Methods and compositions for antisense cancer therapeutics

Abstract

This invention relates to agents, compositions and methods for treating cancer with antisense agents for suppressing expression of MALT1 and isoforms of TGF-β, as well as modulators of IRAK4, TRIM5, HIF1A, TRIM22, IRF5, and PARP9. Agents and therapies include antisense agents for suppressing expression of MALT1. Synergistic therapies further include agents, compositions and methods for treating cancer with an agent for suppressing expression of MALT1 in combination with agents for suppressing expression of isoforms of TGF-β, as well as the other gene modulators.

Description

Docket No. 018988-034WO1METHODS AND COMPOSITIONS FOR ANTISENSE CANCER THERAPEUTICS SEQUENCE LISTING

[0001] This application includes a sequence listing submitted electronically as an ST.26 file created on March 22, 2026, named 018988-034W01_SL.xml, which is 33,802 bytes in size.TECHNICAL FIELD

[0002] This invention relates to agents, compositions and methods for treating cancer with antisense agents for suppressing expression of MALT1 and TGF-P, as well as modulators of IRAK4, TRIM5, HIF1A, TRIM22, IRF5, and PARP9. Agents and therapies include antisense agents for suppressing expression of MALT1. Synergistic therapies further include agents, compositions and methods for treating cancer with an agent for suppressing expression of MALT 1 in combination with agents for suppressing expression of TGF-p. Agents for suppressing expression of TGF-P may be selective for TGF-P2 alone, all of TGF-pi, TGF-P2 and TGF-P3, or TGF-pi and TGF-P2, or TGF-P2 and TGF-P3. The agents and compositions can be used in combination with chemotherapy and other standard-of-care therapies.BACKGROUND

[0003] Cancer is a complex pathology involving multiple variant cellular pathways. Because of this complexity, many anti-cancer drugs have limited or partial therapeutic effectiveness.

[0004] Drawbacks of conventional therapies include lack of efficacy as determined by overall survival.

[0005] Further drawbacks of conventional therapies include significant unwanted side effects such as killing healthy cells in addition to killing cancer cells.

[0006] Additional drawbacks of anti-cancer agents include high toxicity at required levels of therapeutic administration.

[0007] What is needed are methods, agents and uses for cancer diseases to increase efficacy, and reduce toxicity and unwanted side effects.

[0008] Therapeutic compositions of different agents are needed to supply significant antitumor effects and cancer immunotherapeutic effects and which can reduce side effects and adverse health effects. There is an urgent need for improved agents and compositions for synergistic effects.Docket No. 018988-034WO1BRIEF SUMMARY

[0009] This invention relates to agents, compositions and methods for treating cancer with antisense agents for suppressing expression of MALT1 and TGF-P, as well as modulators of IRAK4, TRIM5, HIF1A, TRIM22, IRF5, and PARP9.

[0010] Provided herein are agents and therapies utilizing antisense agents for suppressing expression of MALTl.

[0011] Embodiments of this invention provide synergistic therapies which include agents, compositions and methods for treating cancer with an agent for suppressing expression of MALTl in combination with agents for suppressing expression of TGF-P isoforms.

[0012] Synergistic therapies include use of agents, compositions and methods for treating cancer with an agent for suppressing expression of MALTl in combination with agents for suppressing expression of TGF-p. The agents for suppressing expression of TGF-P isoforms may be selective for TGF-P2 alone, all three of TGF-pi, TGF-P2 and TGF-P3, or two forms TGF-P 1 and TGF-P2, or two forms TGF-P2 and TGF-P3.

[0013] Additional embodiments of this disclosure provide agents, compositions and methods for treating cancer with antisense agents in combination with modulators of one or more of IRAK4, TRIM5, HIF1A, TRIM22, IRF5, and PARP9.

[0014] The agents and compositions of this invention can be used in combination with chemotherapy, cancer standard-of-care therapies, and other cancer drugs.

[0015] In some embodiments, methods and therapeutic strategies of this invention can increase efficacy, as well as reduce toxic side effects and adverse health effects in cancer treatment.

[0016] Embodiments of this invention include the following:

[0017] An antisense agent for suppressing expression of MALTL

[0018] A composition comprising an antisense agent for suppressing expression of MALTl and a carrier for use in the preparation of a cancer medicament or for use in treating or ameliorating the symptoms of cancer in a subject.

[0019] A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a composition comprising an antisense agent for suppressing expression of MALTl and a carrier; and administering a therapeutically sufficient amount of the composition to the subject.Docket No. 018988-034WO1

[0020] The agent, composition or method above, wherein the cancer is a multiple myeloma, a gastric cancer, a glioma, a glioblastoma, a diffuse midline glioma (DMG), a pancreatic cancer, a melanoma, a skin cancer, a lung cancer, a breast cancer, a prostate cancer, a colorectal cancer, a kidney cancer, a stomach cancer, an ovarian cancer, a cervical cancer, or a liver cancer.

[0021] The agent, composition or method above, wherein the cancer is multiple myeloma or gastric cancer.

[0022] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 transcript and 15-30 nucleotides in length.

[0023] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.

[0024] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 transcript as in Table 1.

[0025] The agent, composition or method above, comprising a MALT 1 -specific antisense oligonucleotide as in Table 1 having one or more nucleotides chemically modified as a phosphorothioate intemucleoside linkage, a methoxypropylphosphonate internucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’ -4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5-methylcytodine base.

[0026] The agent, composition or method above, wherein the agent, medicament or administration comprises MALT 1 -specific antisense oligonucleotides:chemically-modified AGACGCCATCAACACTTCTC SEQ ID NO: 15; or A*G*A*C*G*C*C*A*T*C*A*A*C*A*C*T*T*C*T*C SEQ ID NO:16.

[0027] The agent, composition or method above, wherein the agent, medicament or administration comprises MALT 1 -specific antisense oligonucleotides:chemically-modified GGAGCTTTGAGCTTGGGGTG SEQ ID NO: 17; or G*G*A*G*C*T*T*T*G*A*G*C*T*T*G*G*G*G*T*G SEQ ID NO:18.

[0028] The agent, composition or method above, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.Docket No. 018988-034WO1

[0029] The agent, composition or method above, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.

[0030] The agent, composition or method above, wherein the agent, composition or method is substantially free of excipients.

[0031] The agent, composition or method above, wherein the agent, composition or method is stable for at least 14 days in carrier at 37°C.

[0032] The agent, composition or method above, wherein the agent, composition or method is combined with a standard of care treatment for the cancer.

[0033] The agent, composition or method above, wherein the agent, composition or method is for use or administration by infusion, injection, or intracranial continuous infusion.

[0034] The agent, composition or method above, comprising one or more additional medicaments selected from a cancer growth blocker, a targeted cancer drug, an angiogenesis inhibitor, a histone deacetylase inhibitor, a hedgehog blocker, an mTOR inhibitor, a p53 inhibitor, a PARP inhibitor, a proteasome inhibitor, a tyrosine kinase inhibitor, and an EGFR tyrosine kinase inhibitor.

[0035] The agent, composition or method above, in combination with one or more of everolimus, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, bevacizumab, belzutifan, dabrafenib, trametinib, TMZ, and radiation therapy.

[0036] The agent, composition or method above, wherein the agent, composition or method increases an overall survival rate of the subject at month 6, 12, 18, 24, 30, or 36.

[0037] A kit comprising: an agent or composition above; and a carrier.

[0038] The agent, composition or method above in combination with one or more agents for modulating a level of one or both of IRAK4 and TRIM5 for use in treating or ameliorating the symptoms of cancer in a subject.

[0039] The agent, composition or method above, wherein the one or more agents for modulating a level of IRAK4 are selected from: TLR4 agonists; TLR3 agonists; TLR7-TLR8 agonists; and synthetic, recombinant or artificial human IRAK4 supplement protein.

[0040] The agent, composition or method above, wherein the one or more agents for modulating a level of IRAK4 are selected from: MPLA; poly IC; R837 or R848; and synthetic, recombinant or artificial human IRAK4 supplement protein.Docket No. 018988-034WO1

[0041] The agent, composition or method above, wherein the one or more agents for modulating a level of TRIM5 are selected from Type I interferons; TLR agonists; and synthetic, recombinant or artificial human TRIM5 supplement protein.

[0042] The agent, composition or method above, wherein the one or more agents for modulating a level of TRIM5 are selected from IFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb; imiquimod or resiquimod; and synthetic, recombinant or artificial human TRIM5 supplement protein.

[0043] The agent, composition or method above, wherein the cancer is multiple myeloma and the modulating agents are for one or both of IRAK4 and TRIM5.

[0044] The agent, composition or method above, in combination with one or more antisense agents for suppressing expression of isoforms of TGF-P for use in treating or ameliorating the symptoms of cancer in a subject.

[0045] The agent, composition or method above, wherein the antisense agents for suppressing expression of isoforms of TGF-P are selective for TGF-pi, TGF-P2, TGF-P3, TGF-pi and TGF-P2 and TGF-P3 simultaneously, TGF-pi and TGF-P2 simultaneously, or TGF-P2 and TGF-P3 simultaneously.

[0046] The agent, composition or method above, wherein the antisense agents for suppressing expression of isoforms of TGF-P are one or more or all of:chemically-modified GGTGCTGTTGTA SEQ ID NO:21;G*G*T*G*C*T*G*T*T*G*T*A SEQ ID NO:22;chemically-modified CAGAAGTTGGC SEQ ID NO:23;C*A*G*A*A*G*T*T*G*G*C SEQ ID NO:24;chemically-modified AGCTTGCTCA SEQ ID NO:25;A*G*C*T*T*G*C*T*C*A SEQ ID NO:26;chemically-modified TTCAGCTTGCTCAGGATCTG SEQ ID NO:27;T*T*C*A*G*C*T*T*G*C*T*C*A*G*G*A*T*C*T*G SEQ ID NO:28; chemically-modified CGGCATGTCTATTTTGTA SEQ ID NO:29 (OT-101); C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO:30;chemically-modified ACCTAAGTTGGACTCTCTTC SEQ ID NO:31;A*C*C*T*A*A*G*T*T*G*G*A*C*T*C*T*C*T*T*C SEQ ID NO:32.

