Methods of restoring acute phase response in AATD patients

Abstract

Provided herein are methods for improving or restoring an acute phase response to an infection in a subject who is homozygous for a Z AAT allele by editing the subject's SERPINA1 DNA or mRNA.

Description

[0001] Atty Docket No. K199354 1070WO (00038)

[0002] KB-056-PCT METHODS OF RESTORING ACUTE PHASE RESPONSE IN AATD PATIENTS CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 880,868, filed on September 12, 2025, and U.S. Provisional Application No. 63 / 777,862, filed on March 26, 2025. The entire contents of the foregoing applications are hereby incorporated herein by reference.

[0004] SEQUENCE LISTING

[0005] The instant application contains a Sequence Listing which has been filed electronically in extensible Markup Language (XML) format and is hereby incorporated by reference in its entirety. Said XML copy, created on March 24, 2026, is named K199354_1070WO_SL.xml and is 4,936,342 bytes in size.

[0006] BACKGROUND

[0007] The systemic inflammatory component of innate immunity is called the acute phase response (APR). The APR is a transient deviation from homeostasis, invoked when the integrity of the organism is breached. The major APR proteins, such as C-reactive protein (CRP), bind to pathogens to mediate their elimination by activating the complement cascade and recruiting phagocytic cells. Bacterial lipopolysaccharide (LPS) triggers the APR through interaction with toll like receptor-4 expressed on monocytes, macrophages, and dendritic cells, to produce IL6, IL1B, and TNFa, which activate expression of APR genes in hepatocytes, vascular endothelium, and other target cells.

[0008] Alpha- 1 -antitrypsin (AAT) is an abundant liver derived protein that is secreted into circulation and functions to inhibit neutrophil elastase in the lungs. AAT is also an acute phase reactant along with others such as C-reactive protein (CRP), and Serum amyloid 1 (SAA1), with increased serum levels during inflammatory states such as COVID- 19 infection or pneumonia. Circulating AAT protein is important to down-regulate inflammation due to infection. For patients with abnormal AAT protein levels, e.g., due to Z allele pathology, APR is limited. Thus, a need exists for methods address APR in AAT Z allele patients.

[0009] These acute phase reactants are essential for signaling immune cell activation, modulating inflammation levels, and promoting tissue repair. In patients with Alpha- 1 -antitrypsin deficiency (AATD), a mutation in the SERPINA1 gene that encodes AAT results in protein polymerization within the liver resulting in liver damage and lack of secretion into circulation, leading to impaired neutrophil elastase inhibition within the lungs. As a result, patients are unable to significantly increase AAT during acute phase response, and those patients on augmentation therapy or recombinant AAT therapies are unable to regulate exogenously delivered AAT. Patients on siRNA therapies are only correcting the liver phenotype by knocking down mutant SERPINA1 transcript, so these patients will also be unable to regulate increases normal SERPINA1 expression or AAT increases. RNA editingAtty Docket No. K199354 1070WO (00038)

[0010] KB-056-PCT therapeutics are designed to correct the most common mutation in AATD, leading to production of wild type protein (M-AAT) to clear polymerized protein aggregates in the liver and is secreted in circulation to restore neutrophil elastase inhibition. Because normal wild type transcript and protein are generated, a restored acute phase response is predicted to occur, allowing AATD patients on RNA editing therapy to adequately react to inflammation or infection.

[0011] DNA editing typically involve the CRISPR-Cas9 proteins, coopted from the bacterial immune system, that direct DNA editing machinery to a target genome locus through a guide RNA to correct the Z mutation by base editing at E366K mutation. Because the precise editing of the mutation can be edited back to the wild-type sequence, this approach has the potential to address both lung and liver manifestations of AATD by reducing liver aggregations and increasing functional AAT in circulation. Base editing can correct the mutation and restore the gene function, a normal acute phase response is predicted to occur and adequately react to inflammation an infection.

[0012] SUMMARY

[0013] Provided herein are methods of improving or restoring an acute phase response to an infection in a subject who is homozygous for a Z-AAT allele comprising: administering to the subject an oligonucleotide composition capable of editing a target adenosine to an inosine in SERPINA1 DNA or mRNA such that, when translated, the SERPINA1 mRNA produces an M form of AAT protein; the produced M AAT protein facilitating the inhibition of neutrophil elastase activity to improve or restore the acute phase response to an infection in the subject.

[0014] In one aspect, the methods disclosed herein comprise administering an oligonucleotide comprising the structure:

[0015] [AJ-X’-X^X^Bn]

[0016] wherein each A and B comprise (i) a nucleobase, (ii) a sugar (“an A / B sugar”), and (iii) an intemucleotide linkage;

[0017] each A / B sugar is independently a 2 ’-methoxyribose, a 2’-methoxyethylribose, a 2 ’-fluoroarabinose, a 2’-deoxy-2’fluororibose, or a 2’-deoxyribose;

[0018] m is 20 to 40;

[0019] n is 4 to 15;

[0020] X1comprises (i) a nucleobase selected from uracil and thymine, (ii) a 2 ’deoxyribose sugar, and (iii) an intemucleotide linkage;

[0021] X2comprises a structure

[0022]

[0023] of and an intemucleotide linkage, wherein N is a nucleobase; X3comprises (i) a nucleobase selected from guanosine, hypoxanthine, and 7-deazaguinine, (ii) a sugarAtty Docket No. K199354 1070WO (00038)

[0024] KB-056-PCT selected from 2 ’-deoxyribose and 2 ’-deoxy-2’ -fluoroarabinose, and (iii) an intemucleotide linkage; and the intemucleotide linkages of the oligonucleotide comprise at least 30% phosphoramidate and / or phosphorothioate linkages.

[0025] The details of one or more embodiments described herein are set forth in the description below. Other features, objects, and advantages described herein will be apparent from the description and from the claims.

[0026] BRIEF DESCRIPTION OF THE FIGURES

[0027] Figure 1 shows SERPINA1 expression levels before and after exposure to LPS in serum of mice administered vehicle (PBS) or Oligo 7, an RNA editing oligo, formulated in a lipid nanoparticle (LNP).

[0028] Figure 2 shows AAT (M-AAT and Z-AAT) levels secreted in PiZ mouse serum at Day 4 after exposure to LPS and administered vehicle (PBS) or Oligo 7, an RNA editing oligo, formulated in a lipid nanoparticle (LNP).

[0029] Figure 3 A shows LCMS measurements of total AAT in serum of PiZ mice exposed to LPS and administered vehicle (PBS) or Oligo 7, an RNA editing oligo, formulated in a lipid nanoparticle (LNP). Figure 3B shows amount of functional AAT in serum of PiZ mice exposed to LPS and administered vehicle (PBS) or Oligo 7 formulated in a LNP.

[0030] Figure 4A shows dose-dependent SERPINA1 RNA editing levels (% editing) in monocytes derived from five individual ZZ patients after incubation with KB-20794, an RNA editing oligo, formulated in a lipid nanoparticle (LNP). Figure 4B shows SERPINA1 RNA editing levels (% editing) in monocytes derived from the five individual ZZ patients of Figure 4A, and in PiZ hepatocytes, after incubation with KB-9486, a GalN Ac-conjugated RNA editing oligo.

[0031] DETAILED DESCRIPTION

[0032] Provided herein are methods for improving or restoring an acute phase response to an infection in a subject who is homozygous for a Z AAT allele comprising administering to the subject an oligonucleotide composition capable of editing a target adenosine to an inosine in SERPINA1 DNA or mRNA such that, when translated, the SERPINA1 mRNA produces an M form of AAT protein; the produced M AAT protein facilitating the inhibition of neutrophil elastase activity to improve or restore the acute phase response to an infection in the subject.

[0033] Alpha- 1 -antitrypsin (Al AT or AAT) deficiency is a genetic disease caused by defects in the SERPINA1 gene (also known as PI; A1A; AAT; PI1; A1AT; PRO2275; and alphalAT, set forth in Genbank Accession No. KJ897327.1).Atty Docket No. K199354 1070WO (00038)

[0034] KB-056-PCT AAT deficiency is one of the most common genetic diseases in subjects of Northern European descent. Severe AAT deficiency causes emphysema, with subjects developing emphysema in their third or fourth decade. AAT deficiency can also cause liver failure and hepatocellular carcinoma, with up to 30% of subjects with severe AAT deficiency developing significant liver disease, including cirrhosis, fulminant liver failure, and hepatocellular carcinoma.

[0035] There are two predominant mutations in the SERPINA1 gene that cause AAT deficiency. These missense mutations affect protein conformation and secretion leading to reduced circulating levels of AAT. The more common and more severe mutation is a glutamate to lysine substitution at amino acid position 342 (E342K, “Z mutation”) of the mature AAT protein, which can arise from, e.g., c.lO24G>A. Alleles carrying the Z mutation are identified as PiZ alleles. Subjects homozygous for the PiZ allele are termed PiZZ carriers, and express 10-15% of normal levels of serum AAT.

[0036] Approximately 95% of subjects who are symptomatic for AAT deficiency have the PiZZ genotype. Subjects heterozygous for the Z mutation are termed PiMZ mutants, and express 60% of normal levels of serum AAT. The other predominant mutation is a glutamate to valine substitution at position 264 (E264V, “S mutation”) of the mature AAT protein, which can arise from, e.g., c.791A>T. Alleles with the S mutation are termed PiS. Subjects homozygous for the PiS allele are termed PiSS carriers, and express 60% of normal levels of serum AAT. Subjects heterozygous for this mutation are termed PiMS and express 80% of normal levels of serum AAT. Compound heterozygotes are represented as PiSZ. PiSZ subjects express 40% of normal levels of serum AAT. Normal SERPINA1 subjects are represented as PiMM.

[0037] The pathophysiology of AAT deficiency varies by the organ affected. Liver disease is due to a gain-of-function mechanism. Abnormally folded AAT, especially Z-type AAT (Z-AAT), aggregates and polymerizes within hepatocytes. AAT inclusions are found in PiZZ subjects and are thought to cause cirrhosis and, in some cases, hepatocellular carcinoma. Evidence for the gain-of-fimction mechanism in liver disease is supported by null homozygotes. These subjects produce no AAT and do not develop hepatocyte inclusions or liver disease. Lung disease has been classically thought to be due to a loss-of-function mechanism: lower AAT levels lead to unchecked activity of neutrophil elastase and subsequent alveolar destruction. There is recent evidence that lung disease is also due in part to a gain-of-fimction mechanism. Z-type AAT has been identified within the lung parenchyma and has been shown to be a neutrophil chemoattractant. Z-AAT may contribute through a toxic gain-of-fimction mechanism to inflammation and destruction of the lung parenchyma in AAT deficiency. AAT deficiency leads to lung disease due to reduced inhibition of neutrophil elastase in the lung. AAT enters the lung interstitium and alveolar lining fluid via passive diffusion from the plasma. Unchecked elastase activity in alveolae leads to destruction of the lung parenchyma. The primary manifestation of disease is emphysema with severe airflow obstruction. Subjects may also develop chronic bronchitis, bronchiectasis and asthma. Between 85 and 100% of subjects with the PiZZAtty Docket No. K199354 1070WO (00038)

[0038] KB-056-PCT genotype develop lung disease in their fourth or fifth decade. Other genotypes have a lower likelihood of developing lung disease and generally develop disease in their fifth decade or later. Smoking dramatically alters the phenotype in all AAT deficient subjects. Smokers are more likely to develop disease and to experience earlier onset (generally 20 years earlier) and more severe disease. Lung disease in AAT deficiency may additionally be due to monocyte and macrophage derived pathogenic Z -protein. Misfolded AAT in PiZZ or PiSZ mutants is expressed by macrophages and has been demonstrated to be pro-inflammatory. The more severe lung phenotype of PiZZ and PiSZ genotypes may be due to the secretion of an altered protein in lung tissue by macrophages and monocytes.

[0039] Lung disease associated with AAT deficiency is currently treated with intravenous administration of human-derived replacement AAT protein (Prolastin, Zemaira, or Aralast). The target AAT blood level in plasma is greater than or equal to 570 micrograms per milliliter, which generally corresponds to a dose of 60 mg / kg weekly. AAT replacement therapy can be used for the prevention of lung disease prior to definitive clinical demonstration of efficacy in delaying the onset and / or progression of disease, e.g., to reduce loss in lung density. Other treatment methods currently in use include, but are not limited to, bronchodilators, antibiotics to treat respiratory infections, and vaccination against pneumococcus and influenza. Inhaled corticosteroids and long-acting bronchodilators are also used in subjects with asthmatic symptoms or airflow obstruction. A treatment that prevents the progression of lung disease in AAT deficiency without the need for monthly injections would be superior to the current standard of care. The inability of AAT replacement therapy to fully prevent the development of lung disease may be due to the fact that replacement therapy does not eliminate the mutant Z-protein from being expressed by circulating monocytes and macrophages. Thus, a treatment that prevents damage to lung tissue that may occur due to the expression of the Z allele by circulating monocytes and macrophages would also be superior to the current standard of care.

[0040] AAT deficiency leads to liver disease in up to 50% of AAT subjects and leads to severe liver disease in up to 30% of subjects. Liver disease may manifest as: (a) cirrhosis during childhood that is selflimiting, (b) severe cirrhosis during childhood or adulthood that requires liver transplantation or leads to death and (c) hepatocellular carcinoma that is often deadly. The onset of liver disease is bi-modal, predominantly affecting children or adults. Childhood disease is self-limiting in many cases but may be lead to end-stage, deadly cirrhosis. Up to 18% of subjects with the PiZZ genotype may develop clinically significant liver abnormalities during childhood. Approximately 2% of PiZZ subjects develop severe liver cirrhosis leading to death during childhood (Sveger 1988; Volpert 2000). Adultonset liver disease may affect subjects with all genotypes, but presents earlier in subjects with the PiZZ genotype. Approximately 2-10% of A1AT deficient subjects develop adult-onset liver disease. Screening for hepatocellular carcinoma (HCC) includes, e.g., serial hepatic ultrasounds to monitor for the appearance liver nodules. Subjects who develop hepatocellular carcinoma can be treated with chemotherapy and surgery. Subjects who develop liver failure can be treated with a liver transplant.Atty Docket No. K199354 1070WO (00038)

[0041] KB-056-PCT The development of liver disease in AAT deficiency may be fatal in a large proportion of subjects: in one study, 40% of adult-onset liver disease subjects survived less than 2 years. A treatment that prevents the development of cirrhosis, liver failure, and hepatocellular carcinoma in subjects with AAT deficiency would be vastly superior to the current standard of care.

[0042] For a wild type human, normal AAT serum levels (M protein) are 20-40 pM, but during an infection, serum AAT levels are 45-90 pM. For a Z allele human, typical AAT serum levels (M protein) are 0-10 pM. Thus, Z allele patients (alternatively referred to herein as patients with PiZZ genotype) do not have sufficient M protein circulation to adequately respond to an infection, such as to downregulate inflammation. Further, because these patients are not able to trigger a response in hepatocytes to increase expression of functional AAT in response to an infection.

[0043] M protein augmentation therapy or siRNA knockdown therapy for Al AT do not address the AAT role during acute phase response because they do not restore the ability of hepatocytes to upregulate the expression and secretion of functional AAT protein in response to stimuli, such as IL6 or LPS. In contrast, a therapy that edits the mutant SERPINA1 gene or mRNA that can allow for a physiological response to an infection via the acute phase response because the upregulation of expression will allow for secretion of increased amounts of functional AAT protein due to the editing of the DNA or mRNA.

[0044] Editing of mutant SERPINA1 can be via the SERPINA1 DNA or SERPINA1 mRNA, editing the DNA or mRNA to allow production of M form of the Al AT that can provoke the acute phase response to infection.

[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present disclosure; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0046] General Terms

[0047] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed technology, because the scope of the technology is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. If there is an apparent discrepancy between the usage of aAtty Docket No. K199354 1070WO (00038)

[0048] KB-056-PCT term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0049] In this application, unless otherwise clear from context, (i) the term “a” may be understood to mean “at least one”; (ii) the term “or” may be understood to mean “and / or”; and (iii) the terms “including” and “comprising” may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps.

[0050] As used herein, the terms “about” and “approximately” refer to a value that is within 10% above or below the value being described. For example, the term “about 5 nM” indicates a range of from 4.5 to 5.5 nM.

[0051] The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21-nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.

[0052] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, an oligonucleotide with “no more than 5 unmodified nucleotides” has 5, 4, 3, 2, 1, or 0 unmodified nucleotides. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.

[0053] As used herein, the term “administration” refers to the administration of a composition (e.g., a compound or a preparation that includes a compound as described herein) to a subject or system. Administration to an animal subject (e.g., to a human) may be by any appropriate route, such as the one described herein.

[0054] The term “oligonucleotide” as used herein, is a molecule including two or more nucleotides. The term “nucleotide” refers to anucleobase, a sugar moiety, and an intemucleotide linkage.

[0055] Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide described herein may be man-made, and is chemically synthesized, and is typically purified or isolated. Oligonucleotide is also intended to include (i) compounds that have one or more furanose moieties that are replaced by furanose derivatives or by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the base moiety, (ii) compounds that have one or more phosphodiester linkages that are either modified, as in the case ofAtty Docket No. K199354 1070WO (00038)

[0056] KB-056-PCT phosphoramidate or phosphorothioate linkages, or completely replaced by a suitable linking moiety as in the case of formacetal or riboacetal linkages, and / or (iii) compounds that have one or more linked furanose-phosphodiester linkage moieties replaced by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the nucleobase moiety. The oligonucleotide described herein may include one or more alternative nucleotides (e.g., including those described herein). It is also understood that oligonucleotide includes compositions lacking a sugar moiety or nucleobase but is still capable of forming a pairing with or hybridizing to a target sequence. Oligonucleotides as used herein comprise 100 or fewer nucleotides.

[0057] The terms “nucleobase” and “base” include the purine (e.g., adenine and guanine) and pyrimidine (e.g. uracil, thymine, and cytosine) moiety present in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. The term nucleobase also encompasses alternative nucleobases that may differ from naturally occurring nucleobases but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as alternative nucleobases. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0058] “G,” “C,” “A,” “T,” and “U” each generally stand for a naturally occurring nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a nucleobase, respectively. However, G, C, A, T and U can also refer to the guanine, cytosine, adenine, thymidine, and uracil nucleobase with a sugar moiety other than ribose (or deoxyribose). Such alternate sugar moieties are discussed herein.

[0059] In a some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as an “alternative nucleobase” selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5 -propynyl -uracil, 5 -bromouracil, 5-thiazolo-uracil, 2-thio-uracil, pseudouracil, 1 -methylpseudouracil, 5 -methoxyuracil, 2'-thio-thymine, hypoxanthine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0060] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C, or U, wherein each letter may optionally include alternative nucleobases of equivalent function.

[0061] A “sugar” or “sugar moiety,” includes sugars having a furanose ring (e.g., ribose, deoxyribose, arabinose). A sugar also includes an “alternative sugar,” defined as a structure that is capable of replacing the furanose ring of a nucleoside. In certain embodiments, alternative sugars are nonfuranose (or 4'-substituted furanose) rings or ring systems or open systems. Such structures include a six-membered ring (e.g., a pyranose ring), or non-ring moieties such as those used in peptide nucleicAtty Docket No. K199354 1070WO (00038)

[0062] KB-056-PCT acids. Alternative sugars may also include a morpholino, a pyranyl, or hexitol ring system. Sugar moieties useful in the preparation of oligonucleotides having motifs include, without limitation, P-D-ribose, -D-2'-deoxyribose, methoxy-substituted sugars (e.g., -D-2 ’methoxyribose), MOE-substituted sugars (e.g., -D-2’methoxyethylribose), fluoro substituted sugars (e.g., 2’-deoxy-2-fluororibose and P-D-2 ’-deoxy-2’-fluoroarabinofurose, also referred to herein as 2 ’-fluoroarabinose), substituted sugars (such as 2', 5' and bis substituted sugars), 4'-S-sugars (such as 4'-S-ribose, 4'-S-2'-deoxyribose and 4'-S-2'-substituted ribose), bicyclic alternative sugars (such as locked nucleic acid (LNA) having a 2'-0 — CH2-4' or 2'-0 — (CH2)2-4' bridged ribose derived bicyclic sugar) and sugar surrogates (such as when the ribose ring has been replaced with a morpholino, a pyran, or a hexitol ring system, such as a P-D-homoDNA). A P-D-homoDNA sugar moiety is a pyran ring substituted as

[0063] shown in this structure:

[0064]

[0065] The intemucleotide linkage of the nucleotide can be a phosphate linkage. Other intemucleotide linkages are known in the art, including, but not limited to, phosphorothioate or boronophosphate. Other intemucleotide linkages include phosphotriester, phosphorothionate, phosphoramidate, and other variants of the phosphate backbone .

[0066] The term “nucleoside” refers to a monomeric unit of an oligonucleotide or a polynucleotide having a nucleobase and a sugar moiety.

