7 1:1 Water:CH3CN with 80 μM linking molecule8 1:1 Water:CH3CN with 80 μM linking moleculeThe respective fluids were flowed into the respective lanes and allowed to incubate for 2 hours at 60°C. The fluids were then removed using an extra wash.
[0168] Decoding was performed after the linking molecules were introduced using sequencing by synthesis. The results are not reproduced herein, but were similar to those shown in Fig. 6.
[0169] After decoding, azide-term inated capture molecules (a cleavable P5 sequence with an azide at the 5’ end and a polyT sequence at the 3’ end) were grafted to the second alkyne of the linking molecule via a copper-catalyzed azide alkyne cycloaddition reaction. In each flow channel, 2.0 pM of the azide-terminated capture molecules were introduced in a carbonate buffer.
[0170] Fluorescently labelled DNA that was complementary to the grafted azide-terminated capture molecules was introduced, and the fluorescence intensity was measured after hybridization. The results are shown in Fig. 7, as a function of the concentration of the linking molecule. As illustrated, azide conversion was accomplished at each linking molecule concentration, but overall, the 20 pM concentration of the linking molecule was most successful.
[0171] For the second flow cell, BCN-PEG-alkyne linking molecules were then introduced into all eight of the flow channels at the same concentration (1:1 Water:CH3CN with 20 μM linking molecule). The fluid was introduced, incubated, and washed as described herein.
[0172] Decoding was performed after the linking molecules were introduced using sequencing by synthesis. The results are not reproduced herein, but were similar to those shown in Fig. 6.
[0173] After decoding, azide-term inated capture molecules (a cleavable P5 sequence with an azide at the 5’ end and a polyT sequence at the 3’ end) were grafted to the second alkyne of the linking molecule via a copper-catalyzed azide alkyne cycloaddition reaction. In the second flow cell, different concentrations of the azide-terminated capture molecules and different buffers were used to test the grafting efficiency. The fluids introduced into each flow channel is shown in Table 3.TABLE 3Flow Channel ID Fluid1 0.1 pM azide-term inated capture molecules in carbonate buffer2 0.5 pM azide-term inated capture molecules in carbonate buffer3 1.0 pM azide-term inated capture molecules in carbonate buffer4 1.5 pM azide-term inated capture molecules in carbonate buffer5 2.0 pM azide-term inated capture molecules in carbonate buffer6 0.5 pM azide-term inated capture molecules in HEPES buffer7 1.0 pM azide-term inated capture molecules in HEPES buffer8 1.5 pM azide-term inated capture molecules inHEPES buffer
[0174] Fluorescently labelled DNA that was complementary to the grafted azide-terminated capture molecules was introduced, and the fluorescence intensity was measured after hybridization. The results are shown in Fig. 8, as a function of the concentration of the azide-terminated capture molecule. As illustrated, azide conversion was more efficient in the carbonate buffer, although both buffers enabled successful grafting.
[0175] Additional Notes
[0176] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.
[0177] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0178] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.
Claims
What is claimed is:
1. A kit, comprising:a flow cell including:a substrate; anda polymeric hydrogel having surface azide groups and being attached to the substrate;a first fluid including:a first liquid carrier; anda linking molecule including first and second alkynes;a second fluid including:a second liquid carrier; anda plurality of barcoded primers; anda third fluid including:a third liquid carrier; anda plurality of azide terminated capture primers.
2. The kit as defined in claim 1, further comprising an amplification primer set attached to the polymeric hydrogel.
3. The kit as defined in claim 1, further comprising a fourth fluid including: a fourth liquid carrier; andalkyne terminated first and second primers.
4. The kit as defined in claim 1, wherein:the linking molecule includes a linker positioned between the first and second alkynes;the linker is selected from the group consisting of poly(ethylene oxide), polyvinyl alcohol, poly(acrylic acid), and polyvinylpyrrolidone;the first alkyne is selected from the group consisting of cyclooctyne, a monofluorinated cyclooctyne, difluorocyclooctyne, bicyclononyne, 6,7-dimethoxyazacyclooct-4-yne, benzocyclooctyne, dibenzocyclooctyne,dibenzocyclooctynol, dibenzoazacyclooctyne, biarylazacyclooctynone, and 3, 3,6,6-tetramethylthiacycloheptyne; andthe second alkyne is a terminal alkyne.
5. The kit as defined in claim 1, wherein each of the plurality of barcoded primers includes, in order from a 5’ end to a 3’ end: an amplification domain sequence, an index sequence, and a sequencing primer sequence.
6. The kit as defined in claim 1, wherein each of the plurality of azide terminated capture primers includes, in order from a 5’ end to a 3’ end: a terminal azide, an amplification domain sequence, and a polyT sequence.
7. A method, comprising:initiating a strain-promoted azide alkyne cycloaddition reaction between an available azide group of a polymeric hydrogel positioned in a lane or each of a plurality of depressions of a flow cell and a first alkyne at a first end of a linking molecule, the linking molecule including a second alkyne at a second end that is opposed to the first end and that has reactivity orthogonal to the first alkyne;initiating amplification of a barcoded primer using at least one primer of an amplification primer set attached to the polymeric hydrogel; andinitiating a copper-catalyzed azide alkyne cycloaddition reaction between the second alkyne and an azide terminated capture primer.
8. The method as defined in claim 7, further comprising grafting the amplification primer set to the polymeric hydrogel prior to initiating the strain-promoted azide alkyne cycloaddition reaction.
9. The method as defined in claim 7, wherein amplification of the barcoded primer generates a cluster of barcoded primer complements, and wherein prior to initiating the copper-catalyzed azide alkyne cycloaddition and after the cluster is generated, the method further comprises initiating sequencing by synthesis of thebarcoded primer complements, thereby decoding an index sequence of the barcoded primer.
10. The method as defined in claim 7, wherein initiating the copper-catalyzed azide alkyne cycloaddition reaction involves:introducing the azide terminated capture primer to the flow cell; and introducing a copper(I) catalyst to the flow cell.
11. The method as defined in claim 7, wherein initiating the strain-promoted azide alkyne cycloaddition reaction involves:introducing the linking molecule to the flow cell; andincreasing a temperature of the flow cell to about 60°C.
12. The method as defined in claim 7, further comprising introducing an RNA sample to the flow cell including the azide terminated capture primer.