Translation enhancing nucleic acid compounds for JAG1 and uses thereof

WO2026206997A1PCT designated stage Publication Date: 2026-10-01ARNATAR THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/020606
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-25
Filing Date
2026-03-24
Publication Date
2026-10-01

Smart Images

  • Figure US2026020606_01102026_PF_FP_ABST
    Figure US2026020606_01102026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are methods and compounds for enhancing gene expression by compounds targeting JAG1. Such methods and compounds are useful for increasing expression of certain genes, many of which are associated with a variety of diseases and disorders.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Dkt. 30902.10WO01 / SBA / TYL

[0002] TRANSLATION ENHANCING NUCLEIC ACID COMPOUNDS FOR JAG1 AND USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U. S. Provisional Application Nos. 63 / 777,441, filed March 25, 2025, the entire content of which is incorporated herein in its entirety by this reference.

[0004]

[0005] INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0006] Incorporated by reference in its entirety is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: the text file named " 2026_03_24_Seq_listing_uORF” (245,760 bytes), which was created on March 1, 2026.

[0007] Throughout this application various publications are referenced. All publications, gene transcript identifiers, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, gene transcript identifiers, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0008] FIELD

[0009]

[0010] Certain embodiments are directed to nucleic acid compounds for enhancing JAG1 gene expression and methods of using the compounds. Such methods and compounds are useful for increasing expression of Jagged 1 (JAG1) protein, which is associated with Alagille Syndrome (AI. GS).

[0011] BACKGROUND

[0012] Alagille Syndrome (ALGS) is a rare, autosomal dominant disorder with characteristic multi-organ features. The clinical manifestations are variable, and commonly include hepatic(cholestasis, characterized by bile duct paucity), cardiac (primarily involving the pulmonary arteries), renal, skeletal, ophthalmologic, and facial abnormalities. ALGS can range from a subclinical presentation to a life-threatening condition, with a mortality rate of up to 10% (Benabed et al, 2018, Ann Biol Clin (Paris) 76: 675-680; Mitchell et al,, 2018, Clin Liver Dis 22: 625-641). A recent study on a large international cohort of ALGS patients found that only 40.3% of children with ALGS reach adulthood with their native liver (Vandriel el al,, 2023, Hepatology 22: 532- 529), Currently, available treatment has no cure and mainly includes symptom management. Two small molecule drugs that inhibit the ileal bile acid transporter (IB AT) to decrease the reabsorption of bile acids from intestine to blood stream were approved recently (Himes el al., 2024, J Pediatr Gastroenterol Nutr 78: 506-513; Jarasvarapam el al., 2024, Expert Opin Pharmacother 25: 1647-1655). However, due to the mechanism of action of IBAT in the gastrointestinal tract, inhibition of IBAT may cause side effects, including diarrhea and abdominal pain (Sutton et al., 2024, Hepatology 10.1097 / HEP.0000000000001032). End-stage liver disease treatment includes liver transplantation, which is limited by donor resources and has little effect on already impaired extra¬ liver organs. Thus, a new strategy to treat ALGS from the cause is highly desired.

[0013] In the majority of ALGS patients, the disorder Is caused by mutations in the JAG1 gene leading to JAG1 haploinsufficiency. JAG1 haploinsufficiency results in impaired bile duct development in the liver during early childhood. Therefore, increasing JAG1 protein levels to compensate for JAG1 haploinsufficiency in ALGS patients offers a potential treatment approach.

[0014] Herein we designed antisense oligomeric compounds of the invention to specifically increase the translation of JAG 1 mRNA, thus increasing Jagged 1 (JAG1) protein levels so as to compensate for JAG1 haploinsufficiency to treat ALGS.

[0015] SUMMARY OF THE INVENTION

[0016] Several embodiments provided herein relate to the discovery of certain ARNATAR design modified antisense compounds targeting JAG1 that can enhance their effectiveness in modulating JAG1 gene expression. In certain embodiments, the antisense compound is an antisense oligonucleotide targeting the mRNA transcript of JAG1, wherein the compound enhances translation of JAG 1 protein. In a preferred embodiment, the compound targets an upstream open reading frame (uORF) in the 5’ UTR of a JAG1 mRNA transcript, a structural region in the 5’UTR of a JAG1 mRNA transcript or a miRNA targeting region in the 3’ L'TR of JAG1 mRNA. In certain embodiments, the miRNA is miR-153, miR-26, miR-124.

[0017] In certain embodiments, a pharmaceutical composition for enhancing JAG1 gene expression comprises an antisense compound targeting JAG 1, alone or in combination with a pharmaceutically acceptable carrier or excipient.

[0018] Certain embodiments provide a method for increasing translation of JAG1 mRNA in a cell comprising administering an antisense compound targeting JAGl to a cell, in an amount sufficient to increase translation of the JAG1 mRNA.

[0019] Certain embodiments provide a method for increasing expression of JAG1 protein in a subject comprising administering an antisense compound targeting JAG1 to a cell, in an amount sufficient to increase expression of JAG1 protein.

[0020] Certain embodiments provide a method for treating a haploinsufficiency disorder in a subject comprising administering an antisense compound targeting JAG1 to the subject, in an amount sufficient to treat the haploinsufficiency disorder in the subject. In a preferred embodiment. the haploinsufficiency disorder is Alagille Syndrome.

[0021] Certain embodiments provide a process or method for making a compound targeting JAG1 of the invention comprising synthesizing an oligonucleotide on a solid support using phosphoramidite chemistry thereby making the JAG1 targeting antisense compound.

[0022] BRIEF DESCRIPTION OF THE DRAWINGS

[0023] FIGURE 1A-B: Shows that different ASOs can increase JAG1 protein and mRNA levels in human HEK293 cells at 24 hrs after transfection: A) Western Blot showing increased protein levels by several ASOs and decreased JAG1 protein level by a JAG1 siRNA (JAG 1 -si) compared to mock transfection; and, B) qRT-PCR results measuring JAG1 mRNA levels. An siRNA targeting JAG1 was used to knockdown expression of JAG1 protein and mRNA in order to monitor the ability of JAGl antibody to determine JAG1 protein levels. The JAGl protein levels were normalized to a non-specific band (marked with *) detected by the same JAGl antibody and the relative JAG1 levels compared to the mock treated sample.

[0024] FIGURE 2: Shows a Western Blot of the level of JAG1 protein in HEK293 cells 36 hr after transfection with two ASOs, ATXL100 and ATXL104, at varying concentrations. JAG1 proteinlevels were normalized to the amount of GAPDH protein present and the relative levels compared with the mock transfected samples,

[0025] FIGURE 3: Shows a Western Blot of the level of JAG1 protein in ALGS patient derived fibroblast cell line GM05759 cells 24 hrs after transfection with different ASOs. ATXL100 was transfected at 15 nM, and other ASOs were transfected at 5 nM final concentrations. JAG1 protein levels were normalized to the amount of GAPDH protein present and the relative levels of JAGI protein compared with the mock treated sample.

[0026] FIGURE 4: Shows a Western Blot of the level of JAG1 protein in HEK293 cells 24 hr after transfection with two ASOs, ATXL212 and ATXL213, at varying concentrations. JAG1 protein levels were normalized to the amount of GAPDH protein present and the relative levels compared with the mock transfected samples.

[0027] FIGURE 5: Shows a Western Blot of the level of JAG1 protein in HEK293 or HeLa cells 24 hrs after transfection with different ASOs. JAG1 protein levels were normalized to the amount of GAPDH protein present and the relative levels of JAGI protein compared with the mock treated sample. “M” designates a pre-stained size maker of 39 kDa.

[0028] FIGURE 6: Shows a Western Blot of the level of JAG1 protein in HeLa cells 24 hr after transfection with two ASOs, ATXL212 and ATXL247, at varying concentrations. JAG1 protein levels were normalized to the amount of GAPDH protein present and the relative levels compared with the mock transfected samples.

[0029] FIGURE 7: Shows a Western Blot of the level of JAGI protein in HeLa cells 24 hr after transfection with ASO ATXL233, at varying concentrations. JAGI protein levels were normalized to the amount of Hsp90 protein present and the relative levels compared with the mock transfected samples.

[0030] FIGURE 8A-C: Shows that ASOs ATXL212 and ATXL233 targeting the uORF region of JAGI 5’UTR can increase JAGI protein expression in mice treated with the ASOs: A) Schematic of the dosing strategy; B) Western Blot showing JAGI protein expression; and, C) a chart of JAGI protein levels. GAPDH protein was used as a loading standard for quantification. NS is not significant; * is P<0.05; ** is P<0.01; *** is P<0.001. “M” designates a size maker of 39 kDa. FIGURE 9A-C: Shows that ASOs ATXL233 and ATXL252 targeting the uORF region of JAGI 5’UTR can increase JAGI protein expression in mice treated with the ASOs: A) Schematic of the dosing strategy; B) Western Blot showing JAGI protein expression; and, C) Quantification ofJAGl mRNA levels by qRT-PCR. Tubulin protein was used as a loading standard for quantification. NS is not significant; * is P<0.05.

[0031] FIGURE 10A-B: Shows qRT-PCR results quantifying NOTCH1 and NOTCH2 mRNA levels in mice liver after treatment with JAG1 ASOs relative to PBS control: A) a chart of NOTCH! mRNA levels, and B) a chart of NOTCH2 mRNA levels.

[0032] FIGURE 11 A-B: Shows that ASO treatment can increase JAG1 protein levels in a Jag 1 - / - mouse model: A) Schematic of the dosing strategy; and, B) Western Blot showing JAGl protein expression. GAPDH protein served as a control for protein loading. JAG1 protein levels were quantified after normalization to the levels of GADPH and compared to the amount of JAG1 protein in PBS treated WT mice.

[0033] FIGURE 12: Shows a chart quantitating JAG1 protein levels after ASO treatment in a Jagl+ / - mouse model, NS is not significant; * is PO.05; ** is P<0.01; *** is P<0.001.

[0034] FIGURE 13A-C: Shows that ATXL233 ASO treatment can increase JAGl protein levels in a Jag1+ / -mouse model: A) Schematic of the dosing strategy; B) Western Blot showing JAGl protein expression; and, C) a chart quantifying the JAGl protein levels seen in the Westen Blot. Tubulin protein served as a control for protein loading. JAGl protein levels were quantified after normalization to the levels of Tubulin and compared to the amount of JAG l protein in PBS treated WT mice.

[0035] FIGURE 14A-B: Shows that ATXL233 ASO treatment can increase biliary tree development in a Jagl / " mouse model: A) ink stained liver biliary trees; and, B) a chart quantifying the amount of ink stained areas in the Jagl+ / ' samples compared to the ink stained areas in WT mice. * is P<0.05. FIGURE 15A-B: Shows immunohistochemical staining of portal veins (PV) and bile ducts (BD) in liver samples after ATXL233 treatment of Jagl+ / " mice: A) immunohistochemical staining of the liver samples, liver sections were stained with CK (green) and a-SMA (red) antibodies, nuclei were stained with DAPI; and, B) a chart quantifying the ratio of bile duct (BD) and portal vein (PV) in mouse liver. Scale bars are 100 pM. * is P<0.05.

[0036] FIGURE 16A-D: Charts the amounts of plasma bile acid (A), plasma bilirubin (B), plasma triglyceride (C), and cholesterol (D) after treatment of Jagl+ / " mice with ATXL233. ** is P<0.01.

[0037] DETAILED DESCRIPTION OF THE INVENTION

[0038] It is to be understood that both the foregoing general description and the follo wing detaileddescription are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0039] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

[0040] Definitions

[0041] Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers, and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

[0042] Unless otherwise indicated, the following terms have the following meanings:

[0043] “2’-O-methoxyethyl” (also 2’-M0E and 2’-O(CH2)2-OCH3) refers to an O-methoxy-ethyl modification at the 2’ position of a furanose ring. A 2’-O-methoxyethyl modified sugar is a modified sugar.

[0044] “2 ’-MOE nucleoside” (also 2’-O-methoxyethyl nucleoside) means a nucleoside comprising a 2’-M0E modified sugar moiety. “2’ -MOE nucleotide” (also 2’-O-methoxyethyl nucleotide) means a nucleotide comprising a 2 ’-MOE modified sugar moiety.“2’-0-methyl” (also 2’-OCH3 and 2’-0Me) refers to an O-methyl modification at the 2 position of a furanose ring. A 2 ’-O-methyl modified sugar is a modified sugar.

[0045] “2’-OMe nucleoside” (also 2’-O-methyI nucleoside) means a nucleoside comprising a 2’- OMe modified sugar moiety. “2’-OMe nucleotide” (also 2 ’-O-methyl nucleotide) means a nucleotide comprising a 2’-0Me modified sugar moiety.

[0046] “2’ -substituted nucleoside’’ > means a nucleoside comprising a substituent, i.e., a modification, at the 2 ’-position of the furanosyl ring other than H or OH. In certain embodiments, 2’ substituted nucleosides include nucleosides with a fluoro (2’-F), O-methyl (2’-OMe), O-methoxyethyl (2 ’-MOE) or bicyclic sugar modifications. A ’-substituted nucleoside is a modified nucleoside,

[0047] “3’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3 ’-most nucleotide of a particular antisense compound.

[0048] “5’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5 ’-most nucleotide of a particular antisense compound.

[0049] “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase and is part of a modified nucleoside. “5- methylcytidine” is the name of the nucleoside when the 5 methyl modified nucleobase is combined with a modified or unmodified sugar.

[0050] “About” as used herein means within ±7% of a measurable value. For example, if it is stated, “the compounds affected al least about 70% inhibition of mRNA”, it is implied that the mRNA levels are inhibited within a range of 63% and 77%. The term “about” as used herein when referring to an amount of a compound or agent of this invention, dose, time, temperature, and the like, is meant to encompass variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified amount. For sequence identity, “about” as used for percent sequence identity encompasses variations of ± 5%. Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.”

[0051] “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.“. Antibody” refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fcregion.

[0052] “Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides (ASOs), siRNAs, shRNAs, snoRNAs, miR As, and satellite repeats. It is to be understood that antisense compounds include compounds targeting JAG1.

[0053] “Antisense oligonucleotide” or “ASO” means a single-stranded oligonucleotide having a micleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid. In certain embodiments, the ASO comprises one or more modified nucleosides.

[0054] “Average” as used herein may be mean, mode or medium for a group of measurements. As used herein the singular forms "a", "and", and "the" include plural referents unless the context dearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and reference to "the culture" includes reference to one or more cultures and equivalents thereof known to those skilled in the art.

[0055] “Base complementarity” refers to the capacity for the base pairing of nucleobases of an oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases. Base complementarity also refers to canonical (e.g., A: U, A: T, or C; G) or non-canonical base pairings (e.g., A: G, A: U, G: U, I: U, I: A, or I: C).

[0056] “Bicyclic sugar” means a furanose ring modified by the bridging of two non-geminal carbomatoms. A bicyclic sugar is a modified sugar.

[0057] “Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.

[0058] “cEt” or “constrained ethyl” means a bicyclic sugar moiety comprising a bridge connecting the 4’-carbon and the 2* -carbon, wherein the bridge has the formula: 4’-CH(CH3)-O-

[0059] “Constrained ethyl nucleoside” (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4’-CH(CH3)-O-2’ bridge.“Chemical modification” means a modification of molecular structure or element from naturally occurring molecules. For example, antisense oligonucleotides are composed of linked deoxyribonucleosides (also sometimes referred to herein as DNA nucleoside), therefore, substitution of a 2’-M0E nucleoside for a DNA nucleoside is considered a chemical modification of the antisense oligonucleotide. Examples of other chemical modifications may be found hereinbelow.

[0060] “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2’~O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2’-O-methoxyethyl modifications.

[0061] “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0062] “Comply” means the adherence with a recommended therapy by an individual.

[0063] “Comprise,” “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0064] “Contiguous nucleobases” means nucleobases immediately adjacent to each other.

[0065] “Deoxyribonucleoside” means a nucleoside having a hydrogen at the 2’ position of the sugar portion of the nucleoside. A deoxyribonucleoside is sometimes referred to as DNA nucleoside, “D” or “d” herein. Deoxyribonucleosides may be modified with any of a variety of substituents and may be connected by covalent linkages other than naturally occurring phosphodiester such as phosphoro thioate.

[0066] “Deoxyribonucleotide” means a nucleotide having a hydrogen at the 2’ position of the sugar portion of the nucleotide. A deoxyribonucleotide is sometimes referred to as DNA nucleotide, “D” or “d” herein. Deoxyribonucleotides may be modified with any of a variety of substituents and may be connected by covalent linkages other than naturally occurring phosphodiester such as phosphorothioate.

[0067] “Derivative” of an ASO of the invention refers to selecting a sequence and then modifying the sequence for use as an ASO. Merely by way of example, modifications may be any of insertions, additions, deletions, or substitutions of particular nucleosides into a sequence, as well as chemical modifications. For example, a substitution of an A in place of a T (and vice-versa)forms a derivative sequence, In another example, a substitution of T in place of a U (and vice- versa) forms a derivative sequence. In the ASO, a modification can include at least one substitution, at least two substitutions, or at least three substitutions.

[0068] “Efficacy” means the ability to produce a desired effect.

[0069] “Expression” includes ah the functions by which a gene’s coded information is converted into structures present and operating, in a cell. Such structures include, but are not limited to the products of transcription and translation.

[0070] “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid, “Fully modified” or “Fully chemically modified” refers to an antisense compound comprising a contiguous sequence of nucleosides wherein each nucleoside has a chemical modification.

[0071] “Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.

[0072] “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.

[0073]

[0074] “Individual” means a human or non-human animal selected for treatment or therapy. “Induce”, “inhibit”, “potentiate”, “elevate”, “increase”, “decrease”, “enhance” or the like, generally denote quantitative differences between two states.