[0067] The oligonucleotide may be of any length that permits base modification of a target nucleobase (e.g., deamination of a target adenosine) on a desired target RNA through an ADAR-mediated pathway, and may range from about 27-50 base pairs in length, e.g., about 30-45 base pairs in length or about 35-45 base pairs in length, for example, about 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 base pairs in length. Ranges intermediate to the above recited ranges are also contemplated to be part of the oligonucleotides described herein.

[0068] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide or nucleoside sequence in relation to a second nucleotide or nucleoside sequence, refers to the ability of an oligonucleotide or polynucleotide including the first nucleotide or nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C, or 70 °C, for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can beAtty Docket No. K199354 1070WO (00038)

[0069] KB-056-PCT encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides or nucleosides.

[0070] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and alternative nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.

[0071] Complementary sequences between an oligonucleotide and a target sequence as described herein, include base-pairing of the oligonucleotide or polynucleotide including a first nucleotide sequence to an oligonucleotide or polynucleotide including a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally no more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., deamination of an adenosine. “Substantially complementary” can also refer to an oligonucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA having a target adenosine). For example, an oligonucleotide is complementary to at least a part of the mRNA of interest if the sequence is substantially complementary to a non-interrupted portion of the mRNA of interest.

[0072] As used herein, the term "region of complementarity" refers to the region on the oligonucleotide that is substantially complementary to all or a portion of a gene, primary transcript, a sequence (e.g., a target sequence; e.g., a target sequence having a target nucleobase, e.g., adenosine), or processed mRNA, so as to interfere with expression of the endogenous gene. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5'- and / or 3'-terminus of the oligonucleotide.

[0073] The phrase "contacting a cell with an oligonucleotide," such as an oligonucleotide as described herein, includes contacting a cell by any possible means. Contacting a cell with an oligonucleotide includes contacting a cell in vitro with the oligonucleotide or contacting a cell in vivo with the oligonucleotide. The contacting may be done directly or indirectly. Thus, for example, the oligonucleotide may be put into physical contact with the cell by the individual performing the method, or alternatively, the oligonucleotide agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell. An oligonucleotide can be contacted with any cell described herein. It would beAtty Docket No. K199354 1070WO (00038)

[0074] KB-056-PCT understood for the purposes of the present disclosure that the contacted cell comprises a SERPINA1 gene. In some instances, the cell can be a hepatocyte. In some instances, the cell is a human immune cell, such as a macrophage or monocyte, or a precursor thereof.

[0075] Contacting a cell in vitro may be done, for example, by incubating the cell with the oligonucleotide. Contacting a cell in vivo may be done, for example, by injecting the oligonucleotide into or near the tissue where the cell is located, or by injecting the oligonucleotide agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the oligonucleotide may contain and / or be coupled to a ligand, e.g., GalNAc3, that directs the oligonucleotide to a site of interest, e.g., the liver.

[0076] Alternatively, the oligonucleotide may be formulated in a lipid nanoparticle (LNP) which can function to deliver the oligonucleotide into a cell of interest (e.g., monocyte or macrophage). Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an oligonucleotide and subsequently transplanted into a subject.

[0077] In one embodiment, contacting a cell with an oligonucleotide includes "introducing" or "delivering the oligonucleotide into the cell" by facilitating or effecting uptake or absorption into the cell.

[0078] Absorption or uptake of an oligonucleotide can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an oligonucleotide into a cell may be in vitro and / or in vivo. For example, for in vivo introduction, oligonucleotides can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and / or are known in the art.

[0079] As used herein, "lipid nanoparticle" or "LNP" is a vesicle including a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an oligonucleotide. LNP refers to a stable nucleic acid-lipid particle. LNPs typically contain a cationic, ionizable lipid, a noncationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are described in, for example, U.S. Pat. Nos. 6,858,225; 6,815,432; 8,158,601; and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

[0080] As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the oligonucleotide composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the oligonucleotide composition, although in some examples, it may. Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes including one or moreAtty Docket No. K199354 1070WO (00038)

[0081] KB-056-PCT specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.

[0082] "Micelles" are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

[0083] As used herein, the terms “effective amount,” “therapeutically effective amount,” and “a “sufficient amount” of an agent that results in a therapeutic effect (e.g., in a cell or a subject) described herein refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an “effective amount” or synonym thereto depends on the context in which it is being applied. For example, in the context of treating a disorder, it is an amount of the agent that is sufficient to achieve a treatment response as compared to the response obtained without administration. The amount of a given agent will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and / or weight) or host being treated, and the like, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a “therapeutically effective amount” of an agent is an amount that results in a beneficial or desired result in a subject as compared to a control. As defined herein, a therapeutically effective amount of an agent may be readily determined by one of ordinary skill by routine methods known in the art. Dosage regimen may be adjusted to provide the optimum therapeutic response.

[0084] A “therapeutically effective amount” includes an amount (either administered in a single or in multiple doses) of an oligonucleotide that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. Oligonucleotides employed in the methods as disclosed herein may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment.

[0085] By “determining the level of a protein” is meant the detection of a protein, or an mRNA encoding the protein, by methods known in the art either directly or indirectly. “Directly determining” means performing a process (e.g., performing an assay or test on a sample or “analyzing a sample” as that term is defined herein) to obtain the physical entity or value. “Indirectly determining” refers to receiving the physical entity or value from another party or source (e.g., a third-party laboratory that directly acquired the physical entity or value). Methods to measure protein level generally include, but are not limited to, western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry,Atty Docket No. K199354 1070WO (00038)

[0086] KB-056-PCT liquid chromatography (LC)-mass spectrometry, microcytometry, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry, as well as assays based on a property of a protein including, but not limited to, enzymatic activity or interaction with other protein partners. Methods to measure mRNA levels are known in the art.

[0087] “Percent (%) sequence identity” with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleotides or amino acids in a candidate sequence that are identical to the nucleotides or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given sequence, A, to, with, or against a given sequence, B, (which can alternatively be phrased as a given sequence, A that has a certain percent sequence identity to, with, or against a given sequence, B) is calculated as follows:

[0088] 100 multiplied by (the fraction X / Y)

[0089] where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program’s alignment of A and B, and where Y is the total number of nucleotides or amino acids in B. It will be appreciated that where the length of sequence A is not equal to the length of sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A.

[0090] By “level” is meant a level or activity of a protein, or mRNA encoding the protein, as compared to a reference. The reference can be any useful reference, as defined herein. By a “decreased level” or an “increased level” of a protein is meant a decrease or increase in protein level, as compared to a reference (e.g., a decrease or an increase by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 150%, about 200%, about 300%, about 400%, about 500%, or more; a decrease or an increase of more than about 10%, about 15%, about 20%, about 50%, about 75%, about 100%, or about 200%, as compared to a reference; a decrease or an increase by less than about 0.01-fold, about 0.02-fold, about 0.1-fold, about 0.3-fold, about 0.5-fold, about 0.8-fold, or less; or an increase by more than about 1.2-fold, about 1.4-fold, about 1.5-fold, about 1.8-fold, about 2.0-fold, about 3.0-fold, about 3.5-fold, about 4.5-fold, about 5.0-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 1000-fold, or more). A level of a protein may be expressed inAtty Docket No. K199354 1070WO (00038)

[0091] KB-056-PCT mass / vol (e.g., g / dL, mg / mL, pg / mL, ng / mL) or percentage relative to total protein or mRNA in a sample.

[0092] The term “pharmaceutical composition,” as used herein, represents a composition containing a compound described herein formulated with a pharmaceutically acceptable excipient, and preferably manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a mammal. Pharmaceutical compositions can be formulated, for example, for oral administration in unit dosage form (e.g., a tablet, capsule, caplet, gelcap, or syrup); for topical administration (e.g., as a cream, gel, lotion, or ointment); for intravenous administration (e.g., as a sterile solution free of particulate emboli and in a solvent system suitable for intravenous use); for intrathecal injection; for intracerebroventricular injections; for intraparenchymal injection; or in any other pharmaceutically acceptable formulation.

[0093] A “pharmaceutically acceptable excipient,” as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (com), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0094] As used herein, the term “pharmaceutically acceptable salt” means any pharmaceutically acceptable salt of an oligonucleotide as described herein. For example, pharmaceutically acceptable salts include those that are within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, pharmaceutically acceptable salts are described in: Berge et al., J. Pharmaceutical Sciences 66:1-19, 1977 and in Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P.H. Stahl and C.G. Wermuth), Wiley-VCH, 2008. The salts can be prepared in situ during the final isolation and purification of the compounds described herein or separately by reacting a free base group with a suitable organic acid.Atty Docket No. K199354 1070WO (00038)

[0095] KB-056-PCT Pharmaceutically acceptable salts may be acid addition salts involving inorganic or organic acids or the salts maybe prepared from inorganic or organic bases. Frequently, pharmaceutically acceptable salts are prepared as addition products of pharmaceutically acceptable acids or bases. Suitable pharmaceutically acceptable acids and bases and methods for preparation of the appropriate salts are well-known in the art. Salts may be prepared from pharmaceutically acceptable non-toxic acids and bases including inorganic and organic acids and bases. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethane sulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, and ethylamine. By a “reference” is meant any useful reference used to compare protein or mRNA levels or activity. The reference can be any sample, standard, standard curve, or level that is used for comparison purposes. The reference can be a normal reference sample or a reference standard or level. A “reference sample” can be, for example, a control, e.g., a predetermined negative control value such as a “normal control” or a prior sample taken from the same subject; a sample from a normal healthy subject, such as a normal cell or normal tissue; a sample (e.g., a cell or tissue) from a subject not having a disease; a sample from a subject that is diagnosed with a disease, but not yet treated with a compound described herein; a sample from a subject that has been treated by a compound described herein; or a sample of a purified protein (e.g., any described herein) at a known normal concentration. By “reference standard or level” is meant a value or number derived from a reference sample. A “normal control value” is a pre-determined value indicative of non-disease state, e.g., a value expected in a healthy control subject. Typically, a normal control value is expressed as a range (“between X and Y”), a high threshold (“no higher than X”), or a low threshold (“no lower than X”). A subject having a measured value within the normal control value for a particular biomarker is typically referred to as “within normal limits” for that biomarker. A normal reference standard or level can be a value or number derived from a normal subject not having a disease or disorder; a subject that has been treated with a compound described herein. In preferred embodiments, the reference sample, standard, or level is matched to the sample subject sample by at least one of the following criteria:Atty Docket No. K199354 1070WO (00038)

[0096] KB-056-PCT age, weight, sex, disease stage, and overall health. A standard curve of levels of a purified protein, e.g., any described herein, within the normal reference range can also be used as a reference.

[0097] As used herein, the term “subject” refers to any organism to which oligonucleotides or compositions described herein may be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). A subject may seek or be in need of treatment, require treatment, be receiving treatment, be receiving treatment in the future, or be a human or animal who is under care by a trained professional for a particular disease or condition.

[0098] As used herein, the terms "treat," "treated," or "treating" mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

[0099] As used herein, the terms “variant” and “derivative” are used interchangeably and refer to naturally occurring, synthetic, and semi-synthetic analogues of a compound, peptide, protein, or other substance described herein. A variant or derivative of a compound, peptide, protein, or other substance described herein may retain or improve upon the biological activity of the original material.

[0100] I. Oligonucleotides

[0101] Oligonucleotides disclosed herein can be editors of SERPINA1 DNA or SERPINA1 mRNA.

[0102] Editing SERPINA1 DNA

[0103] Editors for SERPINA1 DNA adenosine in mutant SERPINA1 are described in WO2024259364, the disclosure of which is incorporated by reference in its entirety.

[0104] Editing SERPINA I mRNA

[0105] The oligonucleotides described herein are complementary to target RNA with the exception of at least one mismatch capable of recruiting ADAR enzymes used to edit a target nucleobase on the target RNA, e.g., to deaminate a target adenosine on the target SERPINA1 RNA. In some embodiments, only one nucleobase (e.g., one adenosine) is edited (e.g., deaminated). In some embodiments, 1, 2, or 3 nucleobases are edited. The oligonucleotide includes a mismatch opposite the target base, e.g., atAtty Docket No. K199354 1070WO (00038)

[0106] KB-056-PCT X2(see structure below). The oligonucleotides described herein may further include modifications (e.g., alternative nucleotides) to increase stability and / or increase deamination efficiency. In some embodiments, the oligonucleotides described herein comprises 1, 2, 3, 4, or 5 mismatches or wobbles. In some embodiments, one or more of the nucleotides of an oligonucleotide described herein is chemically modified to enhance stability or other beneficial characteristics. Without being bound by theory, it is believed that certain modification can increase nuclease resistance and / or serum stability or decrease immunogenicity. For example, oligonucleotides described herein may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain nucleotides that have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or intemucleotide linkage).

[0107] The oligonucleotides described herein comprise the structure:

[0108] | Am| -X -X -X -[ Bn|

[0109] wherein each of A and B comprise (i) a nucleobase, (ii) a sugar (“an A / B sugar”), and (iii) an intemucleotide linkage; each A / B sugar is independently a 2’-methoxyribose, a 2’-deoxy-2’-fluororibose, 2 ’-methoxyethylribose, a 2’-fluoroarabinose, or a 2’-deoxyribose; m is an integer from 20 to 40; n is an integer from 4 to 15; X1comprises (i) a nucleobase selected from uracil and thymine, a (ii) 2’deoxyribose sugar, and (iii) an intemucleotide linkage; X2comprises a structure of

[0110]

[0111] (a p-D-homoDNA sugar with an “N” nucleobase) and an intemucleotide linkage, wherein N is a nucleobase; X3comprises (i) a nucleobase selected from guanosine, hypoxanthine, and 7-deazaguinine, (ii) a sugar selected from 2 ’-deoxyribose and 2 ’-deoxy-2’ -fluoroarabinose, and (iii) an intemucleotide linkage; and the intemucleotide linkages of the oligonucleotide comprise at least 30% phosphoramidate and / or phosphorothioate linkages.

[0112] In some embodiments, N is a pyrimidine. In some embodiments, N is a cytosine.

[0113] R_N=[i’-OH

[0114] 6y

[0115] Phosphoramidate linkages (e

[0116]

[0117] .g., ' , where R is a suitable substituent on the nitrogen, such

[0118] Me— N=f^-OH

[0119] d dy

[0120] as an alkyl, sulfoxide, or the like), include mesyl phosphoramidate

[0121]

[0122] ' . Mesyl phosphoramidate is a preferred phosphoramidate intemucleotide linkage.Atty Docket No. K199354 1070WO (00038)

[0123] KB-056-PCT In some embodiments, the intemucleotide linkages of the oligonucleotide comprise at least 30% (e.g., at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or at least 85%) phosphoramidate and / or phosphorothioate linkages.

[0124] In some embodiments, the intemucleotide linkages of the oligonucleotide comprise 0% phosphoramidate linkages. In some embodiments, the intemucleotide linkages of the oligonucleotide comprise 10-15%, or 35-70%, or 40-85% phosphoramidate linkages. In some embodiments, the intemucleotide linkages comprise 10%, 15%, 20%, 25%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% phosphoramidate linkages.

[0125] In some embodiments, the intemucleotide linkages comprise 0% phosphorothioate linkages. In some embodiments, the intemucleotide linkages comprise 10-15%, or 35-70%, or 40-85% phosphorothioate linkages. In some embodiments, the intemucleotide linkages comprise 10%, 15%, 20%, 25%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% phosphorothioate linkages. In some embodiments, the intemucleotide linkages comprise at least 50% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85%) phosphorothioate linkages.

[0126] In some embodiments, the intemucleotide linkage between X1and X2is a phosphorothioate. In some embodiments, the intemucleotide linkage between X2and X3is a phosphorothioate. In some embodiments, the intemucleotide linkage between X1and X2is a phosphorothioate, and the intemucleotide linkage between X2and X3is a phosphorothioate.

[0127] The A / B sugars of the oligonucleotides disclosed herein are each individually 2 ’-methoxyribose

[0128]

[0129] In some embodiments, 45-75% (e.g., 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62% 63% 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%,Atty Docket No. K199354 1070WO (00038)

[0130] KB-056-PCT 73%, 74%, or 75%) of the A / B sugars of the oligonucleotides described herein are 2-methoxyribose. In some embodiments, 20-60% (e.g., 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%) of the A / B sugars of the oligonucleotides described herein are 2 ’-methoxyethylribose. In some embodiments, no A / B sugar is a 2 ’-deoxyribose or a 2 ’-methoxyethylribose.

[0131] In some embodiments, 11-20 A / B sugars in the oligonucleotide are 2’-deoxy-2’fluororibose. In some embodiments, the oligonucleotide comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, or 202’-deoxy-2’fluororibose.

[0132] In some embodiments, 18-29 A / B sugars in the oligonucleotide are 2 ’-methoxyethylribose. In some embodiments, the oligonucleotide comprises 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 292’-methoxyethylribose .

[0133] In some embodiments, m is an integer ranging from 21-35. In some embodiments, m is 21, 22, 23, 24, 25, 26, 27, 28, 29. 30, 31, 32, 33, 34 or 35. In some embodiments, m is 30. In some embodiments, [Am] has a sequence of SEQ ID NO: 142 (AAC AUG GCC CCA GCA GCU UCA GUC CCU UUC) or SEQ ID NO: 143 (AAC AUG GCC CCA GCA GCU UCA GUU CCU UUC) or SEQ ID NO: 144 (AAC AUG GCU CCA GCA GUU UCA GUU CCU UUC).

[0134] In some embodiments, n is an integer ranging from 8 to 10. In some embodiments, n is 8, 9, or 10. In some embodiments, n is 9. In some embodiments, [Bn] has a sequence of UCG AUG GUC.

[0135] In some embodiments, the oligonucleotides described herein comprise 4-7 (e.g., 4, 5, 6 or 7) phosphoroamidate linkages. In some embodiments, the oligonucleotides described herein comprise 14 to 30 (e.g., 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) phosphorothioate linkages. In some embodiments, the phosphorothioate linkages are Sp phosphorothioate linkages. In other embodiments, the phosphorothioate linkages are Rp phosphorothioate linkages. In some embodiments, the phosphorothioate linkages are stereorandom.

[0136] Exemplary oligonucleotides described herein are shown in Table 1 below (in Hierarchical Editing Language for Macromolecules (HELM) syntax) (Zhang et al., J. Chem. Inf. Model. 2012, 52, 10, 2796-2806), where each nucleotide is noted by terms between periods (.); the first term indicates the sugar moiety, the next is the nucleobase, and last term is the intemucleotide linkage. For clarity, the terms can be separated by punctuation, e.g., brackets and parentheses. Thus, a nucleotide designation of “ f(A)P .” means a 2 ’-deoxy-2’ -fluororibose sugar moiety and an adenosine nucleobase that is then linked via a phosphodiester linkage. Sugar moiety designations are “f “for 2 ’-deoxy-2 ’-fluororibose, “m” for 2 ’-methoxyribose, “fana” for 2’-fluroarabinose, “d” is deoxyribose, “hD” or “hd” (or “Dh”) is beta-homoDNA, and “moe” is 2’-MOEribose. For linkages, “msPA” indicates a mesyl phosphroamidate intemucleotide linkage, “sP” indicates a phosphorothioate linkage; and “P” indicatesAtty Docket No. K199354 1070WO (00038)

[0137] KB-056-PCT a phosphate linkage. “GD” indicates GalNac with a decanol linker (CIO). Nucleotide designations are “I” for inosine, “isoU” for isouridine, “m5c” for 5 -methylcytosine, and “d7g” for 7-deazaguinine.

[0138] Table 1. Exemplary Oligonucleotides

[0139] Oligo Base sequence Oligonucleotide sequence

[0140] No.

[0141] 1 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCUCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 2)

[0142] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[0143] [sP] ,f(C) [sP] ,f(U) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U) [sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 1)

[0144] 2 f(A) [sP] ,f(A) [sP] ,m(C) [sP] ,m(A) [sP] ,f(U) [sP] ,f(G) [ AACAUGGCCCCAGCAGCUU sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)P.f(A)[ CAGUCCCUUUCTCIUCGAU sP] ,m(G) [sP] ,m(C)P.f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4)

[0145] P] ,m(U) [sP] ,m(C)P ,m(A)P.f(G) [sP] ,f(U) [sP] ,m(C) [s

[0146] P] ,f(C) [sP] ,f(C)[sP] ,f(U)[sP] ,m(U)P.f(U) [sP] ,m(C)P

[0147] ,d(T) [sP] . [hD] (C) [sP] ,d(I) [sP] ,m(U) [sP] ,f(C) [sP] ,m(

[0148] G)P ,m(A)P.m(U) [sP] ,m(G) [sP] ,f(G) [sP] ,f(U) [sP] .m

[0149] (C) (SEQ ID NO: 3)

[0150] 3 f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G) AACAUGGCCCCAGCAGCUU [sP] ,f(G) [sP] ,f(C) [sP] ,m(C) [sP] ,f(C) [sP] ,m(C) [sP] ,f( CAGUCCCUUUCTCIUCGAU A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] . GGUC (SEQ ID NO: 4) f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [

[0151] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0152] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0153] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].f(G)[sP].f(U)[msPA].m(C) (SEQ ID NO: 5)

[0154] 4 m(A) [msPA] ,m(A) [sP] .m(C) [sP] .m(A)P ,m(U)P .d(G AACAUGGCCCCAGCAGCUU )[sP] ,f(G)[sP] ,f(C)[sP] ,m(C)P.d(C)[sP] ,m(C)P.m(A) CAGUCCCUUTCTCIUCGAU P m(G)P ,m(C)P.f(A) [sP] ,f(G) [sP] ,f(C) [sP] ,m(U)P. GGTC (SEQ ID NO: 6) m(U)P .d(C) [sP] .m(A) [msPA] ,m(G)P.f(U) [msPA] .m (C)P.f(C)[sP].f(C)[sP].m(U)P.m(U)P.d(T)[sP].m(C)

[0155] P d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [sP] .

