Use of c / EBP-beta antagonist and EGFR inhibitor

WO2026207001A1PCT designated stage Publication Date: 2026-10-01SAPIENCE THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/020610
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-24
Filing Date
2026-03-24
Publication Date
2026-10-01

Smart Images

  • Figure US2026020610_01102026_PF_FP_ABST
    Figure US2026020610_01102026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are methods of administering a peptide antagonist of CCAAT / enhancer-binding protein beta (C / EBPβ) in combination with an inhibitor of epidermal growth factor receptor (EGER).
Need to check novelty before this filing date? Find Prior Art

Description

Sapience.025.WOl PATENT USE OF C / EBP-BETA ANTAGONIST AND EGFR INHIBITORBACKGROUND

[0001] Glioblastoma (GBM) is the most common and aggressive malignant brain tumor, with median overall survival following standard-of-care treatment of 15-18 months and 5-year survival of less than 10%. Despite extensive characterization of the genetic lesions driving GBM, there has been no improvement on the overall natural history of the disease, mostly due to the cellular and genetic heterogeneity of these tumors.

[0002] CCAAT / Enhancer Binding Protein f> (C / EBP ) is a transcription factor identified as a master regulator of the mesenchymal transition in GBM. Upregulated or overactivated C / EBPP drives oncogenesis by promoting tumor survival and proliferation, and is a critical regulator of the immunosuppressive environment (Homma 2006; Ruffell 2009).

[0003] ST101, also known as, lucicebtide is a C / EBP0 antagonist peptide that was evaluated in a Phase 2 clinical study in patients with recurrent and newly diagnosed GBM (NCT04478279) and has shown durable responses in a subset of patients. STIOl’s antitumor activity is two-fold in that it directs cancer cell death and stimulates immune- activation within the tumor microenvironment.

[0004] Epidermal growth factor receptor (EGFR) is a transmembrane receptor with intracellular protein kinase activity. Ligand binding to EGFR activates downstream signaling, including via the c-Jun N-terminal kinase (JNK), mitogen-activated protein kinase (MAPK), and protein kinase B (Akt) pathways. Mutations that lead to EGFR overexpression are commonly observed in GBM and are associated with poor survival (Tomoszkova 2024).

[0005] Given the poor prognosis for GBM, new therapeutic approaches are needed for this difficult-to-treat cancer.SUMMARY OF THE INVENTION

[0006] Some of the main aspects of the present invention are summarized below.Additional aspects are described in the Detailed Description of the Invention, Examples, Drawings, and Claims sections of this disclosure. The description in each section of this disclosure is intended to be read in conjunction with the other sections. Furthermore, the various embodiments described in each section of this disclosure can be combined inSapience.025.WOl PATENTvarious different ways, and all such combinations are intended to fall within the scope of the present invention.

[0007] Provided is a combination approach for administering a peptide antagonist of C / EBPp and an inhibitor of EGFR (EGFRi). In particular, the herein studies demonstrate the ability of ST101 to enhance the activity of molecularly targeted therapeutics such as EGFRi, that are typically not effective when used as monotherapies in GBM.

[0008] One embodiment is a method of treating a GBM in a subject, the method comprising combination therapy with: (i) a pharmaceutical composition comprising an effective amount of a peptide antagonist of C / EBP and (ii) a pharmaceutical composition comprising an effective amount of an EGFRi; wherein the pharmaceutical composition comprising the antagonist of C / EBP and the pharmaceutical composition comprising the EGFRi are administered to the subject together or separately.

[0009] In one embodiment, wherein the GBM comprises a gain-of-function mutation in a member of the EGFR pathway. In certain embodiments, the GBM comprises a gain- of function mutation in a gene selected from the group consisting of c-Met, cyclin- dependent kinase 4 (CDK4), EGFR, murine double minute 2 (MDM2), murine double minute 4 (MDM4), platelet-derived growth factor receptor alpha (PDGFRA), and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PI3KCA). In a particular embodiment, the gain-of-function mutation is an EGFRvIII mutation.

[0010] In one embodiment, the peptide antagonist comprises the D-amino acid sequence VAEAREELERLEARLGQARGEL (SEQ ID NO: 1). In some embodiments, the peptide antagonist is a cell-penetrating peptide. For example, the peptide antagonist can comprise a cell-penetrating sequence. In a particular embodiment, the peptide antagonist is ST101.

[0011] In some embodiments, the peptide antagonist is administered to the subject at a dose of about 0.5-16 mg / kg. In one embodiment, the dose of peptide antagonist is about 500 mg.

[0012] In a certain aspect of the invention, the EGFRi is a tyrosine kinase inhibitor.In some embodiments, the EGFRi is selected from the group consisting of afatinib, almonertinib, avitinib, BDTX-1035, brigatinib, canertinib, dacomitinib, erlotinib, gefitinib, icotinib, lapatinib, lazertinib, mobocertinib, naquotinib, nazartinib, neratinib, olmutinib, osimeritinib, pelitinib, pyrotinib, rociletinib, simotinib, and vandetanib. In a particular embodiment, the EGFRi is selected from the group consisting of BDTX-1535,Sapience.025.WOl PATENTosimertinib, and afatinib. In some embodiments, the pharmaceutical composition comprising the EGFRi comprises more than one EGFRi.

[0013] In one embodiment, the pharmaceutical composition comprising the antagonist of C / EBP is administered parenterally, for example, intravenously.

[0014] In some embodiments, the pharmaceutical composition comprising the antagonist of C / EBP0 and the pharmaceutical composition comprising the EGFRi are administered to the subject on different days.

[0015] In certain embodiments, the pharmaceutical composition comprising the antagonist of C / EBP0 is administered once weekly for at least three weeks, or once every two weeks for at least four weeks.

[0016] Also provided is a pharmaceutical composition comprising an effective amount of a peptide antagonist of C / EBP and a pharmaceutical composition comprising an effective amount of an EGFRi for use in a method of combination therapy for treating GBM in a subject.