[0047] The agent, composition or method above, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.Docket No. 018988-034WO1

[0048] The agent, composition or method above, wherein the agents are administered concurrently, simultaneously, sequentially, or separately in time.

[0049] The agent, composition or method above, wherein the agents are administered by infusion, injection, or intracranial continuous infusion.

[0050] The agent, composition or method above in combination with one or more agents for modulating a level of one or more of HIF1 A, TRIM22, IRF5, and PARP9 for treating or ameliorating the symptoms of cancer in a subject.

[0051] The agent, composition or method above, wherein the one or more agents for modulating a level of HIF1A are selected from PHD inhibitors; and synthetic, recombinant or artificial human HIF1A supplement protein.

[0052] The agent, composition or method above, wherein the one or more agents for modulating a level of HIF1A are selected from roxadustat or daprodustat; and synthetic, recombinant or artificial human HIF1A supplement protein.

[0053] The agent, composition or method above, wherein the one or more agents for modulating a level of TRIM22 are selected from Type I interferons; TLR agonists; and synthetic, recombinant or artificial human TRIM22 supplement protein.

[0054] The agent, composition or method above, wherein the one or more agents for modulating a level of TRIM22 are selected from IFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb; imiquimod or resiquimod; and synthetic, recombinant or artificial human TRIM22 supplement protein.

[0055] The agent, composition or method above, wherein the one or more agents for modulating a level of IRF5 are selected from Type I Interferon agents; GM-CSF (CSF2) agents; Type I interferons such as IFN-a and IFN-P and TLR agonists such as imiquimod and resiquimod; and synthetic, recombinant or artificial human IRF5 supplement protein.

[0056] The agent, composition or method above, wherein the one or more agents for modulating a level of IRF5 are selected from Peginterferon Alfa-2a, IFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb; sargramostim; imiquimod or resiquimod; and synthetic, recombinant or artificial human IRF5 supplement protein.

[0057] The agent, composition or method above, wherein the one or more agents for modulating a level of PARP9 are selected from Type I interferons; TLR agonists; and synthetic, recombinant or artificial human PARP9 supplement protein.Docket No. 018988-034WO1

[0058] The agent, composition or method above, wherein the one or more agents for modulating a level of PARP9 are selected from IFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb; imiquimod or resiquimod; and synthetic, recombinant or artificial human PARP9 supplement protein.

[0059] The agent, composition or method above, wherein the cancer is multiple myeloma and the modulating agents are for one or more of IRAK4 and TRIM5.

[0060] The agent, composition or method above, wherein the cancer is gastric cancer and the modulating agents are for one or more of TRIM5, HIF1A, and TRIM22.

[0061] The agent, composition or method above, wherein the cancer is glioblastoma and the modulating agents are for one or more of IRAK4, TRIM5, HIF1A, TRIM22, and PARP9.

[0062] The agent, composition or method above, wherein the cancer is melanoma and the modulating agents are for one or more of IRAK4, TRIM5, TRIM22, IRF5 and PARP9.BRIEF DESCRIPTION OF THE DRAWINGS

[0063] FIG. 1 shows results of a study of clinical outcomes for multiple myeloma patients and the beneficial impact on overall survival for multiple myeloma patients of the therapeutic use of a MALT 1 -specific antisense agent in combination with modulators of associated gene products. The Kaplan-Meier chart of FIG. 1 (KM Plotter) shows that overall survival was significantly improved for patients above median IRAK4 and having low MALT1. This study established a basis for therapeutic use of a MALTl-specific antisense agent in combination with a modulator agent of IRAK4 for treating multiple myeloma. The median overall survival time for patients from the IRAK4(high)-MALTl(low) group was 87 months (logrank P=3.3e-16), which was significantly and surprisingly increased over the 32 months observed for patients of the IRAK4(low)-MALTl(low) group.

[0064] FIG. 2 shows results of a study of clinical outcomes for multiple myeloma patients and the beneficial impact on overall survival for multiple myeloma patients of the therapeutic use of a MALTl-specific antisense agent in combination with modulators of associated gene products. The Kaplan-Meier chart of FIG. 2 (KM Plotter) shows that overall survival was significantly improved for patients above median TRIM5 and having low MALT1. This study established a basis for therapeutic use of a MALTl-specific antisense agent in combination with a modulator agent of TRIM5 for treating multiple myeloma. The median overall survival time for patientsDocket No. 018988-034WO1from the TRIM5(high)-MALTl(low) group was 87 months (logrank P=1E-16), which was significantly and surprisingly increased over the 25 months observed for patients of the TRIM5(low)-MALTl(low) group.

[0065] FIG. 3 shows negative prognostic impact of MALT 1 mRNA expression on OS hazard ratios (HR) in glioblastoma (GBM) patients. The multivariate Cox proportional hazards model was implemented to assess the individual effects of MALT 1 mRNA expression (log2 TPM values), TGFB 1 / 2 / 3, and MGMT controlling for age at diagnosis (AGE), Sex (Male relative to Female), and interaction terms for TGFB2 x Age and Age x Sex interactions. The Forest plot depicts the impact on hazard ratio (HR) for each factor. *** P< 0.001, ** P< 0.01, * P< 0.05.

[0066] FIG. 4 shows interaction plots depicting the negative prognostic impact of MALT1 mRNA expression on OS hazard ratios (HR) in GBM patients dependent on Age and Sex. The negative prognostic impact of increasing MALT1 mRNA levels (minimum (Min MALT1 = 7.447 log2 (TPM); lower quartile (LQuart MALT1 = 8.182); upper quartile (UQuart MALTl = 8.948); maximum (Max MALT1 = 10.191)) comparing Sex (Male and Female) and Age (Old = 89 yr; Young = 21 yr) of GBM patients was investigated. OS was followed with the gene methylation variables set to low levels of TGFB1 / 2 / 3 and MGMT. [A], For young males, increasing the mRNA levels of MALT1 from minimum, LQuart, and UQuart to the maximum also decreased the median survival time from 21.3, 16.6, and 14.5 to 8.4, respectively. [B] For young females, the median survival times decreased from 50.3, 50.3, 47.9, and 25.3 months, respectively. [C] For old males, survival times decreased from 15, 11.8, 8.4, and 4.1 months, respectively. [D] The median survival times for old females decreased from 4.9, 4.1, 3.1, and 1.1 months, respectively.DETAILED DESCRIPTION OF THE DISCLOSURE

[0067] This invention relates to methods, compositions and uses thereof for treating or ameliorating the symptoms of cancer in a human or animal subject with pharmaceutical compositions designed to promote anti-tumor effects.

[0068] This invention relates to agents, compositions and methods for treating cancer with antisense agents for suppressing expression of MALT1 and TGF-P, as well as modulators of IRAK4, TRIM5, HIF1A, TRIM22, IRF5, and PARP9. Agents and therapies include antisense agents for suppressing expression of MALT1. SynergisticDocket No. 018988-034WO1therapies further include agents, compositions and methods for treating cancer with an agent for suppressing expression of MALT 1 in combination with agents for suppressing expression of TGF-p. Agents for suppressing expression of TGF-P may be selective for TGF-P2 alone, all of TGF-pi, TGF-P2 and TGF-P3, or TGF-pi and TGF-P2, or TGF-P2 and TGF-P3. The agents and compositions can be used in combination with chemotherapy and other standard-of-care therapies. Further embodiments include use of a composition comprising an agent for suppressing expression of IRF5 alone or in combination with an agent for suppressing expression of TGF-P2 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.

[0069] As used herein, the term agent can refer to one or more active compounds, a combination of active compounds, or a composition containing one or more active compounds and a carrier, and / or a solvent, and / or any number of excipients. In some embodiments, the composition may be a pharmaceutical composition. In certain embodiments, the composition may be a pharmaceutical composition containing a therapeutically effective amount of one or more active compounds. Some examples of excipients are given in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 1975, and Liberman, H. A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980. Methods for determining a therapeutically effective amount of a compound are known in the art.

[0070] In some embodiments, methods and therapeutic strategies of this invention can increase efficacy, as well as reduce toxic side effects and adverse health effects in cancer treatment.

[0071] In further embodiments, methods and therapeutic strategies of this invention can improve guidance of the therapy using appropriate biomarkers to select synergistic effects of the compositions.Human MALT 1 -specific antisense oligodeoxynucleotides

[0072] Embodiments of this invention further include pharmaceutical compositions for inhibiting or suppressing expression of MALT1, or for treating or ameliorating the symptoms of cancer in a human or animal. The pharmaceutical compositions may contain a pharmaceutically acceptable salt form, an ester form, or a polymorph or stereoisomer of any active agent of this disclosure, as well as a carrier. The MALT1Docket No. 018988-034WO1agent may be selected from MALT 1 -specific antisense oligonucleotides. The carrier may be sterile water for injection, saline, isotonic saline, or a combination thereof.

[0073] MALT1 antisense may be chemically-modified in the same manner as described below for TGF-beta antisense.

[0074] MALT1 antisense were based on Homo sapiens mRNA for MALT1, complete cds, GenBank: AB026118.1.