[0156] m(G)P .m(A)P.m(U)P.m(G) [sP] .m(G) [sP] .d(T) [msP

[0157] A].m(C) (SEQ ID NO: 7)

[0158] 5 m(A)[msPA] ,m(A)[sP].m(C)P.m(A)P.f(U)[sP].f(G)[ AACAUGGCCCCAGCAGCUU sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[sP CAGUCCCUUUCTCIUCGAU ] ,m(G)P.m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [sP] GGUC (SEQ ID NO: 4) .m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] .f(U)[msPA] . m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP].m

[0159] (C)P d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(U)[msP

[0160] A].m(C) (SEQ ID NO: 9)

[0161]

[0162] Atty Docket No. K199354 1070WO (00038)

[0163] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0164] No.

[0165] 6 m(A)[msPA] ,m(A)[sP].m(C)P.m(A)P.f(U)[sP].f(G)[ AACAUGGCUCCAGCAGUU sP] .m(G)P.m(C)P.m(U)P.f(C)[sP] ,m(C)P.f(A)[sP] . UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0166] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0167] C)P ,d(T) [sP] . [hd] (C) [sP] d(I) [msPA] ,m(U)P.f(C) [sP

[0168] ] .m(G)P.m(A)P ,m(U)P .m(G)P.m(G) [sP] .f(U) [msPA

[0169] ].m(C) (SEQ ID NO: 11)

[0170] 7 m(A)[msPA] ,m(A)[sP].m(C)P.m(A)P.f(U)[sP].f(G)[ AACAUGGCCCCAGCAGCUU sP].m(G)P.m(C)P.m(C)P.m(C)P.m(C)P.f(A)[sP].m( CAGUCCCUUUCTCIUCGAU G)P.m(C)P.f(A)[sP].f(G)[sP].m(C)P.f(U)[sP].m(U)[ GGUC (SEQ ID NO: 4) msPA] .m(C)P.m(A)P.f(G) [msPA] ,f(U)[sP] .m(C)P.f

[0171] (C)[sP] ,f(C)[sP] ,f(U)[sP] ,m(U)P.f(U)[sP] ,m(C)P.d(

[0172] T) [sP] . [hd] (C) [sP] d(I) [msPA] ,m(U)P.f(C)[sP] ,m(G )P.m(A)P.m(U)P.m(G)P.m(G)[sP] .f(U)[msPA] ,m(C

[0173] ) (SEQ ID NO: 13)

[0174] 8 m(A)[msPA] ,m(A)[sP].m(C)P.f(A)[sP].m(U)P.f(G)[ AACAUGGCCCCAGCAGCUU sP] m(G)P ,m(C)P ,m(C)P.m(C)P ,m(C)P ,m(A)P.f(G) CAGUUCCUUUCTCIUCGAU [sP] ,m(C)P.m(A)P.f(G) [sP] ,f(C) [sP] ,m(U)P ,m(U) [ GGUC (SEQ ID NO: 14) msPA].m(C)P.m(A)P.m(G)[msPA].f(U)[sP] .m(U)P. f(C)[sP].m(C)P.f(U)[sP].m(U)P.f(U)[sP].m(C)P.d(T

[0175] ) [sP] . [hd] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C)[sP] ,m(G)

[0176] P .m(A)P ,m(U)P .m(G)P .m(G) [sP] .f(U) [msPA] ,m(C)

[0177] (SEQ ID NO: 15)

[0178] 9 m(A)[msPA] ,m(A)[sP].m(C)P.f(A)[sP].m(U)P.f(G)[ AACAUGGCCCCAGCAGCUU sP] m(G)P ,m(C)P ,m(C)P.m(C)P ,m(C)P ,m(A)P.f(G) CAGUUCCUUUCT(isoU)IUCG [sP] ,m(C)P.m(A)P.f(G) [sP] ,f(C) [sP] ,m(U)P ,m(U) [ AUGGUC (SEQ ID NO: 16) msPA].m(C)P.m(A)P.m(G)[msPA].f(U)[sP] .m(U)P. f(C)[sP].m(C)P.f(U)[sP].m(U)P.f(U)[sP].m(C)P.d(T

[0179] )[sP] ,d([isoU])[sP] ,d(I)[msPA] ,m(U)P.f(C)[sP] ,m(G )P.m(A)P.m(U)P.m(G)P.m(G)[sP] .f(U)[msPA] ,m(C

[0180] ) (SEQ ID NO: 17)

[0181] 10 m(A)[msPA] ,m(A)[sP].m(C)P.f(A)[sP].m(U)P.f(G)[ AACAUGGCCCCAGCAGCUU sP] m(G)P ,m(C)P ,m(C)P.m(C)P ,m(C)P ,m(A)P.f(G) CAGUUCCUUUCTC(d7G)UC [sP] ,m(C)P.m(A)P.f(G) [sP] ,f(C) [sP] ,m(U)P ,m(U) [ GAUGGUC (SEQ ID NO: 18) msPA].m(C)P.m(A)P.m(G)[msPA].f(U)[sP] .m(U)P. f(C)[sP].m(C)P.f(U)[sP].m(U)P.f(U)[sP].m(C)P.d(T

[0182] ) [sP] . [hd] (C) [sP] ,d( [d7G]) [msPA] ,m(U)P.f(C) [sP] . m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(U)[msPA],

[0183] m(C) (SEQ ID NO: 19)

[0184] 11 m(A)[msPA] ,m(A)[sP].m(C)P.f(A)[sP].m(U)P.f(G)[ AACAUGGCCCCAGCAGCUU sP] m(G)P ,m(C)P ,m(C)P.m(C)P ,m(C)P ,m(A)P.f(G) CAGUUCCUUUCT(isoU)(d7G) [sP] ,m(C)P.m(A)P.f(G) [sP] ,f(C) [sP] ,m(U)P ,m(U) [ UCGAUGGUC (SEQ ID NO: msPA].m(C)P.m(A)P.m(G)[msPA].f(U)[sP] .m(U)P. 20)

[0185] f(C)[sP].m(C)P.f(U)[sP].m(U)P.f(U)[sP].m(C)P.d(T

[0186]

[0187] )[sP].d([isoU])[sP].d([d7G])[msPA].m(U)P.f(C)[sP]Atty Docket No. K199354 1070WO (00038)

[0188] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0189] No.

[0190] .m(G)P.m(A)P ,m(U)P .m(G)P .m(G) [sP] .f(U) [msPA]

[0191] m(C) (SEQ ID NO: 21)

[0192] 12 { [moe] (A) [msPA] . [moe] (A) [sP] .m(C)P .m(A) [sP] .f( AACAUGGCCCCAGCAGCUU U) [sP] ,f(G) [sP] ,f(G) [sP] ,f(C) [sP] ,m(C) [sP] ,f(C) [sP] . CAGUCCCUUUCTCIUCGAU m(C) [sP] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP GGUC (SEQ ID NO: 4) ] .m(C)[sP] .f(U)[sP] .m(U)P.m(C)P.m(A)[msPA] ,f(G

[0193] ) [sP] ,f(U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [s

[0194] P] ,m(U) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP

[0195] ] . [fana] (I) [msPA] ,m(U) [sP] .f(C) [sP] .m(G)P .m(A)P .

[0196] m(U)P ,m(G) [sP] ,f(G) [sP] ,f(U) [msPA] ,m(C) (SEQ

[0197] ID NO: 22)

[0198] 13 { [moe] (A) [sP] . [moe] (A) [sP] .m(C)P .m(A) [sP] .f(U) [ AACAUGGCCCCAGCAGCUU sP] ,f(G) [sP] ,f(G) [sP] ,f(C) [sP] ,m(C) [sP] ,f(C) [sP] ,m( CAGUCCCUUUCTCIUCGAU C) [sP] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] . GGUC (SEQ ID NO: 4) m(C) [sP] .f(U) [sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [

[0199] sP] ,f(U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP]

[0200] ,m(U) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [

[0201] fana] (I) [msPA] ,m(U) [sP] .f(C) [sP] .m(G)P.m(A)P.m( U)P.m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID

[0202] NO: 23)

[0203] 14 {m(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] .f(U) [sP] .f( AACAUGGCCCCAGCAGCUU G)[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP CAGUCCCUUUCTCIUCGAU ] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [s GGUC (SEQ ID NO: 4) P] ,f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U

[0204] ) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [

[0205] sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I

[0206] ) [msPA] ,m(U) [sP] .f(C) [sP] .m(G)P.m(A)P ,m(U)P .m (G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0207] 24)

[0208] 15 {f(A) [msPA] ,m(A) [sP] .m(C)P .m(A) [sP] .f(U) [sP] .f( AACAUGGCCCCAGCAGCUU G)[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP CAGUCCCUUUCTCIUCGAU ] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [s GGUC (SEQ ID NO: 4) P] ,f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U

[0209] ) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [

[0210] sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I

[0211] ) [msPA] ,m(U) [sP] .f(C) [sP] .m(G)P.m(A)P ,m(U)P .m (G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0212] 25)

[0213] 16 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP] .f(G)[sP] ,f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[s CAGUCCCUUUCTCIUCGAU P] ,f(A)[sP] ,m(G)P.m(C)[sP] ,f(A) [sP] ,f(G) [sP] ,m(C) GGUC (SEQ ID NO: 4) [sP] ,f(U)[sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(

[0214] U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U

[0215] ) [sP] ,f(U) [sP] ,m(C)[sP]d(T) [sP] . [hD] (C) [sP] . [fana] (

[0216]

[0217] I) [msPA] ,m(U) [sP] ,f(C) [sP] ,m(G)P.m(A)P ,m(U)P.Atty Docket No. K199354 1070WO (00038)

[0218] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0219] No.

[0220] m(G)[sP].f(G)[sP].f(U)[msPA].m(C)) (SEQ ID NO:

[0221] 26)

[0222] 17 {f(A) [sP] ,f(A) [sP] ,m(C)P.m(A) [sP] ,f(U) [sP] ,f(G) [s AACAUGGCCCCAGCAGCUU P] ,f(G)[sP] ,f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[sP] ,f(A CAGUCCCUUUCTCIUCGAU ) [sP] ,m(G)P.m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] ,f( GGUC (SEQ ID NO: 4) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m

[0223] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0224] f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [m

[0225] sPA] ,m(U)[sP] .f(C)[sP] .m(G)P.m(A)P.m(U)P.m(G) [sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO: 27)

[0226] 18 {m(A) [sP] .m(A) [sP] .m(C)P .m(A) [sP] .f(U) [sP] .f(G) AACAUGGCCCCAGCAGCUU [sP] ,f(G) [sP] ,f(C) [sP] ,m(C) [sP] ,f(C) [sP] ,m(C) [sP] ,f( CAGUCCCUUUCTCIUCGAU A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] . GGUC (SEQ ID NO: 4) f(U) [sP] .m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [

[0227] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0228] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0229] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0230] 28)

[0231] 19 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] . [moe] (T) [sP AACATGGCCCCAGCAGCUU ].f(G)[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C) CAGUCCCUUUCTCIUCGAU [sP] ,f(A)[sP] ,m(G)P.m(C)[sP] ,f(A) [sP] ,f(G) [sP] ,m( GGUC (SEQ ID NO: 30) C) [sP] ,f(U) [sP] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP

[0232] ] ,f(U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] .m

[0233] (U) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fa

[0234] na] (I) [msPA] ,m(U) [sP] .f(C) [sP] .m(G)P .m(A)P ,m(U )P.m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID

[0235] NO: 29)

[0236] 20 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] . [moe] (T)P .f AACATGGCCCCAGCAGCUU (G)[sP] .f(G)[sP] ,f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[s CAGUCCCUUUCTCIUCGAU P] ,f(A)[sP] ,m(G)P.m(C)[sP] ,f(A) [sP] ,f(G) [sP] ,m(C) GGUC (SEQ ID NO: 30) [sP] ,f(U)[sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(

[0237] U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U

[0238] ) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana]

[0239] (I) [msPA] ,m(U) [sP] ,f(C) [sP] ,m(G)P ,m(A)P ,m(U)P . m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0240] 31)

[0241] 21 { f( A) [msPA] . f( A) [sP] .m(C)P .m(A)P . [moe] (T)P . f(G AACATGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 30) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0242] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0243] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0244] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0245]

[0246] 32)Atty Docket No. K199354 1070WO (00038)

[0247] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0248] No.

[0249] 22 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] .m(U) [sP] .f( AACAUGGCCCCAGCAGCUU G)[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP CAGUCCCUUUCTCIUCGAU ] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [s GGUC (SEQ ID NO: 4) P] ,f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U

[0250] ) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [

[0251] sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I

[0252] ) [msPA] ,m(U) [sP] .f(C) [sP] .m(G)P.m(A)P ,m(U)P .m (G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0253] 33)

[0254] 23 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A)P ,m(U) [sP] .f(G) AACAUGGCCCCAGCAGCUU [sP] ,f(G) [sP] ,f(C) [sP] ,m(C) [sP] ,f(C) [sP] ,m(C) [sP] ,f( CAGUCCCUUUCTCIUCGAU A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] . GGUC (SEQ ID NO: 4) f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [

[0255] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0256] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0257] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0258] 34)

[0259] 24 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A)P ,m(U)P.f(G) [sP AACAUGGCCCCAGCAGCUU ].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f(A) CAGUCCCUUUCTCIUCGAU [sP] ,m(G)P.m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] ,f( GGUC (SEQ ID NO: 4) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m

[0260] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0261] f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [m

[0262] sPA] ,m(U)[sP] .f(C)[sP] .m(G)P.m(A)P.m(U)P.m(G) [sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO: 35)

[0263] 25 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] .f(U) [sP] .m( AACAUGGCCCCAGCAGCUU G)[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP CAGUCCCUUUCTCIUCGAU ] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [s GGUC (SEQ ID NO: 4) P] ,f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U

[0264] ) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [

[0265] sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I

[0266] ) [msPA] ,m(U) [sP] .f(C) [sP] .m(G)P.m(A)P ,m(U)P .m (G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0267] 36)

[0268] 26 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] .f(U) [sP] .m( AACAUGGCCCCAGCAGCUU G)P.f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f( CAGUCCCUUUCTCIUCGAU A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] . GGUC (SEQ ID NO: 4) f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [

[0269] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0270] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0271] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0272] 37)

[0273]

[0274] Atty Docket No. K199354 1070WO (00038)

[0275] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0276] No.

[0277] 27 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] .m(U) [sP] .m AACAUGGCCCCAGCAGCUU (G)[sP] ,f(G)[sP] ,f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[s CAGUCCCUUUCTCIUCGAU P] ,f(A)[sP] ,m(G)P.m(C)[sP] ,f(A) [sP] ,f(G) [sP] ,m(C) GGUC (SEQ ID NO: 4) [sP] ,f(U)[sP] .m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(

[0278] U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U

[0279] ) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana]

[0280] (I) [msPA] ,m(U) [sP] ,f(C) [sP] ,m(G)P ,m(A)P ,m(U)P . m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0281] 38)

[0282] 28 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A)P ,m(U)P .m(G) [s AACAUGGCCCCAGCAGCUU P] ,f(G)[sP] ,f(C)[sP] ,m(C)[sP] ,f(C)[sP] ,m(C)[sP] ,f(A CAGUCCCUUUCTCIUCGAU ) [sP] ,m(G)P.m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] ,f( GGUC (SEQ ID NO: 4) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m

[0283] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0284] f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [m

[0285] sPA] ,m(U)[sP] .f(C)[sP] .m(G)P.m(A)P.m(U)P.m(G) [sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO: 39)

[0286] 29 {f(A) [msPA] .f(A) [sP] .m(C)P .m(A)P ,m(U)P .m(G)P . AACAUGGCCCCAGCAGCUU f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] ,f(U) GGUC (SEQ ID NO: 4) [sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msP

[0287] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0288] U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [msP

[0289] A].m(U)[sP].f(C)[sP] .m(G)P.m(A)P.m(U)P.m(G)[s P].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO: 40)

[0290] 30 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] .f(U) [msPA] AACAUGGCCCCAGCAGCUU ,f(G)[sP] .f(G)[sP] ,f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[ CAGUCCCUUUCTCIUCGAU sP] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C GGUC (SEQ ID NO: 4) )[sP].f(U)[sP].m(U)P.m(C)P.m(A)[msPA].f(G)[sP].f

[0291] (U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(

[0292] U) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fan

[0293] a] (I)[msPA] ,m(U) [sP] .f(C) [sP] .m(G)P.m(A)P.m(U) P.m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID

[0294] NO: 41)

[0295] 31 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0296] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0297] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0298] msPA] ,m(U) [sP] .f(C) [sP] . [moe] (G)P.m(A)P ,m(U)P ,m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID

[0299] NO: 42)

[0300] 32 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU

[0301]

[0302] (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4)Atty Docket No. K199354 1070WO (00038)

[0303] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0304] No.

[0305] ,f(U) [sP] .m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0306] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0307] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0308] msPA] ,m(U)[sP] .f(C)[sP] .m(G)[sP] .m(A)P.m(U)P. m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0309] 43)

[0310] 33 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0311] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0312] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0313] msPA] ,m(U) [sP] .f(C) [sP] .m(G) [msPA] ,m(A)P ,m(U )P.m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID

[0314] NO: 44)

[0315] 34 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGGU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 225) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0316] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0317] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0318] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(G)P.m(U)P.m( G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0319] 45)

[0320] 35 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0321] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0322] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0323] msPA] ,m(U) [sP] .f(C) [sP] .m(G)P .m(A) [sP] .m(U)P. m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0324] 46)

[0325] 36 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0326] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0327] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0328] msPA] ,m(U) [sP] .f(C) [sP] .m(G)P .m(A) [msPA] ,m(U )P.m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID

[0329] NO: 47)

[0330] 37 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4)

[0331]

[0332] ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [Atty Docket No. K199354 1070WO (00038)

[0333] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0334] No.

[0335] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0336] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0337] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].m(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0338] 48)

[0339] 38 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0340] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0341] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0342] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].f(G)[sP].m(U)[msPA].m(C)} (SEQ ID NO:

[0343] 49)

[0344] 39 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0345] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0346] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0347] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].m(G)[sP].m(U)[msPA].m(C)} (SEQ ID NO:

[0348] 50)

[0349] 40 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0350] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0351] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0352] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)P.m(G)[sP].m(U)[msPA].m(C)} (SEQ ID NO:

[0353] 51)

[0354] 41 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0355] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0356] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0357] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].f(G)[sP].f(U)[sP].m(C)} (SEQ ID NO: 52)

[0358] 42 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0359] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0360]

[0361] ] ,f(U) [sP] ,m(C) [sP] . d(T) [sP] . [hD] (C) [sP] . [fana] (I) [Atty Docket No. K199354 1070WO (00038)

[0362] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0363] No.

[0364] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)[sP].m(G)[sP].m(U)[sP].m(C)} (SEQ ID NO: 53)

[0365] 43 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] .m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0366] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0367] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0368] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m( G)P.m(G)[sP].m(U)[sP].m(C)} (SEQ ID NO: 54)

[0369] 44 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGT (SEQ ID NO: 56) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0370] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0371] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0372] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m(

[0373] G) [sP] .f(G) [sP] . [moe] (T) [msPA] . [moe] ([m5 C])

[0374] (SEQ ID NO: 55)

[0375] 45 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGT (SEQ ID NO: 56) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0376] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0377] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0378] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m(

[0379] G) [sP] .m(G) [sP] . [moe] (T) [msPA] . [moe] ([m5 C] )

[0380] (SEQ ID NO: 57)

[0381] 46 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGT (SEQ ID NO: 56) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0382] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0383] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0384] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m(

[0385] G) [sP] ,f(G) [sP] . [moe] (T) [sP] . [moe] ([m5 C]) (SEQ

[0386] ID NO: 58)

[0387] 47 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGT (SEQ ID NO: 56) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0388] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0389] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0390] msPA] ,m(U)[sP] .f(C) [sP] .m(G)P.m(A)P.m(U)P.m(

[0391] G) [sP] .m(G) [sP] . [moe] (T) [sP] . [moe] ([m5 C]) (SEQ

[0392]

[0393] ID NO: 59)Atty Docket No. K199354 1070WO (00038)

[0394] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0395] No.