[0017] In a preferred embodiment of the invention, the subject is a human subject.BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIG. 1 shows the outline of a synthetic lethal screen for ST101 sensitivity in GBM cell lines. CAS9-expressing GBM lines were transduced with EGFP-tagged sgRNAs targeting a control region (Ctrl) or two non-overlapping EGFR sgRNAs (EGFR A and B). Cells were mixed with TagRed-expressing Ctrl sgRNA cells and plated in the presence of increasing concentrations of ST101 (Luci). After one week, cell mixtures were recovered and assessed for EGFP:TagRed cell ratio.

[0019] FIG. 2A-2B show that suppression of EGFR is synthetic lethal with ST101 treatment of T98G GBM cells. Western blot was performed to assess suppression of EGFR in selected T98G (FIG. 2A, left panel) and U251 (FIG. 2B, left panel) control, EGFR A ,and EGFR B pools. Beta-actin was used as loading control, l.e. = long exposure. The EGFP:TagRed normalized ratio was determined for T98G (FIG. 2A, right panel) or U251 (FIG. 2B, right panel) cells infected with Control (Ctrl), EGFR A, or EGFR B sgRNAs and treated with 0, 2.5, 5 or 10 pM ST101. Assays were performed in triplicate. Error bars represent standard deviations. Statistics: 2-way ANOVA, T-test with Dunnet’s correction for the indicate comparisons (*** p<0.0001; *** p<0.001; ns, not significant).Sapience.025.WOl PATENT

[0020] FIG. 3A-3C show synergy between EGFR inhibition and STI 01 in GBM.FIG. 3A shows Bliss surface models for two GBM cell lines (T98G and U251) treated with ST101 in combination with EGFR inhibitors BDTX-1535, Osimertinib, or Afatinib at the indicated concentrations. An apoptosis assay based on Annexin V and Sytox Red was performed at 48 hours post-treatment. FIG. 3B and FIG. 3C show dose response curves (left panels), absolute inhibitory concentration (IC) (middle panels), and area under the curve (AUC) (right panels) for Osimertinib combined with the indicated ST101 concentrations in T98G (FIG.3B) and U251 (FIG.3C) cell lines. For each cell line, an appropriate IC was utilized depending on the max effect reached in the Osimertinib-only response: T98G IC20 (FIG. 3B, middle panel); U251 IC10 (FIG. 3C, middle panel). For dose-response graphs, dotted lines represent T98G IC20 or U251 IC10 levels. AUC (T98G: FIG.3B, right panel; U251 : FIG.3C, right panel) was integrated over the 0-10 uM linear Osimertinib range. Error bars for AUC represent standard deviations obtained by bootstrapping (1000 replicates).

[0021] FIG. 4 shows a Western Blot assay for phospho-proteins from U251 GBM cells treated with the indicated concentration of BDTX-1535 (EGFRi) or ST101 for one hour. The combination of BDTX-1535 and ST101 led to increased suppression of PI3 Independent AKT 308 phosphorylation and S6 phosphorylation, compared to BDTX-1535 treatment alone. In addition, ST 101 -mediated phospho-MAPK was increase was reduced by the addition of BDTX-1535.

[0022] FIG. 5A shows tumor volumes for U251 xenotransplants treated with Control (vehicle) or with the indicated Osimertinib dose administered QD (5 mg / kg; 10 mg / kg; 20 mg / kg). Statistics: 1-way ANOVA (****p<0.0001, ***,p<0.001; *,p<0.05; n=5 / group) for volumes at Day 22. Error bars represent standard deviations. FIG. 5B shows relative mouse body weights reported for U251 xenotransplants treated with Control (vehicle) or with the indicated treatment (Osimertinib (Osi), 2 mg / kg QD; subpharmacologic STI 01 (Luc) 10 mg / kg 3x / week; combination (Luc + Osi)). No statistical significance was found by 1-way ANOVA (***,p<0.001;**,P<0.01; *,p<0.05; ns, not significant; n=5 / group) for volumes at Day 30. Error bars represent standard deviations.

[0023] FIG. 6 shows enhanced anti -tumor activity by combination of STI 01 and EGFR suppression in GBM in vivo. Tumor volumes of mice transplanted with U251 cells and treated with Control (vehicle) or with the indicated treatment (Osimertinib (Osi), 2 mg / kg QD; subpharmacologic ST101 (Luc) 10 mg / kg 3x / week; combination (Luc +Sapience.025.WOl PATENTOsi). Statistics indicate 1-way ANOVA (***,p<0.001 ;**,P<0.01 ; *,p<0.05; ns, not significant; n=5 / group) for volumes at Day 30. Error bars represent standard deviations.DETAILED DESCRIPTION OF THE INVENTION

[0024] In order that the present invention can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention is related.

[0025] Any headings provided herein are not limitations of the various aspects or embodiments of the invention, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0026] All references cited in this disclosure are hereby incorporated by reference in their entireties. In addition, any manufacturers’ instructions or catalogues for any products cited or mentioned herein are incorporated by reference. Documents incorporated by reference into this text, or any teachings therein, can be used in the practice of the present invention. Documents incorporated by reference into this text are not admitted to be prior art.I. Definitions

[0027] The phraseology or terminology in this disclosure is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.

[0028] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents, unless the context clearly dictates otherwise. The terms “a” (or “an”) as well as the terms “one or more" and “at least one” can be used interchangeably.

[0029] Furthermore, “and / or” is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” is intended to include A and B, A or B, A (alone), and B (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C”Sapience.025.WOl PATENTis intended to include A, B, and C; A, B, or C; A or B; A or C; B or C; A and B; A and C; B and C; A (alone); B (alone); and C (alone).

[0030] Wherever embodiments are described with the language “comprising,” otherwise analogous embodiments described in terms of “consisting of’ and / or “consisting essentially of’ are included.

[0031] Units, prefixes, and symbols are denoted in their Systeme International d' Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range, and any individual value provided herein can serve as an endpoint for a range that includes other individual values provided herein. For example, a set of values such as 1, 2, 3, 8, 9, and 10 is also a disclosure of a range of numbers from 1-10, from 1-8, from 3-9, and so forth. Likewise, a disclosed range is a disclosure of each individual value (i.e., intermediate) encompassed by the range, including integers and fractions. For example, a stated range of 5-10 is also a disclosure of 5, 6, 7, 8, 9, and 10 individually, and of 5.2, 7.5, 8.7, and so forth.