[0075] Examples of agents of this disclosure for inhibiting or suppressing expression of MALT1 include MALT 1 -specific antisense oligonucleotides given in Table 1.Table 1: MALT 1 -specific antisense oligonucleotides SEQ IDRef. ANTISENSE SEQUENCENO:1 713-732 AGACGCCATCAACACTTCTC2 1098-1117 GGAGCTTTGAGCTTGGGGTG3 1099-1118 AGGAGCTTTGAGCTTGGGGT4 714-733 GAG AC GC CAT C AAC AC T T C T5 1882-1901 CGGTGGTTTGTAAACTATAC6 1883-1902 CCGGTGGTTTGTAAACTATA7 1884-1903 TCCGGTGGTTTGTAAACTAT8 1885-1904 CTCCGGTGGTTTGTAAACTA9 1886-1905 TCTCCGGTGGTTTGTAAACT10 1887-1906 ATCTCCGGTGGTTTGTAAAC11 1888-1907 TATCTCCGGTGGTTTGTAAA12 1889-1908 TTATCTCCGGTGGTTTGTAA13 1890-1909 ATTATCTCCGGTGGTTTGTA14 1891-1910 TATTATCTCCGGTGGTTTGT

[0076] Each entry in the table above can also be used in the form of a phosphorothioate in which at least one or all of the internucleotide linkages are phosphorothioate.

[0077] In some embodiments, a MALTl-specific antisense oligonucleotides can have the sequence(SEQ ID NO: 15) AGACGCCATCAACACTTCTC ; or(SEQ ID NO: 16) A*G*A*C*G*C*C*A*T*C*A*A*C*A*C*T*T*C*T*C .

[0078] In some embodiments, a MALTl-specific antisense oligonucleotides can have the sequence(SEQ ID NO: 17) GGAGCTTTGAGCTTGGGGTG; orDocket No. 018988-034WO1

[0079] (SEQ ID NO:18) G*G*A*G*C*T*T*T*G*A*G*C*T*T*G*G*G*G*T*G.

[0080] In some embodiments, a MALTl-specific antisense oligonucleotides can have the sequence(SEQ ID NO: 19) AGGAGCTTTGAGCTTGGGGT ; or

[0081] (SEQ ID NO:20) A*G*G*A*G*C*T*T*T*G*A*G*C*T*T*G*G*G*G*T .

[0082] In some embodiments, the following criteria can be used for an antisense oligonucleotide: A) 40% <= GC % <= 60%; B) No GGGG in the target sequence; C) Average unpaired probability for target site nucleotides >= 0.5; D) For each peak in the accessibility profile that can be above the threshold probability of 0.5, all sites targeted to this same peak may be ranked by their average unpaired probability (the higher the better) and at most n sites can be selected for each peak, where n is determined by max([width of peak / site length], 2); E) Among sites satisfying criteria A-D, the top 20 unique ones with the highest average unpaired probability may be listed. In certain embodiments, the average unpaired probability can be used in filter criteria C, D and E to cut down the number of reported sites in order to make the disruption energy calculation manageable.

[0083] The MALT1 antisense sequences can be chemically-modified to provide active variants thereof, LNA variants thereof, as well as gapmer variants thereof, as known in the art. The sequences can be used in any combination as active agents, such as pooling combinations.

[0084] In some embodiments, the MALT1 antisense sequences can be n-M-n RNA(2’-OMe)*-DNA*-RNA(2’-OMe)* gapmers, where n is from 3-7 and M is from 6-12. In certain embodiments, the MALT1 antisense sequences can be 3-10-3 or 5-10-5 LNA*-DNA*-LNA* or cEt*-DNA*-cEt* gapmers.

[0085] It is understood that additional antisense oligonucleotides in various formats can be constructed based on the MALT1 gene sequence.

[0086] Any of the unmodified antisense oligonucleotides herein can have any number and order of nucleotides modified with phosphorothioate linkages. In some embodiments, all nucleotides can be modified with phosphorothioate linkages.

[0087] In some embodiments, as discussed herein, the MALT1 antisense sequences can be gapmers formed by adding 1 to 5 protected ribonucleotides on each flank of the phosphorothioate deoxy-nucleotide sequences in Table 1. For example, theDocket No. 018988-034WO1ribonucleotides can be protected with 2’-0Me, 2’-OEt, or 2’-0-M0E substituents, or with LNA, cMOE, or cEt bridges, as well as phosphorothioate linkages.Anti-cancer methods and compositions

[0088] This invention includes agents for suppressing expression of MALT 1 for treating or ameliorating the symptoms of cancer in a subject.

[0089] In further embodiments, this invention includes uses of a composition comprising an agent for suppressing expression of MALT1 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.

[0090] In certain embodiments, this invention includes methods for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of MALT1; and administering a therapeutically sufficient amount of the composition to the subject.

[0091] In some embodiments, the cancer is a multiple myeloma, a gastric cancer, a glioma, a glioblastoma, a diffuse midline glioma (DMG), a pancreatic cancer, a melanoma, a skin cancer, a lung cancer, a breast cancer, a prostate cancer, a colorectal cancer, a kidney cancer, a stomach cancer, an ovarian cancer, a cervical cancer, or a liver cancer.

[0092] In further embodiments, the cancer is a multiple myeloma or a gastric cancer.

[0093] This invention also includes agents for suppressing expression of MALT1 for treating or ameliorating the symptoms of cancer in a subject in combination with modulators of one or more associated gene products IRAK4, TRIM5, HIF1A, TRIM22, IRF5, and PARP9.

[0094] This invention includes agents for suppressing expression of MALT 1 for treating or ameliorating the symptoms of cancer in a subject in combination with an agent for inhibiting or suppressing expression of isoforms of TGF-p.

[0095] In further embodiments, this invention includes uses of a composition comprising an agent for suppressing expression of MALT1 in combination with an agent for inhibiting or suppressing expression of isoforms of TGF-P in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.Docket No. 018988-034WO1

[0096] In certain embodiments, this invention includes methods for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of MALT1 in combination with an agent for inhibiting or suppressing expression of isoforms of TGF-P; and administering a therapeutically sufficient amount of the composition to the subject.

[0097] This invention also includes agents for suppressing expression of MALT1 for treating or ameliorating the symptoms of cancer in a subject in combination with an agent for inhibiting or suppressing expression of isoforms of TGF-P and an immune checkpoint inhibitor or modulators of one or more associated gene products IRAK4, TRIM5, HIF1A, TRIM22, IRF5, and PARP9.

[0098] In further embodiments, this invention includes uses of a composition comprising an agent for suppressing expression of MALT1 in combination with an agent for inhibiting or suppressing expression of isoforms of TGF-P and an immune checkpoint inhibitor or modulators of one or more associated gene products IRAK4, TRIM5, HIF1 A, TRIM22, IRF5, and PARP9 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.

[0099] In certain embodiments, this invention includes methods for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of MALT1 in combination with an agent for inhibiting or suppressing expression of isoforms of TGF-P and an immune checkpoint inhibitor or modulators of one or more associated gene products IRAK4, TRIM5, HIF1A, TRIM22, IRF5, and PARP9; and administering a therapeutically sufficient amount of the composition to the subject.

[0100] This invention includes methods for treating or ameliorating the symptoms of cancer in a human or animal subject in need, by administering a therapeutically sufficient amount of a pharmaceutical composition comprising an agent for inhibiting or suppressing expression of isoforms of TGF-P to the subject; and administering a therapeutically sufficient amount of a pharmaceutical composition comprising a checkpoint inhibitor or modulators of one or more associated gene products IRAK4, TRIM5, HIF1 A, TRIM22, IRF5, and PARP9 to the subject.Docket No. 018988-034WO1

[0101] Any of the foregoing therapies may be combined with a standard of care treatment for cancer. Anti-cancer therapies and agents can be administered by infusion, injection, or intracranial continuous infusion.

[0102] Any of the therapies herein may be combined with one or more additional medicaments comprising a targeted cancer drug, a cancer growth blocker, or an EGFR inhibitor, erlotinib, gefitinib, afatinib, osimertinib, dacomitininb, and combinations thereof.

[0103] In some embodiments, any of the therapies herein may be combined with one or more additional medicaments which are targeted cancer drugs selected from bevacizumab, everolimus, belzutifan, dabrafenib, trametinib, and combinations thereof.

[0104] In further embodiments, any of the therapies herein may be combined with one or more additional medicaments which are cancer growth blockers selected from an angiogenesis inhibitor, a histone deacetylase inhibitor, a hedgehog blocker, an mTOR inhibitor, a p53 inhibitor, a PARP inhibitor, a proteasome inhibitor, a tyrosine kinase inhibitor, and combinations thereof.

[0105] In certain embodiments, any of the therapies herein may be combined with one or more additional medicaments for treatment of glioma selected from TMZ, radiation, and bevacizumab, or comprising any one or more additional medicaments for treatment of pancreatic cancer selected from paclitaxel, gemcitabine, 5FU, leucovrin, nal-Irinotecan, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.

[0106] As used herein, where a combination of active agents is described, the active agents may be co-formulated, or may be singly-formulated and used or administered concurrently, simultaneously, sequentially, or separately in time.Human TGF-B2-specific phosphorothioate antisense oligodeoxynucleotide

[0107] An antisense oligonucleotide (ASO) can be a single-stranded deoxyribonucleotide, which may be complementary to an mRNA target. The antisense therapy may downregulate a molecular target, which may be achieved by induction of RNase H endonuclease activity that cleaves the RNA-DNA heteroduplex with a significant reduction of the target gene translation. Other ASO mechanisms can include inhibition of 5’ cap formation, alteration of splicing process such as splice-switching, and steric hindrance of ribosomal activity.Docket No. 018988-034WO1

[0108] Antisense therapeutic strategies can utilize single-stranded DNA oligonucleotides that inhibit protein production by mediating the catalytic degradation of a target mRNA, or by binding to sites on mRNA needed for translation. Antisense oligonucleotides can be designed to target the viral RNA genome or viral transcripts. Antisense oligonucleotides can provide an approach for identifying potential targets, and therefore represent potential therapeutics.