[0396] 48 {f(A) [msPA] ,f(A) [sP] .m(C)P .m(A) [sP] .f(U) [msPA] AACAUGGCCCCAGCAGCUU ,f(G)[sP] ,f(G)[sP] .f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[ CAGUCCCUUUCTCIUCGAU sP] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C GGUC (SEQ ID NO: 4) )[sP].f(U)[sP].m(U)P.m(C)P.m(A)[msPA].f(G)[sP].f

[0397] (U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(

[0398] U) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fan

[0399] a] (I) [msPA] ,m(U) [sP] .f(C) [sP] .m(G)P.m(A) [msPA]

[0400] ,m(U)P.m(G) [sP] ,f(G) [sP] ,f(U) [msPA] ,m(C) } (SEQ

[0401] ID NO: 60)

[0402] 49 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] . [moe] (T) [ AACATGGCCCCAGCAGCUU msPA] ,f(G) [sP] ,f(G) [sP] ,f(C) [sP] ,m(C) [sP] ,f(C) [sP] CAGUCCCUUUCTCIUCGAU ,m(C) [sP] ,f(A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [s GGTC (SEQ ID NO: 62) P] ,m(C) [sP] ,f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(

[0403] G) [sP] ,f(U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [

[0404] sP] ,m(U) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [s

[0405] P] .d(I) [msPA] ,m(U) [sP] .f(C) [sP] .m(G) [sP] .m(A) [m

[0406] sPA] ,m(U)P .m(G) [sP] .f(G) [sP] . [moe] (T) [msPA] ,m(

[0407] C)} (SEQ ID NO: 61)

[0408] 50 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0409] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0410] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0411] msPA] ,m(U) [sP] .f(C) [sP] .m(G) [sP] .m(A) [msPA] .m

[0412] (U)P.m(G)[sP] .f(G)[sP] ,f(U)[msPA] ,m(C)} (SEQ

[0413] ID NO: 63)

[0414] 51 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP] .f(G)[sP] ,f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[s CAGUCCCUUUCTCIUCGAU P] ,f(A)[sP] ,m(G)P.m(C)[sP] ,f(A) [sP] ,f(G) [sP] ,m(C) GGUC (SEQ ID NO: 4) [sP] ,f(U)[sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(

[0415] U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U

[0416] ) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana]

[0417] (I) [msPA] ,m(U) [sP] .f(C) [sP] .m(G) [sP] .m(A)P ,m(U) P.m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID

[0418] NO: 64)

[0419] 52 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP] .f(G)[sP] ,f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[s CAGUCCCUUUCTCIUCGAU P] ,f(A)[sP] ,m(G)P.m(C)[sP] ,f(A) [sP] ,f(G) [sP] ,m(C) GGUC (SEQ ID NO: 4) [sP] ,f(U)[sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(

[0420] U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U

[0421] ) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana]

[0422] (I) [msPA] ,m(U) [sP] .f(C) [sP] .m(G) [sP] .m(A)P ,m(U) P.m(G)[sP].m(G)[sP].m(U)[msPA].m(C)} (SEQ ID

[0423] NO: 65)

[0424]

[0425] Atty Docket No. K199354 1070WO (00038)

[0426] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0427] No.

[0428] 53 {m(A) [msPA] ,m(A) [sP] .m(C)P. [moe] (A)P.f(U) [sP] AACAUGGCCCCAGCAGCUU .f(G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f( CAGUCCCUUUCTCIUCGAU A)[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f( GGUC (SEQ ID NO: 4) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m

[0429] sPA] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [

[0430] sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P .

[0431] f(C) [sP] m(G)P ,m(A)P ,m(U)P ,m(G)P.m(G) [sP] ,f(U

[0432] )[msPA].m(C)} (SEQ ID NO: 66)

[0433] 54 {m(A) [msPA] ,m(A) [sP] .m(C)P. [moe] (A) [sP] .f(U) [s AACAUGGCCCCAGCAGCUU P] ,f(G)[sP] ,f(G)[sP] ,f(C)[sP] ,m(C)P.f(C)[sP] ,m(C)P CAGUCCCUUUCTCIUCGAU ,f(A)[sP] ,m(G)P.m(C)[sP] ,f(A)[sP] .f(G)[sP] ,m(C)P. GGUC (SEQ ID NO: 4) f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [ msPA].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U

[0434] ) [sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U) P.f(C)[sP].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(

[0435] U)[msPA].m(C)} (SEQ ID NO: 67)

[0436] 55 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [msPA] . AACAUGGCCCCAGCAGCUU f(G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f( CAGUCCCUUUCTCIUCGAU A)[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f( GGUC (SEQ ID NO: 4) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m

[0437] sPA] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [

[0438] sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P .

[0439] f(C) [sP] m(G)P ,m(A)P ,m(U)P ,m(G)P.m(G) [sP] ,f(U

[0440] )[msPA].m(C)} (SEQ ID NO: 68)

[0441] 56 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A CAGUCCCUUUCTCIUCGAU )[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f(U) GGUC (SEQ ID NO: 4) [sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msP A].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP

[0442] ] ,m(C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f( C)[sP].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(U)[

[0443] msPA].m(C)} (SEQ ID NO: 69)

[0444] 57 {m(A)[msPA].m(A)[sP].m(C)P.m(A)[msPA].f(U)[s AACAUGGCCCCAGCAGCUU P] ,f(G)[sP] ,f(G)[sP] ,f(C)[sP] ,m(C)P.f(C)[sP] ,m(C)P CAGUCCCUUUCTCIUCGAU ,f(A)[sP] ,m(G)P.m(C)[sP] .f(A)[sP] .f(G)[sP] ,m(C)P. GGUC (SEQ ID NO: 4) f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [ msPA].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U

[0445] ) [sP] ,m(C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U) P.f(C)[sP].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(

[0446] U)[msPA].m(C)} (SEQ ID NO: 70)

[0447] 58 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [msP AACAUGGCCCCAGCAGCUU A] ,f(G) [sP] ,f(G)[sP] ,f(C)[sP] ,m(C)P.f(C) [sP] ,m(C)P CAGUCCCUUUCTCIUCGAU ,f(A)[sP] ,m(G)P.m(C)[sP] .f(A)[sP] .f(G)[sP] ,m(C)P. GGUC (SEQ ID NO: 4) f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [

[0448] msPA].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U

[0449]

[0450] ) [sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)Atty Docket No. K199354 1070WO (00038)

[0451] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0452] No.

[0453] P.f(C)[sP].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(

[0454] U)[msPA].m(C)} (SEQ ID NO: 71)

[0455] 59 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A)P.m(U) [sP] .f( AACAUGGCCCCAGCAGCUU G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A) CAGUCCCUUUCTCIUCGAU [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [ GGUC (SEQ ID NO: 4) sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA

[0456] ] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0457] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P ,f(C

[0458] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0459] sPA] .m(C)} (SEQ ID NO: 72)

[0460] 60 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .m(U) [sP] . AACAUGGCCCCAGCAGCUU f(G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f( CAGUCCCUUUCTCIUCGAU A)[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f( GGUC (SEQ ID NO: 4) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m

[0461] sPA] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [

[0462] sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P .

[0463] f(C) [sP] m(G)P ,m(A)P ,m(U)P ,m(G)P.m(G) [sP] ,f(U

[0464] )[msPA].m(C)} (SEQ ID NO: 73)

[0465] 61 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .m( AACAUGGCCCCAGCAGCUU G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A) CAGUCCCUUUCTCIUCGAU [sP] ,m(G)P.m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [ GGUC (SEQ ID NO: 4) sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA

[0466] ] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0467] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C

[0468] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0469] sPA].m(C)} (SEQ ID NO: 74)

[0470] 62 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .m( AACAUGGCCCCAGCAGCUU G)P.f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0471] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0472] m(C)P.d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C

[0473] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0474] sPA].m(C)} (SEQ ID NO: 75)

[0475] 63 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A)P.m(U) [sP] .m( AACAUGGCCCCAGCAGCUU G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A) CAGUCCCUUUCTCIUCGAU [sP] ,m(G)P.m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [ GGUC (SEQ ID NO: 4) sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA

[0476] ] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0477] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C

[0478] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0479] sPA].m(C)} (SEQ ID NO: 76)

[0480] 64 {m(A)[msPA].m(A)[sP].m(C)P.m(A)P.m(U)P.m(G) AACAUGGCCCCAGCAGCUU [sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU

[0481]

[0482] P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4)Atty Docket No. K199354 1070WO (00038)

[0483] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0484] No.

[0485] P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0486] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0487] m(C)P.d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P.f(C

[0488] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0489] sPA] .m(C)} (SEQ ID NO: 77)

[0490] 65 {m(A)[msPA].m(A)[sP].m(C)P.m(A)P.m(U)P.m(G) AACAUGGCCCCAGCAGCUU P.f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[sP]. CAGUCCCUUUCTCIUCGAU m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [sP] . GGUC (SEQ ID NO: 4) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m (C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP].m(C

[0491] )P d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P.f(C) [sP]

[0492] .m(G)P.m(A)P ,m(U)P .m(G)P .m(G) [sP] .f(U) [msPA]

[0493] m(C)} (SEQ ID NO: 78)

[0494] 66 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0495] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0496] m(C)[sP] ,d(T) [sP] . [hD](C) [sP] ,d(I) [msPA] ,m(U)P.f

[0497] (C) [sP] ,m(G)P.m(A)P.m(U)P ,m(G)P ,m(G) [sP] ,f(U)

[0498] [msPA].m(C)} (SEQ ID NO: 79)

[0499] 67 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0500] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0501] m(C) [msPA] ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U

[0502] )P f(C) [sP] .m(G)P .m(A)P ,m(U)P .m(G)P.m(G) [sP] .f

[0503] (U)[msPA].m(C)} (SEQ ID NO: 80)

[0504] 68 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0505] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0506] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C

[0507] ) [sP] ,m(G) [sP] ,m(A)P .m(U)P.m(G)P.m(G) [sP] ,f(U)

[0508] [msPA].m(C)} (SEQ ID NO: 81)

[0509] 69 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0510] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0511] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C )[sP].[moe](G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(U

[0512] )[msPA].m(C)} (SEQ ID NO: 82)

[0513]

[0514] Atty Docket No. K199354 1070WO (00038)

[0515] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0516] No.

[0517] 70 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0518] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0519] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P ,f(C

[0520] ) [sP] .m(G) [msPA] ,m(A)P ,m(U)P .m(G)P.m(G) [sP] .f

[0521] (U)[msPA].m(C)} (SEQ ID NO: 83)

[0522] 71 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGGU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 225) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0523] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0524] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P ,f(C

[0525] ) [sP] .m(G)P.m(G)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0526] sPA] .m(C)} (SEQ ID NO: 84)

[0527] 72 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0528] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0529] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C )[sP].m(G)P.m(A)[sP].m(U)P.m(G)P.m(G)[sP].f(U)

[0530] [msPA].m(C)} (SEQ ID NO: 85)

[0531] 73 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0532] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0533] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C )[sP].m(G)P.m(A)[msPA].m(U)P.m(G)P.m(G)[sP].f

[0534] (U)[msPA].m(C)} (SEQ ID NO: 86)

[0535] 74 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0536] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0537] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C

[0538] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .m(U) [

[0539] msPA].m(C)} (SEQ ID NO: 87)

[0540] 75 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0541] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0542]

[0543] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P ,f(CAtty Docket No. K199354 1070WO (00038)

[0544] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0545] No.

[0546] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [s

[0547] P].m(C)} (SEQ ID NO: 88)

[0548] 76 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGUC (SEQ ID NO: 4) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0549] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0550] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P ,f(C

[0551] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .m(U) [s

[0552] P].m(C)} (SEQ ID NO: 89)

[0553] 77 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGT (SEQ ID NO: 56) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0554] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0555] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C

[0556] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] . [moe] (

[0557] T)[msPA].[moe]([m5C]) (SEQ ID NO: 90)

[0558] 78 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A)[s CAGUCCCUUUCTCIUCGAU P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C)P.f(U) [s GGT (SEQ ID NO: 56) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0559] ,m(C)P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0560] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C

[0561] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] . [moe] (

[0562] T)[sP].[moe]([m5C]) (SEQ ID NO: 91)

[0563] 79 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [msPA] . AACAUGGCCCCAGCAGCUU f(G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f( CAGUCCCUUUCTCIUCGAU A)[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f( GGUC (SEQ ID NO: 4) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m

[0564] sPA] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [

[0565] sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U

[0566] )P f(C) [sP] .m(G)P .m(A) [msPA] .m(U)P.m(G)P.m(G

[0567] )[sP].f(U)[msPA].m(C)} (SEQ ID NO: 92)

[0568] 80 {m(A)[msPA].m(A)[sP].m(C)P.m(A)P.[moe](T)[ms AACATGGCCCCAGCAGCUU PA] ,f(G)[sP] ,f(G)[sP] ,f(C)[sP] ,m(C)P.f(C)[sP] ,m(C) CAGUCCCUUUCTCIUCGAU P.f(A)[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C) GGTC (SEQ ID NO: 62) P f(U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U)

[0569] [msPA] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(

[0570] U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] .

[0571] m(U) [sP] .f(C) [sP] .m(G) [sP] .m(A) [msPA] ,m(U)P .m (G)P.m(G)[sP].[moe](T)[msPA].m(C)} (SEQ ID

[0572] NO: 93)

[0573]

[0574] Atty Docket No. K199354 1070WO (00038)

[0575] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0576] No.

[0577] 81 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [msPA] . AACAUGGCCCCAGCAGCUU f(G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f( CAGUCCCUUUCTCIUCGAU A)[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f( GGUC (SEQ ID NO: 4) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [sP

[0578] ] ,m(C)P.f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] .

[0579] m(C)[sP] ,d(T) [sP] . [hD](C) [sP] . d(I) [msPA] ,m(U)P.f

[0580] (C) [sP] .m(G)P.m(A) [msPA] ,m(U)P .m(G)P.m(G) [sP

[0581] ].f(U)[msPA].m(C)} (SEQ ID NO: 94)

[0582] 82 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A CAGUCCCUUUCTCIUCGAU )[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f(U) GGUC (SEQ ID NO: 4) [sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msP A].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP

[0583] ] ,m(C)P.d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P.f(

[0584] C) [sP] .m(G) [sP] .m(A)P.m(U)P .m(G)P .m(G) [sP] .f(

[0585] U)[msPA].m(C)} (SEQ ID NO: 95)

[0586] 83 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A CAGUCCCUUUCTCIUCGAU )[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f(U) GGUC (SEQ ID NO: 4) [sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msP A].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP

[0587] ] ,m(C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U) [sP] .

[0588] f(C) [sP] .m(G) [sP] m(A)P m(U)P.m(G)P .m(G) [sP] .f

[0589] (U)[msPA].m(C)} (SEQ ID NO: 96)

[0590] 84 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A CAGUCCCUUUCTCIUCGAU )[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f(U) GGUC (SEQ ID NO: 4) [sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msP A].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP

[0591] ] ,m(C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U) [sP] .

[0592] f(C) [sP] .m(G) [sP] m(A)P m(U)P.m(G)P .m(G) [sP] .

[0593] m(U)[msPA].m(C)} (SEQ ID NO: 97)

[0594] 85 {m(A)[msPA].m(A)[sP].m(C)P.m(A)[msPA].f(U)[s AACAUGGCCCCAGCAGCUU P] ,f(G)[sP] ,f(G)[sP] ,f(C)[sP] ,m(C)P.f(C)[sP] ,m(C)P CAGUCCCUUUCTCIUCGAU ,f(A)[sP] ,m(G)P.m(C)[sP] .f(A)[sP] .f(G)[sP] ,m(C)P. GGUC (SEQ ID NO: 4) f(U) [sP] ,m(U)P.m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [ msPA].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U

[0595] ) [sP] ,m(C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)

[0596] [sP] .f(C)[sP] .m(G)[sP] .m(A)P.m(U)P.m(G)P.m(G)[

[0597] sP].m(U)[msPA].m(C)} (SEQ ID NO: 98)

[0598] 86 {m(A) [msPA] ,m(A) [sP] .m(C)P. [moe] (A)P.f(U) [sP] AACAUGGCUCCAGCAGUU .f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A) UCAGUUCCUUUCTCIUCGA [sP] ,m(G)P.m(C)[sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [ UGGUC (SEQ ID NO: 10) sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA

[0599] ].m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0600]

[0601] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P ,f(CAtty Docket No. K199354 1070WO (00038)

[0602] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0603] No.

[0604] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0605] sPA].m(C)} (SEQ ID NO: 99)

[0606] 87 {m(A) [msPA] ,m(A) [sP] .m(C)P. [moe] (A) [sP] .f(U) [s AACAUGGCUCCAGCAGUU P].f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f( UCAGUUCCUUUCTCIUCGA A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f( UGGUC (SEQ ID NO: 10) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m sPA].m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[

[0607] sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P .

[0608] f(C) [sP] m(G)P ,m(A)P ,m(U)P ,m(G)P.m(G) [sP] ,f(U

[0609] )[msPA].m(C)} (SEQ ID NO: 100)

[0610] 88 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [msPA] . AACAUGGCUCCAGCAGUU f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[ UCAGUUCCUUUCTCIUCGA sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0611] m(C)P.d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C

[0612] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0613] sPA].m(C)} (SEQ ID NO: 101)

[0614] 89 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCUCCAGCAGUU (G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0615] m(C)P.d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C

[0616] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0617] sPA].m(C)} (SEQ ID NO: 102)

[0618] 90 {m(A)[msPA].m(A)[sP].m(C)P.m(A)[msPA].f(U)[s AACAUGGCUCCAGCAGUU P].f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f( UCAGUUCCUUUCTCIUCGA A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f( UGGUC (SEQ ID NO: 10) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m sPA].m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[

[0619] sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P .

[0620] f(C) [sP] m(G)P ,m(A)P ,m(U)P ,m(G)P.m(G) [sP] ,f(U

[0621] )[msPA].m(C)} (SEQ ID NO: 103)

[0622] 91 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [msP AACAUGGCUCCAGCAGUU A].f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f( UCAGUUCCUUUCTCIUCGA A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f( UGGUC (SEQ ID NO: 10) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m sPA].m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[

[0623] sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P .

[0624] f(C) [sP] m(G)P ,m(A)P ,m(U)P ,m(G)P.m(G) [sP] ,f(U

[0625] )[msPA].m(C)} (SEQ ID NO: 104)

[0626] 92 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A)P.m(U) [sP] .f( AACAUGGCUCCAGCAGUU G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA

[0627]

[0628] P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10)Atty Docket No. K199354 1070WO (00038)

[0629] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0630] No.

[0631] P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0632] m(C)P.d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P.f(C

[0633] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0634] sPA].m(C)} (SEQ ID NO: 105)

[0635] 93 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .m(U) [sP] . AACAUGGCUCCAGCAGUU f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[ UCAGUUCCUUUCTCIUCGA sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0636] m(C)P.d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P.f(C

[0637] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0638] sPA].m(C)} (SEQ ID NO: 106)

[0639] 94 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .m( AACAUGGCUCCAGCAGUU G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0640] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C

[0641] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0642] sPA].m(C)} (SEQ ID NO: 107)

[0643] 95 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .m( AACAUGGCUCCAGCAGUU G)P.m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0644] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0645] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(U)[msP

[0646] A].m(C)} (SEQ ID NO: 108)

[0647] 96 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A)P.m(U) [sP] .m( AACAUGGCUCCAGCAGUU G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0648] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P .f(C

[0649] ) [sP] .m(G)P.m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0650] sPA].m(C)} (SEQ ID NO: 109)

[0651] 97 {m(A)[msPA].m(A)[sP].m(C)P.m(A)P.m(U)P.m(G) AACAUGGCUCCAGCAGUU [sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0652] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0653] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(U)[msP

[0654] A].m(C)} (SEQ ID NO: 110)

[0655]

[0656] Atty Docket No. K199354 1070WO (00038)

[0657] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0658] No.

[0659] 98 {m(A)[msPA].m(A)[sP].m(C)P.m(A)P.m(U)P.m(G) AACAUGGCUCCAGCAGUU P .m(G)P .m(C)P .m(U)P .f(C) [sP] .m(C)P .f(A) [sP] .m( UCAGUUCCUUUCTCIUCGA G)P.m(C)[sP] ,f(A)[sP] ,f(G) [sP] ,m(U)P.f(U) [sP] ,m( UGGUC (SEQ ID NO: 10) U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] ,m(U

[0660] )P.f(C) [sP] ,f(C)[sP] ,f(U)[sP] ,m(U)P.f(U) [sP] ,m(C)P

[0661] ,d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P.f(C) [sP] .m (G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(U)[msPA].m

[0662] (C)} (SEQ ID NO: 111)

[0663] 99 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP]. UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0664] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0665] C) [sP] ,d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P.f(C)

[0666] [sP] m(G)P m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [ms

[0667] PA].m(C)} (SEQ ID NO: 112)

[0668] 100 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0669] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0670] C) [msPA] ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P .