[0032] Unless otherwise indicated, the terms “at least” or “about” preceding a series of elements is to be understood to refer to every element in the series. The term “about” preceding a numerical value includes ± 10% of the recited value. For example, a concentration of about 1 mg / mL includes 0.9 mg / mL to 1.1 mg / mL. Likewise, a concentration range of about 1% to 10% (w / v) includes 0.9% (w / v) to 11% (w / v).

[0033] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably to refer to polymers of amino acids of any length, and their salts. The polymer can be linear or branched, can comprise modified amino acids, and can be interrupted by non-amino acids. Except where indicated otherwise, e.g., for the abbreviations for the uncommon or unnatural amino acids set forth herein, the three-letter and one -letter abbreviations, as used in the art, are used herein to represent amino acid residues. Except when preceded with a “D” or in lower case, the amino acid is an L-amino acid. Groups or strings of amino acid abbreviations are used to represent peptides. Except where specifically indicated, peptides are indicated with the N-terminus of the left and the sequence is written from the N-terminus to the C-terminus.

[0034] A “retro inverse” peptide has a reversed amino acid sequence, relative to a reference L-amino acid sequence, and is made up of all D-amino acids (inverting the a- center chirality of the amino acid subunits) to help maintain side-chain topology similar to that of the original L-amino acid peptide.Sapience.025.WOl PATENT

[0035] An “isolated” molecule is one that is in a form not found in nature, including those which have been purified.

[0036] An “active agent” is an ingredient that is intended to furnish biological activity. The active agent can be in association with one or more other ingredients. An active agent that is a peptide can also be referred to as an “active peptide.”

[0037] An “effective amount” of an active agent is an amount sufficient to carry out a specifically stated purpose.

[0038] The term “pharmaceutical composition” refers to a preparation that is in such form as to permit the biological activity of the active ingredient to be effective and which contains no additional components that are unacceptably toxic to a subject to which the composition would be administered. Such composition can be sterile and can comprise a pharmaceutically acceptable carrier, such as physiological saline. Suitable pharmaceutical compositions can comprise one or more of a buffer (e.g., acetate, phosphate, or citrate buffer), a surfactant (e.g., polysorbate), a stabilizing agent (e.g., polyol or amino acid), a preservative (e.g., sodium benzoate), and / or other conventional solubilizing or dispersing agents.

[0039] A “subject” or “individual” or “animal” or “patient” or “mammal,” is any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include humans, domestic animals, farm animals, sports animals, and laboratory animals including, e.g., humans, non-human primates, canines, felines, porcines, bovines, equines, rodents, including rats and mice, rabbits, etc.

[0040] A “control patient” is a subject that has not received a treatment of the invention. A “control population” or a “population of control patients” is a group of subjects that have not received a treatment of the invention. A control patient or subject in the control population has the same disease or disorder as the subject being compared to the control patient or control population. For example, a clinical outcome of a cancer patient receiving the compositions or method of the invention is compared with the average (median) outcome of subjects having the same type of cancer who did not receive a pharmaceutical composition or method of the invention. In some embodiments, the control patient or patients in the control population have received a treatment other than a treatment of the invention, for example, a standard-of-care treatment.

[0041] Terms such as “treating” or “treatment” or “to treat” or “alleviating” or “to alleviate” refer to therapeutic measures that cure, slow down, lessen symptoms of, and / orSapience.025.WOl PATENThalt progression of a diagnosed pathologic condition or disorder. In certain embodiments, a subject is successfully “treated” for a disease or disorder if the patient shows total, partial, or transient alleviation or elimination of at least one symptom or measurable physical parameter associated with the disease or disorder.

[0042] An “antagonist” is a substance that prevents, blocks, inhibits, neutralizes, or reduces a biological activity or effect of another molecule, such as a receptor or ligand.

[0043] The terns “inhibit,” “block,” and “suppress” are used interchangeably and refer to any statistically significant decrease in occurrence or activity, including full blocking of the occurrence or activity. For example, “inhibition” can refer to a decrease of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% in activity or occurrence. An “inhibitor” is a molecule, factor, or substance that produces a statistically significant decrease in the occurrence or activity of a process, pathway, or molecule.

[0044] A “tumor” or “solid tumor” is a mass of neoplastic cells, such as cancer cells.The terms “advanced,” “metastatic,” and “advanced / metastatic” are used interchangeably to describe a cancer in which malignant cells have migrated from the original tumor to another location, for example, another organ, in a patient’s body.

[0045] A “neoplastic cell” or “neoplasm” typically has undergone some form of mutation / transformation, resulting in abnormal growth as compared to normal cells or tissue of the same type. Neoplasms include morphological irregularities, as well as pathologic proliferation. Neoplastic cells can be benign or malignant. Malignant neoplasms, i.e., cancers, are distinguished from benign in that they demonstrate loss of differentiation and orientation of cells, and have the properties of invasion and metastasis. II. Peptides and CompositionsC / EBPB

[0046] C / EBPp represents a prime target for development of peptide anatagonists, due to its reliance on basic leucine zipper (bZIP) interactions with co-factors. In order to associate with DNA and transactivate gene expressions, C / EBPP dimerizes with binding partners via interactions between their bZIP domains. In addition to homodimerization, C / EBPP forms heterodimers with bZIP-containing transcription factors such as Jun / Fos, C / EBPy (Huggins 2013), delta-interacting protein A (Bezy 2005), and the CREB / ATF family (Zhao 2014).Sapience.025.WOl PATENT

[0047] Activating transcription factor 5 (ATF5) is a CREB / ATF factor that has been determined to associate with and activate C / EBPp in HEK293 and HCT116 cancer cells, resulting in transactivation of a pro-survival phenotype (Zhang 2015). ATF5 is highly expressed in many cancers, including glioma, where it contributes to the oncogenic phenotype by driving the overexpression of Bcl-2 family proteins and survivin, but is largely not found in differentiated cell types (Sheng 2010). Overexpression of the truncated bZIP domain of ATF5 lacking a DNA-binding domain in glioma and other tumor cells resulted in cancer cell cytotoxicity (Angelastro 2006); administration of a peptide containing the truncated bZIP domain produced similar results (Cates 2016; Karpel-Massler 2016).C / EBPB Antagonist Peptides

[0048] In some embodiments, methods of the invention comprise treating a patient having a GBM with combination therapy comprising an effective amount of a peptide antagonist of C / EBPP and an EGFRi. In one embodiment, the peptide antagonist of C / EBPP comprises the D-amino acid sequence VAEAREELERLEARLGQARGEL (SEQ ID NO: 1), which is a retro inverse variant of the wild-type ATF5 bZIP domain. Peptide antagonists of C / EBPP can be designed, for example, as described in Example 1 of WO 2021 / 262604.