[0075] “Inhibiting the expression or activity” refers to a reduction, or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.

[0076] “Internucleoside linkage” or “linkage” refers to the chemical bond between nucleosides. The 3’ position of a nucleoside is hereby linked to a 5’ position of a subsequent nucleoside via the internucleoside linkage.

[0077] “Isolated” means a state following one or more purifying steps but does not require absolute purity.,

[0078] “Linked nucleosides” means adjacent nucleosides (e.g., A, G, C, T, or U) linked together by an internucleoside linkage, Examples of linked nucleosides include deoxyribonucleosides

[0079]

[0080] (sometimes referred to as DNA nucleosides herein) or ribonucleosides (sometimes referred to as RNA nucleosides herein).

[0081] “Linker” means a molecule that may function as a spacer between two components, e.g., between an antisense oligonucleotide and a delivery agent.

[0082] “Mismatch” or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid through Watson-Crick base-pairing (e.g., A: T. A: U, or C: G).

[0083] “Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

[0084] “Modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). In certain embodiments, an RNA nucleoside is considered modified when a DNA nucleoside is substituted for the RNA nucleoside. In certain embodiments, a DNA nucleoside is considered modified when an RNA nucleoside is substituted for the DNA nucleoside.

[0085] “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and / or modified nucleobase.

[0086] “Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified intemucleoside linkage, and / or a modified nucleobase.

[0087] “Modified oligonucleotide” means an oligonucleotide comprising at least one modified intemucleoside linkage, a modified sugar, and / or a modified nucleobase.

[0088] “Modified sugar” means substitution and / or any change from a natural sugar moiety. “Moiety” means one of the portions into which something is divided i.e., a part or component of something. For example, a sugar moiety of a nucleotide is the sugar component of the nucleotide.

[0089] “Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0090] “Motif’ means the pattern of unmodified and modified nucleosides in an antisense compound. Antisense compounds comprise motifs with various modified nucleobases, modified sugars, and / or internucleoside linkages in order to improve, among other characteristics, delivery, stability, specificity, safety and potency of the antisense compounds. The motif is independent of

[0091] Bthe nucleobase sequence of the antisense compound and identifies only the patern of modifications.

[0092] “Natural sugar moiety” means a sugar moiety found in DNA (2’-H) or RNA (2’-OH). “Naturally occurring internucleoside linkage” means a 3’ to 5' phosphodiester linkage. “Non-complementary nucleobase” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

[0093] “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA e.g., mRNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids (e.g., antisense oligonucleotides (ASOs) and microRNAs (miRNA)), double-stranded nucleic acids (e.g., small interfering ribonucleic acids (siRNAs) and short hairpin RNAs (shRNAs).

[0094] “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

[0095] “Nucleobase complementarity” refers to a nucleobase that is capable of base pairing (also known as being complementary) with another nucleobase. If a nucleobase at a certain position of an oligomeric compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligomeric compound and the target nucleic acid is considered to be complementary at that nucleobase pair. For example, in DNA, adenine (A) is complementary to thymine (T); in RNA, adenine (A) is complementary to uracil (U); and, Guanine (G) is complementary to cytosine (C) in both DNA and RNA. Base pairs, or complementary nucleobases, are usually canonical Watson-Crick base pairs (e.g., C: G, A: U, or A: T), but, non-canonical base pairs such as Hoogsteen base pairs (e.g., A: G, or A: U), Wobble base pairs (e.g., G: U, I: U, I: A, or I: C, wherein I is hypoxanthine) and the like are also included. Nucleobase complementarity facilitates hybridization of the oligomeric compounds described herein to their target nucleic acids.

[0096] “Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, and / or nucleobase modification.

[0097] “Nucleoside" means a nucleobase linked to a sugar,

[0098] “Nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl,tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholines (morpholinos linked by -N(H)-C(=O)-O- or other non-phosphodiester linkage), Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system, " Mimetic" refers to groups that are substituted for a sugar, a nucleobase, and / or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

[0099] “Nucleotide” means a nucleoside having a linkage group (e.g., a phosphate (p) or phosphorothioate (PS) group) covalently linked to the sugar portion of the nucleoside. Nucleotides include ribonucleotides and deoxyribonucleotides. Ribonucleotides are the linked nucleotide units forming RNA, Deoxyribonucleotides are the linked nucleotide units forming DNA.

[0100] “Off-target effect” refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

[0101] “Oligomeric compound” means a sequence of linked monomeric subunits that is capable of undergoing hybridization to at least a region of a target nucleic acid through hydrogen bonding. The monomeric subunits can be modified or unmodified nucleotides or nucleosides. Examples of oligomeric compounds include antisense compounds (e.g., antisense oligonucleotides (ASOs)).

[0102] “Oligonucleotide” as used herein means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Oligonucleotides can have a linking group other than a phosphate group (e.g., a phosphorothioate ~ thiophosphate group) used as a linking moiety between nucleosides.

[0103] “Substantially modified” or “substantially chemically modified” refers to an antisense compound comprising a contiguous sequence of nucleosides wherein the nucleosides are mostly, but, not fully, chemically modified. For example, the compound includes not more than about 5, 4, 3, 2, or 1 unmodified nucleoside,

[0104] “Phosphorothioate linkage”: or “PS” means a linkage between nucleosides where the phosphodi ester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfuratom. A phosphorothioate (= thiophosphate or also known as thiophosphate) linkage is a modified internucleoside linkage.

[0105] “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

[0106] “Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

[0107] “RNA” or “ribonucleic acid” consists of ribose nucleotides or ribonucleotides (nitrogenous bases attached to a ribose sugar) linked by phosphodiester bonds, forming strands of varying lengths, The nitrogenous bases in RNA are adenine, guanine, cytosine, and uracil. The ribose sugar of RNA is a cyclical structure of five carbons and one oxygen,

[0108] '■'Ribonucleoside” means a nucleoside having a hydroxy at the 2’ position of the sugar portion of the nucleoside. A ribonucleoside is sometimes referred to as RNA nucleoside, “R” or “r” herein.

[0109] “Ribonucleotide” means a nucleotide having a hydroxy at the 2’ position of the sugar portion of the nucleotide. A ribonucleotide is sometimes referred to as RNA nucleotide, “R” or “r” herein,

[0110] “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used herein, are defined as unique nucleobase positions within a target nucleic acid.

[0111] “Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense compound (e.g., ASO) and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments. Examples of sufficient degrees of complementarity are disclosed herein.

[0112] “Stringent hybridization conditions” or “stringent conditions” refer to conditions under which an antisense compound will hybridize to its target sequence, but to a minimal number of other sequences.

[0113] “Subject” means a human or non-human animal selected for treatment or therapy.“Target” refers to a protein or nucleic acid sequence (e.g., mRNA), the modulation of which is desired. In certain embodiments, the modulation is an increase in expression of the target nucleic acid, In certain embodiments, the modulation is a decrease in expression of the target nucleic acid.

[0114] “Target gene” refers to a gene encoding a target.

[0115] “Targeting” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0116] “Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by antisense compounds,

[0117] “Target region” means a portion of a target nucleic acid to which one or more antisense compound is targeted.

[0118] “Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5’ target site” refers to the 5 ’-most nucleotides of a target segment, “3’ target site” refers to the ’-most nucleotides of a target segment. In an embodiment, a target segment is at least a 12-nuc,leobase portion (i.e., at least 12 consecutive nucleobases) of a target region to which an antisense compound is targeted,

[0119] “Therapeutic efficacy” refers to the effectiveness of a therapeutic compound such as an antisense compound. Therapeutic efficacy can be increased by improvements in delivery, stability, specificity, safety and potency of the therapeutic compound.

[0120] “Unmodified” RNA nucleosides mean the purines adenine (A) and guanine (G), and the pyrimidines cytosine (C) and uracil (U). “Unmodified” DNA nucleosides mean the purines adenine (A) and guanine (G). and the pyrimidines thymine (T) and cytosine (C). In certain embodiments, an unmodified RNA nucleoside is considered modified when a DNA nucleoside is substituted for the RNA nucleoside. In certain embodiments, an unmodified DNA nucleoside is considered modified when an RNA nucleoside is substituted for the DNA nucleoside.

[0121] “Unmodified nucleoside” means a nucleoside composed of commonly and naturally occurring nucleobases and sugar moieties. For example, an unmodified nucleoside is a DNA nucleoside if used in a DNA sequence, however, in such DNA sequence, any other nucleoside (e.g., RNA nucleoside, 2’-0Me, 2’ -MOE, or 2’-F) is considered a modified nucleoside.

[0122] “Unmodified nucleotide” means a nucleotide composed of commonly and naturally occurring nucleobases, sugar moieties, and intemucleoside linkages. For example, an unmodifiednucleotide is a DNA nucleotide if used in a DNA sequence, however, in such DNA sequence, any other nucleotide (e.g., RNA nucleotide, 2’-0Me, 2 ’-MOE or 2’-F) is considered a modified nucleotide.

[0123] “Validated target segment” is defined as at least an 8-nucleobase portion (i.e. 8 consecutive nucleobases) of a target region to which an antisense compound is targeted.

[0124] “Wing segment” means a plurality of nucleosides at the 3’ and / or 5’ end of an antisense oligonucleotide, wherein the nucleosides are modified to impart to the antisense oligonucleotide properties such as. for example, enhanced activity, increased binding affinity for a target nucleic acid, and / or resistance to degradation by in vivo nucleases.

[0125] Disclosed herein are antisense compounds, or salts thereof, for enhancing expression of JAGI in a cell, wherein the compound comprises any of the antisense oligomeric sequences targeting JAGI in any one of Tables 1, 5, 7, or 11. In one embodiment, a salt form of an antisense compound targeting JAGI described in any one of Tables 1, 5, 7, or 11 enhances expression of JAGI in a cell.

[0126] In certain embodiments, the compound targeting JAGI comprises about 13 to 40, 13 to 39, 13 to 38, 13 to 37, 13 to 36, 13 to 35, 13 to 34, 13 to 33, 13 to 32, 13 to 31, 13 to 30, 13 to 29, 13 to 28, 13 to 27, 13 to 26, 13 to 25, 16 to 40, 16 to 35. 16 to 34, 16 to 33, 16 to 32, 16 to 31, 16 to 30, 16 to 29, 16 to 28, 16 to 27, 16' to 26, 16 to 25, 19 to 40, 19 to 35, 19 to 34, 19 to 33, 19 to 32, 19 to 31, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 24 to 40, 24 to 35, 24 to 34, 24 to 33, 24 to 32, 24 to 1, 24 to 30, 24 to 29, 24 to 28, 24 to 27, 24 to 26, 24 to 25, 25 to 40, 25 to 35, 25 to 34, 25 to 33, 25 to 32, 25 to 31, 25 to 30, 25 to 29, 25 to 28, or 25 to 27 linked subunits in length.

[0127] In certain embodiments, the compound targeting JAGI further comprises an agent (e.g., a delivery, therapeutic, or diagnostic agent) so as to form a conjugated compound. In certain embodiments, the conjugate agent (also referred to herein as moiety) can be selected from cholesterols, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, peptides, antibodies, dyes, and tocopherol. In a preferred embodiment, the conjugate agent is a GalNAc moiety.

[0128] In certain embodiments, the compound targeting JAGI comprises at. least one chemical modification, In certain embodiments, the compound targeting JAGI is partially, substantially, or fully chemically modified. In certain embodiments, the compound targeting JAGI is chemicallymodified such that the chemical modification, is selected from one or more of 2’-O-methyl (2’~ OMe), 2’-O-methoxyethyI (2’-M0E), 2’ -fluoro (2’-F), constrained ethyl (cEt), unlocked nucleic acid (UNA), locked nucleic acid (LNA) and / or 5-methylcytosine base.

[0129] In certain embodiments, the compound targeting JAG1 comprises at least one modified internucleoside linkage. In certain embodiments, the at least one modified internucleoside linkage is a phosphorothioate internucleotide (PS) linkage,

[0130] In certain embodiments, the compound targeting JAG1 is about 13 to 40 linked nucleosides in length; includes at least one modified sugar, such as a bicyclic sugar, a 2’-O-methoxyethyl group (2’-MOE), a 2’-O-methyl group

[0131]

[0132] and / or a 4’-CH(CHj)-O-2’ constrained ethyl (cEt) group; includes at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage; and / or includes at least one modified nucleobase, such as a 5- methylcytidine.

[0133] In certain embodiments, the compound targeting JAG1 targets a uORF in the 5’ UTR of JAG1 mRNA, a structural region in the 5’ UTR of J. AG1 mRNA or a microRNA (miRNA) binding site in the 3’ UTR of J'AG l mRNA. In a preferred embodiment, the target region on the miRNA is a miR-124 binding site,

[0134] In certain embodiments, the compound, or salt thereof, targeting JAG1 increases expression of JAG1 protein in a cell by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, or 300%.

[0135] Certain embodiments disclosed herein provide a pharmaceutical composition comprising the compound, or salt thereof, targeting JAG1 described herein, alone or in combination with a pharmaceutically acceptable carrier or excipient.

[0136] Certain embodiments disclosed herein provide a method for increasing translation of JAG 1 mRNA in a cell comprising administering a compound, or salt thereof, targeting JAG I to a cell, in an amount sufficient to increase translation of the JAG1 mRNA. The compound targeting JAG1 increases translation of the JAG1 by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, or 300%.

[0137]

[0138] In some embodiments, the invention provides methods for increasing translation of JAG 1 mRNA in a cell comprising administering a compound, or salt thereof, targeting JAG1 to a cel! so that the compound binds JAG1, in an amount sufficient to increase translation of the JAG1 mRNA.

[0139] Certain embodiments disclosed herein provide a method for increasing expression of J. AG1 protein in a subject comprising administering a compound, or salt thereof, targeting JAG1 to a cell, in an amount sufficient to increase expression of JAG 1 protein. The compound targeting JAG1 increases expression of JAG1 protein by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, or 300%.

[0140] In further embodiments, the invention provides methods for increasing expression of JAG I protein in a subject comprising administering a compound, or salt thereof, targeting JAG 1 to a cell so that the compound binds JAG1, in an amount sufficient to increase expression of JAG1 protein.

[0141] Certain embodiments disclosed herein provide a method for treating a haploinsufficiency disorder in a subject comprising administering a compound, or salt thereof, targeting JAG1 to the subject, in an amount sufficient to treat the haploinsufficiency disorder in the subject. The compound targeting JAG1 increases expression of a protein by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, or 300% in order to treat the haploinsufficiency disorder in the subject. In certain embodiments, the haploinsufficiency disorder is ALGS,

[0142] Certain embodiments disclosed herein provide a method for treating ALGS in a subject comprising administering a compound, or salt thereof, targeting JAG 1 to the subject, in an amount sufficient to treat the subject. The compound targeting JAG1 increases expression of a protein by at least about 10%, 15%, 20%, 25%; 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, or 300% in order to treat ALGS in the subject.

[0143] In certain embodiments, a compound targeting JAG1 can be administered subcutaneously or intravenously to a subject.

[0144] Certain embodiments disclosed herein provide a process or methods for making a compound targeting JAG1 of the invention comprising synthesizing an oligonucleotide on a solid support using phosphoramidite chemistry thereby making the JAG1 targeting compound.In one embodiment, a process for preparing a JAG1 targeting compound of the invention is provided, wherein the process comprises the steps of: a) preparing the compound by sequential coupling of modified and / or unmodified nucleotides and / or linkers via the phosphoramidite oligonucleotide synthesis on a conjugate modified or unmodified solid support: b) optionally, coupling a conjugate moiety to the compound on the solid support via the phosphoramidite oligonucleotide synthesis: c) detaching the compound from the solid support and removing the solid support; and (d) optionally, adding a conjugate post cleavage; and / or (e) optionally, further purifying the compound, optionally using chromatography.

[0145] In one embodiment, a process for preparing a JAG1 targeting compound of the invention is provided, wherein the process comprises the steps of: a) coupling a conjugate moiety to a solid support via the phosphoramidite oligonucleotide synthesis, b) coupling a modified and / or unmodified nucleotide via the phosphoramidite oligonucleotide synthesis to the conjugate moiety on the solid support; c) sequentially coupling additional modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis to prepare the compound; d) detaching the compound from the solid support and removing the solid support; and e) optionally, further purifying the compound, optionally using chromatography.

[0146] A ntisense Compounds

[0147] Antisense compounds include antisense oligonucleotides (ASOs). An antisense compound is “antisense” to a target nucleic acid, meaning that it is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

[0148] In certain embodiments, an antisense oligonucleotide comprises a nucleobase sequence that, when written in the 5" to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

[0149] In certain embodiments, an antisense compound is about 13 to 40 subunits in length. In certain embodiments, an antisense compound comprises a JAG1 targeting compound which in turn comprises an antisense oligonucleotide about 13 to 40 subunits in length.In other embodiments, an antisense compound is about 13 to 40, 13 to 39, 13 to 38, 13 to 37, 13 to 36, 13 to 35, 13 to 34, 13 to 33, 13 to 32, 13 to 31, 13 to 30, 13 to 29, 13 to 28, 13 to 27, 13 to 26, 13 to 25, 19 to 40, 19 to 35, 19 to 34, 19 to 33, 19 to 32, 19 to 31, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 22 to 40, 22 to 35, 22 to 34, 22 to 33, 22 to 32, 22 to 31, 22 to 30, 22 to 29, 22 to 28, 22 to 27, 22 to 26, 22 to 25, 25 to 40, 25 to 35, 25 to 34, 25 to 33, 25 to 32, 25 to 31, 25 to 30, 25 to 29, 25 to 28, or 25 to 27 linked subunits. In certain such embodiments, antisense compounds are about 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 linked subunits in length, or a range defined by any two of the above values.