[0671] f(C) [sP] m(G)P ,m(A)P ,m(U)P ,m(G)P.m(G) [sP] ,f(U

[0672] )[msPA].m(C)} (SEQ ID NO: 113)

[0673] 101 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0674] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0675] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U) [sP] ,f(C)

[0676] [sP] m(G)P m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [ms

[0677] PA].m(C)} (SEQ ID NO: 114)

[0678] 102 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0679] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0680] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s

[0681] P] . [moe] (G)P ,m(A)P .m(U)P.m(G)P.m(G) [sP] ,f(U) [

[0682] msPA].m(C)} (SEQ ID NO: 115)

[0683] 103 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0684] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0685]

[0686] C)P.d(T)[sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P.f(C) [sAtty Docket No. K199354 1070WO (00038)

[0687] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0688] No.

[0689] P] .m(G) [sP] .m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0690] sPA].m(C)} (SEQ ID NO: 116)

[0691] 104 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP]. UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0692] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0693] C)P ,d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U) [sP] ,f(C)

[0694] [sP] ,m(G) [sP] ,m(A)P .m(U)P.m(G)P.m(G) [sP] ,f(U) [

[0695] msPA].m(C)} (SEQ ID NO: 117)

[0696] 105 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0697] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0698] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s

[0699] P] .m(G) [msPA] .m(A)P.m(U)P .m(G)P .m(G) [sP] .f(U

[0700] )[msPA].m(C)} (SEQ ID NO: 118)

[0701] 106 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0702] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0703] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U) [sP] ,f(C) [sP].m(G)[msPA].m(A)P.m(U)P.m(G)P.m(G)[sP].f(

[0704] U)[msPA].m(C)} (SEQ ID NO: 119)

[0705] 107 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGG m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 226 m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0706] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0707] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(G)P.m(U)P.m(G)P.m(G)[sP].f(U)[msP

[0708] A].m(C)} (SEQ ID NO: 120)

[0709] 108 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0710] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0711] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s

[0712] P] .m(G)P .m(A) [sP] .m(U)P .m(G)P .m(G) [sP] .f(U) [m

[0713] sPA].m(C)} (SEQ ID NO: 121)

[0714] 109 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA

[0715]

[0716] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10)Atty Docket No. K199354 1070WO (00038)

[0717] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0718] No.

[0719] m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0720] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0721] C)P ,d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P.f(C)[s

[0722] P] .m(G)P.m(A) [msPA] .m(U)P.m(G)P.m(G)[sP] .f(U

[0723] )[msPA].m(C)} (SEQ ID NO: 122)

[0724] 110 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP]. UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0725] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0726] C)P ,d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].m(U)[ms

[0727] PA].m(C)} (SEQ ID NO: 123)

[0728] 111 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0729] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0730] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].f(U)[sP],

[0731] m(C)} (SEQ ID NO: 124)

[0732] 112 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGUC (SEQ ID NO: 10) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0733] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0734] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].m(U)[sP].

[0735] m(C)} (SEQ ID NO: 125)

[0736] 113 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGT (SEQ ID NO: 227) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0737] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0738] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].[moe](T)[

[0739] msPA].[moe]([m5C])} (SEQ ID NO: 126)

[0740] 114 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [sP] .f(G AACAUGGCUCCAGCAGUU )[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[sP], UCAGUUCCUUUCTCIUCGA m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [sP] . UGGT (SEQ ID NO: 227) m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msPA] .m

[0741] (U)P.f(C)[sP] ,f(C)[sP].f(U)[sP] ,m(U)P.f(U)[sP] ,m(

[0742] C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C) [s P].m(G)P.m(A)P.m(U)P.m(G)P.m(G)[sP].[moe](T)[

[0743] sP].[moe]([m5C])} (SEQ ID NO: 127)

[0744]

[0745] Atty Docket No. K199354 1070WO (00038)

[0746] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0747] No.

[0748] 115 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [msPA] . AACAUGGCUCCAGCAGUU f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[ UCAGUUCCUUUCTCIUCGA sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0749] m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P.f

[0750] (C) [sP] .m(G)P.m(A) [msPA] ,m(U)P .m(G)P.m(G) [sP

[0751] ].f(U)[msPA].m(C)} (SEQ ID NO: 128)

[0752] 116 {m(A)[msPA].m(A)[sP].m(C)P.m(A)P.[moe](T)[ms AACATGGCUCCAGCAGUUU PA] ,f(G)[sP] .m(G)P.m(C)P.m(U)P.f(C)[sP] ,m(C)P.f CAGUUCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f( GGTC (SEQ ID NO: 130) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m sPA].m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[

[0753] sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U

[0754] ) [sP] .f(C) [sP] .m(G) [sP] .m(A) [msPA] ,m(U)P .m(G)P .m(G)[sP].[moe](T)[msPA].m(C)} (SEQ ID NO:

[0755] 129)

[0756] 117 {m(A)[msPA] ,m(A)[sP] .m(C)P.m(A)P.f(U) [msPA] . AACAUGGCUCCAGCAGUU f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[ UCAGUUCCUUUCTCIUCGA sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [sP] ,m(

[0757] U)P.f(C) [sP] ,f(C)[sP] ,f(U)[sP] ,m(U)P.f(U) [sP] ,m(C

[0758] ) [sP] ,d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U)P.f(C) [

[0759] sP] .m(G)P.m(A) [msPA] .m(U)P.m(G)P.m(G)[sP] .f(

[0760] U)[msPA].m(C)} (SEQ ID NO: 131)

[0761] 118 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCUCCAGCAGUU (G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0762] m(C)P.d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C

[0763] ) [sP] ,m(G) [sP] ,m(A)P .m(U)P.m(G)P.m(G) [sP] ,f(U)

[0764] [msPA].m(C)} (SEQ ID NO: 132)

[0765] 119 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCUCCAGCAGUU (G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0766] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U) [sP] .f

[0767] (C) [sP] .m(G) [sP] .m(A)P ,m(U)P .m(G)P.m(G) [sP] .f(

[0768] U)[msPA].m(C)} (SEQ ID NO: 133)

[0769] 120 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCUCCAGCAGUU (G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA]

[0770]

[0771] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP].Atty Docket No. K199354 1070WO (00038)

[0772] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0773] No.

[0774] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U) [sP] .f

[0775] (C) [sP] .m(G) [sP] .m(A)P ,m(U)P .m(G)P.m(G) [sP] .m

[0776] (U)[msPA].m(C)} (SEQ ID NO: 134)

[0777] 121 {m(A)[msPA].m(A)[sP].m(C)P.m(A)[msPA].f(U)[s AACAUGGCUCCAGCAGUU P].f(G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f( UCAGUUCCUUUCTCIUCGA A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f( UGGUC (SEQ ID NO: 10) U) [sP] ,m(U)P ,m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [m sPA].m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[

[0778] sP] ,m(C)P.d(T) [sP] . [hD] (C) [sP] d(I) [msPA] ,m(U) [s

[0779] P] ,f(C) [sP] ,m(G) [sP] .m(A)P.m(U)P.m(G)P ,m(G) [sP

[0780] ].m(U)[msPA].m(C)} (SEQ IDNO: 135)

[0781] 122 {f(A) [msPA] ,f(A) [sP] ,m(C)P ,m(A) [sP] ,f(U) [sP] ,f(G AACAUGGCCCCAGCAGCUU )[sP].f(G)[sP].f(C)[sP].m(C)[sP].f(C)[sP].m(C)[sP].f CAGUCCCUUUCTCIUCGAU (A) [sP] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(C) [sP] GGUC (SEQ ID NO: 4) ,f(U) [sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(U) [

[0782] msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP

[0783] ] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana] (I) [

[0784] msPA] ,m(U)[sP] .f(C)[sP] .m(G)[sP] .m(A)P.m(U)P. m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID NO:

[0785] 136)

[0786] 123 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP] .f(G)[sP] ,f(C)[sP] ,m(C)[sP] .f(C)[sP] ,m(C)[s CAGUCCCUUUCTCIUCGAU P] ,f(A)[sP] ,m(G)P.m(C)[sP] ,f(A) [sP] ,f(G) [sP] ,m(C) GGUC (SEQ ID NO: 4) [sP] ,f(U)[sP] ,m(U)P.m(C)P.m(A) [msPA] ,f(G) [sP] ,f(

[0787] U) [msPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U

[0788] ) [sP] ,f(U) [sP] ,m(C) [sP] ,d(T) [sP] . [hD] (C) [sP] . [fana]

[0789] (I) [msPA] ,m(U) [sP] .f(C) [sP] .m(G) [sP] .m(A)P ,m(U) P.m(G)[sP].f(G)[sP].f(U)[msPA].m(C)} (SEQ ID

[0790] NO: 137)

[0791] 124 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A CAGUCCCUUUCTCIUCGAU )[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f(U) GGUC (SEQ ID NO: 4) [sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msP A].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP

[0792] ] ,m(C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(

[0793] C) [sP] .m(G) [sP] .m(A)P.m(U)P .m(G)P .m(G) [sP] .f(

[0794] U)[msPA].m(C)} (SEQ ID NO: 138)

[0795] 125 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCCCCAGCAGCUU (G)[sP].f(G)[sP].f(C)[sP].m(C)P.f(C)[sP].m(C)P.f(A CAGUCCCUUUCTCIUCGAU )[sP].m(G)P.m(C)[sP].f(A)[sP].f(G)[sP].m(C)P.f(U) GGUC (SEQ ID NO: 4) [sP] .m(U)P .m(C)P .m(A) [msPA] ,f(G) [sP] .f(U) [msP A].m(C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP

[0796] ] ,m(C)P ,d(T) [sP] . [hD] (C) [sP] ,d(I) [msPA] ,m(U) [sP] .

[0797] f(C) [sP] .m(G) [sP] m(A)P m(U)P.m(G)P .m(G) [sP] .f

[0798] (U)[msPA].m(C)} (SEQ ID NO: 139)

[0799]

[0800] Atty Docket No. K199354 1070WO (00038)

[0801] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0802] No.

[0803] 126 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCUCCAGCAGUU (G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0804] m(C)P.d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U)P.f(C

[0805] ) [sP] ,m(G) [sP] ,m(A)P .m(U)P.m(G)P.m(G) [sP] ,f(U)

[0806] [msPA].m(C)} (SEQ ID NO: 140)

[0807] 127 {m(A) [msPA] ,m(A) [sP] .m(C)P.m(A) [sP] .f(U) [sP] .f AACAUGGCUCCAGCAGUU (G)[sP].m(G)P.m(C)P.m(U)P.f(C)[sP].m(C)P.f(A)[s UCAGUUCCUUUCTCIUCGA P] m(G)P ,m(C) [sP] ,f(A) [sP] ,f(G) [sP] ,m(U)P.f(U) [s UGGUC (SEQ ID NO: 10) P] ,m(U)P ,m(C)P ,m(A) [msPA] ,f(G) [sP] ,f(U) [msPA] .m(U)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP],

[0808] m(C)P . d(T) [sP] . [hD] (C) [sP] . d(I) [msPA] ,m(U) [sP] .f

[0809] (C) [sP] .m(G) [sP] .m(A)P ,m(U)P .m(G)P.m(G) [sP] .f(

[0810] U)[msPA].m(C)} (SEQ ID NO: 141)

[0811] 128 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0812] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[0813] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U )[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0814] 151)

[0815] 129 m(C)[sP].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f(G)[s CCCCAGCAGCUUCAGUCCC P] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] ,f(U) UUUCTCIUCGA (SEQ ID NO:

[0816] [sP] ,m(C)[sP] ,f(A)[sP] ,f(G)[sP] ,f(U)[sP] ,m(C)[sP] .f 152)

[0817] (C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U) [sP] ,f(C) [sP

[0818] ] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [sP] ,m(U) [sP] ,f(C) [sP] .m

[0819] (G)[sP].m(A) (SEQ ID NO: 153)

[0820] 130 m(C)[sP].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f(G)[s CCCCAGCAGCUUCAGUCCC P] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] ,f(U) UUUCTCIUCGA (SEQ ID NO:

[0821] [sP] .m(C)[sP] .f(A)[msPA] ,f(G)[sP] .f(U) [msPA] ,m( 152)

[0822] C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U) [sP] .

[0823] f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [sP]

[0824] .f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 154)

[0825] 131 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U)[sP] ,m(C)[sP] ,f(A)[sP] ,f(G) [sP] ,f(U) [msPA] .m 152)

[0826] (C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U) [sP

[0827] ] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [s P].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 155)

[0828] 132 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [sP] .m 152)

[0829] (C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U) [sP

[0830] ] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [s

[0831]

[0832] P].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 156)Atty Docket No. K199354 1070WO (00038)

[0833] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0834] No.

[0835] 133 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0836] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[0837] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [sP] ,m(U) [sP

[0838] ].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 157)

[0839] 134 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0840] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[0841] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] ,m(U

[0842] )[sP].f(C)[sP].m(G)[sP].m(A) (SEQ ID NO: 158)

[0843] 135 m(C)[msPA] ,f(C)[msPA] ,f(C)[sP] .f(C)[sP] .m(A)[sP CCCCAGCAGCUUCAGUCCC ].f(G)[sP].f(C)[sP].f(A)[sP].m(G)[sP].f(C)[sP].f(U)[ UUUCTCIUCGA (SEQ ID NO: sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [ms 152)

[0844] PA] ,m(C)[sP] ,f(C)[sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] .f

[0845] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] . d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0846] 159)

[0847] 136 m(C)[msPA] ,f(C)[sP] .f(C)[msPA] ,f(C)[sP] .m(A)[sP CCCCAGCAGCUUCAGUCCC ].f(G)[sP].f(C)[sP].f(A)[sP].m(G)[sP].f(C)[sP].f(U)[ UUUCTCIUCGA (SEQ ID NO: sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [ms 152)

[0848] PA] ,m(C)[sP] ,f(C)[sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] .f

[0849] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0850] 160)

[0851] 137 m(C) [msPA] ,f(C) [sP] .f(C) [sP] .f(C) [msPA] ,m(A) [sP CCCCAGCAGCUUCAGUCCC ].f(G)[sP].f(C)[sP].f(A)[sP].m(G)[sP].f(C)[sP].f(U)[ UUUCTCIUCGA (SEQ ID NO: sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [ms 152)

[0852] PA] ,m(C)[sP] ,f(C)[sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] .f

[0853] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0854] 161)

[0855] 138 m(C) [msPA] ,f(C) [sP] .f(C) [sP] .f(C) [sP] .m(A) [msPA CCCCAGCAGCUUCAGUCCC ].f(G)[sP].f(C)[sP].f(A)[sP].m(G)[sP].f(C)[sP].f(U)[ UUUCTCIUCGA (SEQ ID NO: sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [ms 152)

[0856] PA] ,m(C)[sP] ,f(C)[sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] .f

[0857] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0858] 162)

[0859] 139 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [msPA] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) UUUCTCIUCGA (SEQ ID NO:

[0860] [sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[0861] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0862] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0863] 163)

[0864] 140 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [msPA] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) UUUCTCIUCGA (SEQ ID NO:

[0865] [sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[0866]

[0867] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .Atty Docket No. K199354 1070WO (00038)

[0868] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0869] No.

[0870] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0871] 164)

[0872] 141 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [msPA] ,m(G) [sP] ,f(C) [sP] ,f(U) UUUCTCIUCGA (SEQ ID NO:

[0873] [sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[0874] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0875] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0876] 165)

[0877] 142 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [msPA] ,f(C) [sP] ,f(U) UUUCTCIUCGA (SEQ ID NO:

[0878] [sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[0879] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0880] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0881] 166)

[0882] 143 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [msPA] ,f(U) UUUCTCIUCGA (SEQ ID NO:

[0883] [sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[0884] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0885] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0886] 167)

[0887] 144 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [ms UUUCTCIUCGA (SEQ ID NO: PA] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[0888] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0889] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0890] 168)

[0891] 145 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [msPA] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[0892] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0893] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0894] 169)

[0895] 146 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [msPA] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[0896] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0897] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0898] 170)

[0899] 147 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [msPA] ,f(U) [m 152)

[0900] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[0901]

[0902] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] .Atty Docket No. K199354 1070WO (00038)

[0903] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0904] No.

[0905] m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0906] 171)

[0907] 148 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0908] ] ,m(C) [msPA] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .f

[0909] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] . d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0910] 172)

[0911] 149 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0912] ] ,m(C) [sP] ,f(C) [msPA] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .f

[0913] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0914] 173)

[0915] 150 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0916] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [msPA] ,f(U) [sP] ,m(U) [sP] .f

[0917] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0918] 174)

[0919] 151 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0920] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [msPA] ,m(U) [sP] .f

[0921] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0922] 175)

[0923] 152 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0924] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [msPA] .f

[0925] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0926] 176)

[0927] 153 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0928] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[0929] [msPA] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0930] 177)

[0931] 154 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0932] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[0933] [sP] ,f(C) [msPA] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0934]

[0935] 178)Atty Docket No. K199354 1070WO (00038)

[0936] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0937] No.

[0938] 155 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0939] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[0940] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] ,m(U

[0941] ) [msPA] ,f(C)[sP].m(G) [msPA] ,m(A) (SEQ ID NO:

[0942] 179)

[0943] 156 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[0944] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[0945] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] ,m(U )[sP].f(C)[msPA].m(G)[msPA].m(A) (SEQ ID NO:

[0946] 180)

[0947] 157 f(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f(G CCCCAGCAGCUUCAGUCCC ) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] ,f( UUUCTCIUCGA (SEQ ID NO: U)[sP] ,m(C)[sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA] . 152)

[0948] m(C)[sP] ,f(C) [sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] ,f(U) [s

[0949] P] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [ sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 181)

[0950] 158 m(C) [msPA] ,m(C) [sP] .f(C) [sP] .f(C) [sP] .m(A) [sP] .f CCCCAGCAGCUUCAGUCCC (G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP UUUCTCIUCGA (SEQ ID NO: ] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0951] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0952] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0953] 182)

[0954] 159 m(C) [msPA] ,f(C) [sP] .m(C) [sP] .f(C) [sP] .m(A) [sP] .f CCCCAGCAGCUUCAGUCCC (G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP UUUCTCIUCGA (SEQ ID NO: ] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0955] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0956] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0957] 183)

[0958] 160 m(C) [msPA] ,f(C) [sP] .f(C) [sP] .m(C) [sP] .m(A) [sP] .f CCCCAGCAGCUUCAGUCCC (G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP UUUCTCIUCGA (SEQ ID NO: ] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0959] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0960] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0961] 184)

[0962] 161 m(C)[msPA] ,f(C)[sP] ,f(C) [sP] ,f(C)[sP] ,f(A) [sP] ,f(G CCCCAGCAGCUUCAGUCCC ) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] ,f( UUUCTCIUCGA (SEQ ID NO: U)[sP] ,m(C)[sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA] . 152)

[0963] m(C)[sP] ,f(C) [sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] ,f(U) [s

[0964] P] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [ sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 185)

[0965] 162 m(C) [msPA] ,f(C) [sP] .f(C) [sP] .f(C) [sP] .m(A) [sP] .m CCCCAGCAGCUUCAGUCCC (G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP UUUCTCIUCGA (SEQ ID NO: ] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0966]

[0967] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(Atty Docket No. K199354 1070WO (00038)

[0968] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[0969] No.

[0970] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0971] 186)

[0972] 163 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,m(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP UUUCTCIUCGA (SEQ ID NO: ] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0973] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0974] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0975] 187)

[0976] 164 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,m(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP UUUCTCIUCGA (SEQ ID NO: ] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0977] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0978] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0979] 188)

[0980] 165 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G)[sP].f(C)[sP].f(A)[sP].f(G)[sP].f(C)[sP].f(U)[sP].f UUUCTCIUCGA (SEQ ID NO: (U)[sP] ,m(C)[sP] ,f(A)[msPA] ,f(G)[sP] ,f(U)[msPA] . 152)

[0981] m(C)[sP] ,f(C) [sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] ,f(U) [s

[0982] P] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [ sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 189)

[0983] 166 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,m(C) [sP] ,f(U) [sP UUUCTCIUCGA (SEQ ID NO: ] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0984] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0985] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0986] 190)

[0987] 167 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,m(U) [sP UUUCTCIUCGA (SEQ ID NO: ] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0988] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0989] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0990] 191)

[0991] 168 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,m(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[0992] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[0993] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[0994] 192)

[0995] 169 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U)[sP] ,f(C)[sP] ,f(A)[msPA] ,f(G)[sP] ,f(U)[msPA] . 152)

[0996] m(C)[sP] ,f(C) [sP] .f(C)[sP] .f(U)[sP] ,m(U)[sP] ,f(U) [s

[0997] P] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [

[0998]

[0999] sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 193)Atty Docket No. K199354 1070WO (00038)

[1000] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[1001] No.

