Triphasic optical sensing for chemical measurements without matrix effect and optical interference

Abstract

Methods and systems of triphasic optical sensing are provided. The methods and systems are used for the measurement of analytes in a manner that is free of a matrix effect and / or optical interference.

Description

[0001] -IL- TRIPHASIC OPTICAL SENSING FOR CHEMICAL MEASUREMENTS WITHOUT MATRIX EFFECT AND OPTICAL INTERFERENCE

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 63 / 777,818 filed March 26, 2025.

[0004] SEQUENCE LISTING

[0005] This application includes as the Sequence Listing the complete contents of the accompanying text file “02941819TA_sequence_listing", created March 25, 2026, containing 5,436 bytes, hereby incorporated by reference.

[0006] BACKGROUND OF THE INVENTION

[0007] Field of the Invention

[0008] This invention generally relates to assay systems and methods for detecting analytes. In particular, the invention provides triphasic optical sensing for the measurement of analytes; the methods and systems reduce matrix effect and / or optical interference by separating the assay from the sample.

[0009] State of Technology

[0010] There are a wide variety of optical assays for detecting chemical and biochemical analytes in diverse sample matrices. However, many sample types require preprocessing before they can be directly combined with sensing components for optical detection. For example, when blood is used as the sample, plasma is typically separated from whole blood and then subjected to significant dilution using a diluent optimized for the specific optical assay. Without such preprocessing, incompatibilities between the sample matrix and the assay conditions may adversely affect the assay. The inherent color, turbidity, and autofluorescence of biological samples can interfere with the optical signals generated by sensing reagents. In addition, matrix components such as high protein content, elevated ionic strength, and physiological pH conditions may be suboptimal for interactions between the analyte and sensing components. Although preprocessing steps such as separation and dilution improve compatibility, they increase assay complexity, reduce convenience, andlimit suitability for point-of-care testing and continuous monitoring applications. These steps may also require larger sample volumes, which is undesirable when the available sample is limited or valuable.

[0011] It would be advantageous to have available assay systems and methods that eliminate or reduce such incompatibilities and that require little or no sample preprocessing.

[0012] SUMMARY OF THE INVENTION

[0013] The present disclosure provides assay systems and methods that eliminate or reduce the incompatibilities of the prior art. The assay systems and methods require little or no sample preprocessing prior to optical detection. Rather than directly mixing the sensing components with the sample, the system includes an organic phase that physically separates two aqueous phases: a sample phase containing the analyte and a sensing phase containing one or more sensing components. The analyte is transported from the sample phase, through the organic phase and then into the sensing phase. Such transport may occur via mechanisms including, but not limited to, concentration gradients, partition-driven diffusion, facilitated transport, ion exchange, or carrier-mediated interactions. Transport is optionally selective, e.g. via carrier-mediated transport. Upon reaching the sensing phase, the analyte interacts with the sensing components to induce or produce an optical response, such as a change in absorbance, fluorescence, or luminescence, which is detected by an optical detector.

[0014] Because optical detection is performed in the sensing phase rather than in the sample phase, interference arising from sample color, turbidity, and autofluorescence is decreased or eliminated.

[0015] Furthermore, the chemical environment of the sensing phase can be independently optimized without being constrained by the composition of the sample. For example, if an optical assay requires alkaline conditions, the sensing phase may be formulated at an elevated (alkaline) pH regardless of the pH of the sample. Similarly, if low ionic strength is required for optimal assay performance, the sensing phase may be formulated with a reduced salt concentration independent of the salt content of the sample.

[0016] In addition to improving compatibility between the sample and assays, the triphasic configuration may enhance selectivity. Beyond the intrinsic selectivity of the sensing chemistry itself, analyte transport across the organic phase provides an additional discrimination step, as potential interferents may be less favorably extracted into the organicphase or less efficiently transported into the sensing phase, or even actively transported across the organic phase via a carrier, compared to the target analyte.

[0017] An exemplary system comprises a channel or other structure. Generally, such exemplary structure has a body material (or materials) which are solid and shaped to retain liquids. A microfluidic structure like a microfluidic channel may be configured (e.g., shaped and sized) to cause movement of a liquid when the liquid is inside the channel. In addition or in the alternative, a structure of some exemplary apparatuses may be configured simply to hold (i.e., retain) a liquid absent external forces, e.g., a pressure differential established between different parts (e.g., different ends) of the structure, which cause movement of liquid (or liquids, as the case may be) inside the structure.

[0018] For convenience and clarity of discussion, this description frequently employs the term “structure” in the singular. It should be appreciated that such description is not generally intended to require only a single structure. Rather, when “structure” is used, it should be appreciated that “at least one structure” is the intended meaning. The phrase “at least one structure” is also interchangeable with “one or more structures”. The word “structure” may be qualified as a “microfluidic” structure where applicable.

[0019] For convenience and clarity of discussion, this description frequently employs the term “channel” in the singular. It should be appreciated that such description is not generally intended to require only a single channel. Rather, when “channel” is used, it should be appreciated that “at least one channel” is the intended meaning. The phrase “at least one channel” is also interchangeable with “one or more channels”. A “channel” is in some embodiments a microfluidic channel. In some embodiments, however, a “channel” is not necessarily “microfluidic” in nature. Generally, “channel” is used herein to describe a solid structure that may be configured as microfluidic or configured larger in size than implied by the term microfluidic.