[0150] It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and / or introduce base mismatch(s) with the target without eliminating activity (US Patent 7,772,203, incorporated-by-reference herein). For example, it is possible to introduce non-canonical base pairings (e.g., A: G, A: C, G: U, I: U, I: A, or I: C) into an antisense oligonucleotide without eliminating activity. In certain embodiments, designing an antisense oligonucleotide with one or more non-canonical base pairings, i.e., mismatch(s), enhances the activity of the antisense compound.

[0151] Antisense Oligonucleotide Motifs

[0152] A motif refers to a pattern of modification of an antisense oligonucleotide. Various motifs have been described in the art and are incorporated-by-reference herein (e.g., US Patent 11,203,755; US Patent 10,870,849; EP Patent 1,532,248; US Patent 11,406,716; US Patent 10,668,170; US Patent 9,796,974; US Patent 8,754,201; US Patent 10,837,013; US Patent 7,732,593; US Patent 7,015,315; US Patent 7,750,144; US Patent 8,420,799; US Patent 8,809,516; US Patent 8,796,436; US Patent 8,859,749; US Patent 9,708,615; US Patent 10,233,448; US Patent 10,273,477; US Patent 10,612,024; US Patent 10,612,027; US Patent 10,669,544; US Patent 11,401,517; US Patent 9,260,471; US Patent 9,970,005; US Patent 11,193,126; US Patent 8,604,183; US Patent 9,150,605; US Patent 9,708,610; USSN 2020 / 0031862; and USSN 2016 / 0272970).

[0153] In certain embodiments, antisense oligonucleotides disclosed herein have chemically modified subunits arranged into motifs or patterns (i.e., chemical modification motifs / pattems) to confer on to the antisense oligonucleotides beneficial properties including, but not limited to:enhanced activity to increase potency; increased binding affinity to increase specificity for a target nucleic acid, thereby limiting off-target effects and increasing safety; or enhanced resistance to degradation by in vivo nucleases thereby increasing stability and durability.

[0154] Target mRNAs and Associated Gene Expression

[0155] Several embodiments are directed to methods of upregulating protein expression by a JAG1 targeting antisense compound. In certain embodiments, the JAG1 target is an mRNA transcript of JAG1. In a preferred embodiment, the JAG1 mRNA target is the sequence in GENBANK Accession No. NM_000214.3 (SEQ ID NO: 1). In certain embodiments, the target region on the mRNA is in the 5’ UTR or 3’UTR, In certain embodiments, the target region on the mRNA is a uORF or structural region in the 5’ UTR. In certain embodiments, the target region on the mRNA is a microRNA (miRNA) binding site. In a preferred embodiment, the target region on the mRNA is a miR-124 binding site;

[0156] In certain embodiments, the target mRNA is present in a eukaryotic cell or a prokaryotic cell. In certain embodiments, the target protein is expressed in a eukaryotic cell or a prokaryotic cell. In certain embodiments, the eukaryotic cell or a prokaryotic cell is a mammalian cell, a plant cell, a yeast cell or a bacteria cell. In some embodiments, the mammalian cell includes cells from mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits, mammals from the order Carnivora, including Felines (cats) and Canines (dogs), mammals from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perissodactyla, including Equines (horses). In some aspects, the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). In a preferred aspect, the mammalian cell is a human cell. In certain embodiments, the cell is in the form of a cultured cell line. In certain embodiments, the cell line is a primary cell line.

[0157] Hybridization

[0158] In some embodiments, hybridization occurs between an antisense compound disclosed herein and a mRNA, The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.In Watson-Crick canonical base pairings, adenine (A) is complementary to thymine (T) in DNA, adenine (A) is complementary to uracil (U) in RNA, and Guanine (G) is complementary to cytosine (C) in both DNA and RNA. Base pairs, or complementary nucleobases, are usually Watson-Crick base pairs (e.g., C; G, A: U, or A: T), but, non-canonical base pairs such as Hoogsteen base pairs (e.g,, A: G or A: U), Wobble base pairs (e.g., G: U, I: U, I: A, or 1: C, wherein I is hypoxanthine) and the like are also permitted during hybridization of the antisense compound to a target nucleic acid or target region. Wobble base pairs in RNAi agents have previously been described (see e.g., US Patent 7,732,593 and US Patent 7,750,144).

[0159] Nucleobase complementarity facilitates hybridization of the antisense compounds described herein to their target nucleic acids with the stronger the pairing (e.g., the more base pairs and / or the stronger the hydrogen bond), the stronger the hybridization of the antisense compound to the target. Hybridization can occur under varying conditions. Stringent conditions are sequence¬ dependent and are determined by the nature and composition of the antisense compound to be hybridized.

[0160] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a target mRNA with little to no off-target binding.

[0161] Complementarity

[0162] An antisense compound comprising an antisense oligonucleotide is complementary to a target nucleic acid when a sufficient number of nucleobases of the antisense oligonucleotide can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g,, upregulation of a target nucleic acid such as a JAG1 mRNA).

[0163] Non-complementary nucleobases between an antisense oligonucleotide and an mRNA nucleic acid may be tolerated provided that the antisense oligonucleotide remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense oligonucleotide may hybridize over one or more segments of an mRNA nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch, or hairpin, structure).In certain embodiments, for antisense compounds that comprise an antisense oligonucleotide, the antisense oligonucleotide portion is, or are at least, about 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an mRNA nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense oligonucleotide with a target nucleic acid can be determined using routine methods.

[0164] For example, an antisense compound in which about 18 out of 20 nucleobases of the antisense oligonucleotide are complementary to a target region, and would therefore specifically hybridize to the target, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases of the antisense oligonucleotide may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense oligonucleotide which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense oligonucleotide with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al.,, J Mol, Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656), Percent homology, sequence identity, or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis,), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

[0165] In certain embodiments, the antisense oligonucleotides provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense oligonucleotide may be fully complementary to an mRNA nucleic acid, or a target region, or a target segment or a target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense oligonucleotide is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense oligonucleotide is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of thetarget nucleic acid that is fully complementary to the antisense oligonucleotide. Fully complementary can also be used in reference to a specified portion of the first and / or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense oligonucleotide can be "fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense oligonucleotide. At the same time, the entire 30 nucleobase antisense oligonucleotide may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense oligonucleotide are also complementary to the target sequence.

[0166] The location of a non-complementary nucleobase may be at the 5’ end or 3’ end of the antisense oligonucleotide. Alternatively, the non-complementary nucleobase or nucleobases may be al an internal position of the antisense oligonucleotide. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

[0167] In certain embodiments, antisense oligonucleotides that are, or are up to about 1, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than one ( 1 ) non-complementary nucleobase(s) relative to a target nucleic acid, such as an mRNA nucleic acid, or specified portion thereof.

[0168] In certain embodiments, antisense oligonucleotides that are, or are up to about 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, such as an mRNA nucleic acid, or specified portion thereof.

[0169] The antisense oligonucleotides provided also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotides are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense oligonucleotides arecomplementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense oligonucleotides are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense oligonucleotides are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense oligonucleotides are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense oligonucleotides are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense oligonucleotides that are complementary to at least an about 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

[0170] Identity

[0171] The antisense oligonucleotides provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific identity number, or portion thereof. As used herein, an antisense oligonucleotide is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, an RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense oligonucleotide described herein as well as oligonucleotides having non-identical bases relative to the antisense oligonucleotides provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense oligonucleotide. Percent identity of an antisense oligonucleotide is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

[0172] In certain embodiments, the antisense oligonucleotides, or portions thereof, are at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense oligonucleotides or SEQ ID NOs, or a portion thereof, disclosed herein.

[0173] In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24. or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.Chemical Modifications

[0174] A nucleoside, is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a covalent linkage (e.g,, phosphate group or a chemically modified linkage as described infra) to the sugar portion of the nucleoside. Oligonucleotides are formed through the covalent linkage of adjacent nucleotides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the linkage groups are commonly referred to as forming the intemucleoside linkages of the oligonucleotide.

[0175] Modifications to antisense compounds encompass substitutions or changes to nucleobases, intemucleoside linkages or sugar moieties. Modified antisense compounds are often preferred over native or unmodified forms because of desirable properties such as, for example, enhanced delivery (e.g., increased cellular uptake), enhanced specificity or affinity for a nucleic acid target, increased stability in the presence of nucleases, enhanced safety (e.g., fewer side effects after administration of the compound to a subject) or increased potency (e.g., increased activity).

[0176] Intemucleoside Linkage Modifications

[0177] The naturally occurring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. For nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligomeric compounds having one or more modified, i.e. non-naturally. occurring, intemucleoside linkages are often selected over oligomeric compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, decreased toxicity, increased stability and durability, decreased degradation and other desirable features for an oligomeric compound. Modified internucleoside linkages and their advantages are well known in the art (Crooke et al., 2021, Nat Rev Drug Discov 20: 427-453; Crooke el al., 2021, J Biol Chem 296: 100416).

[0178] Oligomeric compounds having modified internucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates (e.g., 5‘-methylphosphonate (5’-MP)), phosphoramidate, phosphorothioat.es (e.g,, phosphorodithioate Rp isomer (PS, Rp), phosphorodithioate Rp isomer (PS, Sp), or 5 ’-phosphorothioate (5’-PS)), methoxypropylphosphonate, (S)-5’-C-methyl with Phosphate, and 5’-(E)-vinylphosphonate. In certain aspects, the internucleoside linkage may be replaced with a peptide nucleic acid (PNA) linkage.

[0179] In certain embodiments, oligomeric compounds targeted to a nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified intemucleoside linkages are phosphorothioate (PS) linkages. In certain embodiments, one or more intemucleoside linkage of an oligomeric compound is a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of an oligomeric compound is a phosphorothioate intemucleoside linkage. In certain embodiments, each internucleoside linkage of an oligonucleotide is a phosphorothioate internucleoside linkage.

[0180] Sugar Modifications

[0181] Oligomeric compounds provided herein can contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart desirable features such as increased stability, increased durability (e.g,, increased half-life), increased binding affinity, decreased off-target effects, decreased immunogenicity, decreased toxicity, increased potency, or some other beneficial biological property to the oligomeric compounds. Sugar modifications and their advantages are known in the art (Faria, M., and H. Ulrich, 2008 Sugar boost: when ribose modifications improve oligonucleotide performance. Curr Opin Moi Ther 10: 168-175; Crooke, S. T., et al., 2021b Antisense technology: A review. J Biol Chem 296: 100416; Egli, M,, and M. Manoharan, 2023 Chemistry, structure and function of approved oligonucleotide therapeutics. Nucleic Acids Res 51: 2529-2573).

[0182] In certain embodiments, nucleosides comprise a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings can include, without limitation, addition of substituent groups (e.g., 5’ sugar modifications, or 2’ sugar modifications); bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA); replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R)2 (R ~ H, Ci-Cn alkyl or a protecting group); nucleoside mimetic; and combinations thereof.Examples of chemically modified sugars include, 2'-F-5'-methyl substituted nucleoside (see, e.g., PCT Publication W02008101157 for other disclosed 5', 2'-bis substituted nucleosides), replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see, e.g., U. S, Publication US20050130923), or, alternatively, 5 '-substitution of a BNA (see, PCT Publication W02007134181 wherein LNA is substituted with, for example, a 5'-methyl or a 5'- vinyl group).

[0183] A 2’-modified sugar refers to a furanosyl sugar modified at the 2’ position. A 2’-niodified nucleoside refers to a nucleoside comprising a sugar modified at the 2’ position of a furanose ring, In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2’ modifications are selected from substituents including, but not limited to: O[(CH2)nO]mCH3, O(CH2)nNH2, ()(CH?.)nCH3,, O(CH2)nONH2, OCH2C(=O)N(H)CH3, and O(CFl2)nON[(CH2)nCH3]2, where ri and m are from 1 to about 10. Other 2’- substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, Na, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, and a group for improving the pharmacodynamic properties of an oligomeric compound, and other substituents having similar properties.

[0184] Further examples of nucleosides having modified sugar moieties include, without limitation, nucleosides comprising 5 ’-vinyl, 5’-methyl (R or S), 2’-F-5’-methyl, 4’-S, 2’-deoxy- 2’-fluoro (2’-F), 2’-OCH (2’-O-rnethyl, 2’-OMe), 2’-O(CH )2OCHJ (2’-O-methoxyethyl, 2’-O-MOE, 2’-MOE), 2’-O-methyl-4-pyridine, phosphorodiamidate morpholino (PMO), tricyclo-DNA (tcDNA), 2’-arabino-fluoro, 2’-O-benzyl, glycol nucleic acid (GNA), and / or unlocked nucleic acid (UNA) substituent groups. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, O-allyl, O-OC10 alkyl, OCF3, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(Rn), and O-CH2-C(=O)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl. 2’-OMe or 2 / -OCH3 or 2’-O-methyl each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2’ position of the sugar ring. 2’-F refers to a sugar comprisinga fluoro group at the 2’ position. 2’-O-methoxyethyl or 2’-0-M0E or 2*-M0E each refers to a nucleoside comprising a sugar comprising an -O(CH2)2OCH3 group at the 2’ position of the sugar ring.

[0185] BNAs refer to modified nucleosides comprising a bicyclic sugar moiety wherein a bridge connecting two carbon atoms of the sugar ring connects the 2’ carbon and another carbon of the sugar ring. Examples of bicyclic nucleosides include, without limitation, nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms such as in locked nucleic acid (LNA). In certain embodiments, oligomeric compounds provided herein include one or more bicyclic nucleosides wherein the bridge comprises a 4’ to 2’ bicyclic nucleoside. LNAs and UNAs have been described by Campbell and Wengel (Chem Soc Rev, 2011, 40(12):5680-9) and are incorporated-by-reference herein,

[0186] In certain embodiments, oligomeric compounds comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2’-MOE. In certain embodiments, the modified sugar moiety has a 2’-OMe modification. In certain embodiments, the modified sugar moiety has a 2’-F modification. In certain embodiments, the modified sugar moiety is a cEt.

[0187] Oligomeric Compound Delivery Systems

[0188] Oligomeric compounds require entry into target cells to become active. A variety of modalities have been used to traffic oligomeric compounds into target cells including viral delivery vectors, lipid-based delivery, polymer-based delivery, and conjugate-based delivery (Paunovska et al., Drug Delivery Systems for RNA Therapeutics, 2022, Nature Reviews Genetics, 23(5):265~ 280; Chen et al., 2022, Molecular Therapy, Nucleic Acids, 29: 150- 160).

[0189] Lipid-based particles can form specific structures such as micelles, liposomes and lipid nanoparticles (LNPs) to carry oligomeric compounds into cells. To form these particles, LNPs can include one or more of a cationic or ionizable lipid (e.g., DLin-MC3-DMA, SM-102, or ALC- 0315), cholesterol, a helper lipid, 1,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC), poly(ethylene glycol) (PEG) modified lipid (e.g., PEG-2000-C-DMG, PEG-2000-DMG, or ALC- 0159), Cl 2-200, cKK-E12 and the like. Different combinations of lipids can be formulated to affect the delivery of the oligomeric compound to different types of cells. In one example,therapeutic siRNA patisiran was formulated in cationic ionizable lipid DLin-MC3-DMA, cholesterol, polar phospholipid DSPC, and PEG-2000-C-DMG for delivery to hepatocytes.

[0190] Polymer-based particles are also used in oligomeric compound delivery systems. Such polymers include poly(lactic-co-glycolic acid) (PLGA), polyethylenimine (PEI), poly(l-lysine) (PLL), poly(beta-amino ester) (PBAE), dendrimers (e.g., poly(amidoamine) (PAMAM) or PLL), and other polymers or modified polymers thereof. The polymer composition can be varied depending on the traits desired for delivery of the oligomeric compound.

[0191] The oligomeric compounds disclosed herein may be covalently linked to one or more moieties or conjugate agents which enhance the activity, cellular distribution or cellular uptake of the resulting compound. Conjugate agents can include cholesterols, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, peptides, antibodies, dyes, tocopherol (Nishina et al., 2008, Molecular Therapy, 16(4):734-740), etc. Conjugate-based delivery can actively deliver oligomeric compounds to specific cell types.

[0192] In an example, N-Acetylgalactosamine (GalNAc) is conjugated to an oligomeric compound and delivers the compound into hepatocytes. Various GalNAc conjugate agents can be found in several publications including the following, all of which are incorporated-by-reference herein: Sharma et al,, 2018, Bioconjugate Chem, 29:2478-2488; Nair et al., J. Am. Chem. Soc.

[0193] 2014, 136(49): 16958-16961; Ream, 2022, Drugs, 82:1419-1425; US Patent 10,087,208; Prakash et al., 2014, Nucleic Acids Res, 42(13):8796-8807; Debacker et al., 2020, Molecular Therapy, 28(8):1759-177l; US Patent 11,110,174; US Patent 9,796,756; US Patent 9,181,549; US Patent 10,344,275; US Patent 10,570,169; US Patent 9,506,030; US Patent 7,582,744; and, WO2024137545.

[0194] Oligomeric Compound Synthesis

[0195] Oligomeric compounds were designed, synthesized, and prepared using methods known in the art.