[1002] 170 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,m(A) [msPA] ,f(G) [sP] ,f(U) [msP 152)

[1003] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[1004] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1005] 194)

[1006] 171 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,m(G) [sP] ,f(U) [msP 152)

[1007] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[1008] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1009] 195)

[1010] 172 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,m(U) [msP 152)

[1011] A] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(

[1012] U) [sP] . f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] .m (U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1013] 196)

[1014] 173 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152) ].f(C)[sP].f(C)[sP].f(C)[sP].f(U)[sP].m(U)[sP].f(U)[

[1015] sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 197)

[1016] 174 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1017] ] ,m(C)[sP] ,m(C) [sP] ,f(C)[sP] ,f(U)[sP] ,m(U) [sP] ,f(U

[1018] ) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m( U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1019] 198)

[1020] 175 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1021] ] ,m(C) [sP] ,f(C) [sP] ,m(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U

[1022] ) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m( U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1023] 199)

[1024] 176 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1025] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,m(U) [sP] ,m(U) [sP] ,f(U

[1026] ) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m( U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1027] 200)

[1028] 177 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO:

[1029]

[1030] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)Atty Docket No. K199354 1070WO (00038)

[1031] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[1032] No.

[1033] ].m(C)[sP].f(C)[sP].f(C)[sP].f(U)[sP].f(U)[sP].f(U)[

[1034] sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] d(I) [msPA] ,m(U) [sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 201)

[1035] 178 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1036] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,m(U

[1037] ) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] ,m( U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1038] 202)

[1039] 179 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1040] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[1041] [sP] ,m(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m( U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1042] 203)

[1043] 180 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1044] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[1045] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,f(U) [ sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO: 204)

[1046] 181 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1047] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[1048] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U )[sP].m(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1049] 205)

[1050] 182 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1051] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[1052] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U )[sP].f(C)[sP].f(G)[msPA].m(A) (SEQ ID NO: 206)

[1053] 183 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1054] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[1055] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U )[sP].f(C)[sP].m(G)[msPA].f(A) (SEQ ID NO: 207)

[1056] 184 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U)[msPA] ,m(C)[sP] .f(A)[sP] ,f(G)[msPA] ,f(U)[sP 152)

[1057] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,f(U)

[1058] [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U )[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1059]

[1060] 208)Atty Docket No. K199354 1070WO (00038)

[1061] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[1062] No.

[1063] 185 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U)[msPA] ,m(C)[sP] .f(A)[sP] ,f(G)[msPA] ,f(U)[sP 152)

[1064] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [msPA] ,m(U) [sP] .f

[1065] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] . d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1066] 209)

[1067] 186 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)P.f(G)[ CCCCAGCAGCUUCAGUCCC sP] ,f(C) [sP] ,f(A) [sP] ,m(G)P.f(C) [sP] ,f(U) [sP] ,f(U) [ UUUCTCIUCGA (SEQ ID NO: sP] ,m(C)P.f(A) [msPA] ,f(G) [sP] ,f(U) [msPA] ,m(C)P 152)

[1068] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] ,f(C) [sP] .

[1069] d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] ,m(U) [sP] ,f(C) [sP]

[1070] .m(G)[msPA].m(A) (SEQ ID NO: 210)

[1071] 187 m(C) [msPA] ,m(C) [sP] .m(C) [sP] .m(C) [sP] .m(A) [sP CCCCAGCAGCUUCAGUCCC ].f(G)[sP].f(C)[sP].f(A)[sP].m(G)[sP].f(C)[sP].f(U)[ UUUCTCIUCGA (SEQ ID NO: sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [ms 152)

[1072] PA] ,m(C)[sP] ,f(C)[sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] .f

[1073] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] . d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1074] 211)

[1075] 188 m(C) [msPA] ,f(C) [sP] .f(C) [sP] .f(C) [sP] .m(A) [sP] .m CCCCAGCAGCUUCAGUCCC (G) [sP] ,m(C) [sP] ,m(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [ UUUCTCIUCGA (SEQ ID NO: sP] ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [ms 152)

[1076] PA] ,m(C)[sP] ,f(C)[sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] .f

[1077] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1078] 212)

[1079] 189 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: .f(U) [sP] .m(C) [sP] .m(A) [msPA] ,m(G) [sP] .m(U) [ms 152)

[1080] PA] ,m(C)[sP] ,f(C)[sP] ,f(C)[sP] ,f(U)[sP] ,m(U)[sP] .f

[1081] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1082] 213)

[1083] 190 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1084] ] ,m(C) [sP] ,m(C) [sP] ,m(C) [sP] ,m(U) [sP] ,m(U) [sP] .f

[1085] (U) [sP] . f(C) [sP] . d(T) [sP] . [Dh] (C) [sP] ,d(I) [msP A] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1086] 214)

[1087] 191 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)[sP].f( CCCCAGCAGCUUCAGUCCC G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,f(C) [sP] ,f(U) [sP] UUUCTCIUCGA (SEQ ID NO: ,f(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [msPA 152)

[1088] ] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] ,m(U

[1089] ) [sP] ,m(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m( U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1090] 215)

[1091] 192 m(C) [msPA] ,m(C) [sP] .m(C) [sP] .m(C) [sP] .m(A)P ,f( CCCCAGCAGCUUCAGUCCC G)[sP].f(C)[sP].f(A)[sP].m(G)P.f(C)[sP].f(U)[sP].f( UUUCTCIUCGA (SEQ ID NO:

[1092]

[1093] U)[sP] .m(C)P.f(A)[msPA] ,f(G)[sP] ,f(U) [msPA] ,m( 152)Atty Docket No. K199354 1070WO (00038)

[1094] KB-056-PCT Oligo Base sequence Oligonucleotide sequence

[1095] No.

[1096] C)P.f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.f(U)[sP].f(C)[

[1097] sP] ,d(T) [sP] . [Dh] (C) [sP] . d(I) [msPA] ,m(U) [sP] ,f(C)

[1098] [sP].m(G)[msPA].m(A) (SEQ ID NO: 216)

[1099] 193 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)P.m(G CCCCAGCAGCUUCAGUCCC )P ,m(C)P.m(A)P m(G)P ,f(C) [sP] ,f(U) [sP] ,f(U) [sP] . UUUCTCIUCGA (SEQ ID NO: m(C)P.f(A)[msPA].f(G)[sP].f(U)[msPA].m(C)P.f(C 152)

[1100] ) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] ,f(C) [sP] ,d(T

[1101] ) [sP] . [Dh] (C) [sP] . d(I) [msPA] ,m(U) [sP] ,f(C) [sP] ,m(

[1102] G)[msPA].m(A) (SEQ ID NO: 217)

[1103] 194 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)P.f(G)[ CCCCAGCAGCUUCAGUCCC sP] ,f(C) [sP] ,f(A) [sP] m(G)P ,m(C)P.m(U)P ,m(U)P . UUUCTCIUCGA (SEQ ID NO: m(C)P.f(A)[msPA].f(G)[sP].f(U)[msPA].m(C)P.f(C 152)

[1104] ) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] ,f(C) [sP] ,d(T

[1105] ) [sP] . [Dh] (C) [sP] . d(I) [msPA] ,m(U) [sP] ,f(C) [sP] ,m(

[1106] G)[msPA].m(A) (SEQ ID NO: 218)

[1107] 195 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)P.f(G)[ CCCCAGCAGCUUCAGUCCC sP] ,f(C) [sP] ,f(A) [sP] m(G)P ,f(C) [sP] ,f(U) [sP] ,f(U) [ UUUCTCIUCGA (SEQ ID NO: sP] .m(C)P.m(A) [msPA] ,m(G)P .m(U) [msPA] ,m(C) 152)

[1108] P.f(C)[sP] ,f(C) [sP] ,f(U) [sP] ,m(U)P.f(U) [sP] ,f(C) [sP

[1109] ] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [sP] ,f(C) [s

[1110] P].m(G)[msPA].m(A) (SEQ ID NO: 219)

[1111] 196 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)P.f(G)[ CCCCAGCAGCUUCAGUCCC sP] ,f(C) [sP] ,f(A) [sP] m(G)P ,f(C) [sP] ,f(U) [sP] ,f(U) [ UUUCTCIUCGA (SEQ ID NO: sP] ,m(C)P.f(A) [msPA] ,f(G) [sP] ,f(U) [msPA] ,m(C)P 152)

[1112] ,m(C)P ,m(C)P ,m(U)P ,m(U)P.f(U) [sP] ,f(C) [sP] ,d(T)

[1113] [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [sP] ,f(C) [sP] ,m(

[1114] G)[msPA].m(A) (SEQ ID NO: 220)

[1115] 197 m(C)[msPA].f(C)[sP].f(C)[sP].f(C)[sP].m(A)P.f(G)[ CCCCAGCAGCUUCAGUCCC sP] ,f(C) [sP] ,f(A) [sP] m(G)P ,f(C) [sP] ,f(U) [sP] ,f(U) [ UUUCTCIUCGA (SEQ ID NO: sP] ,m(C)P.f(A) [msPA] ,f(G) [sP] ,f(U) [msPA] ,m(C)P 152) .f(C)[sP].f(C)[sP].f(U)[sP].m(U)P.m(U)P.m(C)P.d(

[1116] T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] ,m(U) [sP] ,f(C) [sP] .m

[1117] (G)[msPA].m(A) (SEQ ID NO: 221)

[1118] 198 {m(C)[msPA] ,f(C)[sP] ,f(C)[sP] .f(C)[sP] ,m(A)[sP] .f CCCCAGCAGCUUCAGUCCC (G) [sP] ,f(C) [sP] ,f(A) [sP] ,m(G) [sP] ,m(C) [sP] ,m(U) [ UUUCTCIUCGA (SEQ ID NO: sP] ,m(U) [sP] ,m(C) [sP] ,f(A) [msPA] ,f(G) [sP] ,f(U) [m 152)

[1119] sPA] ,m(C) [sP] ,f(C) [sP] ,f(C) [sP] ,f(U) [sP] ,m(U) [sP] .

[1120] f(U) [sP] ,f(C) [sP] ,d(T) [sP] . [Dh] (C) [sP] ,d(I) [msPA] . m(U)[sP].f(C)[sP].m(G)[msPA].m(A) (SEQ ID NO:

[1121] 222)

[1122] 199 { GD } { [moe] ( [m5 C] ) [msPA] . [moe] ( [m5 C] ) [sP] . [mo CCCAGCAGCUUCAGUCCCU e]([m5C])[msPA].f(A)[sP].f(G)[sP] .m(C)P.m(A)P.f UTCTCIUCGAU (SEQ ID NO: (G)[msPA].f(C)[sP].m(U)P.m(U)P.m(C)P.m(A)P.m 224) (G)P.f(U)[msPA].[moe]([m5C])P.f(C)[sP].[moe]([m

[1123] 5 C])P.f(U) [sP] ,m(U)P . [moe] (T)P ,f(C) [sP] ,d(T) [sP] .

[1124] [hD] (C) [sP] ,d(I) [msPA] ,m(U)P.f(C)[sP] ,m(G)[sP] .f

[1125]

[1126] (A)[msPA].m(U)} (SEQ ID NO: 223)

[1127] In some embodiments, the oligonucleotides disclosed herein does not include a stem-loop structure. Stem loop structures can act as a recruitment domain for the ADAR enzyme (e.g., an ADAR-Atty Docket No. K199354 1070WO (00038)

[1128] KB-056-PCT recruiting domain), yet the oligonucleotides as disclosed herein can affect ADAR recruitment and activity against a target adenosine in a target RNA without such a stem loop structure.

[1129] In some embodiments, the oligonucleotide described herein may further include a 5’ cap structure. In some embodiments, the 5’ cap structure is a 2,2,7-trimethylguanosine cap.

[1130] An oligonucleotide described herein can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

[1131] The oligonucleotide can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide including unnatural or alternative nucleotides can be easily prepared. Single-stranded oligonucleotides described herein can be prepared using solution-phase or solid-phase organic synthesis or both.

[1132] It is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing linked nucleosides to generate longer or shorter sequences. Such optimized sequences can be adjusted by, e.g., the introduction of alternative nucleosides, alternative sugar moieties, and / or alternative intemucleotide linkages as described herein or as known in the art, including alternative nucleosides, alternative sugar moieties, and / or alternative intemucleotide linkages as known in the art and / or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, and / or increasing interaction with RNA editing enzymes (e.g., ADAR)).

[1133] The nucleotides of oligonucleotides described herein are synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Representative U.S. patents that teach the preparation of the oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[1134] Some embodiments include oligonucleotides with phosphorothioate backbones, and / or oligonucleotides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2-[known as a methylene (methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2-CH2-[wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the abovereferenced U.S. Pat. No. 5,602,240. In some embodiments, the oligonucleotides featured herein haveAtty Docket No. K199354 1070WO (00038)

[1135] KB-056-PCT morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506. In some embodiments, the oligonucleotides described herein include phosphorodiamidate morpholino oligomers (PMO), in which the deoxyribose moiety is replaced by a morpholine ring, and the charged phosphodiester inter-subunit linkage is replaced by an uncharged phophorodiamidate linkage, as described in Summerton, et al., Antisense Nucleic Acid Drug Dev. 1997, 7:63-70.

[1136] An oligonucleotide described herein can include nucleobase (often referred to in the art simply as "base") alternatives (e.g., modifications or substitutions). Unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Alternative nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine, 5 -hydroxymethylcytosine, 5-formylcytosine, 5 -carboxy cytosine, pyrrolocytosine, dideoxycytosine, uracil, 5 -methoxyuracil, 5 -hydroxydeoxyuracil, dihydrouracil, 4-thiouracil, pseudouracil, 1 -methyl -pseudouracil, deoxyuracil, 5 -hydroxybutynl-2’ -deoxyuracil, xanthine, hypoxanthine, 7-deaza-xanthine, thienoguanine, 8-aza-7-deazaguanine, 7-methylguanine, 7-deazaguanine, 6-aminomethyl-7-deazaguanine, 8-aminoguanine, 2,2,7-trimethylguanine, 8-methyladenine, 8-azidoadenine, 7-methyladenine, 7-deazaadenine, 3 -deazaadenine, 2,6-diaminopurine, 2-aminopurine, 7-deaza-8-aza-adenine, 8-amino-adenine, thymine, dideoxythymine, 5 -nitroindole, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5 -halo, particularly 5 -bromo, 5 -trifluoromethyl and other 5 -substituted uracils and cytosines, 8-azaguanine and 8-azaadenine, and 3 -deazaguanine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligonucleotides disclosed herein. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5 -methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.Atty Docket No. K199354 1070WO (00038)

[1137] KB-056-PCT Representative U.S. patents that teach the preparation of certain of the above noted alternative nucleobases as well as other alternative nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272;

[1138] 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[1139] Oligonucleotide Conjugated to Ligands

[1140] Oligonucleotides described herein may be chemically linked to one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Uetsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Uet., 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Uet., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).

[1141] In one embodiment, a ligand alters the distribution, targeting, or lifetime of an oligonucleotide agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ, or region of the body, as, e.g., compared to a species absent such a ligand.

[1142] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-Atty Docket No. K199354 1070WO (00038)

[1143] KB-056-PCT hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[1144] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

[1145] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport / absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridineimidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[1146] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose.

[1147] The ligand can be a substance, e.g., a drug, which can increase the uptake of the oligonucleotide agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. The drug can be, for example, taxon,Atty Docket No. K199354 1070WO (00038)

[1148] KB-056-PCT vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[1149] In some embodiments, a ligand attached to olgonucleotides described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that include a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, including multiple of phosphorothioate linkages in the backbone are also amenable as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

[1150] Ligand-conjugated oligonucleotides described herein may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

[1151] The oligonucleotides used in the conjugates described herein may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

[1152] In the ligand-conjugated oligonucleotides described herein, such as the ligand-molecule bearing sequence-specific linked nucleosides described herein, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligandbearing building blocks.

[1153] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides described herein are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standardAtty Docket No. K199354 1070WO (00038)

[1154] KB-056-PCT phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[1155] Lipid Conjugates

[1156] In some embodiments, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and / or (c) can be used to adjust binding to a serum protein, e.g., HSA.

[1157] A lipid-based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

[1158] In some embodiments, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. Exemplary vitamins include vitamin A, E, and K.

[1159] Cell Permeation Agents

[1160] In some embodiments, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.

[1161] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to oligonucleotide agents can affect pharmacokinetic distribution of the oligonucleotide, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[1162] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS -containing peptide is RFGF having the amino acid sequenceAtty Docket No. K199354 1070WO (00038)

[1163] KB-056-PCT AAVALLPAVLLALLAP (SEQ ID NO: 145). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 146) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a "delivery" peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ; SEQ ID NO: 147) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK; SEQ ID NO: 148) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to an oligonucleotide agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

[1164] An RGD peptide for use in the compositions and methods described herein may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidomimetics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Some conjugates of this ligand target PECAM-1 or VEGF.

[1165] A cell permeation peptide is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an a-helical linear peptide (e.g., LL-37 or Ceropin Pl), a disulfide bond-containing peptide (e.g., a-defensin, p-defensin, or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV- 1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[1166] Carbohydrate Conjugates

[1167] In some embodiments, oligonucleotides described herein further includes a carbohydrate. The carbohydrate conjugated oligonucleotide is advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, "carbohydrate" refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbonAtty Docket No. K199354 1070WO (00038)

[1168] KB-056-PCT atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[1169] In some embodiments, a carbohydrate conjugate is a monosaccharide.

[1170] In some embodiments, the carbohydrate conjugate further includes one or more additional ligands as described above, such as, but not limited to, a PK modulator and / or a cell permeation peptide.

[1171] Additional carbohydrate conjugates (and linkers) include those described in PCT Publication Nos. WO 2014 / 179620 and WO 2014 / 179627, the entire contents of each of which are incorporated herein by reference.

[1172] Linkers

[1173] In some embodiments, the conjugate or ligand described herein can be attached to an oligonucleotide with various linkers that can be cleavable or non-cleavable.

[1174] Linkers typically include a direct bond or an atom such as oxygen or sulfur, a unit such as NRs. C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(Rs), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where Rs is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms. A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferredAtty Docket No. K199354 1070WO (00038)

[1175] KB-056-PCT embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

[1176] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selective for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[1177] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3.

[1178] Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

[1179] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

[1180] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

[1181] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissues. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture,Atty Docket No. K199354 1070WO (00038)

[1182] KB-056-PCT in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In some embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[1183] Redox Cleavable Linking Groups

[1184] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (— S— S— ). To determine if a candidate cleavable linking group is a suitable "reductively cleavable linking group," or for example is suitable for use with a particular oligonucleotide moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one embodiment, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

[1185] Phosphate-Based Cleavable Linking Groups

[1186] In another embodiment, a cleavable linker includes a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -O-P(O)(ORk)-O-, O P(S)(ORk) O-, -O-P(S)(SRk)-O-, -S-P(O)(ORk)-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, O P(S)(ORk) S , -S-P(S)(ORk)-O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)-O-, S P(O)(Rk)-S-, -O-P(S)(Rk)-S-. These candidates can be evaluated using methods analogous to those described above.

[1187] Acid Cleavable Linking Groups

[1188] In another embodiment, a cleavable linker includes an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can actAtty Docket No. K199354 1070WO (00038)

[1189] KB-056-PCT as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula -C=NN— , C(O)O, or — OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

[1190] Ester-Based Linking Groups

[1191] In another embodiment, a cleavable linker includes an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells.

[1192] Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula — C(O)O--, or — OC(O)— . These candidates can be evaluated using methods analogous to those described above.

[1193]

[1194] -Based

[1195] In yet another embodiment, a cleavable linker includes a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (— C(O)NH— ). The amide group can be formed between any alkylene, alkenylene, or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide-based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula — NHCHRAC(O)NHCHRBC(O)— , where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

[1196] In some embodiments, oligonucleotides described herein are conjugated to a carbohydrate through a linker. Linkers include bivalent and trivalent branched linker groups. Exemplary oligonucleotide carbohydrate conjugates with linkers include, but are not limited to, those described in formulas 24-35 of PCT Publication No. WO 2018 / 195165.

[1197] Representative U.S. patents that teach the preparation of oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941;Atty Docket No. K199354 1070WO (00038)

[1198] KB-056-PCT 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664;

[1199] 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.

[1200] In certain instances, the oligonucleotide described herein can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to oligonucleotides in order to enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm, 2007, 365( 1): 54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4: 1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., dihexadecyl -rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such oligonucleotide conjugates have been listed above. Typical conjugation protocols involve the synthesis of an oligonucleotide bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the oligonucleotide still bound to the solid support or following cleavage of the oligonucleotide, in solution phase. Purification of the oligonucleotide conjugate by HPLC typically affords the pure conjugate.

[1201] II. Pharmaceutical Uses

[1202] The oligonucleotides described herein may be used to treat alpha- 1 -antitrypsin deficiency in a subject in need thereof. In some embodiments, the oligonucleotides described herein, when administered to the subject, can result in correction of a guanosine to adenosine mutation. In some embodiments, the oligonucleotides described herein can result in turning off of a premature stop codon so that a desiredAtty Docket No. K199354 1070WO (00038)

[1203] KB-056-PCT protein (e.g., SERPINA1) is expressed. In some embodiments, the oligonucleotides described herein can result in inhibition of expression of an undesired protein (e.g., SERPINA1).