[0049] The peptide antagonist of C / EBPp can be a cell-penetrating peptide. In one embodiment, the peptide comprises a cell-penetrating domain. Numerous cellpenetrating peptide sequences are described and characterized in the literature (see WO 2019 / 136125). In one embodiment, the peptide is a cyclic peptide. Cyclized peptides, for example, using hydrocarbon staples (Bernal 2007; Bird 2016) or other cyclization methods known in the art, can enter cells via passive diffusion, endocytosis / endosomal escape, or other mechanisms (Dougherty 2019). Peptides can also be delivered to cells via mechanisms that exploit cellular receptors, for example, integrin-targeting, RGD-like sequences. Alternatively, peptides can be encapsulated and delivered to cells in vesicles, such as exosomes or liposomes, or in micelles.

[0050] The ability of a peptide based on the native ATF5 bZIP domain to antagonize the activity of C / EBP[3 can be measured by methods described, for instance, in Example 2 of WO 2021 / 262604. The cytotoxic activity of a peptide antagonist of C / EBP|3 can be measured in vitro by known assays and / or in vivo using known tumor models; for example, WO 2019 / 136125 describes such assays and models.Sapience.025.WOl PATENT

[0051] Lucicebitide (also known as ST101) is an all D-amino acid peptide that displays potent anti-tumor activity in vitro and in vivo and resistance to proteolytic degradation. Cytotoxicity of ST101 has been demonstrated in numerous cell types, including HL60 (promyelocytic leukemia), AML14 (acute myeloid leukemia), SET2 (megakaryoblastic leukemia), A375 (melanoma), MCF7 (breast carcinoma), U87 (glioblastoma), U251 (glioblastoma), DU145 (prostate cancer), A549 (lung cancer), peripheral blood mononuclear cells (PBMC), and bone marrow mononuclear cells (BMMC) (see WO 2019 / 136125). In addition, subcutaneous administration of ST101 in xenograft mouse model using A375, HL60, MCF7, and U251 cells resulted in significant reduction in tumor volume (see WO 2019 / 136125).

[0052] ST101 is comprised of modified domains based on the ATF5 bZIP domain and on the Antennapedia penetratin domain, to allow for cell penetration. The D-amino acid sequence of ST101 is VAEAREEEEREEAREGGARGEEKKWKMRRNQFWLKLQR (SEQ ID NO: 2), with the cell-penetrating region italicized. ST101 promotes cytotoxic activity in tumor cells by disrupting the association of C / EBPP with anti-apoptotic transcription factors (see WO 2021 / 262604).

[0053] We demonstrate for the first time that that inhibition of EGFR is synthetic lethal with ST101 treatment in GBM cells.Methods of Preparing C / EBPB Antagonists

[0054] Peptide antagonists of C / EBPP can be chemically synthesized, for example, using solid-phase peptide synthesis or solution-phase peptide synthesis, or a combination of both. Synthesis may optionally occur as fragments of the peptide that are subsequently combined either chemically or enzymatically. Alternatively, peptide antagonists of C / EBPP can be expressed using recombinant methods.

[0055] Peptides can be purified using methods that include, for example, reversephase high-performance liquid chromatography (RP-HPLC), multicolumn countercurrent solvent gradient purification (MCSGP), and ion-exchange chromatography.III. EGFR Inhibitors

[0056] The methods of the invention involve combination therapy comprising administration of a C / EBPP antagonist and an EGFRi. Mutations in the EGFR familySapience.025.WOl PATENTmembers are associated with various cancers, including GBM (Zubair 2023; Tomoszkova 2024).

[0057] EGFRi can include, for example, monoclonal antibodies to EGFR and small molecule inhibitors, such as tyrosine kinase inhibitors.

[0058] Non-limiting examples of small molecule EGFRi include afatinib, almonertinib, avitinib, BDTX-1535, brigatinib, canertinib, dacomitinib, erlotinib, gefitinib, icotinib, lapatinib, lazeitinib, mobocertinib, naquotinib, nazartinib, neratinib, ohnutinib, osimeritinib, pelitinib, pyrotinib, rociletinib, simotinib, and vandetanib. In one embodiment, the EGFRi is selected from the group consisting of afatinib, BDTX-1535, and osimertinib.

[0059] In some embodiments, the pharmaceutical composition comprising the EGFRi can comprise more than one EGFRi.IV. Compositions and Administration

[0060] In certain aspects, the invention provides a combination approach comprising administration of a composition, e.g., a pharmaceutical composition, comprising an effective amount of a peptide antagonist of C / EBPp, such as lucicebitide (ST101), and administration of composition, e.g., a pharmacal composition, comprising an effective amount of an EGFRi. Methods of administering peptide antagonists of C / EBPP are described, for example, in WO 2021 / 262604.

[0061] Because the combination therapy of the invention demonstrates synergism between the C / EBPp antagonist and the EGFRi, the effective amount of each active agent can, in some embodiments, be lower than the effective amount when each active agent is administered individually. For example, the effective amount of each of the peptide antagonist of C / EBPp and the EGFRi may be a sub-therapeutic dose.

[0062] The peptide antagonist of C / EBPp is dosed based on the patient's weight. The peptide antagonist of C / EBPp, such as ST101, can be administered to a patient at a dose of about 0.5 mg / kg to about 16 mg / kg. In certain embodiments, ST101 is administered at a dose of about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 10 mg / kg, about 12 mg / kg, about 14 mg / kg, or about 16 mg / kg. These amounts can also serve as endpoints for a range of doses to beSapience.025.WOl PATENTadministered, for example, about 0.5 mg / kg to about 8 mg / kg, about 2 mg / kg to about 4 mg / kg, etc.