[0196] Solid phase syntheses of oligonucleotides were done on a MerMade™ 48x synthesizer (BioAutomation, LGC, Biosearch Technologies, Hoddesdon, UK), which can make up to 48 IpMole or 5pMole scale oligonucleotides per run using standard phosphoramidite chemistry. Phosphoramidite synthesis of oligonucleotides on a solid support is well known in the art (e.g,,Beaucage and Caruthers, 1981. Tetrahedron Letters, 22(20): 1859-1862; Roy and Caruthers. 2013, Molecules, 18:14268-14284; and Roy and Caruthers et al., 2021, Nature Communications, 12:2760), Solid support is controlled pore glass (500-1400 A) loaded with universal linkers or loaded with 3’-GalNAc conjugates (AM Chemicals, Vista, CA, USA; Primetech ALC, Minsk, Belarus; Gene Link, Elmsford, NY, USA; or any GalNAc conjugate disclosed herein) or universal solid support (AM Chemicals, Vista, CA, USA). Ancillary synthesis reagents and standard 2’- cyanoethyl phosphoramidite monomers (2’ -fluoro nucleosides, 2’-O-methyl nucleosides, RNA nucleosides, DNA nucleosides) were obtained from various sources (Hongene Biotech, Shanghai, China; Sigma-Aldrich, St. Louis, MO, USA; Glen Research, Sterling, VA, USA; ThermoFisher Scientific, Waltham, MA, USA; LGC Biosearch Technologies, Hoddesdon, UK). Phosphoramidite mixtures were prepared in anhydrous acetonitrile or 30% DMF:acetonitrile and were coupled using 0.25M 4,5-dicyanoimidazole(DCI) (Sigma-Aldrich, St. Louis, MO, USA) with coupling times ranging from 120-360 seconds. Standard phosphodiester linkages were achieved using 0.02M iodine mixture in Tetrahydrofuran (THF), pyridine and water. Phosphorothiate linkages were generated using 0.05M sulfurizing Reagent II (3-((Dimethylamino- methylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT) (40:60, Pyridine / Acetonitrile) (LGC Biosearch Technologies, Hoddesdon, UK) with an oxidation time of 6 minutes. All sequences were synthesized with Dimethoxy Trityl (DMT) protecting group removed.

[0197] Upon completion of solid phase synthesis, the oligonucleotides were cleaved from the solid support and deprotection of base labile groups performed by incubation in ammonium hydroxide at 55 °C for 6 hours. Ammonium hydroxide was removed using a centrifugal vacuum concentrator to dryness at room temperature. For sequences containing natural ribonucleotides (2’-OH) protected with tert-butyl dimethyl silyl (TBDMS), a second deprotection was performed using triethylamine; trihydrofluoride (TEA: 3 HF). To each TBDMS protected oligonucleotide 100µL. DMSO and 125µL TEA:3HF were added and incubated at 65°C for 2.5 hours. After incubation, 25µL of 3M sodium acetate was added to the solution which was subsequently precipitated in butanol at -20‘C for 30 minutes. The cloudy solution was centrifuged to a cake at which time the supernatant was carefully decanted with a pipette. The standard precipitation process was then completed with 75% ethanol:water then 100% ethanol as supernatant solutions. The oligonucleotide cake was dried for 30 minutes in a centrifugal vacuum concentrator.Desalting without HPLC purification was performed after precipitation with 3M sodium acetate with a follow on G25 Sephadex® column (Sigma-Aldrich, St. Louis, MO, USA) elution. Purification of oligonucleotides was afforded by anion exchange chromatography on a Gilson GX271 prep HPLC system (Middleton, WI, USA) using BioWorks Q40 resin (Uppsala, Sweden). Final desalt was performed by Sephadex® G25 column. All oligonucleotides were analyzed by ion pairing reverse phase HPLC for purity on an Agilent 1200 analytical HPLC (Santa Clara, CA, USA), negative ion mass spectrometry for intact mass on an Agilent 6130 single quad mass spectrometer (Santa Clara, CA, USA), and A260 quantification by UV / Vis on a Tecan Infinite® M Plex plate reader (Zurich, Switzerland),

[0198] In Vitro Testing of Oligomeric Compounds

[0199] Described herein are methods for treatment of cells with oligomeric compounds such as compounds targeting JAG1.

[0200] Cells may be treated with oligomeric compounds when the cells reach approximately 60- 80% confluency in culture.

[0201] Reagents commonly used to ’introduce oligomeric compounds into cultured cells include the cationic lipid transfection reagent OligofectamineTM2000 or LipofectamineTM2000 (ThermoFisher Scientific, Waltham, MA). In one example, oligomeric compounds may be mixed with OligofectamineTM2000 in OPTI-MEM (ThermoFisher Scientific, Waltham, MA) to achieve the desired final concentration of oligomeric compounds that may range from 0.001 to 300 nM oligomeric compounds in culture medium. Transfection procedures are done according to the manufacturer’s recommended protocols.

[0202] Another technique used to introduce oligomeric compounds into cultured cells includes electroporation.

[0203] Oligomeric compounds conjugated with a delivery moiety can be introduced to cells through incubation of the conjugated compounds with cells without transfection reagents, referenced herein as “free uptake”.

[0204] Cells are treated with oligomeric compounds by routine methods. Cells may be harvested 4 -144 hours after oligomeric compounds treatment, at which time mRNA (harvested at 4-144 hrs) or protein levels (extracted at 24-96 hrs) of target nucleic acids are measured by methods known

[0205]

[0206] in the art and described herein. In general, treatments are performed in multiple replicates, and the data are presented as the average of the replicate treatments plus the standard deviation.

[0207] The concentration of oligomeric compounds used varies from cell line to cell line and target to target. Methods to determine the optimal oligomeric compound concentration for a particular target in a particular cell line are well-known in the art. In general, cells are treated with oligomeric compounds in a dose-dependent manner to allow for the calculation of the half- maximal inhibitory concentration value (IC50). Oligomeric compounds are typically used at concentrations ranging from 0.001 nM to 300 nM when transfected with Oligofectamine™ 2000. Oligomeric compounds are used at higher concentrations ranging from 7.5 to 20,000 nM when transfected using electroporation or free uptake.

[0208] In Vivo Testing of Oligomeric Compounds

[0209] The oligomeric compounds of the invention, for example, compounds targeting, are tested in animals to assess their ability to modulate expression of a target protein and produce phenotypic changes such as a change in one or more markers affected by the target nucleic acid. Also, the phenotypic change can be a decrease in a disease, disorder, condition, or symptom related to the target nucleic acid. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, oligomeric compounds are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline (PBS). Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of dosage and dosing frequency depends upon factors such as route of administration and animal body weight. In one embodiment, following a period of treatment with oligomeric compounds of the invention, RNA encoding the target nucleic acid is isolated from liver tissue and changes in the target nucleic acid expression are measured. Changes in protein levels expressed by the target nucleic acid can also be measured.

[0210] RNA Isolation

[0211] RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA, Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TR1ZOL Reagent (Thermo Fisher Scientific, Waltham, MA), Qiagen RNeasy kit (Qiagen, Hilden, Germany), or AcroPrep Advance 96-well Filter Plates (PallCorporation, Port Washington, New York) using Qiagen’s RLT, RW1 and RPE buffers. RNA extraction procedures are done according to the manufacturer’s recommended protocols.

[0212] Protein Isolation

[0213] Protein analysis can be conducted on total cell extracts or tissue lysates. Methods of cell extracts or tissue lysates are well known in the art. Cellular proteins are prepared using methods well known in the art, for example, using RIP A buffer (ThermoFisher Scientific, Waltham, MA) or other appropriate buffers. Tissue lysates are prepared in RIP A buffer, with tissue homogenizer. Levels of proteins can be analyzed using Western blotting, ELISA, or other approaches.

[0214] Compositions and Methods for Formulating Pharmaceutical Compositions

[0215] The oligomeric compounds of the invention, such as compounds targeting JAG1 described herein, can be combined with pharmaceutically acceptable active or inert substances, such as a diluent, excipient, or carrier, for the preparation of pharmaceutical compositions or formulations.

[0216] Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0217] In certain embodiments, the pharmaceutical carrier or excipient is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more oligomeric compounds to an animal. The excipient can be liquid or solid and can be selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone and / or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates and / or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, and / or sodium acetate, etc.); disintegrants (e.g., starch, and / or sodium starch glycolate, etc.): and wetting agents (e.g., sodium lauryl sulphate, etc.).Pharmaceutically acceptable organic or inorganic excipients, which do not deleteriously react with nucleic acid compounds, suitable for parenteral or non-parenteral administration can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. A pharmaceutically acceptable diluent includes phosphate-buftered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an oligomeric compound and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the oligomeric compound is a JAG1 targeting compound.

[0218] Pharmaceutical compositions comprising oligomeric compounds such as compounds targeting JAG1 can encompass any pharmaceutically acceptable salts, esters, or salts of such esters, which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0219] In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, and / or intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer (e.g., PBS). In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.

[0220] Dosages

[0221]

[0222] For purposes of the disclosure, the amount or dose of the active agent (i.e., oligomeric compound of the invention) administered should be sufficient to e.g., modulate the expression of a target protein in an animal. In the animal (e.g., human), dose will be determined by the efficacy of the particular active agent and the condition of the animal, as well as the body weight of the animal to be treated.

[0223] Many assays for determining an administered dose are known in the art.

[0224] The dose of the active agent of the present disclosure also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular active agent of the present disclosure. Typically, the attending physician will decide the dosage of the active agent of the present disclosure with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, active agent of the present disclosure to be administered, route of administration, and the severity of the condition being treated.

[0225] Dosing

[0226] In certain embodiments, pharmaceutical compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect. The desired effect can be, for example, reduction of a target nucleic acid or the prevention, reduction, amelioration or slowing the progression of a disease, disorder and / or condition, or symptom thereof, associated with the target nucleic acid. In certain embodiments, the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject. " Concentration of pharmaceutical composition" as used with regard to dose regimen can refer to the oligomeric compound or active ingredient of the pharmaceutical composition. For example, in certain embodiments, dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect.

[0227] Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism. In certain embodiments, dosage is from about 0.01 pg to 50 mg per kg of body weight, 0.01 ug to 100 mg per kg of body weight, or within a range of abou t 0.001 mg to 1000 mg dosing,and may be given once or more daily, weekly, monthly, quarterly or yearly, or even once every 2 to 20 years. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligomeric compound is administered in maintenance doses, ranging from about 0,01 pg to 100 mg per kg of body weight, once or more daily, once or more weekly, once or more monthly, once or more quarterly, once or more yearly, to once every 20 years or ranging from about 0.001 mg to 1000 mg dosing. In certain embodiments, it may be desirable to administer the oligomeric compound from at most once daily, once weekly, once monthly, once quarterly, once yearly, once every two years, once every three years, once every four years, once every five years, once every ten years, to once every 20 years.

[0228] In certain embodiments, the range of dosing is between any of about 1mg-1500mg, lOOmg- 1400mg, 100mg-1300mg, lOOmg-lSOOmg, 10()mg-l lOOmg, l()()mg-1000mg, 100mg-900mg, 200mg-800mg, 300mg-700mg, 400mg-600mg, 100mg-400mg. 200mg~500mg, 300mg-600mg, and 400mg-700mg. In certain embodiments, a dose is about lOOmg, 150mg, 200mg, 250mg, 300mg, 350mg, 400mg, 450mg, 500mg, 550mg, 600mg, 650mg, 700mg, 800mg, 850mg, 900mg, 950mg, lOOOmg, 1050mg, 1 lOOmg, 1150mg, 1200mg, 1250mg, 1300mg, 1350mg, 1400mg, 1450mg, or 1500mg.

[0229] In certain embodiments, the oligomeric compound is dosed at any of about 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, or 900mg twice a year. In certain embodiments, the oligomeric compound is dosed at about 100 mg, 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, or 900mg quarterly. In certain embodiments, the oligomeric compound is dosed at about 50mg, lOOmg, 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, or 900mg once monthly or every two months. In certain embodiments, the oligomeric compound is dosed at about 10mg, 15mg, 20mg 25mg, 50mg, lOOmg, 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, or 900mg weekly or every two weeks.

[0230] Administration

[0231] The oligomeric compounds, such as an antisense compound targeting JAG1, or pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be oral, inhaled or parenteral.In certain embodiments, the compounds and compositions as described herein are administered parenterally. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump.

[0232] In certain embodiments, parenteral administration is by injection. The injection can be delivered with a syringe or a pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue or organ.

[0233] In certain embodiments, formulations for parenteral, intrathecal or intraventricular administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0234] In certain embodiments, formulations for oral administration of the compounds or compositions can include, but is not limited to, pharmaceutical carriers, excipients, powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In certain embodiments, oral formulations are those in which compounds provided herein are administered in conjunction with one or more penetration enhancers, surfactants and chelators.

[0235] Kits of the Invention

[0236] According to another aspect of the invention, kits are provided. Kits according to the invention include package(s) comprising any of the compositions of the invention or oligomeric compound of the invention. In various aspects, the kit comprises any of the compositions of the invention as a unit dose. For purposes herein “unit dose” refers to a discrete amount dispersed in a suitable carrier.

[0237] The phrase "package" means any vessel containing compositions presented herein. In preferred embodiments, the package can be a box or wrapping. Packaging materials for use in packaging pharmaceutical products are well known to those of skill in the art. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes,inhalers, pumps, bags, vials, containers, syringes (including pre-filled syringes), bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.

[0238] The kit can also contain items that are not contained within the package but are attached to the outside of the package, for example, pipettes.

[0239] Kits may optionally contain instructions for administering compositions of the present invention to a subject having a condition in need of treatment, Kits may also comprise instructions for approved uses of components of the composition herein by regulatory agencies, such as the United States Food and Drug Administration. Kits may optionally contain labeling or product inserts for the present compositions, The package(s) and / or any product insert(s) may themselves be approved by regulatory agencies, The kits can include compositions in the solid phase or in a liquid phase (such as buffers provided) in a package. The kits also can include buffers for preparing solutions for conducting the methods, and pipettes for transferring liquids from one container to another.

[0240] The kit may optionally also contain one or more other compositions for use in combination therapies as described herein. In certain embodiments, the package(s) is a container for any of the means for administration such as intravitreal delivery, intraocular delivery, intratumoral delivery, peritumoral delivery, intraperitoneal delivery, intrathecal delivery, intramuscular injection, subcutaneous injection, intravenous delivery, intra-arterial delivery, intraventricular delivery, intrasternal delivery, intracranial delivery, or intradermal injection.

[0241] Methods of Use ■.

[0242] The invention provides methods for enhancing the expression of a target protein in a subject comprising administering an effective amount of an oligomeric compound of the invention or a pharmaceutical composition of the invention, so as to increase the expression of a target protein in the subject. In certain embodiments, the oligomeric compound is a JAG1 targeting compound.

[0243] The invention provides methods for enhancing the expression of a target protein in a eukaryotic cell or a prokaryotic cell comprising administering an effective amount of an oligomeric compound of the invention or a pharmaceutical composition of the invention, so as to increase the expression of a target protein in the subject. In certain embodiments, the oligomeric compound isa JAG1 compound. In certain embodiments, eukaryotic ceil or a prokaryotic cell is a mammalian cell, a plant cell, a yeast cell or a bacteria cell.

[0244] In certain embodiments, a method of enhancing a target gene expression in a ceil comprises administering to the cell an oligomeric compound targeted to an mRNA transcript. In an embodiment, the oligomeric compound is a JAG1 compound.

[0245] In certain embodiments, an oligomeric compound of the invention increases expression of a protein by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In an embodiment, the oligomeric compound is a JAG1 compound.

[0246] In certain embodiments, a method of enhancing JAG 1 gene expression in a cell comprises administering to the cell an oligomeric compound targeted to a JAG1 mRNA transcript (GenBank Accession No: NM_000214.3, SEQ ID NO: 1). In certain embodiments, enhancing JAG1 gene expression in a cell treats a subject suffering from a JAG 1 related disease. In certain embodiments, the JAG1 related disease is related to a decreased level of JAG1 protein. In one embodiment, the JAG1 related disease is haploinsufficiency of the JAG1 protein. In a preferred embodiment, the JAG1 related disease is Alagille Syndrome (ALGS).

[0247] In some embodiments of the present disclosure, the subject is a mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits, mammals from the order Carnivora, including Felines (cats) and Canines (dogs), mammals from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perissodactyla, including Equines (horses). In some aspects, the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). In a preferred aspect, the mammal is a human.

[0248] In Vivo Testing of JAG I Enhancing Compounds

[0249] In some embodiments of the present disclosure, JAG1 compounds can be tested in subjects to assess their ability to enhance expression of a protein. In certain embodiments, JAG1 compounds can be tested in subjects to assess their ability to increase mRNA translation in order to increase protein production and / or produce phenotypic changes related to that protein. In certain embodiments, JAG1 compounds can be tested in subjects to assess their ability to treat a disease such as ALGS associated with the protein. Testing may be performed in normal subjects, or inexperimental disease models. For administration to subjects, JAG! compounds are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of JAG 1 compound dosage and dosing frequency depends upon factors such as route of administration and subjects body weight. In one embodiment, following a period of treatment with a JAG1 compound, the protein is isolated from a tissue and changes in protein expression are measured.

[0250] In Vitro Assay to Identify Compounds Targeting JAG1 for Enhancing Protein Expression

[0251] In some embodiments of the present disclosure, in vitro assays to identify compounds targeting JAG1 for enhancing target protein expression are provided.

[0252] In one example, a test mRNA is chosen as a target to upregulate its protein expression. Cells in culture (e.g., HeLa, Hepal-6, or HEK293), are seeded and grown in one day to -70% confluency. The cells are then transfected with the compounds targeting JAG1 of interest at about 7.5 nM or 15 nM final concentrations using Lipofectamine5M2000 Transfection Reagent (ThermoFisher Scientific, Waltham, MA), or are mock transfected as a control. Twenty-four (24) hr after transfection, cells are harvested and lysed, then the protein is extracted using RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, Waltham, MA). The level of target protein can be determined by Western Blot or chemiluminescence, using a target protein specific antibody and optionally, a secondary antibody conjugated to either alkaline phosphatase or horse radish peroxidase. Western Blot images can be quantified using Image! (an open source software for processing and analyzing scientific images), and the results are quantified as percent protein levels relative to mock transfected cells following normalization to a loading control protein such as GAPDH. As the control protein is not targeted by the compounds targeting JAG1 tested in the assay, the level of the control protein is not affected, showing the specificity of the compounds targeting JAG1 in modulating target protein levels.