[0109] Antisense oligonucleotides can be small synthetic pieces of single-stranded DNA that may be 15-30 nucleotides in length. An ASO may specifically bind to a complementary DNA / RNA sequence by Watson-Crick hybridization and once bound to the target RNA, inhibit the translational processes either by inducing cleavage mechanisms or by inhibiting mRNA maturation. An ASO may selectively inhibit gene expression with specificity. Chemical modifications of DNA or RNA can be used to increase stability.

[0110] For example, modifications can be introduced in the phosphodiester bond, the sugar ring, and the backbone. ASO antiviral agents may block translational processes either by (i) ribonuclease H (RNAse H) or RNase P mediated cleavage of mRNA or (ii) by sterically (non- bonding) blocking enzymes that are involved in the target gene translation. Human TGF-P2-specific phosphorothioate antisense oligodeoxynucleotide (OT-101; AP 12009; Trabedersen), hereafter referred to as OT-101 or AP 12009, is intended to reduce the level of TGF-P2 protein in malignant gliomas, and thereby delay the progression of disease.

[0111] Antisense oligodeoxynucleotides are short strings of DNA that are designed to downregulate gene expression by interfering with the translation of a specific encoded protein at the mRNA level. OT-101 is a synthetic 18-mer phosphorothioate oligodeoxynucleotide (S-ODN) where all 3 ’-5’ linkages are modified to phosphorothioates. The molecular formula is Ci77H2osN6oNai7094Pi7Si7 and the molecular weight 6,143 g / mol. OT-101 was designed to be complementary to a specific sequence of human TGF-P2 mRNA following expression of the gene.

[0112] For example, OT-101 can be supplied as a lyophilized powder in 50 mL glass vials in three different quantities. Each vial is identified by the name of the investigational product, trial number, dosing group, mode of application, quantity of OT-101 contained (in mg), total volume after dissolving (in mL) and resultingDocket No. 018988-034WO1concentration (in pM), name of sponsor, name of manufacturer, batch number, vial number, storage temperature, and expiry date. The study medication can be provided in closed units, packaged separately for each concentration. The packages may contain the appropriate vial(s) and all necessary components of the application system (i.e., syringes, tube, and filter). OT-101 lyophilized powder is dissolved in isotonic (0.9%) aqueous sodium chloride prior to use. A leaflet can be enclosed in the packaging with instructions on how to prepare the product for administration of the desired concentration.

[0113] As used herein, all antisense sequences are shown in 5 '-3' format.TGF-B-isoform specific antisense oligodeoxynucleotides

[0114] Examples of antisense agents of this disclosure for suppressing expression of TGF-P include antisense oligonucleotides specific simultaneously for all of TGF-pi, TGF-P2 and TGF-P3.

[0115] In some embodiments, examples of TGF-P antisense agents include antisense oligonucleotides specific simultaneously for all of TGF-pi, TGF-P2 and TGF-P3, which can have the structure:chemically-modified GGTGCTGTTGTA (SEQ ID NO:21); or G*G*T*G*C*T*G*T*T*G*T*A (SEQ ID NO:22).

[0116] Examples of antisense agents of this disclosure for inhibiting or suppressing expression of TGF-P include antisense oligonucleotides specific simultaneously for both of TGF-P 1 and TGF-P2.

[0117] In some embodiments, examples of TGF-P antisense agents include antisense oligonucleotides specific simultaneously for both of TGF-P 1 and TGF-P2, which can have the structure:chemically-modified CAGAAGTTGGC (SEQ ID NO:23); or C*A*G*A*A*G*T*T*G*G*C (SEQ ID NO:24).

[0118] Examples of antisense agents of this disclosure for inhibiting or suppressing expression of TGF-P include antisense oligonucleotides specific simultaneously for both of TGF-P2 and TGF-P3.Docket No. 018988-034WO1

[0119] In some embodiments, examples of TGF-P antisense agents include antisense oligonucleotides specific simultaneously for both of TGF-P2 and TGF-P3, which can have the structure:chemically-modified AGCTTGCTCA (SEQ ID NO:25);or A*G*C*T*T*G*C*T*C*A (SEQ ID NO:26).

[0120] Examples of antisense agents of this disclosure for inhibiting or suppressing expression of TGF-P include antisense oligonucleotides specific for TGF-P 1. For example, Homo sapiens transforming growth factor beta 1 (TGFB1), mRNA Sequence ID: NM_000660.7.

[0121] In some embodiments, examples of TGF-P antisense agents include antisense oligonucleotides specific for TGF-pi, which can have the structure:chemically-modified TTCAGCTTGCTCAGGATCTG (SEQ ID NO:27); or T*T*C*A*G*C*T*T*G*C*T*C*A*G*G*A*T*C*T*G (SEQ ID NO:28) .

[0122] Examples of antisense agents of this disclosure for inhibiting or suppressing expression of TGF-P include antisense oligonucleotides specific for TGF-P2. For example, Human transforming growth factor-beta-2 mRNA, complete cds Sequence ID: M19154.1, Length: 2570.

[0123] In some embodiments, examples of TGF-P antisense agents include antisense oligonucleotides specific for TGF-P2, which can have the structure:chemically-modified CGGCATGTCTATTTTGTA (SEQ ID NO:29) (OT-101); or C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A (SEQ ID NO:30) (OT-101).

[0124] Examples of antisense agents of this disclosure for inhibiting or suppressing expression of TGF-P include antisense oligonucleotides specific for TGF-P3. For example, Homo sapiens transforming growth factor, beta 3 mRNA, complete cds Sequence ID: BT007287.1, Length: 930.

[0125] In some embodiments, examples of TGF-P antisense agents include antisense oligonucleotides specific for TGF-P3, which can have the structure:chemically-modified ACCTAAGTTGGACTCTCTTC (SEQ ID NO:31); or A*C*C*T*A*A*G*T*T*G*G*A*C*T*C*T*C*T*T*C (SEQ ID NO:32).

[0126] The antisense agents herein can be chemically-modified to provide active variants thereof, LNA variants thereof, as well as gapmer variants thereof, as known inDocket No. 018988-034WO1the art. The antisense agents can be used in any combination as active agents, such as pooling combinations.

[0127] It is understood that additional antisense oligonucleotides of this disclosure can be constructed based on the gene sequence.

[0128] In some embodiments, an agent of antisense sequences can be gapmers formed by adding 1 to 5 protected ribo-nucleotides on each flank of the phosphorothioate deoxy-nucleotide sequence. For example, the ribo-nucleotides can be protected with 2’-0Me, 2’-OEt, or 2’-0-M0E substituents, or with LNA, cMOE, or cEt bridges, as well as phosphorothioate linkages.

[0129] In some embodiments, an agent of antisense sequences can be a n-M-n RNA(2’-OMe)*-DNA*-RNA(2’-OMe)* gapmer, where n is from 3-7 and M is from 6-12. In certain embodiments, the gapmer can be a 3-10-3 or 5-10-5 LNA*-DNA*-LNA* or cEt*-DNA*-cEt* gapmer (* designates phosphorothioate linkages).

[0130] Embodiments of this invention further include pharmaceutical compositions for inhibiting or suppressing expression of TGF-P, or for treating or ameliorating the symptoms of cancer in a human or animal. The pharmaceutical compositions may contain a TGF-P inhibitor, artemisinin, pharmaceutically acceptable salts forms, esters, polymorphs or stereoisomers thereof, and any combination thereof, as well as a carrier. The TGF-P inhibitor may be selected from TGF-P2-specific antisense oligonucleotides. The carrier may be sterile water for injection, saline, isotonic saline, or a combination thereof.

[0131] Importantly, a composition of this disclosure may be substantially free of excipients. Compositions of this invention which are substantially free of excipients have been found to be surprisingly stable in a carrier. In some embodiments, the composition may be stable for at least 14 days, or at least 21 days, or at least 28 days in a carrier at 37°C.

[0132] In additional embodiments, a pharmaceutical composition for infusion may contain less than 1% by weight of excipients, or less than 0.5% by weight of excipients, or less than 0.1% by weight of excipients.Docket No. 018988-034WO1QT-101 antisense oligonucleotide drug product

[0133] The API trabedersen / OT-101 is a synthetic 18-mer S-ODN consisting of the bases adenine (A), thymine (T), guanine (G), and cytosine (C), with all 3'-5' linkages modified to phosphorothioates. This sulfur modification makes the drug more resistant to degradation, resulting in an increased stability in vitro and in vivo. Its molecular structure (nucleotide sequence) was designed to be complementary to a specific sequence of human transforming growth factor-beta 2 (TGF-P2) mRNA. This sequence was selected among related molecules for its superior chemical and structural properties, biological activity, and specificity to achieve the best antisense effects in vitro and in vivo.