[0063] Alternatively, the peptide antagonist C / EBPp can be administered at a fixed dose. The peptide antagonist of C / EBP0, such as ST101, can be administered to a patient at a dose of about 100 mg to about 1500 mg. In certain embodiments, ST101 is administered at a dose of about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, or about 1500 mg. These amounts can also serve as endpoints for a range of doses to be administered, for example, about 600 ng to about 1100 mg, about 750 mg to about 900 mg, etc.

[0064] The composition comprising a peptide antagonist of C / EBP0 is preferably administered parenterally. Parenteral routes of administration include intravenous (IV), intramuscular, intraperitoneal, intrathecal, and subcutaneous. In certain embodiments the composition comprising the peptide antagonist of C / EBPP is administered to the subject by intravenous infusion.

[0065] Most commonly, the composition comprising a peptide antagonist of C / EBPP and the composition comprising the EGFRi can be the same composition or can be different compositions. If the peptide antagonist and the EGFRi are comprised in separate compositions, the compositions can be administered to the subject at the same time or at different times, including on different days.

[0066] Each of the composition comprising a peptide antagonist and the composition comprising an EGFRi is typically administered to the subject more than once. In one embodiment, administration of the peptide antagonist of C / EBPP can occur once weekly for a duration of at least three weeks (i.e., three administrations), six weeks (z'.e., six administrations), nine weeks, twelve weeks, three months, six months, nine months, or twelve months. In another embodiment, administration can occur once every two weeks for a duration of at least four weeks (i.e., two administrations), eight weeks (i.e., four administrations), twelve weeks, three months, six months, nine months, or twelve months. In some embodiments, a patient can be administered the peptide antagonist of C / EBPP once weekly for a duration of at least three weeks, six weeks, nine weeks, twelve weeks, three months, six months, nine months, or twelve months, followed by administrationSapience.025.WOl PATENTonce every two weeks for at least four weeks, eight weeks, twelve weeks, three months, six months, nine months, or twelve months.

[0067] In one embodiment, administration of the EGFRi can occur at least once weekly for a duration of at least three weeks (e.g., three administrations), six weeks (e.g., six administrations), nine weeks, twelve weeks, three months, six months, nine months, or twelve months. In another embodiment, administration can daily for a duration of at least about: four weeks, six weeks, eight weeks, twelve weeks, three months, six months, nine months, or twelve months.

[0068] For purposes of the present disclosure, “combination therapy” means that the treatment period comprising administration of the peptide antagonist of C / EBPP overlaps with the treatment period comprising administration of the EGFRi.V. Methods of Use

[0069] Subjects in need of the methods of the invention are patients diagnosed with GBM. For example, the subject can have a primary GBM or a secondary GBM.

[0070] In one embodiment, the GBM harbors one or more abnormalities in C / EBP0, wherein C / EBPP is overexpressed or overactivated.

[0071] In one embodiment, the GBM harbors one or more abnormalities in one or more members of an EGFR signaling pathway. In some embodiments, the abnormality is a gain-of-function mutation. In a particular embodiment, the abnormality is a gain-of- function mutation in at least one of c-Met, cyclin-dependent kinase 4 (CDK4), EGFR, murine double minute 2 (MDM2), murine double minute 4 (MDM4), platelet-derived growth factor receptor alpha (PDGFRA), or phosphatidylinositol-4,5-bisphosphate 3- kinase catalytic subunit alpha (PI3KCA). In one embodiment, the GBM comprises EGFR variant III (EGFRvIII), wherein exons 2-7 of the EGFR gene are deleted (Gan 2013). This deletion results in a truncated EGFR protein that lacks the extracellular ligandbinding domain. Accordingly, the receptor is constitutively active, resulting in uncontrolled cell growth, survival, and invasion.

[0072] Efficacy of treatment can be evaluated by one or more known measures. For example, patients subjected to methods of the invention can experience outcomes including extended survival, improved progression-free survival, improved duration of response, longer remission, reduced risk of relapse, and / or improved tumor response to treatment with the combination therapy of the invention, compared with the sameSapience.025.WOl PATENToutcome(s) in patients not subjected to methods of the invention, i.e., control patients. An outcome in a patient treated by a method of the invention can be compared, for example, to the median outcome in a population of control patients. The population of control patients can be administered, for example, a regimen selected from the group consisting of a placebo, surgery, radiation, chemotherapy, immunotherapy, hormone-based therapy, or targeted therapy. In another embodiment, a patient subjected to the combination therapy of the invention can be compared to a population of control patients administered treatment with only one of a peptide antagonist of C / EBPfl or an EGFRi. Comparisons can be analyzed statistically using, for example, the Wilcoxon signed rank test or the Kaplan-Meier method.

[0073] Response to treatment compares one or more measures of efficacy after a treatment regimen, as compared to baseline, e.g., prior to treatment with combination therapy. A baseline assessment is preferably performed within 24, 48, or 72 hours, or within 1, 2, 3, or 4 weeks prior to the first treatment. In a one preferred embodiment, a baseline assessment is performed within 24 hours prior to the first treatment.

[0074] “Tumor burden” is the total mass or total size of cancerous tissue in a patient's body. Tumor response can be evaluated by measures including objective response rate, disease control rate, and duration of response. These parameters can be determined, for example, by modified response assessment in neuro-oncology (mRANO) (Ellingson 2017).