[0253] EXAMPLES

[0254] Non-limiting disclosure and incorporation- by-referenceWhile certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is herein inc-orporated-by-reference in its entirety.

[0255] The following applies to all modified sequences disclosed herein.

[0256] A notation is made before or after each nucleoside indicating the type of chemical modification, if any, made to the nucleoside. If no modification notation is made before or after a letter designating a nucleoside, the nucleoside is a deoxyribonucleoside. Notations for the chemical modifications to the compounds can be found as follows:

[0257] » “(5p)” before a nucleoside refers to a 5 ’-phosphate

[0258] ® “r” before a nucleoside refers to a ribonucleoside (ribonucleoside which has been substituted for a deoxyribonucleoside)

[0259] « “d” (or no notation made before or after a nucleoside) before a nucleoside refers to a deoxyribonucleoside

[0260] • “f” before a nucleoside refers to a 2’-fluoro (also known as 2’-F) sugar modification * “m” before a nucleoside refers to a 2’-OCHj (also known as 2’-O-methyl or 2’-0Me) modification

[0261] • “*[mCL]” specifically denotes an LNA 5-methyl cytidine 5 '-thiophosphate

[0262] • “e” before a nucleoside refers to a 2’-O(CH2)2OCHJ (also known as 2’-O- methoxyethyl, 2’-0-M0E or 2’-M0E) modification (e.g., eG)

[0263] • “eCm” refers to a 2’-0~M0E modified 5-methylcytidine

[0264] • refers to a phosphorothioate (PS) linkage which has been substituted for a phosphate (PO) linkage

[0265] • “gna” before a nucleoside refers to a glycol nucleic acid modification

[0266] • “L” after a nucleoside refers to a locked nucleic acid (LNA) modification of the nucleoside (e.g., GL)

[0267] • “AN-Gal Ac” is a GalNAc moiety described in WO2024137545.

[0268] If more than one sequence is disclosed in one row of the tables, the SEQ ID NO applies to the modified sequence (“Sequence + Chemistry”).EXAMPLE 1. ASOs Targeting Human JAG1 mRNA Increase > UG1 Protein Levels in HEK293 Cells

[0269] Antisense oligonucleotides (ASOs) were designed to base-pair with different regions of the 5’ UTR or 3’ UTR of human JAG1 mRNA (GenBank Accession No: NM.000214.3; SEQ ID NO: 1). It has previously been shown that ASOs can increase protein levels by targeting upstream open reading frames (uORFs) or structural inhibitory elements (Liang el al., 2016, Nat Biotechnol 34: 875-880; Liang et at, 2017, Nucleic Acids Res 45: 9528-9546; Wang, 2011, Methods Mol Biol 676: 43-49), To investigate whether JAG1 protein can be increased in cells, some ASOs were designed to target a putative structural region (ATXL098, ATXL099) or a putative uORF region (ATXL100. ATXL101) in the 5’ UTR, Other ASOs were designed to target miR-153 (ATXL102), miR-26 (ATXL103), or miR-124 (ATXL104) binding sites in the 3’ UTR. These ASOs are linked with phosphodiester (PO) backbones, are fully modified with 2’-O-methyl (Me) and do not trigger RNase H cleavage, as shown in Table 1,

[0270] Table 1. Sequence and Chemistry of ASOs Targeting JAG1 to Increase Protein Levels JAG1 ASO

[0271] Sequence and Chemistry Sequence SEQ ID ASO ID Targeting

[0272] (5’ to 3’) (5’ to 3’) NO Design

[0273] ATXL098 mGmCmCmCmGmCmCmC structural GCCCGCCCGGC

[0274] mGmGmCmUm CmUinCmG region in the 5’ 2 UCUCG UTR AT. Xl.v99 mCm U m Am GmCmll mCmG structural CUAGCUCGCGG

[0275] mCmGmGmGmCmCmGmG region in the 5’ 3 GCCGG UTR ATXIJ00 mCmAmUmGmCmAmCmG CAUGCACGACU uORF region

[0276] 4 mAmCmUmGmGmAmAmA GGAAA in 5 ’ UTR ATXL101 mCmU m CmCmGmCmCmG CUCCGCCGAUU uORF region

[0277] 5 mAmUmUmGmGnvhnGmC GGAGC in 5’ UTR ATXL102 mUmUmUmGmCmAmUrnA

[0278] UUUGCAUAGC miR-153 in 3’ niGmCmUmGmUmGmAmG 6 UGUGAGAU UTR

[0279] mAmU

[0280] ATXL103 mGmGmUmUmCmAmAfflG

[0281] GGUUCAAGUA miR-26 in 3’

[0282] mU m AmU mUmCmAmAmC 7 UUCAACUA UTR

[0283] mlJmA

[0284] ATXL104 mAmGrnCrnUmGmCmAmA

[0285] AGCUGCAAAG miR-124 in 3’ mAmGmGmCmAmCmUmU 8 GCACUUUC UTR

[0286]

[0287] mUmCASOs targeting the mRNA of JAG 1, described in Table 1, were assessed in human kidney cells HEK293 for their ability to increase JAGl protein expression.

[0288] In Vitro Assay - Protein Assessment at 24 Hrs Post Transfection

[0289] HEK293 ceils (ATCC, Manassas, VA, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented 'with 10% fetal bovine serum (FBS), 0.1 pg / ml streptomycin and 100 units / ml penicillin in a 37°C incubator with 5% CO?.. The cells, seeded and grown in one day to -70% confluency, were transfected with the compounds listed in Table I at 15 nM final concentration for the ASOs targeting the 5’ UTR, 5 nM for the ASGs targeting the miRNA binding sites in the 3’ UTR or mock transfected as a control using 4 ug / ml LipofectamineF M2000 Transfection Reagent (ThermoFisher Scientific, Wallham, MA, USA) in Opti~MEM medium (Life Technologies. Carlsbad, CA, USA) based on manufacturer’s instructions. A commercially available siRNA targeting JAGl (ThermoFisher Scientific, Waltham, MA, USA; Catalog #146914), JAGl-si, was used as a control to determine whether JAG1 expression modulation could be detected by JAGl antibody in this assay. For the JAGl siRNA, transfection was performed using 6 i / ml LipofectamineTM RNAiMax (ThermoFisher Scientific, Waltham, MA, USA) in Opti-MEM medium (Life Technologies, Carlsbad, CA, USA).

[0290] Twenty-four (24) hrs after transfection, cells were harvested and the protein was extracted using RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, Waltham, MA, USA). The level of JAGl protein was determined by Western Blotting the extracted proteins and probing the Western Blot using a JAGl protein antibody (Abeam, Cambridge, UK; Catalog #abl 09536). The Western blotting result is shown in Figure LA, The Western Blot image was quantified using ImageJ, and the results are shown in Table 2 as percent protein levels relative to mock transfected cells following normalization to a non-specific band (marked with * in Figure 1A) detected by the same JAGl antibody.

[0291] Table 2. JAGl Protein Levels in Cells Treated with Different Compounds Compound 1 JAGl Protein (%)

[0292] Mock 100.0

[0293] . ATXL098 | 125.4;

[0294]

[0295] . ATX L099r130.2

[0296] - 1 - 1

[0297] ATXL100 122.4

[0298] ATXL101 H4A

[0299] . ATXL102. 93

[0300] . A IX LI 03 |. 1053

[0301] . ATXLJ04.. 1313.

[0302] |. JAGl-si. i. 62 / 7.

[0303] |

[0304]

[0305] . 1.

[0306] The results (Figure I A) showed that transfection of several ASOs increased JAG1 protein level by over 20%, including 5' UTR targeting ASOs (ATXL098, ATXL099, and ATXL100), and an ASO targeting miR-124 site (ATXL104). Also, a reduced JAG1 protein level was detected in cells treated with a JAG1 specific siRNA as expected, supporting that the JAG1 antibody can specifically detect the JAG I protein.

[0307] b Vitro Assay - mA’A'd Assessment

[0308] To determine if the JAGl compounds shown to increase protein levels also affect JAG1 mRNA levels, total RNA was isolated from the transfected HEK293 cells described above. Total RNA was prepared using Qiagen's RNeasy kit (Qiagen, Hilden, Germany) and the level of JAGl mRNA was determined using quantitative real-time PCR (qRT-PCR), using a human JAGl specific primer probe set (Table 3). qRT-PCR was performed using AgPath-ID™ One-Step RT- PCR Reagents in QS3 real-time PCR system (ThermoFisher Scientific, Waltham, MA). The qRT-PCR results were quantified using QuantStudio Design and Analysis Desktop Software VI.5.2. The JAGl mRNA levels detected in qRT-PCR assay were normalized to the mRNA of GAPDH detected in the aliquots of the corresponding RNA samples. The JAGl mRNA levels in ASO transfected cells relative to JAGl mRNA levels in mock transfected cells are shown in Figure IB and Table 4,

[0309] Table 3: Sequences

[0310]

[0311] ler Probe Set for Human JAG 1 and Human / Mouse GAPDH Name Sequence (5’ to 3’) 1. SEQ ID NO hJAGl Forward GCAACACCTTCAACCTCAA > r. 35 -.

[0312] U XC Reverse

[0313]

[0314] CAA(kiAAC(iTATA(iGACCl';CG' I 36hJAGl Probe CCAGGCGAAACTGAAAGGCAGC 37 hGAPDH forward.. 38. LGAPD11 Re* ercc AATGAGCCCCAGCCTTCTC 39 hGAPDH Probe CCAGCATCGCCCCACTTGATTfT 40 mGAPDH Forward GTGAACCACGAGAAATATGACAAC 41 mGAPDH Reverse AG I G A'l GuCA IX IGACI C IG..

[0315]

[0316] mGAPDH Probe CAACTTT

[0317] The results (Figure IB) showed that the uORF targeting ASO ATXL100 did not alter the mRNA level, although it increased the protein level, ATXL 104, the ASO targeting miR-124 binding site, substantially increased JAG 1 mRNA level. ATXL098 and ATXL099 also modestly increased JAG1 mRNA levels. ATXL 101 and ATXL 102 do not substantially affect the protein and mRNA levels. It is possible that these two predicted miRNAs may not be involved in regulation of JAG I expression in these cells.

[0318] In Vitro Assay - Protein Assessment Dose Response at 36 Hrs Post Transfection

[0319] A dose response study was performed to evaluate ASOs ATXL 100 and ATXL 104 that had previously been described. The ASOs were transfected into HEK293 cells (as described supra) at different concentrations and JAG1 protein levels were determined by Western Blot analysis 36 hrs post transfection (Figure 2). The Western Blot image was quantified using Imaged, and the results are shown in 'fable 4 as percent protein levels relative to mock transfected cells following normalization to GAPDH protein levels detected by a GAPDH antibody (Sigma-Aldrich, St. Louis, MO, USA; Catalog # G8795).

[0320] Table 4. JAG1 Protein Levels in Cells Treated with ATXL100 or ATXL 104 Compound | Concentration (nM) I JAGI Protein (%)

[0321] | 0 | 100

[0322] 15 i 112.2

[0323] ATX LI 00 L _ _ i _

[0324] 30 1 120.1

[0325] 60 1 100.8

[0326] o i loo

[0327] ATXL 104 I. j.

[0328] 5 1 169.4I J623.

[0329]

[0330] A modest increase was observed for ATXL100 after transfection with 15 and 30 nM, but, no obvious increase was detected at a higher concentration. A greater increase of JAG 1 protein levels was detected for ATXL104 at all three concentrations. The results support that these two ASOs can reproducibly increase JAG1 protein level in HEK293 cells, though the optimal concentration could be different for each ASO depending on the ASO sequence and mRNA target.

[0331] EXAMPLE 2. ASOs Targeting JAG1 mRNA Increase JAG1 Protein Levels in ALGS Patient Fibroblast Cells

[0332] To determine if the ASOs can increase JAG1 protein in a disease setting, ATXL100, ATXL104, and two newly desigped ASOs, ATXL186a and ATXL187a that target predicted additional miR-124 binding sites were transfected into GM05759 fibroblast cells, which were derived from an ALGS patient and contain a heterozygous mutation (Zhu el al., 2021, Siem Cell Res 53: 102366).

[0333] Table 5. Sequence and Chemistry of ASOs Targeting JAG1 mRNA

[0334] JAG1 ASO

[0335] Sequence and Chemistry Sequence SEQ ID ASO ID Targeting

[0336] (5’ to 3’) (5’ to 3’) NO Design mCmAmUmGmCmAmCmG

[0337] CAUGCACGACU uORF region ATXL100 mAmCmUmGmGmAmAmA 4 GGAAA in 5’ UTR mAmGmCmUmGmCmAmA

[0338] mAmGmGmCmAmCmUmU AGCUGCAAAG miR-124 in 3’ ATXL104 8 mUmC GCACUUUC UTR

[0339] mGmUmUmUmUmAmAmG

[0340] GUUUUAAGGC miR-124 in 3’ ATXL186a mGmCmUmCm UmUmGmA 9 UCUUGAUU UTR

[0341] mUmU

[0342]

[0343] | mCm AmCmU mUmAm AmG

[0344] CACUUAAGGC miR-124 in 3’ ATXL187a 1 mGmCmAmGmGmCmAmG

[0345] AGGCAGUG UTR

[0346]

[0347] j mUmG

[0348]

[0349] Patient-derived fibroblast cells, GM05759 (Coriell Institute for Medical Research. Camden, NJ, USA) were cultured in Eagle’s Minimum Essential Medium with Earle’s salts and non-essential amino acids with 2;raM L-glutamine, supplemented with 15% FBS, in a 37°C incubator with 5% CO2. The cells, seeded and grown in one day to -70% confluency, were transfected with ASOs ATXL100 (15 nM), ATXL104 (5 nM), ATXL186a (5 nM), and ATXL187a (5 nM) or mock transfected as a control using 4,g / ml Lipofectaminef M2000 Transfection Reagent (ThermoFisher Scientific, Waltham, MA, USA) in Opti-MEM medium (Life Technologies, Carlsbad, CA, USA) based on manufacturer’s instructions.

[0350] Twenty-four (24) hrs after transfection, cells were harvested and the protein was extracted using RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, Waltham, MA, USA). The level of JAG 1 protein was determined by Western Blotting the extracted proteins and probing the Western Blot using a JAG1 protein antibody (Abeam, Cambridge, UK; Catalog #abl 09536). The Western blotting result is shown in Figure 3. The Western Blot image was quantified using ImageJ, and the results are shown in Table 6 as percent protein levels relative to mock transfected cells following normalization to GAPDH protein levels detected by a GAPDH antibody (Sigma- Aldrich, St. Louis, MO, USA; Catalog & G8795).

[0351] Table 6, JAG1 Protein Levels in GM05759 Cells Treated with ASOs Compound JAG1 Protein (%)

[0352] Mock 100.0

[0353] ATXL100 161.6

[0354] ATX 1.101 157.7

[0355] ATXL186a 111

[0356] ATXL187a 138.9

[0357]

[0358] Western Blot analysis (Figure 3, Table 6) showed that, 24 hr after ASO transfection, both ATXL100 and ATXL104 increased JAG1 protein levels in ALGS patient cells by over 50%. One

[0359]

[0360] of the new ASOs (ATXL187a) also substantially increased JAG1 protein level, supporting that miR-124 may modulate JAG1 expression in these cells by binding to more than one site in JAG1 mRNA. Together, these results indicate that ASOs targeting different regions of JAG 1 mRNA can increase the protein level in both normal cell lines and in ALGS patient cells.

[0361] EXAMPLE 3, ASOs Targeting Human JAG1 mRNA Increase JAG1 Protein Levels in HEK293 Cells and HeLa Cells

[0362] Additional ASOs were designed with enhanced features to increase JAG1 expression. 2 ’-O-methy oxyethyl (MOE) and internucleoside phosphorothioate (PS) linkages modifications were introduced into ASOs to improve ASO stability and proper delivery to target tissues and cells (Table 7). Since ATXL100, a 16-mer ASO described in Examples 1-2, only modestly increased JAG1 protein level in HEK293 cells, an 18-mer PS-MOE ASO, ATXL212, was designed based on the ATXL 100 target site, with a slight shift towards upstream. For ASO ATXL 104 described in Examples 1-2, a PS-MOE modified ASO was designed using the same sequence and named as ATXL2I3. To compensate for the potential reduction of binding affinity due to the PS modification, two locked nucleic acids (LNA) were introduced at the 3’ end of ATXL213.

[0363] To further determine the effects of changes in length and modification on ASO activity and to optimize ASO performance of uORF targeting ASOs, four new ASOs (ATXL 247-ATXL250) were designed based on ATXL212, with different lengths and / or with LNA modification at the last two nucleotides of the ASOs (Table 7).