[0134] The chemical structure, exemplary of the phosphorothioate moieties (C-A-G), and the physical characteristics of trabedersen are shown in Table 2.Table 2: Chemical and Physical Characteristics of TrabedersenChemical and Physical Characteristics of TrabedersenAppearance: White to off-white solid Molecular Formula (sodiumC177N208N60O94P17Sl?Nai7salt, anhydrous)'.-O~^Q\ / CMolecular Weight (sodium6143 g / molsalt, anhydrous)'.oO=P-O — \ / °\zANumber of moieties: 18s- \ j Backbone characteristics: PhosphorothioatesO No crystalline morphology in the 0=P-0 — y / °x. .G Polymorphism:S~ \ / solidO Water content: Up to 15%Phosphorothioate linkages Very soluble in water (> 50 mg / mL) (C-A-G) Soluble in methanol (> 8.5 mg / mL) Solubility:Insoluble in / .so-propanol(0.01 mg / mL)pH of solution: 6 - 8

[0135] The IMP is supplied as a sterile lyophilizate for solution for infusion in 50H glass vials (primary container) containing 7.37 mg trabedersen (intratumoral treatment) and in 20R glass vials (primary container) containing 250 mg trabedersen (intravenous treatment), respectively. No excipients are in the finished drug product. These glass vials are commonly usedDocket No. 018988-034WO1for parenterals. Sterile rubber stoppers appropriate for lyophilization seal the glass vial. The stopper is sealed with a crimping capsule that includes a colored flip-off cap. For clinical use, each vial is provided within a white-colored folding box to protect the vials from light exposure and damage during transport. Both, the glass vials and the folding boxes are labeled according to local requirements. The primary as well as secondary containers of the closure system fulfill international quality standards for the packaging of sterile solid drug products for injections.Checkpoint inhibitor agents

[0136] As referred to herein, checkpoint inhibitors as known in the art are immune checkpoint inhibitor agents. Checkpoint inhibitors are immunotherapy drugs which block checkpoint proteins from binding with their partner proteins. This prevents an “off’ signal from being sent, which allows T cells to kill cancer cells. More particularly, checkpoint proteins, such as PD-1 on T cells, keep immune responses in check. Binding of PD-L1 to PD-1 keeps T cells from killing tumor cells. Thus, blocking the binding of PD-L1 to PD-1 with an immune checkpoint inhibitor may allow the T cells to kill tumor cells. The immune system is essentially turned back on so that T cells can attack cancer cells.

[0137] In some embodiments, a checkpoint inhibitor of this disclosure may be an inhibitor of CTLA-4, PD-1, or PD-L1.

[0138] In certain embodiments, a checkpoint inhibitor of this disclosure may be an inhibitor of PD-1.

[0139] In certain embodiments, a checkpoint inhibitor of this disclosure may be pembrolizumab.

[0140] In certain embodiments, a checkpoint inhibitor of this disclosure may be pembrolizumab, nivolumab, cemiplimab, spartalizumab, atezolizumab, avelumab, or durvalumab.

[0141] Without wishing to be bound by theory, the PD-1 receptor-ligand interaction can be a major pathway hijacked by tumors to suppress immune control. The normal function of PD-1, expressed on the cell surface of activated T cells under healthy conditions, is to down-modulate unwanted or excessive immune responses, including autoimmune reactions. Following T-cell stimulation, PD-1 recruits the tyrosine phosphatases, SHP-1 and SHP-2, to the immunoreceptor tyrosine-based switch motifDocket No. 018988-034WO1within its cytoplasmic tail, leading to the dephosphorylation of effector molecules such as CD3 zeta (CD3Q, protein kinase C-theta (PKC9), and zeta-chain-associated protein kinase (ZAP70), which are involved in the CD3 T-cell signaling cascade.

[0142] Numbered embodiments of this invention include the following:

[0143] (1) An antisense agent for suppressing expression of MALT 1.

[0144] (2) A composition comprising an antisense agent for suppressing expression of MALT1 and a carrier for use in the preparation of a cancer medicament or for use in treating or ameliorating the symptoms of cancer in a subject.

[0145] (3) A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising:preparing a composition comprising an antisense agent for suppressing expression of MALT1 and a carrier; andadministering a therapeutically sufficient amount of the composition to the subject.

[0146] (4) The agent, composition or method of any one of embodiments 1-3, wherein the cancer is a multiple myeloma, a gastric cancer, a glioma, a glioblastoma, a diffuse midline glioma (DMG), a pancreatic cancer, a melanoma, a skin cancer, a lung cancer, a breast cancer, a prostate cancer, a colorectal cancer, a kidney cancer, a stomach cancer, an ovarian cancer, a cervical cancer, or a liver cancer.

[0147] (5) The agent, composition or method of any one of embodiments 1-4, wherein the cancer is multiple myeloma or gastric cancer.

[0148] (6) The agent, composition or method of any one of embodiments 1-5, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 transcript and 15-30 nucleotides in length.

[0149] (7) The agent, composition or method of any one of embodiments 1-6, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.

[0150] (8) The agent, composition or method of any one of embodiments 1-7, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 transcript as in Table 1.Docket No. 018988-034WO1

[0151] (9) The agent, composition or method of any one of embodiments 1-8, comprising a MALT 1 -specific antisense oligonucleotide as in Table 1 having one or more nucleotides chemically modified as a phosphorothioate intemucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’ -4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5-methylcytodine base.

[0152] (10) The agent, composition or method of any one of embodiments 1-9, wherein the agent, medicament or administration comprises MALT 1 -specific antisense oligonucleotides:chemically-modified AGACGCCATCAACACTTCTC SEQ ID NO: 15; or A*G*A*C*G*C*C*A*T*C*A*A*C*A*C*T*T*C*T*C SEQ ID NO:16.

[0153] (11) The agent, composition or method of any one of embodiments 1-10, wherein the agent, medicament or administration comprises MALT 1 -specific antisense oligonucleotides:chemically-modified GGAGCTTTGAGCTTGGGGTG SEQ ID NO: 17; or G*G*A*G*C*T*T*T*G*A*G*C*T*T*G*G*G*G*T*G SEQ ID NO:18.

[0154] (12) The agent, composition or method of any one of embodiments 1-11, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.

[0155] (13) The agent, composition or method of any one of embodiments 1-12, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.

[0156] (14) The agent, composition or method of any one of embodiments 1-13, wherein the agent, composition or method is substantially free of excipients.

[0157] (15) The agent, composition or method of any one of embodiments 1-14, wherein the agent, composition or method is stable for at least 14 days in carrier at 37°C.

[0158] (16) The agent, composition or method of any one of embodiments 1-15, wherein the agent, composition or method is combined with a standard of care treatment for the cancer.

[0159] (17) The agent, composition or method of any one of embodiments 1-16, wherein the agent, composition or method is for use or administration by infusion, injection, or intracranial continuous infusion.

[0160] (18) The agent, composition or method of any one of embodiments 1-17, comprising one or more additional medicaments selected from a cancer growth blocker, a targeted cancer drug, an angiogenesis inhibitor, a histone deacetylase inhibitor, a hedgehog blocker, an mTORDocket No. 018988-034WO1inhibitor, a p53 inhibitor, a PARP inhibitor, a proteasome inhibitor, a tyrosine kinase inhibitor, and an EGFR tyrosine kinase inhibitor.

[0161] (19) The agent, composition or method of any one of embodiments 1-18, in combination with one or more of everolimus, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, bevacizumab, belzutifan, dabrafenib, trametinib, TMZ, and radiation therapy.

[0162] (20) The agent, composition or method of any one of embodiments 1-19, wherein the agent, composition or method increases an overall survival rate of the subject at month 6, 12, 18, 24, 30, or 36.

[0163] (21) A kit comprising an agent or composition of any one of embodiments 1-20; and a carrier.

[0164] (22) The agent, composition or method of any one of embodiments 1-21 in combination with one or more agents for modulating a level of one or both of IRAK4 and TRIM5 for use in treating or ameliorating the symptoms of cancer in a subject.

[0165] (23) The agent, composition or method of any one of embodiments 1-22, wherein the one or more agents for modulating a level of IRAK4 are selected from:TLR4 agonists;TLR3 agonists;TLR7-TLR8 agonists; andsynthetic, recombinant or artificial human IRAK4 supplement protein.

[0166] (24) The agent, composition or method of any one of embodiments 1-23, wherein the one or more agents for modulating a level of IRAK4 are selected from:MPLA;poly IC;R837 orR848; andsynthetic, recombinant or artificial human IRAK4 supplement protein.

[0167] (25) The agent, composition or method of any one of embodiments 1-24, wherein the one or more agents for modulating a level of TRIM5 are selected fromType I interferons;TLR agonists; andsynthetic, recombinant or artificial human TRIM5 supplement protein.

[0168] (26) The agent, composition or method of any one of embodiments 1-25, wherein the one or more agents for modulating a level of TRIM5 are selected fromDocket No. 018988-034WO1IFN-a-2a, IFN-a-2b, IFN-P-la, or IFN- -lb;imiquimod or resiquimod; andsynthetic, recombinant or artificial human TRIM5 supplement protein.

[0169] (27) The agent, composition or method of any one of embodiments 1-26, wherein the cancer is multiple myeloma and the modulating agents are for one or both of IRAK4 and TRIM5.

[0170] (28) The agent, composition or method of any one of embodiments 1-27, in combination with one or more antisense agents for suppressing expression of isoforms of TGF-P for use in treating or ameliorating the symptoms of cancer in a subject.

[0171] (29) The agent, composition or method of any one of embodiments 1-28, wherein the antisense agents for suppressing expression of isoforms of TGF-P are selective for TGF-pi, TGF-P2, TGF-P3, TGF-P 1 and TGF-P2 and TGF-P3 simultaneously, TGF-P 1 and TGF-P2 simultaneously, or TGF-P2 and TGF-P3 simultaneously.