[0075] Objective response rate assesses reduction of tumor size, for example, tumor diameter, which can be determined by clinical examination and / or imaging. Where a patient has multiple tumors, tumor size can optionally be expressed as the average diameter of all tumors or by the sum of diameters of all tumors. Imaging methods include computed tomography (CT), typically with contrast; X-ray; magnetic resonance imaging (MRI); and positron emission tomography (PET), such as (18)F-fluorodeoxy glucose PET. In one embodiment, MRI, such as gadolinium-enhanced MRI, is utilized to assess tumor response. Accordingly, in one aspect, the invention provides a method of reducing tumor burden, i.e., tumor mass and / or tumor size, in a patient, the method comprising administering to the patient combination therapy comprising a peptide antagonist of C / EBPP, such as ST101, and an EGRFi. Reduction in tumor burden is measured relative to baseline.Sapience.025.WOl PATENT

[0076] Duration of response is the length of time from the achievement of a response until disease progression, i.e., the period in which a tumor does not grow or spread, or death. Duration of response in patients receiving combination therapy of the invention can be, for example, at least 4, 6, 8, 10, or 12 weeks, at least 4, 6, 8, 10, 12, 16, 18, or 24 months, or at least 3, 4, or 5 years. Accordingly, in one aspect, the invention provides a method of increasing the duration of response in a patient, the method comprising administering to the patient combination therapy comprising a peptide antagonist of C / EBPp and an EGFRi. Increase in duration of response is measured relative to the median duration of response in a control population.

[0077] Survival can be assessed as overall survival, i.e., the length of time a patient lives, or as progression-free survival, i.e., the length of time a patient is treated without progression or worsening of the disease. Survival can be measured from the date of diagnosis or from the date that treatment commences. Overall survival, median overall survival, progression-free survival, and median progression-free survival can be calculated, for example, by Kaplan-Meier analysis, based on the response to treatment. Accordingly, in one aspect, the invention provides a method of increasing overall survival in a patient, the method comprising administering to the patient combination therapy comprising a peptide antagonist of C / EBPp and an EGFRi. Increase in overall survival is measured relative to the median overall survival in a control population. In another aspect, the invention provides a method of increasing progression-free survival in a patient, the method comprising administering to the patient combination therapy comprising a peptide antagonist of C / EBPP and an EGFRi. Increase in progression-free survival is measured relative to the median progression-free survival in a control population.

[0078] A patient is successfully treated according to the methods of the invention if the patient experiences or displays at least one of the following outcomes after administration of combination therapy:- undetectability of the tumor (or at least one tumor, if multiple tumors are present at baseline);- at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction in tumor size compared to baseline;- no significant increase (e.g., less than 20%) in tumor size compared to baseline;- significantly increased duration of response, optionally compared with median durationSapience.025.WOl PATENTof response of a population of control patients;- significantly increased progression-free survival, optionally compared with median progression-free survival of a population of control patients;- significantly increased overall survival, optionally compared with median overall survival of a population of control patients.EXAMPLES

[0079] Embodiments of the present disclosure can be further defined by reference to the following non-limiting examples. It will be apparent to those skilled in the art that many modifications, both to materials and methods, can be practiced without departing from the scope of the present disclosure.Example 1. Combination of Antagonist of C / EBPp and EGFRi Has Synergistic Effects

[0080] We investigated whether STI 01 (lucicebtide) can synergize with targeted therapeutic strategies against genetic dependencies or immune checkpoints in GBM. Publicly available datasets of GBM patients show that more than 5% have gain-of- function mutations in at least one of the CDK4, c-MET, EGFR, MDM2, MDM4, PDGFR, or PI3KCA genes. We adopted a synthetic lethal CRISPR screen approach, in which gain-of-function drivers were suppressed in the presence or absence of ST101 in two genetically characterized GBM cell lines (FIG. 1).

[0081] Briefly, two human GBM cell lines (T98G and U251) were transduced with a lentiviral vector encoding CAS9 and the selection marker for blasticidin. Cells were selected and tested for CAS9 expression in a Western blot. sgRNAs were chosen from the VBC database prediction as the top ranked target sequences targeting different exons (Kaneda 2016). Two independent target sequences for each target gene were used:EGFR_A: GATGTTCAATAACTGTGAGGTGG (SEQ ID NO: 3); EGFR_B:GATGTGGAGATCGCCACTGATGG (SEQ ID NO: 4); and PCNA:ATACGTGCAAATTCACCAGAAGG (SEQ ID NO: 5) and were cloned in a lentiviral vector encoding dsRed or EGFP fluorescence markers alongside puromycin. Lentiviruses were produced by transient transfection in LentiX packaging cells and used to transduce CAS9-containing pools. For control, a neutral sequence previously identified was used (Breasson 2017). Infection and selection for the sgRNA vectors followed the previously described protocol. The resulting pools were selected by puromycin. Suppression of the target gene was confirmed by Western blot.Sapience.025.WOl PATENT

[0082] EGFP-tagged pools targeting a neutral genome region (control) or EGFR (two pools with distinct sgRNAs - EGFR A and EGFR B) were mixed at 50:50 ratio with a tagRed-infected control pool and treated with increasing concentrations of ST101 for one week. EGFR sgRNA produced nearly complete suppression of EGFR protein expression as assessed by Western Blot in both cell lines (FIG.2A, left panel; FIG.2B, left panel). The normalized EGFP:tagRed ratio was then used to measure the fitness of EGFR knockout cells exposed to ST101 compared to control cells under the same conditions.

[0083] The fitness of EGFR knockout cells substantially decreased in the presence of ST101, reaching -70% and -60% depletion (****p<0.0001) compared to untreated controls in T98G EGFR A and EGFR B respectively (FIG.2A, right panel; FIG.2B, right panel; statistics: 2-way ANOVA T-test with Dunnett’s correction). In contrast, no difference in the control mixtures ratio was observed in either T98G or U251 cell lines. Similar levels of synthetic lethality were observed in U251 cells ((FIG.2A, right panel;FIG. 2B, right panel). These data indicate that sensitivity to ST 101 is enhanced by EGFR depletion and point to a targetable co-dependency of the EGFR / C / EBP0 axis.

[0084] We confirmed these findings by performing checkerboard assays of STI 01 in combination with three chemically distinct EGFR inhibitors, BDTX-1535, osimertinib, and afatinib. For these assays, T98G and U251 cells were plated in 96 wells, treated with ST101 concentrations ranging from 0 to 2.5 pM, each of the EGFR TKIs ranging from 0 to 10 pM or the combination of STI 01 and TKI. Dose responses were measured at 48hrs by Annexin-V / Sytox Red flow cytometry assay and in parallel by TiterGlo. Synergy was measured using Combenefit by the BLISS method (27,29). Combination with ST101 was potently synergic with all three inhibitors regardless of the assay used (FIG.3A).