[0364] Table 7. Sequence and Chemistry of ASOs Targeting JAG I niRNA

[0365] JAG1 ASO

[0366] Sequence and Chemistry Sequence SEQ ID ASO ID Targeting

[0367] (S’ to 3’) (5’ to 3’) NO Design mCmAmUmGmCmAmCmG CAUGCACGACU uORF region ATXL 100 4 mAmCmUmGmGmAmAmA GGAAA. in 5’ UTR mAmGmCmUmGmCmAmA

[0368] AGCUGCAAAG miR-124 in 3’

[0369] ATXL 104 mAmGmGmCmAmCmUmU 8 GCACUUUC UTR

[0370] mUmC

[0371]

[0372] eT*eG*eCm*eA*eCm*eG*e

[0373] TGCACGACTGG uORF region ATXL2I2 A * eCm * eT* eG* eG * e A* e A * 11 AAAACAA in 5’ UTR

[0374] e A* e A * eCm * e A * e A

[0375] e A* eG * eCm* eT* eG* eCm * e

[0376] AGCTGCAAAGG mi R- 124 in 3’ ATXL213 A*eA*eA*eG*eG*eCm*eA* 12 CACTTTC UTR

[0377] eCm*eT*eT*TL*CL

[0378] eCm* e A *eT* eG* eG* eA*eG

[0379] CATGGAGGCGG Does Not ATXL235 *eG*eCm*eG*eG*eCm*eT* 13 CTTGAG Target JAG1 eT*eG*eA*eG

[0380] eT*eG* eCm *e A *eCm * eG* e

[0381] TGCACGACTGG uORF region ATXL247 A*eCm*eT*eG*eG*ezVcA* 14 AAAAC in 5’ UTR eA*eA*eCm

[0382] eT* eG * eCm * e A *eCm * eG*e

[0383] TGCACGACTGG uORF region ATXL248 A* eCm * eT * eG* eG* e A* e A * 15 AAAAC in 5' UTR eA*AL*CL

[0384] eT*eG*eCm*eA*eCm*eG*e

[0385] TGCACGACTGG uORF region ATXL249 A * eC m * eT * eG * eG *e A * e A * 16 AAAACAA in 5’ UTR

[0386] e A* e A* eCm* AL * AL

[0387] eT*eG*eCm*eA*eCm*eG*e

[0388] A*eCm*eT*eG*eG*eA*eA* TGCACGACTGG uORF region ATXL250 17 eA*eA*eCm*eA*eA*eCm*e AAAACAACA in 5’ UTR A

[0389]

[0390] / n Vitro Assay -- Protein Assessment Dose Response in HEK293 Cells 24 Hrs Post Transfection

[0391] A dose response study was performed to evaluate ASOs ATXL212 and ATXL213. The ASOs were transfected into HEK293 cells (as described supra) at different concentrations and JAG1 protein levels were determined by Western Biot analysis 24 hrs post transfection (Figure 4). The Western Blot image was quantified using Image!, and the results are shown in 'fable 8 as percent protein levels relative to mock transfected ceils following normalization to GAPDH protein levels detected by a GAPDH antibody (Sigma-Aldrich, St. Louis, MO, USA; Catalog # G8795).

[0392] Table 8. JAG1 Protein Levels in Cells Treated with ATXL212 or ATXL213 Compound Concentration (nM) JAG1 Protein (%) ATXL212 0 100

[0393]

[0394] TTo

[0395] 20143.7

[0396] 1 40 95.5

[0397] 1 0 100

[0398] 1 10 97.5

[0399] [ 20 103.5

[0400] t..

[0401] 1 40 87.7

[0402]

[0403] ....:

[0404] The Western Blot results showed that ATXL212 increased the JAG1 protein level by around 44% (Figure 4, Table 8), supporting a better activity than ATXL100, which increased the protein by around 22% under similar conditions (Figures 1-2). However, the PS-MOE / LNA modified ATXL213 did not increase JAG1 protein, unlike the case of PO-Me modified ATXL104, supporting that chemical modifications can decrease the activity of this ASO, possibly due to reduced binding affinity since each PS modification may reduce Tm by approximately 0.5°C.

[0405] In Vitro Assay -• Protein Assessment al 24 Hrs Post Transfection in HEK.293 and HeLa Cells ASOs targeting the uORF region in the 5’ UTR were transfected at 15 nM final concentration into HEK293 or HeLa cells.

[0406] HEK.293 and HeLa cells (ATCC, Manassas, VA, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 0.1 pg / ml streptomycin and 100 units / ml penicillin in a 37°C incubator with 5% COz. The cells, seeded and grown in one day to -70% confluency, were transfected with the compounds listed in Table 7 at 15 nM final concentration for the ASOs targeting the 5’ UTR or mock transfected as a control using 4 pg / ml LipofectamineTM2000 Transfection Reagent (ThermoFisher Scientific, Waltham, MA, USA) in Opti-MEM medium (Life Technologies, Carlsbad, CA, USA) based on manufacturer’ s instructions.

[0407] Twenty-four (24) hrs after transfection, cells were harvested and the protein was extracted using RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, Waltham, MA, USA). The level of JAG1 protein was determined by Western Blotting the extracted proteins and probing the Western Blot using a JAG1 protein antibody (Abeam, Cambridge, UK; Catalog #abt 09536). The

[0408]

[0409] Western blotting result is shown in Figure 5. The Western Blot image was quantified using ImageJ, and the results are shown in Table 9 as percent protein levels relative to mock transfected cells following normalization to GAPDH protein levels detected by a GAPDH antibody (Sigma- Aldrich, St. Louis, MO, USA; Catalog # G8795).

[0410] Table 9. JAGS Protein Levels in HEK293 or HeLa Cells Treated with ASOs Cell Type Compound JAG1 Protein (%)

[0411] Mock 100.0

[0412] ATXL250

[0413] ATXL249 106.8

[0414] HEK293

[0415] ATXL248 125.6

[0416] ATXL247 130.2

[0417] ATXL212 124.9

[0418] Mock 100.0

[0419] ATXL250 177.7

[0420] ATXL249 254.1

[0421] HeLa

[0422] ATXL248 264.4

[0423] ATXL247 316.9

[0424] ATXL212 413.1

[0425]

[0426] Western Blot results showed that ATXL212 increased JAG1 protein levels in both cell types (Figure 5, Table 9). Increasing the length of the ASO to 20 nucleotides (ATXL250), or introducing two LNA at the 3’ end of a 18-mer ASO (ATXL249), did not enhance ASO activity. However, the 16-mer ASOs, ATXL247 and ATXL248, have similar activity in increasing JAG1 protein level, compared with ATXL212. A similar trend was observed in both HEK293 and HeLa cells although a greater increase was detected in HeLa cells. Together, these results support that proper length and chemistry of ASOs are needed to achieve a better activity in increasing protein levels.

[0427] In Vitro Assay - Protein Assessment Dose Response in HeLa Cells 24 Hrs Post TransfectionA dose response study was performed in He La to evaluate ASO ATXL212 and a shorter version shorter ASO, ATXL247. The ASOs were transfected into HeLa cells (as described supra) at different concentrations and JAG1 protein levels were determined by Western Blot analysis 24 hrs post transfection (Figure 6). The Western Blot image was quantified using Imaged, and the results are shown in Table 10 as percent protein levels relative to mock transfected ceils following normalization to GAPDII protein levels detected by a GAPDH antibody (Sigma- Aldrich, St. Louis, MO, USA; Catalog # G8795).

[0428] Table 10. JAG1 Protein Levels in Cells Treated with ATXL212 or ATXL247

[0429] Compound Concentration (nM) JAGl Protein (%)

[0430] 0

[0431] 0

[0432] 5 112.2

[0433] 10 127.3

[0434] ATXL212

[0435] . 20 145.5

[0436] 40 153.6

[0437] 80 115.6

[0438] —.

[0439] 0 100

[0440] 5 164.2

[0441] 10 162.3

[0442] ATXL247

[0443] 20 148.8

[0444] 40 105.9

[0445] . 80. 62.6

[0446]

[0447] The results showed that, for ATXL212, a bcll-shapcd dose response was observed, with a better increase at concentrations 20 and 40 nM (Figure 6). ATXL247 showed a better activity at lower concentrations (5 to 20 nM), supporting that the optimal concentration may vary for different ASO designs. Altogether, these results indicate that the uORF targeting ASOs with PS and MOE modifications can increase JAG1 protein levels in different cell types, and that ATXL212 and ATXL247 appear more active than other tested ASOs in vitro.EXAMPLE 4, A GalNAc Conjugated uORF ASO Increased JAG1 Protein Levels in Cells

[0448] Previous examples showed that ASOs targeting the uORF of JAG1 can increase JAG1 protein expression in vitro via transfection of the ASOs into cells. The ability to increase JAG1 protein levels in vivo is an important step towards potential therapeutic application. In order to facilitate in vivo delivery of ASO to the liver where JAG1 is produced, new ASOs were designed utilizing the sequence and chemistry of ASOs, previously described herein, with the addition of a GalNAc moiety conjugated to the ASO (AN-GalNAc described in US Patent 12,247,047 or GL- GalNAc described in Sharma et al., 2018, Bioconjugate Chem, 29:2478-2488),

[0449] Table 1 1. Sequence and Chemistry of GalNAc Conjugated ASOs Targeting JAG1 mRNA New Old JAG1 ASO SEQ Sequence and Chemistry Sequence

[0450] ASO ASO Targeting ID (55to 3’) (S’ to 3’)

[0451] ID ID Design NO eT*eG*eCm*eA*eCm*eG*eA

[0452] ATXL ATXL TGCACGACTGGA uORF region

[0453] * e C m * e T * e G * e G * e A * e A * e A * 11 233 212 AAACAA in 5’ UTR

[0454] e A * eCm* e A * eA (AN-GalN Ac)

[0455] eT*eG*eCm*eA*eCm*cT*eG*

[0456] ATXL TGCACTGACGGA Does Not Na e A * eCm * eG * eG* e A * e A * eT * e 18 245 ATACAA Target JAG1

[0457] A*cCm*eA*eA(GL-GalNAc)

[0458] eT*eG*eCm*eA*eCm*eG*eA

[0459] ATXL ATXL TGCACGACTGGA uORF region *eCm*eT*eG*eG*eA*eA*eA* 14 252 247 AAAC in 5’ UTR

[0460] e A * eCm( AN-GalN Ac)

[0461]

[0462] In Vitro Assay - Protein Assessment in HeLa Cells 24 Hrs Post Transfection

[0463] ATXL233 was initially evaluated in vitro by transfection at different concentrations into Hela ceils to confirm that GalNAc conjugation did not interfere with ASO activity.

[0464] The ASOs were transfected into HeLa cells (as described supra) at different concentrations and JAG1 protein levels were determined by Western Blot analysis 24 hrs post transfection (Figure 7). The Western Blot image was quantified using Imaged, and the results are shown in Table 12 as percent protein levels relative to. mock transfected cells following normalization to Hsp90 protein levels detected by a Hsp90 antibody (ProteinTech. Rosemont, IL, USA; Catalog #13171-1 -AP). K. CNT2 protein levels were assessed by a KCNT2 antibody (Invitrogen, Waltham, MA, USA;Catalog # PA5-23855). H0XA1 protein levels were assessed by a H0XA1 antibody (Invitrogen, Waltham, MA, USA; Catalog # PA5-36164).

[0465] Table 12. JAG1 Protein Levels in Cells Treated with ATXL233

[0466] Compound{Concentration (nM) JAG 1 Protein (%) j

[0467] 0 100

[0468] 5 113.8

[0469] ATXL212 10 98.9 i

[0470] .....

[0471] ..

[0472]

[0473]

[0474] Western results showed that JAG1 protein was substantially increased at 20 and 40nM compared to mock control (Figure 7, Table 12), indicating that the GalNAc conjugation does not affect the ASO function.

[0475] Antisense molecules may have potential off-target effects, e.g., affecting unwanted gene expression through imperfect base-pairing. Thus, in silico prediction for ATXL233 was performed to identify potential off-targets in human. Several mRNAs, including CDKN2D, HOXA1, KCNT2, and SH3PXD2A, were found to have the potential to form 13 base-pairing with ATXL233. Although previous studies demonstrated that translation-upregulation ASOs targeting uORF or TIE have no or little off-target effect on protein levels since the activity is dependent on both sequence and the target position in an mRNA (Liang et al., 2016, Nucleic Acids Res 49: 8277- 8293; Liang el al., 2017, Nucleic Acids Res 45: 9528-9546), the levels of two selected proteins, HOXA1 and KCNT2, in cells transfected with ATXL233 were still determined by Western analysis (Figure 7), No substantial changes in protein levels were observed for these two predicted off-target genes despite substantial increase in the JAG1 protein levels in the same experiment, indicating that ATXL233 does not have substantial off-target effects on these genes.

[0476] EXAMPLE 5. Activity of ASOs ATXL212 and ATXL233 Targeting JAG1 in Mouse Liver The ATXL212 and ATXL233 targeting site is conserved in human and mouse JAG1 mRNAs. To determine if ATXL212 (with no GalNAc conjugation) and ATXL233 (with GalNAcconjugation) can increase JAG1 protein levels in mouse liver in vivo, adult (7-8 weeks) male BalB / C mice (N=3) were subcutaneously injected with varying amounts of ASO mg / kg. At Day 1 and Day 4 ATXL233 was dosed at 1.6, 5.0, and 15 mg / kg while ATXL212 was dosed at 6.7, 20, and 60 mg / kg. Phosphate-buffered saline (PBS) was injected as a negative control. The mice were sacrificed on Day 8. A schematic of the dosing regimen is shown in Figure 8A.

[0477] Mice were sacrificed 8 days after the first dosing, and livers were collected. Total protein from the liver tissue samples were extracted using RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, Waltham, MA, USA) supplemented with proteinase inhibitor (ThermoFisher Scientific, Waltham, MA, USA) and a tissue homogenizer, and separated by SDS- PAGE, The level of JAG 1 protein was determined by Western Blotting the extracted proteins and probing the Western Blot using a JAG1 protein antibody (Abeam, Cambridge, UK; Catalog #abl 09536). The Western blotting result is shown in Figure 8B. The level of JAG 1 on the Western Blot image was quantified using ImageJ, and the results are shown in Figure 8B and Table 13 as percent protein levels relative to PBS-treated control mice group following normalization to GAPDH, which was detected using a GAPDH antibody (Sigma-Aldrich, St. Louis, MO, USA; Catalog # G8795).

[0478] To determine if ATXL212 and ATXL233 affected JAG1 mRNA levels, total RNA was isolated from the liver lysate described above. 'Total RNA was prepared using Qiagen’s RNeasy kit (Qiagen, Hilden, Germany), and the level of JAG1 mRNA was determined using quantitative real-time PCR (qRT-PCR), using a human JAG1 specific primer probe set (Table 3), qRT-PCR was performed using AgPath-ID™ One-Step RT-PCR Reagents in QS3 real-time PCR system (ThermoFisher Scientific. Waltham, MA). The qRT-PCR results were quantified using QuantStudio Design and Analysis Desktop Software VI.5.2, The JAG1 mRNA levels detected in qRT-PCR assay were normalized to the mRNA of GAPDH (primer probe sequences listed in Table 3) detected in the aliquots of the corresponding RNA samples. The JAG1 mRNA levels from ASO- treated mice were calculated relative to JAG1 mRNA levels from PBS treated mice, as shown in Figure 8C. <

[0479] Table 13. JAG1 Protein Levels in Mice Liver at Day 8

[0480] ASO Concentration

[0481] Compound JAG1 Protein (%)

[0482] (nM)

[0483]

[0484] PBS 0 100

[0485] 6,7 129.5

[0486] ATXL212

[0487] (no GalNAc)

[0488] . 60. " 151.4

[0489] 1.6 176,8

[0490] ATXL233

[0491] 5 183.9

[0492] (with GalNAc)

[0493] 15 191.1

[0494]

[0495] Compared with PBS treatment, the un-conjugated ASO, ATXL212, significantly increased JAG1 protein to approximately 150% at 20 mg / kg and 60 mg / kg. The GalNAc-conjugated ASO ATXL233, showed even a greater activity by increasing the protein levels to around 180% at 1.6 mg / kg and 5 mg / kg, and to approximately 190% at 15 mg / kg. 'These results demonstrate that the ASOs targeting the 5’ uORF region can effectively increase JAG1 protein levels in mouse liver, and that GalNAc conjugation dramatically increases ASO activity.

[0496] Similar to previous observation in cell culture, supra, JAG1 ASOs did not increase the JAG1 mRNA levels in mouse liver, as determined by qRT-PCR. assay.

[0497] EXAMPLE 6. Activity of ASOs ATXL252 and ATXL233 Targeting JAG1 in Mouse Liver A shorter uORF-targeting ASO, ATXL247, was selected for further evaluation as this ASO showed substantial protein increase in vitro (see Example 3). To evaluate the in vivo activity of ATXL247, it was conjugated with GalNAc, generating new ASO ATXL252 and the new ASO dosed in mice.

[0498] ATXL252 (with GalNAc conjugation) was assessed with ATXL233 (with GalNAc conjugation) in adult (7-8 weeks) male BalB / C mice (N=3). The mice were subcutaneously injected with varying amounts of ASO mg / kg. At Day 1 and Day 4, ASOs were dosed at 0.5 mg / kg and 3 mg / kg, Phosphate- buffered saline (PBS) was injected as a negative control. The mice were sacrificed on Day 8. A schematic of the dosing regimen is shown in Figure 9A.

[0499] Mice were sacrificed 8 days after the first dosing, and livers were collected. Total protein from the liver tissue samples was extracted using RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, Waltham, MA, USA) supplemented with proteinase inhibitor (ThermoFisher Scientific, Waltham, MA, USA) and a tissue homogenizer, and separated by SDS-PAGE. The level of JAG1protein was determined by Western Blotting the extracted proteins and probing the Western Blot using a JAG1 protein antibody (Abeam, Cambridge, UK; Catalog #ab 109536). The level of NOTCH! protein was determined by probing the Western Blot using a NOTCH 1 protein (cleaved) antibody (Cel! Signaling Technology, Danvers, MA, USA; Catalog #41478).