[1204] Deamination of an adenosine using the oligonucleotides disclosed herein includes any level of adenosine deamination, e.g., at least 1 deaminated adenosine within a target sequence (e.g., at least, 1, 2, 3, or more deaminated adenosines in a target sequence).

[1205] Adenosine deamination may be assessed by a decrease in an absolute or relative level of adenosines within a target sequence compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

[1206] Because the enzymatic activity of ADAR converts adenosines to inosines, adenosine deamination can alternatively be assessed by an increase in an absolute or relative level of inosines within a target sequence compared with a control level. Similarly, the control level may be any type of control level that is utilized in the art, e.g., pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

[1207] The levels of adenosines and / or inosines within a target sequence can be assessed using any of the methods known in the art for determining the nucleotide composition of a polynucleotide sequence. For example, the relative or absolute levels of adenosines or inosines within a target sequence can be assessed using nucleic acid sequencing technologies including but not limited to Sanger sequencing methods, Next Generation Sequencing (NGS; e.g., pyrosequencing, sequencing by reversible terminator chemistry, sequencing by ligation, and real-time sequencing) such as those offered on commercially available platforms (e.g., Illumina, Qiagen, Pacific Biosciences, Thermo Fisher, Roche, and Oxford Nanopore Technologies). Clonal amplification of target sequences for NGS may be performed using real-time polymerase chain reaction (also known as qPCR) on commercially available platforms from Applied Biosystems, Roche, Stratagene, Cepheid, Eppendorf, or Bio-Rad Laboratories. Additionally or alternatively, emulsion PCR methods can be used for amplification of target sequences using commercially available platforms such as Droplet Digital PCR by Bio-Rad Laboratories.

[1208] In certain embodiments, surrogate markers can be used to detect adenosine deamination within a target sequence. For example, effective treatment of a subject having a genetic disorder involving G-to-A mutations with an oligonucleotide of the present disclosure, as demonstrated by an acceptable diagnostic and monitoring criteria can be understood to demonstrate a clinically relevant adenosine deamination. In certain embodiments, the methods include a clinically relevant adenosineAtty Docket No. K199354 1070WO (00038)

[1209] KB-056-PCT deamination, e.g., as demonstrated by a clinically relevant outcome after treatment of a subject with an oligonucleotide of the present disclosure.

[1210] Adenosine deamination in a gene of interest (e.g., SERPINA1) may be manifested by an increase or decrease in the levels of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a gene of interest is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an oligonucleotide of the present disclosure, or by administering an oligonucleotide described herein to a subject in which the cells are or were present) such that the expression of the gene of interest is increased or decreased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an oligonucleotide or not treated with an oligonucleotide targeted to the gene of interest). The degree of increase or decrease in the levels of mRNA of a gene of interest (e.g., SERPINA1) may be expressed in terms of:

[1211] (mRNA in control cells) — (mRNA in treated cells)

[1212]

[1213] (mRNA in control cells)

[1214] In other embodiments, change in the levels of a gene may be assessed in terms of a reduction of a parameter that is functionally linked to the expression of a gene of interest, e.g., protein expression of the gene of interest or signaling downstream of the protein. A change in the levels of the gene of interest may be determined in any cell expressing the gene of interest, either endogenous or heterologous from an expression construct, and by any assay known in the art.

[1215] A change in the level of expression of a gene of interest may be manifested by an increase or decrease in the level of the protein produced by the gene of interest (e.g., SERPINA1) that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above, for the assessment of mRNA suppression, the change in the level of protein expression in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

[1216] A control cell or group of cells that may be used to assess the change in the expression of a 3 gene of interest includes a cell or group of cells that has not yet been contacted with an oligonucleotide of the present disclosure. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an oligonucleotide. The level of mRNA of a gene of interest (e.g., SERPINA1) that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of a gene of interest in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the gene of interest (e.g., SERPINA1). RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNEASY™ RNA preparationAtty Docket No. K199354 1070WO (00038)

[1217] KB-056-PCT kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating mRNA of the gene of interest may be detected using methods the described in PCT Publication WO2012 / 177906, the entire contents of which are hereby incorporated herein by reference. In some embodiments, the level of expression of the gene of interest is determined using a nucleic acid probe. The term "probe," as used herein, refers to any molecule that is capable of selectively binding to a specific sequence, e.g. to an mRNA or polypeptide. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[1218] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses, and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA of a gene of interest. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an AFFYMETRIX gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of mRNA of a gene of interest.

[1219] An alternative method for determining the level of expression of a gene of interest in a sample involves the process of nucleic acid amplification and / or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88: 189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio / Technology 6: 1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects, the level of expression of a gene of interest is determined by quantitative Anorogenic RT-PCR (i.e., the TAQMAN™ System) or the DUAL-GLO® Luciferase assay.

[1220] The expression levels of mRNA of a gene of interest may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sampleAtty Docket No. K199354 1070WO (00038)

[1221] KB-056-PCT tubes, gels, beads or fibers (or any solid support including bound nucleic acids). See U.S. Pat. Nos.

[1222] 5,770,722; 5,874,219; 5,744,305; 5,677,195; and 5,445,934, which are incorporated herein by reference. The determination of gene expression level may also include using nucleic acid probes in solution.

[1223] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of this PCR method is described and exemplified in the Examples presented herein. Such methods can also be used for the detection of nucleic acids of the gene of interest.

[1224] The level of protein produced by the expression of a gene of interest may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of proteins produced by the gene of interest.

[1225] Additionally, the above assays may be used to report a change in the mRNA sequence of interest that results in the recovery or change in protein function thereby providing a therapeutic effect and benefit to the subject, treating a disorder in a subject, and / or reducing of symptoms of a disorder in the subject.

[1226] In some embodiments, the oligonucleotides described herein are administered to a subject such that the oligonucleotide is delivered to a specific site within the subject. The change in the expression of the gene of interest may be assessed using measurements of the level or change in the level of mRNA or protein produced by the gene of interest in a sample derived from a specific site within the subject. In other embodiments, the oligonucleotides described herein are administered in an amount and for a time effective to result in one of (or more, e.g., two or more, three or more, four or more of): (a) decrease the number of adenosines within a target sequence of the gene of interest, (b) delayed onset of the disorder, (c) increased survival of subject, (d) increased progression free survival of a subject, (e) recovery or change in protein function, and (f) reduction in symptoms of the disorder.

[1227] Treating disorders associated with G-to-A mutations can also result in a decrease in the mortality rate of a population of treated subjects in comparison to an untreated population. For example, the mortality rate is decreased by more than 2% (e.g., more than 5%, 10%, or 25%). A decrease in the mortality rate of a population of treated subjects may be measured by any reproducible means, for example, by calculating for a population the average number of disease-related deaths per unit timeAtty Docket No. K199354 1070WO (00038)

[1228] KB-056-PCT following initiation of treatment with a compound or pharmaceutically acceptable salt of a compound described herein. A decrease in the mortality rate of a population may also be measured, for example, by calculating for a population the average number of disease-related deaths per unit time following completion of a first round of treatment with a compound or pharmaceutically acceptable salt of a compound described herein.

[1229] A. Delivery of Oligonucleotides

[1230] The delivery of an oligonucleotide described herein to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a disorder) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an oligonucleotide described herein either in vitro or in vivo, and can be performed ex vivo. In vivo delivery may also be performed directly by administering a composition including an oligonucleotide to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the oligonucleotide. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAcs ligand, or any other ligand that directs the oligonucleotide to a site of interest. Cells can include those of the central nervous system, or muscle cells. These alternatives are discussed further below.

[1231] Contacting of a cell with an oligonucleotide may be done in vitro or in vivo or ex vivo. For in vivo delivery, factors to consider in order to deliver an oligonucleotide molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an oligonucleotide can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the oligonucleotide molecule to be administered.

[1232] For administering an oligonucleotide systemically for the treatment of a disease, the oligonucleotide can include alternative nucleobases, alternative sugar moieties, and / or alternative intemucleotide linkages, or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the oligonucleotide by endo- and exo-nucleases in vivo. Modification of the oligonucleotide or the pharmaceutical carrier can also permit targeting of the oligonucleotide composition to the target tissue and avoid undesirable off-target effects. Oligonucleotide molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the oligonucleotide can be deliveredAtty Docket No. K199354 1070WO (00038)

[1233] KB-056-PCT using drug delivery systems such as a nanoparticle, a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an oligonucleotide molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an oligonucleotide by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an oligonucleotide, or induced to form a vesicle or micelle that encases an oligonucleotide. The formation of vesicles or micelles further prevents degradation of the oligonucleotide when administered systemically. In general, any methods of delivery of nucleic acids known in the art may be adaptable to the delivery of the oligonucleotides described herein. Methods for making and administering cationic oligonucleotide complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9: 1291-1300; Arnold, A S et al., (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of oligonucleotides include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T S. et al., (2006) Nature 441: 111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26: 1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, an oligonucleotide forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of oligonucleotides and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety. In some embodiments the oligonucleotides described herein are delivered by polyplex or lipoplex nanoparticles. Methods for administration and pharmaceutical compositions of oligonucleotides and polyplex nanoparticles and lipoplex nanoparticles can be found in U.S. Patent Application Nos. 2017 / 0121454; 2016 / 0369269; 2016 / 0279256; 2016 / 0251478; 2016 / 0230189; 2015 / 0335764; 2015 / 0307554; 2015 / 0174549; 2014 / 0342003; 2014 / 0135376; and 2013 / 0317086, which are herein incorporated by reference in their entirety.

[1234] i. Membranous Molecular Assembly Delivery Methods

[1235] Oligonucleotides described herein can also be delivered using a variety of membranous molecular assembly delivery methods including polymeric, biodegradable microparticle, or microcapsule delivery devices known in the art. For example, a colloidal dispersion system may be used for targeted delivery an oligonucleotide agent described herein. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Liposomes are artificial membraneAtty Docket No. K199354 1070WO (00038)

[1236] KB-056-PCT vesicles that are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 pm can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the oligonucleotide are delivered into the cell where the oligonucleotide can specifically bind to a target RNA and can mediate RNase H-mediated gene silencing. In some cases, the liposomes are also specifically targeted, e.g., to direct the oligonucleotide to particular cell types. The composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.

[1237] A liposome containing an oligonucleotide can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The oligonucleotide preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the oligonucleotide and condense around the oligonucleotide to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of oligonucleotide.

[1238] If necessary, a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to favor condensation. Methods for producing stable oligonucleotide delivery vehicles, incorporating a oligonucleotide / cationic lipid complex as a structural component of the delivery vehicle, are further described in, e.g., WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U.S. Pat. No. 4,897,355; U.S. Pat. No.

[1239] 5,171,678; Bangham et al., (1965) M. Mol. Biol. 23:238; Olson et al., (1979) Biochim. Biophys. Acta 557:9; Szokaet al., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga et al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858: 161. Microfluidization can be used when consistently small (50Atty Docket No. K199354 1070WO (00038)

[1240] KB-056-PCT to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169. These methods are readily adapted to packaging oligonucleotide preparations into liposomes.

[1241] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid / liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).

[1242] Liposomes entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).

[1243] One major type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and / or phosphatidylcholine and / or cholesterol.

[1244] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. No.

[1245] 5,283,185; U.S. Pat. No. 5,171,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Feigner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11:417.

[1246] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems including non-ionic surfactant and cholesterol. Non-ionic liposomal formulations including NOVASOME™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and NOVASOME™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) S.T.P. Pharma. Sci., 4(6) :466) .Atty Docket No. K199354 1070WO (00038)

[1247] KB-056-PCT Liposomes may also be sterically stabilized liposomes, including one or more specialized lipids that result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.

[1248] Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) includes one or more glycolipids, such as monosialoganglioside GMI, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).

[1249] Various liposomes including one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., (1987), 507:64) reported the ability of monosialoganglio side GM1, galactocerebroside sulfate, and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., (1988), 85:6949). U.S. Pat. No. 4,837,028 and WO 88 / 04924, both to Allen et al., disclose liposomes including (1) sphingomyelin and (2) the ganglioside GMI or a galactocerebroside sulfate ester. U.S. Pat. No.

[1250] 5,543,152 (Webb et al.) discloses liposomes including sphingomyelin. Liposomes including 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97 / 13499 (Lim et al).

[1251] In some embodiments, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver oligonucleotides to macrophages.

[1252] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated oligonucleotides in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes. A positively charged synthetic cationic lipid, N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of oligonucleotides (see, e.g., Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).Atty Docket No. K199354 1070WO (00038)

[1253] KB-056-PCT A DOTMA analogue, l,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. LIPOFECTIN™ Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that include positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, l,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

[1254] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5 -carboxy spermylglycine dioctaoleoylamide ("DOGS") (TRANSFECTAM™, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide ("DPPES") (see, e.g., U.S. Pat. No. 5,171,678).

[1255] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol ("DC-Chol") which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopoly lysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.

[1256] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer oligonucleotides into the skin. In some implementations, liposomes are used for delivering oligonucleotides to epidermal cells and also to enhance the penetration of oligonucleotides into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., (1992) Journal of Drug Targeting, vol. 2,405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, R. J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. et al. (1987) Meth. Enzymol. 149:157-176;Atty Docket No. K199354 1070WO (00038)

[1257] KB-056-PCT Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. Y. and Huang, L., (1987) Proc. Natl. Acad. Sci. USA 84:7851-7855).

[1258] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems including non-ionic surfactant and cholesterol. Non-ionic liposomal formulations including Novasome I (glyceryl dilaurate / cholesterol / poly oxyethylene- 10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with oligonucleotide are useful for treating a dermatological disorder.

[1259] The targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Additional methods are known in the art and are described, for example in U.S. Patent Application Publication No. 20060058255, the linking groups of which are herein incorporated by reference.

[1260] Uiposomes that include oligonucleotides can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include oligonucleotides can be delivered, for example, subcutaneously by infection in order to deliver oligonucleotides to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transfersomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[1261] Other formulations amenable to the disclosed oligonucleotides and methods are described in WO 2009 / 086558, and WO 2009 / 088891. WO 2008 / 042973 also describes formulations that are amenable to the present oligonucleotides and methods.

[1262] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many differentAtty Docket No. K199354 1070WO (00038)

[1263] KB-056-PCT types of surfactants, both natural and synthetic, is by the use of the hydrophile / lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[1264] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general, their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[1265] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[1266] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[1267] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.

[1268] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[1269] The oligonucleotide for use in the methods described herein can also be provided as micellar formulations. Micelles are a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

[1270] ii. Lipid Nanoparticle-Based Delivery Methods

[1271] Oligonucleotides described herein may be fully encapsulated in a lipid formulation, e.g., a lipid nanoparticle (LNP), or other nucleic acid-lipid particle. LNPs are extremely useful for systemicAtty Docket No. K199354 1070WO (00038)

[1272] KB-056-PCT applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00 / 03683. The particles typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No.

[1273] 2010 / 0324120 and PCT Publication No. WO 96 / 40964.

[1274] In some embodiments, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to oligonucleotide ratio) will be in the range of from about 1 : 1 to about 50:1, from about 1 : 1 to about 25:1, from about 3 : 1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part described herein. Non-limiting examples of cationic lipid include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N— (I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N— (I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), l,2-DiUinoleyloxy-N,N-dimethylaminopropane (DUinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DUenDMA), l,2-Dilinoleylcarbamoyloxy-3 -dimethylaminopropane (DLin-C-DAP), l,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DUin-DAC), 1,2-Dilinoley oxy-3 -morpholinopropane (DUin-MA), l,2-Dilinoleoyl-3 -dimethylaminopropane (DUinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DUin-S-DMA), l-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DUin-2-DMAP), l,2-Dilinoleyloxy-3 -trimethylaminopropane chloride salt (DUin-TMA.Cl), l,2-Dilinoleoyl-3 -trimethylaminopropane chloride salt (DUin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DUin-MPZ), or 3-(N,N-Dilinoleylamino)-l,2-propanediol (DUinAP), 3-(N,N-Dioleylamino)-l,2-propanedio (DOAP), l,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DUin-EG-DMA), 1 ,2-Dilinolenyloxy-N,N-dimethylaminopropane (DUinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane (DEin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z, 12Z)-octadeca-9, 12-dienyetetrahydro— 3aH-cyclopenta[d][l,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu- tanoate (MC3), l,l'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami- no)ethyl)piperazin-l-yeethylazanediyedidodecan-2-ol (Tech Gl), or a mixture thereof. The cationic lipid can include, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.Atty Docket No. K199354 1070WO (00038)

[1275] KB-056-PCT The ionizable / non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl -phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane- 1 -carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl -phosphatidyl -ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, 1 -stearoyl -2 -oleoyl -phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The noncationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.

[1276] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (G2), a PEG-dimyristyloxypropyl (G4), a PEG-dipalmityloxypropyl (Cie), or a PEG-distearyloxypropyl (C]s). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

[1277] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.

[1278] III. Pharmaceutical Compositions

[1279] The oligonucleotides described herein are preferably formulated into pharmaceutical compositions for administration to human subjects in a biologically compatible form suitable for administration in vivo. The oligonucleotides described herein may be administered, for example, by oral, parenteral, intrathecal, intracerebroventricular, intraparenchymal, buccal, sublingual, nasal, rectal, patch, pump, intratumoral, or transdermal administration and the pharmaceutical compositions formulated accordingly. Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, intracerebroventricular, intraparenchymal, rectal, and topical modes of administration. Parenteral administration may be by continuous infusion over a selected period of time.

[1280] An oligonucleotide described herein may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard- or soft-shell gelatin capsules, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, an oligonucleotide described herein may be incorporated with an excipient and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions,Atty Docket No. K199354 1070WO (00038)

[1281] KB-056-PCT syrups, and wafers. An oligonucleotide described herein may also be administered parenterally. Solutions of an oligonucleotide described herein can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO, and mixtures thereof with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington’s Pharmaceutical Sciences (2012, 22nd ed.) and in The United States Pharmacopeia: The National Formulary (USP 41 NF 36), published in 2018. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that may be easily administered via syringe. Compositions for nasal administration may conveniently be formulated as aerosols, drops, gels, and powders. Aerosol formulations typically include a solution or fine suspension of the active substance in a physiologically acceptable aqueous or non-aqueous solvent and are usually presented in single or multidose quantities in sterile form in a sealed container, which can take the form of a cartridge or refill for use with an atomizing device. Alternatively, the sealed container may be a unitary dispensing device, such as a single dose nasal inhaler or an aerosol dispenser fitted with a metering valve which is intended for disposal after use. Where the dosage form includes an aerosol dispenser, it will contain a propellant, which can be a compressed gas, such as compressed air or an organic propellant, such as fluorochlorohydrocarbon. The aerosol dosage forms can also take the form of a pump-atomizer. Compositions suitable for buccal or sublingual administration include tablets, lozenges, and pastilles, where the active ingredient is formulated with a carrier, such as sugar, acacia, tragacanth, gelatin, and glycerine. Compositions for rectal administration are conveniently in the form of suppositories containing a conventional suppository base, such as cocoa butter. An oligonucleotide described herein may be administered intratumorally, for example, as an intratumoral injection. Intratumoral injection is injection directly into the tumor vasculature and is specifically contemplated for discrete, solid, accessible tumors. Uocal, regional, or systemic administration also may be appropriate.

[1282] The oligonucleotides described herein may be administered to an animal, e.g., a human, alone or in combination with pharmaceutically acceptable carriers, as noted herein, the proportion of which is determined by the solubility and chemical nature of the oligonucleotide, chosen route of administration, and standard pharmaceutical practice.

[1283] IV. Dosages

[1284] The dosage of the compositions (e.g., a composition including an oligonucleotide) described herein, can vary depending on many factors, such as the pharmacodynamic properties of the compound; the mode of administration; the age, health, and weight of the recipient; the nature and extent of theAtty Docket No. K199354 1070WO (00038)

[1285] KB-056-PCT symptoms; the frequency of the treatment, and the type of concurrent treatment, if any; and the clearance rate of the compound in the animal to be treated. One of skill in the art can determine the appropriate dosage based on the above factors. The compositions described herein may be administered initially in a suitable dosage that may be adjusted as required, depending on the clinical response. In some embodiments, the dosage of a composition (e.g., a composition including an oligonucleotide) is a prophylactically or a therapeutically effective amount.

[1286] V. Kits

[1287] Provided herein are kits including (a) a pharmaceutical composition including an oligonucleotide that results in deamination of an adenosine in an mRNA in a cell or subject described herein, and (b) a package insert with instructions to perform any of the methods described herein. In some embodiments, the kit includes (a) a pharmaceutical composition including an oligonucleotide that results in deamination of an adenosine in an mRNA in a cell or subject described herein, (b) an additional therapeutic agent, and (c) a package insert with instructions to perform any of the methods described herein.

[1288] Embodiments:

[1289] 1. A method of improving or restoring an acute phase response to an infection in a subject who is homozygous for a Z A1AT allele comprising:

[1290] administering to the subject an oligonucleotide composition capable of editing a target adenosine to an inosine in SERPINA1 DNA or mRNA such that, when translated, the SERPINA1 mRNA produces an M form of Al AT protein; the produced M Al AT protein facilitating the inhibition of neutrophil elastase activity to improve or restore the acute phase response to an infection in the subject.