[0172] (30) The agent, composition or method of any one of embodiments 1-29, wherein the antisense agents for suppressing expression of isoforms of TGF-P are one or more or all of chemically-modified GGTGCTGTTGTA SEQ ID NO:21;G*G*T*G*C*T*G*T*T*G*T*A SEQ ID NO:22;chemically-modified CAGAAGTTGGC SEQ ID NO:23;C*A*G*A*A*G*T*T*G*G*C SEQ ID NO:24;chemically-modified AGCTTGCTCA SEQ ID NO:25;A*G*C*T*T*G*C*T*C*A SEQ ID NO:26;chemically-modified TTCAGCTTGCTCAGGATCTG SEQ ID NO:27;T*T*C*A*G*C*T*T*G*C*T*C*A*G*G*A*T*C*T*G SEQ ID NO:28; chemically-modified CGGCATGTCTATTTTGTA SEQ ID NO:29 (OT-101); C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO:30;chemically-modified ACCTAAGTTGGACTCTCTTC SEQ ID NO:31;A*C*C*T*A*A*G*T*T*G*G*A*C*T*C*T*C*T*T*C SEQ ID NO:32.

[0173] (31) The agent, composition or method of any one of embodiments 1-30, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.

[0174] (32) The agent, composition or method of any one of embodiments 1-31, wherein the agents are administered concurrently, simultaneously, sequentially, or separately in time.Docket No. 018988-034WO1

[0175] (33) The agent, composition or method of any one of embodiments 1-32, wherein the agents are administered by infusion, injection, or intracranial continuous infusion.

[0176] (34) The agent, composition or method of any one of embodiments 1-33 in combination with one or more agents for modulating a level of one or more of HIF1 A, TRIM22, IRF5, and PARP9 for treating or ameliorating the symptoms of cancer in a subject.

[0177] (35) The agent, composition or method of any one of embodiments 1-34, wherein the one or more agents for modulating a level of HIF1A are selected fromPHD inhibitors; andsynthetic, recombinant or artificial human HIF1A supplement protein.

[0178] (36) The agent, composition or method of any one of embodiments 1-35, wherein the one or more agents for modulating a level of HIF1A are selected fromroxadustat or daprodustat; andsynthetic, recombinant or artificial human HIF1A supplement protein.

[0179] (37) The agent, composition or method of any one of embodiments 1-36, wherein the one or more agents for modulating a level of TRIM22 are selected fromType I interferons;TLR agonists; andsynthetic, recombinant or artificial human TRIM22 supplement protein.

[0180] (38) The agent, composition or method of any one of embodiments 1-37, wherein the one or more agents for modulating a level of TRIM22 are selected fromIFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb;imiquimod or resiquimod; andsynthetic, recombinant or artificial human TRIM22 supplement protein.

[0181] (39) The agent, composition or method of any one of embodiments 1-38, wherein the one or more agents for modulating a level of IRF5 are selected fromType I Interferon agents;GM-CSF (CSF2) agents;Type I interferons such as IFN-a and IFN-P and TLR agonists such as imiquimod and resiquimod; andsynthetic, recombinant or artificial human IRF5 supplement protein.

[0182] (40) The agent, composition or method of any one of embodiments 1-39, wherein the one or more agents for modulating a level of IRF5 are selected fromDocket No. 018988-034WO1Peginterferon Alfa-2a, IFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb; sargramostim;imiquimod or resiquimod; andsynthetic, recombinant or artificial human IRF5 supplement protein.

[0183] (41) The agent, composition or method of any one of embodiments 1-40, wherein the one or more agents for modulating a level of PARP9 are selected fromType I interferons;TLR agonists; andsynthetic, recombinant or artificial human PARP9 supplement protein.

[0184] (42) The agent, composition or method of any one of embodiments 1-41, wherein the one or more agents for modulating a level of PARP9 are selected fromIFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb;imiquimod or resiquimod; andsynthetic, recombinant or artificial human PARP9 supplement protein.

[0185] (43) The agent, composition or method of any one of embodiments 1-42, wherein the cancer is multiple myeloma and the modulating agents are for one or more of IRAK4 and TRIM5.

[0186] (44) The agent, composition or method of any one of embodiments 1-43, wherein the cancer is gastric cancer and the modulating agents are for one or more of TRIM5, HIF1A, and TRIM22.

[0187] (45) The agent, composition or method of any one of embodiments 1-44, wherein the cancer is glioblastoma and the modulating agents are for one or more of IRAK4, TRIM5, HIF1A, TRIM22, and PARP9.

[0188] (46) The agent, composition or method of any one of embodiments 1-45, wherein the cancer is melanoma and the modulating agents are for one or more of IRAK4, TRIM5, TRIM22, IRF5 and PARP9.

[0189] All publications including patents, patent application publications, and nonpatent publications referred to in this description, as well as the sequence listing are each expressly incorporated herein by reference in their entirety for all purposes.

[0190] Although the foregoing disclosure has been described in detail by way of example for purposes of clarity of understanding, it will be apparent to the artisan thatDocket No. 018988-034WO1certain changes and modifications are comprehended by the disclosure and may be practiced without undue experimentation within the scope of the appended claims, which are presented by way of illustration not limitation. This invention includes all such additional embodiments, equivalents, and modifications. This invention includes any combinations or mixtures of the features, materials, elements, or limitations of the various illustrative components, examples, and claimed embodiments.

[0191] The designations of agents, compounds and structures of this disclosure are meant to encompass all possible isomers, stereoisomers, diastereomers, enantiomers, and / or optical isomers that would be understood to exist for the specified structure, including any mixture, racemic or otherwise, thereof.EXAMPLES

[0192] Example 1 : FIG. 1 shows results of a study of clinical outcomes for multiple myeloma patients and the beneficial impact on overall survival for multiple myeloma patients of the therapeutic use of a MALT 1 -specific antisense agent in combination with modulators of associated gene products. The Kaplan-Meier chart of FIG. 1 (KM Plotter) shows that overall survival was significantly improved for patients above median IRAK4 and having low MALT1. This study established a basis for therapeutic use of a MALT1 -specific antisense agent in combination with a modulator agent of IRAK4 for treating multiple myeloma. The median overall survival time for patients from the IRAK4(high)-MALTl(low) group was 87 months (logrank P=3.3e-16), which was significantly and surprisingly increased over the 32 months observed for patients of the IRAK4(low)-MALTl(low) group.

[0193] Example 2 : FIG. 2 shows results of a study of clinical outcomes for multiple myeloma patients and the beneficial impact on overall survival for multiple myeloma patients of the therapeutic use of a MALTl-specific antisense agent in combination with modulators of associated gene products. The Kaplan-Meier chart of FIG. 2 (KM Plotter) shows that overall survival was significantly improved for patients above median TRIM5 and having low MALT1. This study established a basis for therapeutic use of a MALTl-specific antisense agent in combination with a modulator agent of TRIM5 for treating multiple myeloma. The median overall survival time for patients from the TRIM5(high)-MALTl(low) group was 87 months (logrank P=1E-16), whichDocket No. 018988-034WO1was significantly and surprisingly increased over the 25 months observed for patients of the TRIM5(low)-MALTl(low) group.

[0194] Example 3: FIG. 3 shows negative prognostic impact of MALT1 mRNA expression on OS hazard ratios (HR) in glioblastoma (GBM) patients. The multivariate Cox proportional hazards model was implemented to assess the individual effects of MALT1 mRNA ex-pression (log2 TPM values), TGFB1 / 2 / 3, and MGMT controlling for age at diagnosis (AGE), Sex (Male relative to Female), and interaction terms for TGFB2 x Age and Age x Sex interactions. The Forest plot depicts the impact on hazard ratio (HR) for each factor. *** P< 0.001, ** P< 0.01, * P< 0.05.

[0195] Example 4 : FIG. 4 shows interaction plots depicting the negative prognostic impact of MALT1 mRNA expression on OS hazard ratios (HR) in GBM patients dependent on Age and Sex. The negative prognostic impact of increasing MALT1 mRNA levels (minimum (Min MALT1 = 7.447 log2 (TPM); lower quartile (LQuart MALT1 = 8.182); upper quartile (UQuart MALT1 = 8.948); maximum (Max MALT1 = 10.191)) comparing Sex (Male and Female) and Age (Old = 89 yr; Young = 21 yr) of GBM patients was investigated. OS was followed with the gene methylation variables set to low levels of TGFB1 / 2 / 3 and MGMT. [A], For young males, increasing the mRNA levels of MALT1 from minimum, LQuart, and UQuart to the maximum also decreased the median survival time from 21.3, 16.6, and 14.5 to 8.4, respectively. [B] For young females, the median survival times decreased from 50.3, 50.3, 47.9, and 25.3 months, respectively. [C] For old males, survival times decreased from 15, 11.8, 8.4, and 4.1 months, respectively. [D] The median survival times for old females decreased from 4.9, 4.1, 3.1, and 1.1 months, respectively.

[0196] Example 5 MALT1 mRNA negatively impacted survival rates, providing a potential target for therapies. Our study suggests that patients with high levels of TGFB2 methylation serve as a biomarker for patients susceptible to immunotherapies targeting T-cell activation.

[0197] MALT1 mRNA expression was the only gene product with a negative prognostic impact on OS in GBM patients (HR (95% CI range) = 1.997 (1.1-3.625); P = 0.023). (4) Conclusions: Increased levels of TGFB2 gene methylation exhibit improved OS in adult GBM patients and were correlated with mRNAs related to T-cell activationDocket No. 018988-034WO1and antigen presentation and Toll-like receptor pathways potentially beneficial to patient survival undergoing immune therapies.