[0085] To quantitate the effect of the synergy, dose response curves were fitted and the osimertinib ECio (T98G) and EC20 (U251) were evaluated with and without ST101. These effective concentrations were chosen because they were close to the max effect achieved by 10 uM Osimertinib alone (FIG.3B, FIG.3C). Data indicate that 1.25 pM ST101 induced a 1.9-fold decrease in osimertinib IC20 in T98G and a 3.2-fold decrease in IC10 in U251 (FIG.3B, middle panel; FIG.3C, middle panel) compared to osimertinib alone. Accordingly, 1.25 pM ST101 resulted in a 35% decrease in the AUC in T98G cells and 25% decrease in the U251 line (FIG.3B, right panel; FIG.3C, right panel). These results demonstrate that pharmacological EGFR inhibition is synergistic withSapience.025.WOl PATENT STI 01 and suggests the feasibility of STI 01 -EGFR TKI combination strategies for GBM patients with EGFR mutations.Example 2. Combination of Antagonist of C / EBPp and EGFRi Increases AKT Suppression

[0086] We further characterized the mechanism of action of the EGFRi-STlOl combination on known signal transducers of EGFR in the presence or absence of STI 01 (FIG.4). Briefly, cells were seeded at 200,000 cells / well in 6-well format and left untreated or treated with the indicated concentrations of ST101 and / or the EGFRi, BDTX-1535. After one hour, cells were recovered and lysed in Tritoncontaining buffer. Protein levels were quantified by bicinchoninic acid (BCA) assay, and samples were subjected to SDS-PAGE and blotted to polyvinylidene difluoride membranes. Western blotting was performed using antibodies to the indicated proteins, and visualized by chemiluminescence. Results are shown in FIG.4.Example 3. Biomarker Analysis Identifies Potential Target Populations for Combination Treatment

[0087] We explored the relationship between transcriptional signatures of C / EBPp activity and EGFR mutational profile in publicly available GBM datasets, identifying potential genetic biomarkers for prediction of maximal efficacy of this combination. To test the relationship between EGFR alterations and C / EBPP activity, we scoredl60 GBMs from the publicly available TCGA-GBM dataset, for which annotation of EGFR alterations and RNAseq profiles were both available. For C / EBPP expression, samples were scored as “High” or “Low,” according to the median C / EBPP transcript expression. For EGFR status, samples were scored as “Mutated” or “Wild-Type,” for the presence of any EGFR deletion rearrangement, including the EGFRvIII mutant and other minor deletion variants.

[0088] Contingency analysis revealed that C / EBPP-High tumors are markedly enriched in EGFR-mutants (44 mutated vs. 36 wild-type; ratio 1.22), compared to C / EBPP-Low cases that were observed in 30 EGFR-mutants and 51 wild-type GBMs (ratio 0.58; Fisher’ Exact Test, p=0.027). This analysis indicates mutual fitness between the most prominent EGFR alteration, EGFRvIII, and C / EBPP activity in GBM.Sapience.025.WOl PATENTExample 4. Combination of Antagonist of C / EBPp and EGFRi Displays Anti-Thmor Activity in a Xenograft Model of GBM

[0089] We investigated combination efficacy of ST101 and Osimertinib in vivo in aU251 GBM xenograft model, Five million U251 cells were mixed 1:1 with Matrigel (Corning) and injected in the right flank of 5-6-week-old Nu / J female mice. One week after injection, mice with detectable tumors were randomly assigned to treatment or control cohorts so that mean of tumor volume was within one SEM for all cohorts.Tumors were tracked by bi-weekly caliper measurements and volumes calculated as previously described (Suarez-Carmona 2021).

[0090] Tumor-bearing mice were treated with sub-pharmacologic dosing regimen of Osimertinib (FIG. 5A) and ST101 (Suarez-Carmona 2021). Specifically, mice were treated with vehicle as control (10% DMSO in PBS), sub-pharmacologic Osimertinib (2.5 mg / kg QD), sub-pharmacologic ST101 (10 mg / kg 3x / week), or ST101 in combination with Osimertinib. Tumor volumes were evaluated every 3 days for 30 days.

[0091] Sub-pharmacologic dosing of either compound alone did not yield a significant difference in tumor volumes vs. control (FIG. 6, control vs Osimertinib, p=0.71; control vs ST101, p=0.54). Conversely, the ST101 and Osimertinib combination resulted in 73% tumor growth inhibition (TGI) at day 30 compared to control (p=0.0007), and 66% and 68% TGI compared to monotherapy (Osimertinib vs combination, p=0.006; and ST101 vs combination, p=0.011). None of these regimens significantly impacted relative body weight during the course of the treatment (FIG. 5B).