[0500] The Western blotting result is shown in Figure 9B. The level of JAG1 and NOTCH 1 on the Western Blot image was quantified using Imaged, and the results are shown in Figure 9B-C and Table 14 as percent protein levels relative to PBS-treated control mice group following normalization to Tubulin, which was detected using a Tubulin protein specific antibody (Abeam, Cambridge, UK; Catalog #ab7291).

[0501] Table 14. JAG1 Protein Levels in Mice Liver at Day 8

[0502] ASO Concentration

[0503] Compound JAG1 Protein (%) NOTCH 1 Protein (%) (nM)

[0504] PBS 0 100 100 ATXL252 0.5 111.2 73

[0505] (with GalNAc) 3 124.8 105.9 ATXL233 0.5 185.0 139.1

[0506] (with GalNAc): 3 157.6 137.2

[0507]

[0508] ATXL252, which is two nucleotides shorter than ATXL233, increased JAG1 protein only by approximately 25% at 3.0 mg / kg. In contrast, ATXL233 increased the protein by over 50% at both dose levels, supporting a broad effective dose range of ATXL233 and a lower activity of ATXL252 when administered in vivo.

[0509] JAG1 is involved in the NOTCH signaling pathway. Binding of JAG1 to NOTCH protein can induce cleavage of NOTCH protein by p-secretase on the cell membrane, triggering downstream signaling (Masek and Andersson, 2024, Curr Opin Cell Biol 86: 102302). To determine if increased JAG1 protein by ASO treatment is functional in vivo, the Western membrane was probed for cleaved NOTCH1 (Figure 9B). The results showed that ATXL233 treatment, but not ATXL252 treatment, substantially increased levels of cleaved NOTCH 1, as compared with PBS treated group, in alignment with the levels of JAG1 protein in these mice. These results support that ASO-induced JAG1 protein is functional in vivo.Assessment o NOTCHl an< / NOTCH2 mRNA Levels

[0510] To further confirm the protein observations, NOTCH 1 and N0TCH2 mRNA levels were determined using qRT-PCR. Total RNA was prepared from the mouse liver samples after treatment with ASO or PBS. Total RNA was prepared using Qiagen’s RNeasy kit (Qiagen, Hilden, Germany) and the level of NOTCH 1 and N0TCH2 mRNAs were determined using quantitative real-time PCR (qRT-PCR), using mouse NOTCH1 specific primer probe set (ThermoFisher Scientific, Waltham, MA, USA; Catalog #MmOO627185 nl) or NOTCH2 specific primer probe set (ThermoFisher Scientific, Waltham, MA, USA; Catalog #Mm00803077_mI). qRT-PCR was performed using AgPath-ID™ One-Step RT-PCR Reagents in QS3 real-time PCR system (ThermoFisher Scientific, Waltham, MA). The qRT-PCR results were quantified using QuantStudio Design and Analysis Desktop Software VI.5.2. The NOTCH 1 and NOTCH2 mRNA levels detected in the qRT-PCR assay were normalized to the mRN A of mouse GAPDH (Table 3) detected in the aliquots of the corresponding RNA samples. The NOTCH 1 and NOTCH2 mRNA levels from ASO treated mice were calculated relative to NOTCH1 and NOTCH2 mRNA levels from PBS treated mice and shown in Figure 10.

[0511] The results showed that although not statistically significant, a trend of increases in the mRNA levels of NOTCH 1 and NOTCH2 was observed especially at high ASO doses (Figure 10). The observations together support that ASO treatment that increases JAG1 protein levels can improve Jagl / NOTCH signaling activity in vivo.

[0512] EXAMPLE 7. uORF ASOs Increased JAG1 Protein in a Jagl+ / -Mouse Model

[0513] To determine if JAG1 ASOs can increase JAG I protein levels in a disease setting (e.g„ one Jagl allele is mutated such that less than 50% of JAG1 protein is expressed as compared with healthy subjects), Jagl+ / -heterozygous mice was used. In this mouse model, one Jagl allele from chromosome 2 was functionally deleted from the 5’ end of the gene (Xue et al.., 1999, Hum Mol Genet 8: 723-730). It was demonstrated that Jagl+ / -mice showed decreased survival, mild growth retardation, and, importantly, paucity of intrahepatic bile ducts, especially at the early stage afterbirth (Thakurdas et al., 2016, Hepatology 63: 550-565), enabling it as a valuable mouse model for Alagille Syndrome (ALGS) studies (Huppert, 2016, Hepatology 63: 365-367).

[0514] Since there is no obvious difference between genders in ALGS patients (Mueller, 1987, J Med Genet 24: 621-626), both male and female Jagl+ / -mice (n = 3 for each cohort) at ages of 7- 9 weeks were used. The mice were subcutaneously injected with varying amounts of ASO mg / kg. At Day 1 and Day 4, JAG! ASOs were dosed at 5 mg / kg and 10 mg / kg for ATXL233, and 25 mg / kg and 50 mg / kg for ATXL212. A non-GalNAc conjugated control ASO, ATXL235, which does not target JAG1, was dosed at 50 mg / kg. As a control, wild type C57BL / 6 (WT) mice were similarly dosed with PBS or the control ASO, ATXL235. The mice were sacrificed on Day 8. A schematic of the dosing regimen is shown in Figure 11.

[0515] Mice were sacrificed 8 days after the first dosing, and livers were collected. Total protein from the liver tissue samples was extracted using RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, Waltham, MA, USA) supplemented with proteinase inhibitor (ThermoFisher Scientific, Waitham, MA, USA) and a tissue homogenizer, and separated by SDS-PAGE, The level of JAG I protein was determined by Western Blotting the extracted proteins and probing the Western Blot using a JAG1 protein antibody (Abcam, Cambridge, UK; Catalog #ab109536).

[0516] The Western blotting result is shown in Figure 11 B. The level of JAG 1 on the Western Blot image was quantified using ImageJ, and the results are shown in Figure 12 and Table 15 as percent protein levels relative to PBS-treated control mice group following normalization to GAPDH. which was detected using a GAPDH antibody (Sigma-Aldrich, St. Louis, MO, USA; Catalog # G8795),

[0517] Table 15. JAG1 Protein Levels in Mice Liver at Day 8

[0518] ASO Concentration

[0519] Compound Mouse Type JAG1 Protein (%)

[0520] (nM)

[0521] PBS WT (nlale) 0 100 ATXL233 Jagl+ / -(male) 5 64.5

[0522] (with GalNAc) Jag1+ / ” (male) 10 60.6 ATXL212 Jagl+ / ‘ '(female) 25 17.4

[0523] (no GalNAc) Jag 17'“ (male) 50 28.2 ATXL235 WT (male) 50 85.7

[0524]

[0525] (no GalNAc) Jagl+ / " (male) | 50 [ 20,5

[0526]

[0527] The results showed that JAG) protein level in Jag I17" mice is approximately 25% of that in WT mice in this study, as compared with the WT and Ja l:'” groups treated with the control ASO ATXL235. The control ASO did not. significantly alter the JAG1 protein level in WT mice. However, ATXL233 treatment at,two different doses significantly increased JAG1 protein level in Jag 1+ / * mice as compared with the control ASO-lrealed Jagl+ / ’ mice, reaching approximately 60% of the level in wild type mice. ATXL212 treatment did not cause significant increase in this disease model, although a trend of increase was observed at the high dose group (approximately 35% increase as compared with the control ASO treated Jagl+z’ mice) highlighting the beneficial effect of GalNAc delivery into liver cells. Taken together, these results demonstrate that the JAG 1 uORF targeting ASO, ATXL233, can increase JAG1 protein levels in JagrAmice to reach about 60% of the JAG1 protein amount in wild type animals, supporting a therapeutic potential to treat ALGS, a haploinsufficient disease.

[0528] EXAMPLE 8. JAG1 uORF Targeting ASO Improved Bile Du Development and Reduced Plasma Bile Acid Levels in JagI+ / ~ Mice

[0529] To ascertain if the uORF ASO ATXL233 can cause phenotypic changes in the Jagl+A(Het) mouse model, newborn mice (n=l 1 for Jagl17" ATXL233, n=7 for Jag1+AzVTXL245, and n=9 for JagT''’ PBS ) were subcutaneously injected with 3 mg / kg ATXL233 (Het-ATXL233) on postnatal day 1 (Pl), day 7 (P7), and day 14 (Pl 4), and then sacrificed on postnatal day 30 (P30). As controls, JagT-'" mice were dosed with PBS (Hel-PBS) or were dosed at 3 mg / kg with a negative control ASO, ATX L245 (Het-ATXL245), a GalN Ac-conjugated ASO that does not target J AG1, The mice were sacrificed on Day 30, A schematic of the dosing regimen is shown in Figure 13. The amount of JAG1 protein in wild-type mice C57BL / 6 (WT) was also assessed,

[0530] JAG! Liver Protein Analysis

[0531] A subset of treated mice (n~5 for Jagl+ / " PBS, n~:7 for Jagl+ / ' ATXL245, and n~11 for Jag ATXL233) was sacrificed 30 days after the first dosing, and livers were collected, Total

[0532]

[0533] protein from the liver tissue samples was extracted using RIPA Lysis and Extraction Buffer (ThennoFisher Scientific, Waltham, MA, USA) supplemented with proteinase inhibitor (ThennoFisher Scientific, Waltham, MA, USA) and a tissue homogenizer, and separated by SDS- PAGE. The level of JAG 1 protein was determined by Western Blotting the extracted proteins and probing the Western Blot using a JAG1 protein antibody (Abeam, Cambridge, UK; Catalog #ab 109536).

[0534] The Western blotting result is shown in Figure 13B. The level of JAG1 on the Western Blot image was quantified using ImageJ, and the results are shown in Figure 13C as percent protein levels relative to PBS-treated control mice group following normalization to Tubulin, which was detected using a Tubulin protein specific antibody (Abeam, Cambridge, UK; Catalog #ab7291), As shown in Figure 13, ATXL233 treatment significantly increased JAG1 protein level compared to the PBS treated group or control ATXL245 treated group, reaching a level of approximately 7'7% of that in wild type mice.

[0535] Biliary Tree A nalysis

[0536] Intrahepalic biliary tree formation is disrupted in ALGS patients. Enhancement of biliary tree formation can improve liver function, thus, biliary tree formation was assessed in ASO treated Jag I+ / " mice.

[0537] Biliary trees in a subgroup of animals (N=5 for WT; N=6 for Jagl+ / ’ PBS; N=7 for Jagl+AATXL245 and F::8 for Ja P'" AT L233 groups) were visualized by ink staining (Figure 14), as described previously {Niknejad at al.. 2023, Hepatology 78: 1337-1351),

[0538] Retrograde biliary ink injection was performed as described (Waiter et al., 2012, J Vis Exp: e4272.) on harvest day (P30) on the subgroup of the animals from each treatment group of heterozygous mice as well as the wild-type (WT) group without treatment. Briefly, mice were sacrificed and abdominal cavity was opened up. With a PBS moisturized cotton swab, liver lobes were flipped upwards to access the dorsal view and common bile duct. Using a curved forceps, a surgical suture was passed underneath the bile duct, followed by a loose knot surrounding the bile duct. Using a spring scissor, a small cut was made in the bile duct ~ 1 / 4 inches below the suture knot. Then, the beveled end of a PE- 10 tubing was inserted through the cut and into the bile duct and fixed by tightening the suture. After cannulating the common bile duct, black ink (Higgins1®Black Magic; Higgins, Leeds, MA, USA) was injected into ail the bile ducts in the liver. Injected livers were dissected from the body, put in a 20 ml scintillation vial, and cleared by sequential washes in 50% MeOH / 50%PBS and 100% MeOH for 4 hours and overnight, respectively. After clearing, the liver lobes were imaged using a Zeiss Axio Zoom VI 6 microscope at 20x and reconstructed in Adobe Illustrator. For quantification of the biliary tree density, portions consisting of approximately one-third of each left lobe were cropped from the whole image. Using the color threshold tool in Image!, background was filtered out, and ink-stained areas were quantified.

[0539] A dense biliary tree staining pattern was observed in WT mouse liver. In JagT'" mice, PBS or control ASO ATXL245 treated group showed much less staining and large empty edge areas, consistent with previous observations (Niknejad el al., 2023, Hepatology 78: 1337-1351). However, in Jagl+ / ’ mice treated with ATXL233, a substantial increase in the ink staining density was observed as compared with PBS or ATXL245 treated animals, Indeed, quantification results of the stained areas showed that ink staining density in ATXL233 treated mice reaches around 76% of that in wild type (Figure 14B), a significant (*) increase as compared with the control ATXL245 treated group. No substantial difference was found between the ATXL245 treated group and the PBS group. ’These results support that treatment with ATXL233 increased JAG1 protein level and also improved liver bile duct development in Jagl '' mice.

[0540] Immunohistochemical Staining of the Portal Vein and Bile Duct

[0541] To further confirm the observation that. ATXL233 increased biliary tree formation, portal vein and bile duct were stained through immunohistochemistry, using antibodies against wide spectrum (ws)-CK (CK8 and CK19) (Abeam, Cambridge, UK; Catalog #ab5262) and alpha-SMA (Sigma- Aldrich, St. Louis, MO, USA; Catalog & A2547), which detect bile ducts (BD) and portal veins (PV), respectively (Figure 15).

[0542] Frozen liver samples from WT mice (N=4), or a subgroup of the Jagl+ / " mice treated with PBS (N=7), ATXL245 (N=4), or ATXL233 (N=10) were processed for paraffin embedding and slide sectioning with a similar depth across different liver samples. Portal vein (PV) and bile duct (BD) staining was performed as described previously (Adams and Jafar-Nejad, 2019, J Vis Exp., PMC 2020 April 30). Briefly, aftej antigen retrieval, liver sections were stained overnight with primary antibodies against wide spectrum (ws)-CK (CK8 and CK19) and alpha-SMA. Followingprimary antibody incubations, slides were stained with appropriate fluorescently conjugated secondary antibodies (Anti-rat Alexa488 (Invitrogen, Waltham, MA, USA; Catalog #A21208) and Cy™5 AffiniPure™ Anti-Mouse IgG (Jackson ImmunoResearch. West Grove, PA, USA; Catalog #715-175-151)) for 2 hours at room temperature. AU primary and secondary antibodies were diluted in 10% donkey serum (Jackson ImmunoResearch) in PBST. Slides were mounted on DAPI containing mounting media (Vector Laboratories, Neward, CA, USA) and were imaged using Echo Revolve fluorescence microscope at 20x magnification (Figure 15A). The entire liver surface BDs around each PV were counted manually, and BD / PV ratios were calculated for each animal (Figure 15B).

[0543] Quantification results of the stained samples showed that the BD / PV ratio was significantly (*) increased to 0.7 in ATXL233 treated mice, compared with ~ 0.5 in PBS or ATXL245 treated mice (Figure 15B), further confirming improved bile duct development upon ATXL233 treatment.

[0544] Bile Acid. Bilirubin, Triglyceride and Cholesterol Analysis

[0545] Due to defects in liver bile duct development, ALGS patients exhibit elevated levels of plasma bile acid and bilirubin (Vandriel et al., 2023, Hepatology 77: 12-529). Accordingly, the levels of plasma bile acids, bilirubin, as well as triglycerides and cholesterol in these mice were assessed. Blood from the mice was collected in Microvette® CB 300 lithium heparin-containing tube by cardiac puncture during sacrifice at postnatal day 30, and plasma was separated, Bile acid levels were measured with the Total Bile Acids. Assay Kit (Abeam, Cambridge, UK; Catalog #ab239702) according to the manufacturer’s instructions. In brief, three microliters of plasma, and standard samples were added to a 96-well transparent plate, and the volume was adjusted to 50 pl with HjO. Next, 100 p1 of Probe mix was added to each well, and samples were incubated for 10 min at 37°C; Then, 50 pl Reaction Mix or background control mix was added to appropriate wells, and the absorbance at 405 nm was measured in a kinetic mode at 37°C for 60 min and the results were plotted using Prism.

[0546] Total bilirubin was analyzed using the Bilirubin Assay Kit (Sigma-Aldrich, MAKI 26) according to the manufacturer’s instructions. Briefly, 6 pl plasma, 50 pl calibrator, or 50 ul water were transferred into separate wells in a 96-well transparent plate. 200 pl working reagents wereadded to sample wells, and 200 l water was added to calibrator and water wells. The plate was incubated at room temperature for 10 minutes, and the absorbance at 530 nM was measured.

[0547] Triglyceride was measured by mixing 2 ul plasma and 150 p! of Triglyceride-SL Reagent (Sekisui Diagnostics, Burlington, MA, USA; Catalog #236-60) in each well, Samples were incubated at room temperature for 30 minutes with gentle shaking. The absorbance was measured at 505 ran with 660 rim as reference wavelength,

[0548] Total cholesterol was measured by mixing 2 pl plasma and 200 ul of Choleslurul-SL Reagent (Sekisui Diagnostics, Burlington, MA, USA; Catalog #234-60) to each well. Samples were incubated at room temperature for 15 minutes with gentle shaking. The absorbance was measured at 505 ran with 660 rim as reference wavelength. “Linearity FD General Chemistry” standards from Audit MicroControis (Eatonton, GA, USA: Catalog #K701M-5) were used for both triglyceride and cholesterol assays. Data are plotted using Prism.

[0549] As compared to wild type mice, Jag I ' ' " mice treated with PBS showed elevated bile acid levels, though with a large variation (Figure 16A). This is similar to the heterogeneous situation of disease severity in ALGS patients (Gilbert and Loomes, 2021, Transl Gastroenterol Hepatol 6: 22; Vandriel el al., 2023, Hepatology 77: 512-529).