[0198] Sixty-four Reactome pathways enriched in mRNA expression of genes negatively correlated with TGFB2 methylation. Pathways negatively correlated to TGFB2 methylation were represented by 1161, of which 275 genes exhibited significant negative correlations to TGFB2 methylation (P<0.05, FDR = 0.11). Examination of the levels of mRNA expression of these 275 genes showed that 169 genes were significantly upregulated in tumor tissues (P<0.0001). Expression of these genes was screened for prognostic impact using a multivariate Cox proportion hazards model measuring the effects of mRNA expression of each of the genes that considered the impact of TGFB 1 / 2 / 3, MGMT methylation controlling for Age, Sex, and Age interactions yielded 20 genes that showed OS impact for the gene and MGMT methylation upregulated in tumor tissues in addition to genes representing CD3D (T-cell marker), CD3E (T-cell marker) and CD86 (Ml-like Macrophage marker). To validate the bulk RNA-seq from the TCGA study, we analyzed the expression of the 23 genes in an independent dataset utilizing RNA sequencing quantification from single cells obtained from 20 adult and 8 pediatric IDH-wildtype Glioblastoma patients. In Adult patients, PARP9 and IFI35 exhibited high levels of expression in Macrophages; TRIM22 and MALT1 were highly expressed in Macrophages and T-cells; TRIM5 and HIF1A were highly expressed in Macrophages and Malignant cells; IRAK4 was highly expressed in Macrophages, Malignant and T-cells. In multivariate models, increasing age and male patients exhibited worse survival outcomes, prompting us to investigate the favorable prognostic impact of genes identified in the TCGA and single-cell RNA seq experiments. The fitted parameters from the multivariate Cox proportional hazards model were used to generate survival curves for increasing HIF1A, TRIM22, IRAK4, and PARP9 mRNA levels (HIF1A: 89.26% of macrophage cells, 4.82 Log2 TPM; TRIM22: 80.5%, 3.22 Log2 TPM; IRAK4 92.18%, 1.16 Log2 TPM; PARP9: 50.8%, 1.45 Log2 TPM). They showed significant positive prognostic impact independent of TGFB2 and MGMT methylation.

[0199] MALT1 (Reactome pathway: “CLEC7A (Dectin-1”) signaling) mRNA expression was the only gene product with a negative prognostic impact on OS in GBM patients that showed sexual dimorphism for the OS curves comparing young males andDocket No. 018988-034WO1young females at high TGFB2 gene methylation (Figures 3 and 4). The Forest plot showed a significant increase in HR for MALT1 mRNA expression. The HR for MALT1 mRNA expression was 1.997 (95% CI range: 1.1-3.625; P = 0.023). For the AGE group, the HR was 1.068 (95% CI range: 1.03-1.107; P < 0.001), while the TGFB2 by AGE interaction had an HR of 1.041 (95% CI range: 0.982-1.103; P = 0.18) and the AGE by SEX interaction showed an HR of 0.949 (95% CI range: 0.9-1; P = 0.048). There was not a significant decrease in HR for TGFB2highMe group of patients (HR = 0.067, 95% CI range: 0.002-2.658; P = 0.15), TGFBlhighMe (HR = 0.623, 95% CI range: 0.284-1.368; P = 0.239), or TGFB3highMe (HR = 1.041, 95% CI range: 0.54-2.008; P = 0.904), whereas a significant decrease in HR was observed for the MGMThighMe group (HR = 0.452, 95% CI range: 0.243-0.841; P = 0.012). Examination of the interaction plots showed marked sexual dimorphism comparing young males and young females exhibiting curves for young males, increasing the mRNA levels of MALT1 from minimum, LQuart, and UQuart to the maximum also decreases the median survival time from 21.3, 16.6, and 14.5 to 8.4, respectively, and for young females, the median survival times decreased from 50.3, 50.3, 47.9, and 25.3 months, respectively (Figures 4A and 4B).

[0200] The multivariate model that controlled for genes for TGFB ligands and MGMT methylations revealed that the mRNA expression of 19 mRNA products (BCL10, CAPZA1, HIF1A, HLA-DRB1, IFI35, IFIH1, IFIT3, IRAK4, ITCH, NUDT12, PARP9, PSMA4, RSAD2, SNAP23, STAT1, TRIM21, TRIM22, TRIM5, UBA3) was positively prognostic, with increasing levels of mRNA expression showing decreasing hazard ratios. We validated bulk RNA-seq from the TCGA study using the expression of the genes in an independent dataset utilizing RNA sequencing quantification from single cells obtained from 20 adult and 8 pediatric IDH-wildtype Glioblastoma patients.Eleven genes were preferentially expressed in adult samples (PARP9, IFI35, TRIM22, STAT1, TRIM5, HIF1A, RSAD2, IFIT3, IRAK4, ITCH, MALT1). Of these genes, IFI35, TRIM22, STAT1, TRIM5, RSAD2, and IFIT3 were interferon related, and HIF1A was Interleukin related. In Adult patients, of the genes exhibiting positive prognosis at increasing levels of mRNA ex-pression PARP9 and IFI35 exhibited high levels of expression in Macrophages; TRIM22 was highly expressed in MacrophagesDocket No. 018988-034WO1and T-cells; TRIM5 and HIF1A were highly ex-pressed in Macrophages and Malignant cells; IRAK4 was highly expressed in Macro-phages, Malignant and T-cells.

[0201] Example 6 MALT1 mRNA expression showed a negative prognostic impact on OS in GBM patients.

[0202] MALT1 (Mucosa-Associated Lymphoid Tissue Lymphoma Translocation Protein 1) exhibited a 2.1-fold increase in mRNA expression in tumor compared to normal tissues. This gene was the only non-Interferon related gene out of the 20 that showed prognostic impact in GBM patients. Examination of the single-cell RNA-seq data showed that the expression in Macrophages (30.5%) and T-cells (25.5%) was less than 50% of the total cells surveyed. The multivariate model that included MALT1 mRNA showed that there was a significant increase in HR for MALT1 mRNA expression (HR (95% CI range) = 1.997 (95% CI range: 1.1-3.625; P = 0.023)) representing a 2-fold increase in HR for a 2-fold increase in MALT1 mRNA expression. The TGFB2 methylation x Age interaction did not achieve statistical significance (HR (95% CI range) = 1.041 (95% CI range: 0.982-1.103; P = 0.18), while the Age x Sex interaction effect was significant ((HR (95% CI range) = 0.949 (95% CI range: 0.9-1; P = 0.048) (Figure 3). Plotting the OS curves visualized using the interaction plots showed that the combined impact of young age and high MALT1 mRNA levels exhibited a pronounced negative prognostic impact on OS in GBM patients. These interaction plots exhibited a marked sexual dimorphism between young males and young females at all four levels of MALT1 mRNA expression (compare curves in Figures 4A and 4B). MALT1 is a key signaling molecule in both innate and adaptive immunity. It activates T cells, B cells, myeloid cells, and NK cells by regulating the NF-KB signaling pathway, driving immune cell activation, proliferation, survival, and cytokine production. MALT1 is part of the CAR-MA1-BCL10-MALT1 (CBM) signalosome complex that facilitates antigen receptor signaling in lymphocytes and acts as a paracaspase, cleaving specific substrates to sustain NF-KB signaling, enhancing T cell adhesion, and stabilize mRNA for pro-inflammatory genes. It is critical for developing regulatory T cells, maintaining immune tolerance, and mediating innate immune responses via receptors such as Dectin-1. Dysregulated MALT1 activity is linked to lymphoid malignancies (e.g., MALT lymphoma), autoimmune diseases, and immunodeficiencies. MALT1 plays an important role in cancer, including glioblastomaDocket No. 018988-034WO1(GBM), by driving tumor progression through both cell-intrinsic and cell-extrinsic mechanisms. It promotes tumor cell survival, proliferation, and invasion via EGFR-induced NF-KB activation, while its scaffolding and protease activities regulate key signaling pathways, including the inactivation of NF-KB pathway inhibitors, specifically A20 and CYLD. MALT1 also influences the tumor microenvironment by maintaining immune-suppressive regulatory T cells. In GBM, MALT1 inhibition, such as with MI-2, leads to reduced tumor cell proliferation, migration, and invasion, induces G1 cell cycle arrest, and enhances immune reactivity in the tumor microenvironment, making it a promising therapeutic target. Recent studies indicate that MALT1 is a downstream target of the canonical TGF-p / Smad3 pathway, where TGF-P stimulation increases MALT1 expression dose- and time-dependent via Smad3 phosphorylation. This relationship is supported by correlated expressions of SMAD3 and MALT1 in cancer data (TCGA). MALT1 also mediates TGF-P-induced NF-KB signaling, facilitating nuclear translocation of NF-KB p65 and transcriptional activation, with the CBM signalosome (CARMA-BCL10-MALT1) playing a role in activating NF-KB target genes. This MALT1-TGF-P-NF-KB axis explains TGF-P’s dual role in cancer progression, contributing to survival, proliferation, and metastasis of cancer cells, and highlights MALT1 as a potential therapeutic target for disrupting this interaction in cancer treatment.

[0203] MALT1 mRNA expression was the only gene product with a negative prognostic impact on OS in GBM patients (HR (95% CI range) = 1.997 (1.1-3.625); P = 0.023) and, therefore, can be targeted for immune therapies. TGFB2 gene methylation exhibits improved OS in adult GBM patients that is age and sex-dependent, and correlation with mRNA identifies Reactome pathways that could potentially remodel the tumor microenvironment to augment T-cell activation and antigen processing potentially beneficial to patient survival undergoing immune therapies.

Claims

Docket No. 018988-034WO1WHAT IS CLAIMED IS:

1. An antisense agent for suppressing expression of MALT 1.

2. A composition comprising an antisense agent for suppressing expression of MALT1 and a carrier for use in the preparation of a cancer medicament or for use in treating or ameliorating the symptoms of cancer in a subject.

3. A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising:preparing a composition comprising an antisense agent for suppressing expression of MALT1 and a carrier; andadministering a therapeutically sufficient amount of the composition to the subject.