[1291] 2. The method of embodiment 1, wherein the oligonucleotide composition edits SERPINA1 DNA.

[1292] 3. The method of embodiment 1, wherein the oligonucleotide composition edits SERPINA1 mRNA.

[1293] 4. The method of embodiment 3, wherein the oligonucleotide composition comprises an oligonucleotide having the structure:

[1294] [AJ-X’-X^X^Bn]

[1295] wherein

[1296] each A and B comprises a nucleobase, a sugar (“an A / B sugar”), and an intemucleotide linkage;

[1297] each A / B sugar is independently a 2 ’-methoxyribose, a 2 ’-methoxy ethylribose, a 2’-deoxy-2’fluororibose, a 2’-fluoroarabinose, or a 2 ’-deoxyribose;

[1298] m is 20 to 40;Atty Docket No. K199354 1070WO (00038)

[1299] KB-056-PCT n is 4 to 15;

[1300] X1comprises (i) a nucleobase selected from uracil and thymine, (ii) a 2 ’deoxyribose sugar, and (iii) an intemucleotide linkage;

[1301] N

[1302] O— L

[1303] X2comprises a structure

[1304]

[1305] of and an intemucleotide linkage, wherein N is a nucleobase;

[1306] X3comprises (i) a nucleobase selected from guanosine, hypoxanthine, and 7-deazaguinine, (ii) a sugar selected from 2 ’-deoxyribose and 2’-deoxy-2’-fluoroarabinose, and (iii) an intemucleotide linkage; and

[1307] the intemucleotide linkages of the oligonucleotide comprise at least 30% phosphoramidate and / or phosphorothioate linkages.

[1308] 5. The method of embodiment 4, wherein N is a pyrimidine.

[1309] 6. The method of embodiment 4 or 5, wherein N is cytosine.

[1310] 7. The method of any one of claims 4 to 6, wherein the intemucleotide linkages comprise 0% phosphoramidate linkages.

[1311] 8. The method of any one of embodiments 4 to 6, wherein the intemucleotide linkages comprise 10-15% phosphoramidate linkages.

[1312] 9. The method of any one of embodiments 4 to 8, wherein the intemucleotide linkages comprise 35-70% phosphorothioate linkages.

[1313] 10. The method of any one of embodiments 4 to 9, wherein the intemucleotide linkages comprise at least 50% phosphorothioate linkages.

[1314] 11. The method of any one of embodiments 4 to 10, wherein the intemucleotide linkage between X1and X2is a phosphorothioate.

[1315] 12. The method of any one of embodiments 4 to 11, wherein the intemucleotide linkage between X2and X3is a phosphorothioate.

[1316] 13. The method of any one of embodiments 4 to 12, wherein the intemucleotide linkage between X1and X2is a phosphorothioate, and the intemucleotide linkage between X2and X3is a phosphorothioate .

[1317] 14. The method of any one of embodiments 4 to 13, wherein 45-75% of the A / B sugars are 2 ’-methoxyribose.

[1318] 15. The method of any one of embodiments 4 to 14, wherein 20-60% of the A / B sugars are 2 ’-deoxy-2’ -fluororibose.Atty Docket No. K199354 1070WO (00038)

[1319] KB-056-PCT 16. The method of any one of embodiments 4 to 15, wherein no A / B sugar is a 2’-deoxyribose.

[1320] 17. The method of any one of embodiments 4 to 16, wherein no A / B sugar is a 2’-methoxyethylribose .

[1321] 18. The method of any one of embodiments 4 to 17, wherein m is 23 to 35.

[1322] 19. The method of embodiment 18, wherein m is 30.

[1323] 20. The method of embodiment 19, wherein [Am] has a sequence of SEQ ID NO: 142 (AAC AUG GCC CCA GCA GCU UCA GUC CCU UUC) or SEQ ID NO: 143 (AAC AUG GCC CCA GCA GCU UCA GUU CCU UUC) or SEQ ID NO: 144 (AAC AUG GCU CCA GCA GUU UCA GUU CCU UUC).

[1324] 21. The method of any one of embodiments 4 to 20, wherein n is 8 to 10.

[1325] 22. The method of embodiment 21, wherein n is 9.

[1326] 23. The method of embodiment 22, wherein [Bn] has a sequence UCG AUG GUC. 24. The method of any one of embodiments 20 to 23, having 4-7 phosphoramidate linkages.

[1327] 25. The method of any one of embodiments 20 to 24, having 14-30 phosphorothioate linkages.

[1328] 26. The method of any one of embodiments 20 to 25, wherein 11-20 A / B sugars are 2’-deoxy-2 ’ -fluororibose .

[1329] 27. The method of any one of embodiments 20 to 26, wherein 18-29 A / B sugars are 2’-methoxyribose.

[1330] 28. The method of any one of embodiments 1 to 27, wherein the oligonucleotide is sufficiently complementary to part of the target Al AT mRNA to form a complex with the target Al AT mRNA, such that, upon formation of the complex with the target Al AT mRNA, the nucleotide of the oligonucleotide opposite the target adenosine is X2.

[1331] 29. The method of embodiment 28, capable of binding and recruiting an ADAR enzyme to perform editing on the target adenosine of the target Al AT mRNA.

[1332] 30. The method of any one of embodiments 1 to 29, wherein the oligonucleotide does not comprise a portion that is capable of forming an intramolecular stem-loop structure.

[1333] 31. The method of any one of embodiments 3 and 28-30, wherein the oligonucleotide comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 1-141 and 151-222.

[1334] 32. The method of any one of embodiments 1 to 31, wherein the oligonucleotide of any one of embodiments 1 to 30 complexes with the target SERPINA1 to form a complex, the complex formed by hybridization between the oligonucleotide and the target SERPINA1.

[1335] 33. The method of embodiment 32, wherein the complex comprises 1, 2, 3, 4, or 5 mismatches or wobbles.Atty Docket No. K199354 1070WO (00038)

[1336] KB-056-PCT EXAMPLES

[1337] Example 1 - PiZ mice show limited AAT increase after editor oligonucleotide treatment and LPS-induced inflammatory response

[1338] The main cytokine responsible for initiating secretion of acute phase reactants from the liver is IL-6. IL-6 treatment, along with the bacterial endotoxin lipopolysaccharide (LPS) can be used experimentally for induction of acute phase markers from cells in vitro. To mimic a patient undergoing an APR while on RNA editing therapy. In vivo, the model of acute phase response used was the C57BL / 6-PiZ mouse stimulated with LPS. Similar to human patients, SERPINA1 expression and / or AAT protein secretion and neutrophil elastase inhibition increases in these models.

[1339] Mice were enrolled and bled via submandibular puncture 3 days prior to dosing. Blood was collected into a SST and processed to serum. Blood for serum was kept at room temperature and allowed to clot for 30 minutes. The clotted blood was centrifuged for 10 minutes at 2,000 x g, then serum decanted and stored at -80°C. On Day 0, C57BL / 6-PiZ mice received 0 or 2 mg / kg Oligo #7 in a lipid nanoparticle (LNP) as a single intravenous (IV) dose. On Day 2, mice were dosed intraperitoneal (IP) with vehicle or 300 ug / kg LPS then monitored for 90 minutes for signs of acute toxicity. Mice were bled 6 hours post challenge via submandibular bleed and blood was processed to serum as before. Animals were euthanized via CO2 asphyxiation in accordance with IACUC guidelines. At termination, terminal blood was collected via cardiac puncture with 1-mL tuberculin syringes with 25-gauge needles attached. After removing the needle from the syringe, the collected blood was placed into a SST and processed for serum separation as before. Serum was separated into 3 aliquots and stored at -80°C.

[1340] SERPINA1 expression was analyzed by multiplexed digital PCR. Primers and probes were designed for ACTB and SERPINA1 in the 3'UTR region as listed in Table 2 below. Lor the probes of Table 2, “5ATTO550N” refers to a 5' ATTO™ 550 fluorophore; “5HEX” refers to 5 '-hexachlorofluorescein fluorophore; “ZEN” refers to a ZEN™ internal quencher; and “3IABkFQ” refers to 3' Iowa Black® FQ quencher. The multiplex reaction mix containing the QIAcuity Probe PCR kit (QIAGEN 250103), primers and probes, cDNA, and Molecular Grade Water was added into the QIAcuity Nanoplate 8.5k 96-well (QIAGEN 250021). A common threshold was set per probe channel on one dimensional scatterplot to separate positive and negative partition clusters. The QIAcuity software analysis function determines a concentration (copies / uL) value for each target. Within each well, the concentration (copies / uL) of SERPINA1 over concentration (copies / uL) of ACTB was calculated. The average (SERPINA1 / ACTB) of the negative control group was then calculated. To analyze relative expression of SERPINA1 to the negative control, the samples (SERPINA1 / ACTB) was calculated over the average of the control group.Atty Docket No. K199354 1070WO (00038)

[1341] KB-056-PCT Table 2. Primers and Probes

[1342] Target Forward primer Probe(s) Reverse primer SERPINA ccaagtctcccctcttcatg / 5ATTO550N / CCA CCC AAA / ZEN / atgtcatccagggagggg (SEQ ID 1 E342K (SEQ ID NO: 228) AAT AAC TGC CTC TCG CTC NO: 230)

[1343] 3 ’UTR CTC / 3IABkFQ / (SEQ ID NO: 229)

[1344] M. ctcctaagaggaggatggt / 5HEX / CACAGAAGC / ZEN / AATGC gacctgggccattcagaaat (SEQ ID ACTIN eg (SEQ ID NO: T GTCACCTTCCCC / 3IABkFQ / (SEQ NO: 233)

[1345]

[1346] 231) ID NO: 232)

[1347] Serum collected from C57BL / 6-PiZ mice were diluted and treated with 0.1M methylamine (Thermo Fisher), then incubated with Human neutrophil elastase (Athens Research 16-14-051200) for 1 hour at 37°C. Neutrophil elastase substrate (Sigma M4765) was added and kinetic optical density at 405 nM was measured over 30 min. Functional AAT concentration in pM was calculated from a standard curve of AAT purified from human plasma (Athens Research 16-16-011609).

[1348] The expression levels of SERPINA1 did not differ between the oligonucleotide (oligo 7) treated mice and the vehicle treated mice (Figure 1). However, when the mice were challenged with LPS, they did increase secretion of functional AAT M protein (Figure 2). These results demonstrate that RNA editing oligos and editing of the Z-allele of AAT restores the acute phase response mediated by LPS.

[1349] Example 2 - Elevated functional AAT levels following editor oligonucleotide treatment and LPS

[1350] C57BL / 6J PiZ in vivo serum samples were analyzed for levels of T-AAT, M-AAT and Z-AAT. In short, quantitative analysis was conducted on a Sciex Triple Quad 5000 or 7500 (AB Sciex, Thornhill, Ontario, Canada) attached to an Acquity ultraperformance LC system (Waters Corp., Milford, MA). The aqueous and organic mobile phases consisted of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B), respectively. Samples were eluted through an Acquity UPLC column HSS T3 1.8 pm (2.1 mm x 100 mm) following a 9-minute gradient at a flow rate of 0.3 mL / min, with 0% B to 35% over 6.5 minutes, to 95% B held from 6.7 to 7.7 min. Multiple reaction monitoring analysis was performed in positive ionization mode to quantify levels of T-AAT using surrogate peptide SASLHLPK (SEQ ID NO: 234) (426.8a694.4), M-AAT using surrogate peptide AVLTIDEK (SEQ ID NO: 235) (444.8a718.4) and Z-AAT using surrogate peptide AVLTIDK (SEQ ID NO: 236) (380.2a589.4). Isotope labeled internal standards containing13Ce15N-leucine, were used to generate peak area ratios. Lower limit of quantitation was 0.1 nM for AVLTIDEK (SEQ ID NO: 235) and AVLTIDK (SEQ ID NO: 236), 0.2 nM for SASLHLPK (SEQ ID NO: 234), and 0.5 nM for AVHEAVLTIDEK (SEQ ID NO: 237).

[1351] Serum collected from C57BL / 6-PiZ mice were diluted and treated with 0.1M methylamine (Thermo Fisher), then incubated with Human neutrophil elastase (Athens Research 16-14-051200) for 1 hour at 37°C. Neutrophil elastase substrate (Sigma M4765) was added and kinetic optical density at 405 nMAtty Docket No. K199354 1070WO (00038)

[1352] KB-056-PCT was measured over 30 min. Functional AAT in pM was calculated from a standard curve of AAT purified from human plasma (Athens Research 16-16-011609).

[1353] The data demonstrate that more functional M AAT protein was secreted in PiZ mice treated with an editor oligonucleotide and challenged with LPS (Figure 3A). Further, the ability of the secreted AAT to inhibit neutrophile elastase was increased in response to LPS in mice treated with RNA editing oligos directed at the Z-allele for AAT (Figure 3B).

[1354] Example 3 - LNP delivered oligonucleotides, but not GalN Ac-conjugated oligonucleotides, enable RNA editing in ZZ patient derived monocytes

[1355] Whole blood samples were taken from individual ZZ patient donors. In short, the peripheral blood mononuclear cell (PBMC) fraction was isolated using a Lymphoprep protocol after which the patient-derived PBMCs were resuspended in MACS buffer. Patient-derived monocytes were then isolated from the PBMC fraction by binding of CD 14 beads and a series of centrifugation steps. Purified patient-derived monocytes (CD 14+) were then resuspended in media for subsequent treatment.

[1356] Oligonucleotides were delivered to isolated patient-derived monocytes via lipid nanoparticle (LNP) formulation or GalNAc-conjugation. For LNP delivery, patient-derived monocytes were incubated with 500nM, lOOnM, or OnM (control) of oligonucleotide KB-20794 (Oligo No. 3; SEQ ID NO: 5) formulated in a LNP (prepared similar to Example 1) in media for 48hrs. For GalNAc delivery, patient-derived monocytes were incubated with lOOnM oligonucleotide KB-9486 (Oligo No. 199; SEQ ID NO: 223) for 48 hrs to mediate free uptake. PiZ mouse hepatocytes (isolated from mice described in Example 1) incubated with 100 nM, lOnM or 2nM of KB-9486 for 48 hrs were included as a control to demonstrate that the GalN Ac-conjugated oligonucleotide facilitates editing in hepatocytes in a dose-dependent manner. Editing of SERPINA1 was evaluated as outlined in Example 1 (e.g., dPCR, 48 hrs, n = 3).

[1357] LNP -delivered oligonucleotides demonstrated robust editing of SERPINA1 in patient-derived monocytes isolated from five individual ZZ patients (“203”; “204”; “90B”; “22D”; and “8E”) in a dose-dependent manner (Figure 4A), while GalN Ac-conjugated oligonucleotide targeting the same region in SERPINA1 did not facilitate editing in monocytes derived from the same individuals (Figure 4B). The lack of editing in monocytes from ZZ patients is consistent with absence of ASGP Receptor expression in monocytes.

[1358] These results demonstrate that LNP delivery enabled RNA editing in patient-derived monocytes. Without wishing to be bound by theory, it is believed that editing of monocytes via LNP delivery is enabled due to monocytes' LDLR receptor expression, a capability GalNAc conjugation would not provide, as described above. This establishes monocytes as possible additional source of edited M-AAT production, with potential implications for local alveolar macrophages in the lungs to similarly contribute therapeutic AAT at sites of inflammation.

Claims

1. Atty Docket No. K199354 1070WO (00038)KB-056-PCT What is claimed is:

1. A method of improving or restoring an acute phase response to an infection in a subject who is homozygous for a Z A1AT allele comprising:administering to the subject an oligonucleotide composition capable of editing a target adenosine to an inosine in SERPINA1 DNA or mRNA such that, when translated, the SERPINA1 mRNA produces an M form of Al AT protein; the produced M Al AT protein facilitating the inhibition of neutrophil elastase activity to improve or restore the acute phase response to an infection in the subject.

2. The method of claim 1, wherein the oligonucleotide composition edits SERPINA1 DNA.

3. The method of claim 1, wherein the oligonucleotide composition edits SERPINA1 mRNA.

4. The method of claim 3, wherein the oligonucleotide composition comprises an oligonucleotide having the stmcture:[Am]-X1-X2-X3-[Bn]whereineach A and B comprises a nucleobase, a sugar (“an A / B sugar”), and an intemucleotide linkage;each A / B sugar is independently a 2 ’-methoxyribose, a 2’-methoxyethylribose, a 2’-deoxy-2’fluororibose, a 2 ’-fluoroarabinose, or a 2 ’-deoxyribose;m is 20 to 40;n is 4 to 15;X1comprises (i) a nucleobase selected from uracil and thymine, (ii) a 2 ’deoxyribose sugar, and (iii) an intemucleotide linkage;X2comprises a structureof and an intemucleotide linkage, wherein N is a nucleobase;X3comprises (i) a nucleobase selected from guanosine, hypoxanthine, and 7-deazaguinine, (ii) a sugar selected from 2 ’-deoxyribose and 2 ’-deoxy-2’ -fluoroarabinose, and (iii) an intemucleotide linkage; andthe intemucleotide linkages of the oligonucleotide comprise at least 30% phosphoramidate and / or phosphorothioate linkages.

5. The method of claim 4, wherein N is a pyrimidine.Atty Docket No. K199354 1070WO (00038)KB-056-PCT 6. The method of claim 4 or 5, wherein N is cytosine.

7. The method of any one of claims 4 to 6, wherein the intemucleotide linkages comprise 0% phosphoramidate linkages.

8. The method of any one of claims 4 to 6, wherein the intemucleotide linkages comprise 10-15% phosphoramidate linkages.

9. The method of any one of claims 4 to 8, wherein the intemucleotide linkages comprise 35-70% phosphorothioate linkages.

10. The method of any one of claims 4 to 9, wherein the intemucleotide linkages comprise at least 50% phosphorothioate linkages.

11. The method of any one of claims 4 to 10, wherein the intemucleotide linkage between X1and X2is a phosphorothioate.

12. The method of any one of claims 4 to 11, wherein the intemucleotide linkage between X2and X3is a phosphorothioate.

13. The method of any one of claims 4 to 12, wherein the intemucleotide linkage between X1and X2is a phosphorothioate, and the intemucleotide linkage between X2and X3is a phosphorothioate .

14. The method of any one of claims 4 to 13, wherein 45-75% of the A / B sugars are 2’-methoxyribose.

15. The method of any one of claims 4 to 14, wherein 20-60% of the A / B sugars are 2’-deoxy-2 ’ -fluororibose .

16. The method of any one of claims 4 to 15, wherein no A / B sugar is a 2 ’-deoxyribose.

17. The method of any one of claims 4 to 16, wherein no A / B sugar is a 2’-methoxy ethylribose .

18. The method of any one of claims 4 to 17, wherein m is 23 to 35.

19. The method of claim 18, wherein m is 30.

20. The method of claim 19, wherein [Am] has a sequence of SEQ ID NO: 142 (AAC AUG GCC CCA GCA GCU UCA GUC CCU UUC) or SEQ ID NO: 143 (AAC AUG GCC CCA GCA GCU UCA GUU CCU UUC) or SEQ ID NO: 144 (AAC AUG GCU CCA GCA GUU UCA GUU CCU UUC).

21. The method of any one of claims 4 to 20, wherein n is 8 to 10.

22. The method of claim 21, wherein n is 9.

23. The method of claim 22, wherein [Bn] has a sequence UCG AUG GUC.

24. The method of any one of claims 20 to 23, having 4-7 phosphoramidate linkages.

25. The method of any one of claims 20 to 24, having 14-30 phosphorothioate linkages.

26. The method of any one of claims 20 to 25, wherein 11-20 A / B sugars are 2’-deoxy- 2 ’-fluororibose.Atty Docket No. K199354 1070WO (00038)KB-056-PCT 27. The method of any one of claims 20 to 26, wherein 18-29 A / B sugars are 2’-methoxyribose.

28. The method of any one of claims 1 to 27, wherein the oligonucleotide is sufficiently complementary to part of the target Al AT mRNA to form a complex with the target Al AT mRNA, such that, upon formation of the complex with the target Al AT mRNA, the nucleotide of the oligonucleotide opposite the target adenosine is X2.

29. The method of claim 28, capable of binding and recruiting an ADAR enzyme to perform editing on the target adenosine of the target Al AT mRNA.

30. The method of any one of claims 1 to 29, wherein the oligonucleotide does not comprise a portion that is capable of forming an intramolecular stem-loop structure.

31. The method of any one of claims 3 and 28-30, wherein the oligonucleotide comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 1-141 and 151-222.

32. The method of any one of claims 1 to 31, wherein the oligonucleotide of any one of embodiments 1 to 30 complexes with the target SERPINA1 to form a complex, the complex formed by hybridization between the oligonucleotide and the target SERPINA1.

33. The method of claim 32, wherein the complex comprises 1, 2, 3, 4, or 5 mismatches or wobbles.

Images