[0550] A trend of reduction in plasma bile acid levels was observed in the ATXL233 treated group compared io PBS or control ASO (ATXL245) treated groups. The average bile acid levels were reduced by -40.6% in ATXL233 group compared with that in PBS treated group (Figure 16. A). Similarly, a trend of reduced total bilirubin was also observed in ATXL233 treated mice (Figure 16B). Triglyceride levels, which also elevate in ALGS patients due to impaired liver function (Vandriel etui., 2023, Hepatology Th 512-529), were significantly decreased in ATX 1,233 treated mice (Figure 16C). Cholesterol level ’was not substantially reduced in ASO treated group (Figure 16D). These results demonstrate that weekly dosing of ATXL233 3 times in newborn Jagl+ / " mice significantly increased JAG1 protein level, accompanied by improved bile duct development and reduced plasma bile acid and triglyceride levels, supporting improved liver function.Sequences

[0551] SEQ

[0552] Name ID NO. agacgggctctccgggtccttctccgagagccgggcgggcacgcgtcattgtgt tacctgcggccggcccgcgagctaggctggtttfttttttctcccctccctccccc ctttttccatgcagctgatctaaaagggaataaaaggctgcgcataatcataataat aaaagaaggggagcgcgagagaaggaaagaaagcugggagglggaagag gagggggagcgtctcaaagaagcgatcagaataataaaaggaggccgggctc tttgccttctggaacgggccgctcttgaaagggctttgaaaagtggtgtgttcc agtcgtgcatgctccaatcggcggagtatattagagccgggacgcggcggccg caggggcagcggcgacggcagcaccggcggcagcaccagcgcgaacagca gcggcggcgtcccgagtgcccgcggcgcgcggcgcagcgatgcgttcccca cggacgcgcggccggtccgggcgccccctaagcctcctgctcgccctgctctg tgccctgcgagccaaggtgtgtggggcctcgggtcagttcgagttggagatcct gtccatgcagaacgtgaacggggagctgcagaacgggaactgctgcggcggc gcccggaacccgggagaccgcaagtgcacccgcgacgagtgtgacacatact tcaaagtgtgcctcaaggagtatcagtcccgcgtcacggccggggggccctgc agcttcggctcagggtccacgcctgtcatcgggggcaacaccttcaacctcaag gccagccgcggcaacgaccgcaaccgcatcgtgctgcctttcagtttcgcctgg ccgaggtcctatacgtgctgtggaggcgtgggatccagtaatgacaccgttc aacctgacagtattatgaaaaggcttctcactcgggcatgatcaaccccagccg gcagtggcagacgctgaagcagaacacgggcgttgcccactttgagtatcagat human JAG1 mRNA

[0553] ccgcgtgacctgtgatgactactactatggctttggctgcaataagttctgccgcc (GenBank Accession

[0554] ccagagatgactctttggacactatgcctgtgaccagaatggcaacaaaactg No: NM 0002143)

[0555] catggaaggctggatgggccccgaatgtaacagagctatttgccgacaaggct gcagtcctaagcatgggtctgcaaactcccaggtgactgcaggtgccagtacg gctggcaaggcctgtactgtgataagtgcatcccacacccgggatgcgtccacg gcatctgtaatgagccctggcagtgcctctgtgagaccaactggggcggccag clctgtgacaaagatctcaattactgtgggactcatcagccgtgtctcaacgggg gaacttgtagcaacacaggccctgacaaatatcagtgttcctgccctgaggggta ttcaggacccaactgtgaaattgctgagcacgcctgcctctctgatccctgtcaca acagaggcagctgtaaggagacctccctgggcttgagtgtgagtgttccccag gctggaccggccccacatgctctacaaacattgatgactgttctcctaataactgtt cccacgggggc^ctgccaggacctggttaacggatttaagtgtgtgtgccccc cacagtggactgggaaaacgtgccagttagatgcaaatgaatgtgaggccaaa

[0556] [ ccttgtgtaaacgccaaatcctgtaagaatctcattgccagctactactgcgactgt cttcccggctggatgggtcagaattgtgacataaatattaatgactgccttggcca gtgtca'gaatgacgcctcctgtcgggatttggttaatggttatcgctgtatctgtcc acctggctatgcaggcgatcactgtgagagagacatcgatgaatgtgccagcaa cccctgtttgaatgggggtcactgtcagaatgaaatcaacagattccagtgtctgt gtcccactggtttctctggaaacctctgtcagctggacatcgattattgtgagccta atccctgccagaacggtgcccagtgctacaaccgtgccagtgactatttctgcaa

[0557]

[0558] gtgccccgaggactatgagggcaagaactgctcacacctgaaagaccactgccgcacgaccccctgtgaagtgattgacagctgcacagtggccatggcttccaacg acacacctgaaggggtgcggtatatttcctccaacgtctgtggtcc-tcacgggaa gtgcaagagtc-agtcgggaggcaaatcacctgtgactgtaacaaaggcttoac gggaacatactgccatgaaaatattaatgactgtgagagcaacccttgtagaaac ggtggcacttgcatcgatggtgtcaactcctacaagtgcatctgtagtgacggct gggagg^ggcctactgtgaaaccaatattaatgactgcagccagaacccctgcc | acaatgggggcacgtgtcgcgacctggtcaatgacttctactgtgactgtaaaaa tgggtggaaaggaaagacctgccactcacgtgacagtcagtgtgatgaggcca cgtgcaacaacggtggcacctgctatgatgagggggatgcttttaagtgcatgtg tcctggcggctgggaaggaacaacctgtaacatagcccgaaacaglagclgucl gcccaacccctgccataatgggggcacatgtgtggtcaacggcgagtcctttac gtgcgtctgcaaggaaggctgggaggggcccatctgtgctcagaataccaatg actgcagccctcatccctgttacaacagcggcacctgtgtggatggagacaact ggtaccggtgcgaatgtgccccgggtttgctgggcccgactgcagaataaaca tcaatgaatgccagtctcaccttgtgcctttggagcgacctgtgtggatgagatc aatggctaccggtgtgtctgccctccagggcacagtggtgccaagtgccagga agtttcagggagaccttgcatcaccatggggagtgtgataccagatggggccaa atgggatgatgactgtaatacctgccagtgcctgaatggacggatcgcctgctca aaggtctggtgtggccctcgaccttgcctgctccacaaagggcacagcgagtgc cccagcgggcagagctgcatccccatcclggacgaccagtgcttcgtccaccc ctgcactggtgtgggcgagtgtcggtcttccagtctccagccggtgaagacaaa gtgcacctctgactcctattaccaggataactgtgcgaacatcacatttacctttaa caaggagatgatgtcaccaggtcttactacggagcacatttgcagtgaattgagg aattgaatattttgaagaatgtttccgctgaatattcaatctacatcgcitgcgagcc ttccccttcagcgaacaatgaaatacatgtggccatttctgctgaagatatacggg atgatgggaacccgatcaaggaaatcactgacaaaataatcgatcttgttagtaaa cgtgatggaaacagctcgctgattgctgccgttgcagaagtaagagttcagagg cggcctctgaagaacagaacagatttcctgttcccttgctgagctctgtcttaact gtggcttggatctgttgctggtgacggccttctactggtgcctgcggaagcggc ggaagccgggcagccacacacactcagcctctgaggacaacaccaccaacaa cgtgcgggagcagctgaaccagatcaaaaaccccattgagaaacatggggcc aacacggtccccatcaaggattatgagaacaagaactccaaaatgtctaaaataa ggacacacaattctgaagtagaagaggacgacatggacaaacaccagcagaa agcccggtttgccaagcagccggcgtacacgctggtagacagagaagagaag j ccccccaacggcacgccgacaaaacacccaaactggacaaacaaacaggac i aacagagacttggaaagtgcccagagcttaaaccgaatggagtacatcgtatag cagaccgcgggcactgccgccgctaggtagagtctgagggcttgtagtctttaa | actgicgtgtcatactcgagtctgaggccgttgctgacttagaatccctgtgttaat; taagtttgacaagctggcttacactggcaatggtagtttctgtggtggctgggaa | atcgagtgccgcatctcacagctatgcaaaaagctagtcaacagtaccctggttg i tgtgtccccttgcagccgacacggtctcggatcaggctcccaggagcctgccca i gccccctggtctttgagctcccacttctgccagatgtcctaatggtgatgcagtctt agatcatagtittatttatatttattgactctgagttgtttttgtatattggttttatgatga cgtacaagtagttctgtattgaaagtgcctttgcagctcagaaccacagcaacga teacaaatgactttattatttatttttttaattgtatttttgttgttgggggaggggaga ctttgatgtcagcagtigctgjgtaaaatgaagaa

[0559]

[0560] tttaaagaaaaaaatgtcaaaagtagaacttgtatagttatgtaaataattctttttattaatcactgtgtatattgattta ttaacttaataatcaagagccttaaaacatcattccttittatttatatgtatgtgtttag aattgaaggtttttgatagcattgtaagcgtatggctttatttttttgaactcttctcatt actgttgcctataagccaaaattaaggtgtttgaaaatagtttattttaaaacaatag gatgggcttctgtgcccagaatactgatggaatttitttgtacgacgtcagatgtita aaacaccttctatagcatcactaaaacacgtttaaggactgactgaggcagtttg aggattagttiagaacaggtttttttgtttgtttgtttttgttlttctgctttagactlgaa aagagacaggcaggtgatctgctgcagagcagtaagggaacaagttgagctat gacttaacatagccaaaatgtgagtggttgaatatgattaaaaatatcaaattaattg tgtgaacttggaagcacaccaatcttactttgtaaattctgatttcttttcaccattcgt acataatac.tgaaccacttgtagattgattttttttttaatctactgcatttagggagt atctaataagctagttgaatacttgaaccataaaatglccagtaagatcactgttta gatttgccatagagtacactgcctgccttaagtgaggaaatcaaagtgctattacg aagttcaagatcaaaaaggcttataaaacagagtaatcttgtggttcaccatgag accgtgaagatacttlgtattgtcctaitagtgltatatgaacatacaaatgcatcttt gatgtgttgttcttggcaataaattttgaaaagtaatatttataaatttttttgtatgaaa acatggaacagtgtggcclcttctgagcttacgtagttctaccggctttgccatgtg crtctgccaccctgctgagtctgttctggtaatcggggtataataggctctgcctga cagagggatggaggaagaactgaaaggcttttcaaccacaaaactcatctggag ttctcaaagacctggggctgctgtgaagctggaactgcgggagccccatctagg ggagccttgattcccttgttattcaacagcaagtgtgaatactgcttgaataaacac cactggattaatggcc mGmCmCmCmGmCmCmCmGmGmCmUmCmlJmCm ATXL098

[0561] G

[0562] mCmUmAmGmCmUmCmGmCmGmGmGmCmCmGm ATXL099 3

[0563] G

[0564] mCmAmUmGmCmAmCmGmAmCmUmGinGmAniAm ATXL100 4

[0565] A

[0566] mCmUmCmCmGmCmCmGmAmUmUmGmGmAmGm ATXL1O1 5

[0567] C

[0568] mUmUmUmGmCmAmUmAmGmCmUmGmUmGmAm ATX LI 02 6

[0569] GmAmU

[0570] mGniGmUmU mCmAm Am GmU m Am U mU mC m Am Am ATXL103 7

[0571] CmUmA mAmGmCmUmGmCmAmAmAmGmGmCmAmCmUm ATXL104 8

[0572] UmUmC

[0573] mGml Jm UmUmUm Am AmGmGmCmUmCml) mUmGm A'l'XL186a 9

[0574] AmUmU mCmAmCmUmUmAmAmGmGmCmAmGmGmCmAm ATXL187a 10

[0575] GrnUmCi eT*eG*eCni*eA*e(Xn*eG*eA*eCm*eTM3*eG*eA*eA ATXL212, ATXL 233 11

[0576] *eA*eA*eCm*eA*eA eA*eG*eCm*eT*eG*eCm*eA*eA*eA*eG*eG*eCm*eA ATXL213 12

[0577] *eCm*eT*eT*TL*CL eCm*eA*eT*eG*eG*eA*eG*eG*eCm*eG*eG*eCm*eT ATXL235 13

[0578]

[0579] *eT*eG*eA*eGeT*eG*eCm*eA*eCm*eG*eA*eCm*eT*eG*eG*eA*eA ATXL247, ATXL 252 14

[0580] *eA*eA*eCm eT*eG*eCm*eA*eCm*eG*eA*eCm*eT*eG*eG*eA*eA ATXL248 15

[0581] *eA*A'L*CLeT*eG*eCm*eA*eCm*eG*eA*eCm*eT*eG*eG*eA*eA ATXL249 16

[0582] * eA * eA * eCm * AL* AL eT*eG*eCm*eA*eCm*eG*eA*eCm*eT*eG*eG*eA*eA ATXL250 17

[0583] *eA*eA*eCm*eA*eA*eCm*eA

[0584] eT* eG * eCm * e A* eCm * eT*eG*e A * eCrn *eG* eG * e A* eA ATXL 245 18

[0585] * eT *e A* eCm * e A * e A

[0586] ATXL098 GCCCGCCCGGCUCUCG 19 ATXL099 CUAGCUCGCGGGCCGG 20 ATXL 100 CAUGCACGACUGGAAA 21 ATXL101 CUCCGCCGAUUGGAGC 22 ATXL 102 UUUGCAUAGCUGUGAGAU 23 ATXL 103 GGU UCAAGUAUUCA ACU A 24 ATXL 104 AGCUGCAAAGGCACUCUC 25?. ATXL186a. GLl U 'AAGGC 1'CL'l GAI 1 ' 26 ATXLdT / a CACbUAAGGCAGoCAtfuU 27 ATXL212, ATXL 233 TGCACGACTGGAAAACAA 28 ' ATXL213 AGCTGCAAAGGCACTTTC.. 29 ATXL235 CATGGAGGCGGCfTGAG 30 Al'Xl 247. AFXL 252,

[0587] TGCACGACTGGAAAAC 31 ATXL248

[0588] ATXL249 rGCACGACTGGAAAACAA 32 ATXL250 TGCACGACTGGAAAAC1AACA 33 ATXL 245 TGCACTGACGGAATACAA 34 hJAGl Forward GCAACACC i 'TCAACCTCAAG 35 hJAGl Reverse CAAGCAM ’G 1 A FAG( J ACC H 1G 3o hJAGl Probe CCAGGCGAAAC I GAAAGGCAGC 37 hGAPDH Forward AAT'CCCATCACCAIC11 CCAG 38 hGAPDH Reverse AATGAGCCCCAGCCTTCTC 39 hGAPDH Probe ccAGCArcGcccciAcyr'rGA'r'ri^r 40 mGAPDH Forward GTG^CCACGAGAAATATGACAAC 41 mGAPDH Reverse AGTGA K1GCATGGAC FGTG 42

[0589]

[0590] mGAPDH Probe CAACTTTGGCATTGTGGAAGGGCT 43

[0591]

Claims

WHAT IS CLAIMED IS:

1. An antisense oligomeric compound for enhancing expression of JAG1 in a ceil, wherein the compound comprises any of the antisense oligomeric sequences targeting JAG1 in any one of Tables 1, 5, 7 or 11, or salt thereof or derivative thereof,2. The compound of claim 1, wherein the compound comprises al least one chemical modification.

3. The compound of claim 3, wherein the compound is fully chemically modified,4. The compound of claims 2 to 3, wherein the chemical modification can be selected from 2’-O-methyl (2’-OMe), 2’-O-methoxyethyl (2 ’-MOE), 2 ’-fluoro (2’-F), constrained ethyl (cEt), unlocked nucleic acid (UNA), locked nucleic acid (LNA) and / or 5-methylcytosine.

5. The compound of claim 1, wherein the compound comprises at least one modified internucleoside linkage,6. The compound of claim 5, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleotide (PS) linkage.

7. The compound of claim 1, further comprising a conjugate moiety.

8. The compound of claim 7, wherein the conjugate moiety is any of cholesterols, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, peptides, antibodies, dyes, and tocopherol.

9. The compound of claim 8, wherein the carbohydrate is N-acetylgalactosamine.

10. The compound of claim 1, wherein the compound targets a 5’ uORF of JAG1 rnRNA.

11. The compound of any of claims 1 to 9, wherein the compound increases expression of JAG 1 protein by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, or 300%.

12. A pharmaceutical composition comprising the compound of any preceding claim, alone or in combination with a pharmaceutically acceptable carrier and / or excipient.

13. A method for increasing translation of JAG I mRNA in a cell comprising administering the compound of any of claims 1 to 11 or the pharmaceutical composition of claim 12 to the cell, in an amount sufficient to increase translation of JAG1 mRNA.

14. A method for increasing expression of JAG1 protein in a cell comprising administering the compound of any of claims 1 to 11 or the pharmaceutical composition of claim 12 to the cell, in an amount sufficient to increase expression of JAG 1 protein.

15. A method for treating ALGS in a subject comprising administering the compound of any of claims 1 to 11 or the pharmaceutical composition of claim 12 to the subject, in an amount sufficient to treat ALGS in the subject.

16. The method of any of claims 13-15, where the compound or the pharmaceutical composition can be administered subcutaneously or intravenously to the subject.

17. A process for preparing compound of any one of claims 1-11, wherein the process comprises the steps of:a. preparing the compound by sequential coupling of modified and / or unmodified nucleotides and / or linkers via the phosphoramidite oligonucleotide synthesis on a conjugate modified or unmodified solid support;b. optionally, coupling a conjugate moiety to the compound on the solid support via the phosphoramidite oligonucleotide synthesis;c. detaching the compound from the solid support and removing the solid support; and d. optionally, adding a conjugate post cleavage; and / ore. optionally, further purifying the compound, optionally using chromatography.18, A compound of any of the preceding claims for use in medicine.

19. A compound of any of the preceding claims for use in treating ALGS.