4. The agent, composition or method of any one of claims 1-3, wherein the cancer is a multiple myeloma, a gastric cancer, a glioma, a glioblastoma, a diffuse midline glioma (DMG), a pancreatic cancer, a melanoma, a skin cancer, a lung cancer, a breast cancer, a prostate cancer, a colorectal cancer, a kidney cancer, a stomach cancer, an ovarian cancer, a cervical cancer, or a liver cancer.

5. The agent, composition or method of any one of claims 1-3, wherein the cancer is multiple myeloma or gastric cancer.

6. The agent, composition or method of any one of claims 1-3, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 transcript and 15-30 nucleotides in length.

7. The agent, composition or method of any one of claims 1-3, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.

8. The agent, composition or method of any one of claims 1-3, wherein the agent, medicament or administration comprises one or more MALT 1 -specific antisense oligonucleotides complementary to a MALT1 transcript as in Table 1.

9. The agent, composition or method of any one of claims 1-3, comprising a MALT1-specific antisense oligonucleotide as in Table 1 having one or more nucleotides chemically modified as a phosphorothioate intemucleoside linkage, a methoxypropylphosphonateDocket No. 018988-034WO1internucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-0Me ribose group, a 2’-M0E methoxyethyl ribose group, a 2’-4’ constrained methoxyethyl bicyclic ribose group, a 2’-4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5-methylcytodine base.

10. The agent, composition or method of any one of claims 1-3, wherein the agent, medicament or administration comprises MALT 1 -specific antisense oligonucleotides:chemically-modified AGACGCCATCAACACTTCTC SEQ ID NO: 15; or A*G*A*C*G*C*C*A*T*C*A*A*C*A*C*T*T*C*T*C SEQ ID NO:16.

11. The agent, composition or method of any one of claims 1-3, wherein the agent, medicament or administration comprises MALT 1 -specific antisense oligonucleotides:chemically-modified GGAGCTTTGAGCTTGGGGTG SEQ ID NO: 17; or G*G*A*G*C*T*T*T*G*A*G*C*T*T*G*G*G*G*T*G SEQ ID NO:18.

12. The agent, composition or method of any one of claims 1-3, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.

13. The agent, composition or method of any one of claims 1-3, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.

14. The agent, composition or method of any one of claims 1-3, wherein the agent, composition or method is substantially free of excipients.

15. The agent, composition or method of any one of claims 1-3, wherein the agent, composition or method is stable for at least 14 days in carrier at 37°C.

16. The agent, composition or method of any one of claims 1-3, wherein the agent, composition or method is combined with a standard of care treatment for the cancer.

17. The agent, composition or method of any one of claims 1-3, wherein the agent, composition or method is for use or administration by infusion, injection, or intracranial continuous infusion.

18. The agent, composition or method of any one of claims 1-3, comprising one or more additional medicaments selected from a cancer growth blocker, a targeted cancer drug, an angiogenesis inhibitor, a histone deacetylase inhibitor, a hedgehog blocker, an mTOR inhibitor, a p53 inhibitor, a PARP inhibitor, a proteasome inhibitor, a tyrosine kinase inhibitor, and an EGFR tyrosine kinase inhibitor.Docket No. 018988-034WO119. The agent, composition or method of any one of claims 1-3, in combination with one or more of everolimus, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, bevacizumab, belzutifan, dabrafenib, trametinib, TMZ, and radiation therapy.

20. The agent, composition or method of any one of claims 1-3, wherein the agent, composition or method increases an overall survival rate of the subject at month 6, 12, 18, 24, 30, or 36.

21. A kit comprising:an agent or composition of any one of claims 1-3; anda carrier.

22. The agent, composition or method of any one of claims 1-3 in combination with one or more agents for modulating a level of one or both of IRAK4 and TRIM5 for use in treating or ameliorating the symptoms of cancer in a subject.

23. The agent, composition or method of claim 22, wherein the one or more agents for modulating a level of IRAK4 are selected from:TLR4 agonists;TLR3 agonists;TLR7-TLR8 agonists; andsynthetic, recombinant or artificial human IRAK4 supplement protein.

24. The agent, composition or method of claim 22, wherein the one or more agents for modulating a level of IRAK4 are selected from:MPLA;poly IC;R837 orR848; andsynthetic, recombinant or artificial human IRAK4 supplement protein.

25. The agent, composition or method of claim 22, wherein the one or more agents for modulating a level of TRIM5 are selected fromType I interferons;TLR agonists; andsynthetic, recombinant or artificial human TRIM5 supplement protein.Docket No. 018988-034WO126. The agent, composition or method of claim 22, wherein the one or more agents for modulating a level of TRIM5 are selected fromIFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb;imiquimod or resiquimod; andsynthetic, recombinant or artificial human TRIM5 supplement protein.

27. The agent, composition or method of claim 22, wherein the cancer is multiple myeloma and the modulating agents are for one or both of IRAK4 and TRIM5.

28. The agent, composition or method of any of claims 1-3, in combination with one or more antisense agents for suppressing expression of isoforms of TGF-P for use in treating or ameliorating the symptoms of cancer in a subject.

29. The agent, composition or method of claim 28, wherein the antisense agents for suppressing expression of isoforms of TGF-P are selective for TGF-pi, TGF-P2, TGF-P3, TGF-pi and TGF-P2 and TGF-P3 simultaneously, TGF-pi and TGF-P2 simultaneously, or TGF-P2 and TGF-P3 simultaneously.

30. The agent, composition or method of claim 28, wherein the antisense agents for suppressing expression of isoforms of TGF-P are one or more or all of:chemically-modified GGTGCTGTTGTA SEQ ID NO:21;G*G*T*G*C*T*G*T*T*G*T*A SEQ ID NO:22;chemically-modified CAGAAGTTGGC SEQ ID NO:23;C*A*G*A*A*G*T*T*G*G*C SEQ ID NO:24;chemically-modified AGCTTGCTCA SEQ ID NO:25;A*G*C*T*T*G*C*T*C*A SEQ ID NO:26;chemically-modified TTCAGCTTGCTCAGGATCTG SEQ ID NO:27;T*T*C*A*G*C*T*T*G*C*T*C*A*G*G*A*T*C*T*G SEQ ID NO:28;chemically-modified CGGCATGTCTATTTTGTA SEQ ID NO:29 (OT-101);C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO:30;chemically-modified ACCTAAGTTGGACTCTCTTC SEQ ID NO:31;A*C*C*T*A*A*G*T*T*G*G*A*C*T*C*T*C*T*T*C SEQ ID NO:32.

31. The agent, composition or method of claim 28, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.Docket No. 018988-034WO132. The agent, composition or method of claim 28, wherein the agents are administered concurrently, simultaneously, sequentially, or separately in time.

33. The agent, composition or method of claim 28, wherein the agents are administered by infusion, injection, or intracranial continuous infusion.

34. The agent, composition or method of any one of claims 1-3 in combination with one or more agents for modulating a level of one or more of HIF1A, TRIM22, IRF5, and PARP9 for treating or ameliorating the symptoms of cancer in a subject.

35. The agent, composition or method of claim 34, wherein the one or more agents for modulating a level of HIF1A are selected fromPHD inhibitors; andsynthetic, recombinant or artificial human HIF1A supplement protein.

36. The agent, composition or method of claim 34, wherein the one or more agents for modulating a level of HIF1A are selected fromroxadustat or daprodustat; andsynthetic, recombinant or artificial human HIF1A supplement protein.

37. The agent, composition or method of claim 34, wherein the one or more agents for modulating a level of TRIM22 are selected fromType I interferons;TLR agonists; andsynthetic, recombinant or artificial human TRIM22 supplement protein.

38. The agent, composition or method of claim 34, wherein the one or more agents for modulating a level of TRIM22 are selected fromIFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb;imiquimod or resiquimod; andsynthetic, recombinant or artificial human TRIM22 supplement protein.

39. The agent, composition or method of claim 34, wherein the one or more agents for modulating a level of IRF5 are selected fromType I Interferon agents;GM-CSF (CSF2) agents;Type I interferons such as IFN-a and IFN-P and TLR agonists such as imiquimod andDocket No. 018988-034WO1resiquimod; andsynthetic, recombinant or artificial human IRF5 supplement protein.

40. The agent, composition or method of claim 34, wherein the one or more agents for modulating a level of IRF5 are selected fromPeginterferon Alfa-2a, IFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb;sargramostim;imiquimod or resiquimod; andsynthetic, recombinant or artificial human IRF5 supplement protein.

41. The agent, composition or method of claim 34, wherein the one or more agents for modulating a level of PARP9 are selected fromType I interferons;TLR agonists; andsynthetic, recombinant or artificial human PARP9 supplement protein.

42. The agent, composition or method of claim 34, wherein the one or more agents for modulating a level of PARP9 are selected fromIFN-a-2a, IFN-a-2b, IFN-P-la, or IFN-P-lb;imiquimod or resiquimod; andsynthetic, recombinant or artificial human PARP9 supplement protein.

43. The agent, composition or method of claim 34, wherein the cancer is multiple myeloma and the modulating agents are for one or more of IRAK4 and TRIM5.

44. The agent, composition or method of claim 34, wherein the cancer is gastric cancer and the modulating agents are for one or more of TRIM5, HIF1 A, and TRIM22.

45. The agent, composition or method of claim 34, wherein the cancer is glioblastoma and the modulating agents are for one or more of IRAK4, TRIM5, HIF1A, TRIM22, and PARP9.

46. The agent, composition or method of claim 34, wherein the cancer is melanoma and the modulating agents are for one or more of IRAK4, TRIM5, TRIM22, IRF5 and PARP9.

Images