[0092] Combination efficacy was attributed to direct activity on tumor cells, as minimal host macrophages are present in this model. Thus, in vivo data are consistent with in vitro genetic and pharmacologic checkerboard assays and support the combination of ST101 and EGFR inhibition as a potential therapeutic option for the population of GBM patients that harbor EGFR mutations.REFERENCESAngelastro JM, et al. Selective destraction of glioblastoma cells by interference with the activity or expression of ATF5. Oncogene 2006; 25: 907-916.Bernal F, et al. Reactivation of the p53 Tumor Suppressor Pathway by a Stapled p53 Peptide. J. Am. Chem. Soc. 2007; 129:2456-2457.Sapience.025.WOl PATENTBezy O, et al. Delta-interacting protein A, a new inhibitory partner of CCAAT / enhancer-binding protein beta, implicated in adipocyte differentiation. J Biol Chem 2005; 280: 11432-11438.Bird GH, et al. Biophysical Determinants for Cellular Uptake of Hydrocarbon-Stapled Peptide Helices. Nat. Chem. Biol. 2017; 12:845-852.Breasson L, et al. PI3Ky activity in leukocytes promotes adipose tissue inflammation and early-onset insulin resistance during obesity. Sci Signal. 2017; 10: eaaf2969.Cates CC, et al. Regression / eradication of gliomas in mice by a systemically-deliverable ATF5 dominant-negative peptide. Oncotarget 2016; 7: 12718-12730.Dougherty PG, et al. Understanding Cell Penetration of Cyclic Peptides. Chem. Rev. 2019; 119(17): 10241-10287.Ellingson B, et al. Modified Criteria for Radiographic Response Assessment in Glioblastoma Clinical Trials. Neurotherapeutics. 2017; 14:307-320.Gan HK, et al. The epidermal growth factor receptor variant III (EGFRvIII): where wild things are altered. FEBS J. 2013; 280: 5350-5370.Homma J, et al. Increased expression of CCAAT / enhancer binding protein beta correlates with prognosis in glioma patients. Oncol Rep 2006; 15: 595-601.Huggins CJ, et al. C / EBPgamma suppresses senescence and inflammatory gene expression by heterodimerizing with C / EBPbeta. Mol Cell Biol 2013; 33: 3242-3258.Kaneda MM, et al. PI3Ky is a molecular switch that controls immune suppression. Nature 2016; 539: 437-42.Karpel-Massler G, et al. A Synthetic Cell-Penetrating Dominant -Negative ATF5 Peptide Exerts Anticancer Activity against a Broad Spectrum of Treatment-Resistant Cancers. Clin Cancer Res 2016; 22: 4698-4711.Ruffell D, et al. CREB-C / EBPB cascade induces M2 macrophage-specific gene expression and promotes muscle injury repair. PNAS. 2009; 106:17475-17480.Sheng Z, et al. An activating transcription factor 5-mediated survival pathway as a target for cancer therapy? Oncotarget 2010; 1: 457-460.Suarez-Carmona M, et al. Combined inhibition of CXCL12 and PD-1 in MSS colorectal and pancreatic cancer: modulation of the microenvironment and clinical effects. J Immunother Cancer 2021; 9: e002505.Tomoszkova S, et al. Potential Diagnostic and Clinical Significance of Selected Genetic Alterations in Glioblastoma. Int. J. Mol. Sci. 2024; 25:4438.Zhang ZY, et al. Stabilization of ATF5 by TAKl-Nemo-like kinase critically regulates the interleukin- 1 beta-stimulated C / EBP signaling pathway. Mol Cell Biol 2015; 35: 778-788.Sapience.025.WOl PATENTZhao Y, et al. p300-dependent acetylation of activating transcription factor 5 enhances C / EBPbeta transactivation of C / EBPalpha during 3T3-L1 differentiation. Mol Cell Biol 2014; 34: 315-324.Zubair T, et al. Small Molecule EGFR Inhibitors as Anti-Cancer Agents: Discovery, Mechanisms of Action, and Opportunities. Int. J. Mol. Sci. 2023; 24:2651.The present invention is further described by the following claims.

Claims

Sapience.025.WOl PATENT CLAIMS1. A method of treating a glioblastoma (GBM) in a subject, the method comprising combination therapy with: (i) a pharmaceutical composition comprising an effective amount of a peptide antagonist of CCAAT-enhancer-binding protein 0 (C / EBP0) and (ii) a pharmaceutical composition comprising an effective amount of an epidermal growth factor receptor (EGFR) inhibitor; wherein the pharmaceutical composition comprising the antagonist of C / EBP0 and the pharmaceutical composition comprising the EGFR inhibitor (EGFRi) are administered to the subject together or separately.

2. The method of claim 1, wherein the GBM comprises a gain-of-function mutation in a member of the EGFR pathway.

3. The method of claim 1, wherein the GBM comprises a gain-of function mutation in a gene selected from the group consisting of c-Met, cyclin-dependent kinase 4 (CDK4), EGFR, murine double minute 2 (MDM2), murine double minute 4 (MDM4), platelet-derived growth factor receptor alpha (PDGFRA), and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PI3KCA).

4. The method of claim 1, wherein the GBM comprises EGFRvIII.

5. The method of claim 1, wherein the peptide antagonist comprises the D-amino acid sequence VAEAREELERLEARLGQARGEL (SEQ ID NO: 1).

6. The method of claim 1, wherein the peptide antagonist is a cell-penetrating peptide.

7. The method of claim 1, wherein the peptide antagonist is ST101.

8. The method of claim 1, wherein the peptide antagonist is administered to the subject at a dose of about 0.5-16 mg / kg.

9. The method of claim 1 , wherein the peptide antagonist is administered to the subject at a dose of about 500 mg.

10. The method of claim 1, wherein the EGFRi is a tyrosine kinase inhibitor.

11. The method of claim 1 , wherein the EGFRi is selected from the group consisting of afatinib, osimeritinib, almonertinib, avitinib, BDTX-1035, brigatinib, canertinib, dacomitinib, erlotinib, gefitinib, icotinib, lapatinib, lazertinib, mobocertinib,Sapience.025.WOl PATENTnaquotinib, nazartinib, neratinib, olmutinib, pelitinib, pyrotinib, rociletinib, simotinib, and vandetanib.

12. The method of claim 1, wherein the EGFRi is selected from the group consisting of BDTX-1535, osimertinib, and afatinib.

13. The method of claim 1, wherein the pharmaceutical composition comprising the EGFRi comprises more than one EGFRi.

14. The method of claim 1, wherein the pharmaceutical composition comprising the antagonist of C / EBPP is administered intravenously.

15. The method of claim 1, wherein the pharmaceutical composition comprising the antagonist of C / EBPp and the pharmaceutical composition comprising the EGFRi are administered to the subject on different days.

16. The method of claim 1, wherein the pharmaceutical composition comprising the antagonist of C / EBPP is administered once weekly for at least three weeks.

17. The method of claim 1, wherein the pharmaceutical composition comprising the antagonist of C / EBPP is administered once every two weeks for at least four weeks.

18. A pharmaceutical composition comprising an effective amount of a peptide antagonist of CCAAT-enhancer-binding protein P (C / EBPP) and a pharmaceutical composition comprising an effective amount of an epidermal growth factor receptor (EGFR) inhibitor for use in a method of combination therapy for treating a glioblastoma (GBM) in a subject.

19. The pharmaceutical composition of claim 18, wherein the antagonist of C / EBPP is ST101.

20. The pharmaceutical composition of claim 19, wherein ST101 is administered intravenously at a dose of about 500 mg.