[0020] An exemplary system is for sensing at least one analyte. Sensing at least one analyte generally entails sensing (i.e., detecting) at least the presence of the at least one analyte. The output of such a system may be binary in nature, e.g., a positive result meaning the at least one analyte is present, or a negative result meaning the at least one analyte is not present. Generally, presence or absence of an analyte means presence or absence in a sample, even if sensing / detection is directly performed on a sensing phase rather than directly on a sample.In some embodiments, sensing at least one analyte includes additional information besides presence / absence of the analyte. In particular, for some exemplary systems, sensing at least one analyte includes sensing a quantity of the at least one analyte. For example, an exemplary system may determine an amount (e.g., in mols, mg, or the like), concentration, or other metric which characterizes the quantity of the analyte sensed.

[0021] In addition to a microfluidic structure, an exemplary system further includes at least one sensing phase and at least one organic phase. It is advantageous for both the sensing phase and the organic phase to be pre-selected for compatibility with the at least one analyte the sensing (i.e., detection) of which is desirable.

[0022] Different embodiments use different starting arrangements for the sensing phase and organic phase relative the microfluidic structure. As a first example, an exemplary system may be manufactured so that upon completion of the manufacturing process, the microfluidic structure contains the sensing phase, the organic phase, or both the sensing phase and the organic phase. In such a case the microfluidic structure includes at least one opening by which a sample is admittable to the microfluidic structure. The system is configured so that admittance of a sample phase to the opening leads to contact of the sample phase with the organic phase. The organic phase may already be in contact with the sensing phase, or else the organic phase comes into contact with the sensing phase around the same time as the organic phase comes into contact with the sample phase. In any event, the microfluidic structure is configured so that the sensing phase and the sample phase do not come into direct contact with one another.

[0023] Other features and advantages of the present invention will be set forth in the description of invention that follows, and in part will be apparent from the description or may be learned by practicing the invention. The invention will be realized and attained by the compositions and methods particularly pointed out in the written description and claims hereof.

[0024] It is an object of this invention to provide a method of detecting at least one analyte in an aqueous sample, comprising: providing an organic phase and an aqueous sensing phase, wherein the organic phase is in direct contact with and is immiscible with the aqueous sensing phase, and wherein the aqueous sensing phase comprises at least one sensing agent interactive with the at least one analyte to generate a detectable optical signal;contacting the organic phase with the aqueous sample without the aqueous sample and aqueous sensing phase directly contacting one another; maintaining contact of the organic phase with the aqueous sample and aqueous sensing phase for a period of time sufficient to cause the at least one analyte, if present in the aqueous sample, to move through the organic phase and into the sensing phase and interact with the at least one sensing agent;

[0025] and collecting an optical signal from the aqueous sensing phase. In some aspects, the method further comprises mixing the aqueous sample, mixing the organic phase, and / or mixing the sensing phase. In further aspects, the organic phase is an oil, a plasticizer, an ester, an ether, an alcohol, an ionic liquid, a hydrocarbon or a halogenated solvent. In additional aspects, the organic phase contains one or more optional additives: ion exchangers, ionophores, phasetransfer catalysts, boronic acids, host-guest receptors, hydrogen-bonding agents, or a molecule that interacts with the analyte through covalent or non-covalent interactions. In yet further aspects, the at least one sensing reagent is a chemical or biochemical component capable of generating a detectable optical signal upon interaction with the at least one analyte. In additional aspects, the at least one sensing agent is a molecular probe, an aptamer, an enzyme, a chromogenic substrate, a Anorogenic substrate, a nanoparticle-based sensor, a Auorescent reporter, a luminescent reporter, or a combination thereof. In some aspects, the sensing reagent is a molecular probe, an aptamer, an enzyme, a chromogenic substrate, a Anorogenic substrate, a nanoparticle-based sensor, a Auorescent reporter, a luminescent reporter, or a combination thereof. In additional aspects, the at least one detectable optical signal is absorbance, transmittance, reAectance, Auorescence, phosphorescence, chemiluminescence, bioluminescence, or a visually observable color change. In other aspects, the aqueous sample phase is a biological sample and is or comprises one or more of: i) blood, serum, plasma, urine, semen, saliva, sweat, milk, cerebrospinal Auid, interstitial Auid, amniotic Auid; or ii) an extract of skin, biopsy tissue, hair, nail clippings or tumor cells. In further aspects, the aqueous sample phase is a non-biological sample and is or comprises i) sea water, lake water, a pharmaceutical formulation, a chemical reagent, a laboratory- synthesized substance, an industrial / commercial sample from a food product, irrigation water or mine efAuent; or ii) an extract of a textile, fibers, clothing, soil, glass, weapon residue or environmental debris. In yet further aspects, the at least one analyte is a cation, an anion, a zwitterion, a neutral molecule, a metabolite, a drug, a drug metabolite, a neurotransmitter, a hormone, a vitamin, a lipid, or an environmentalcontaminant. In some aspects, the at least one analyte moves via a concentration gradient, partition-driven diffusion, facilitated transport, ion exchange, or carrier-mediated interactions. In yet further aspects, the at least one analyte is a charged analyte and movement across the organic phase is driven or modulated by an applied electric field.

[0026] Also provided is a system for sensing at least one analyte, comprising: a sensing phase comprising at least one sensing reagent that is reactive with the at least one analyte to generate an optical response; an organic phase immiscible with the sensing phase and immiscible with a sample to be tested for the at least one analyte; and a channel with at least one opening by which the sample is admittable to the channel, wherein the organic phase is formulated to enable transport of the at least one analyte, wherein the channel is configured to simultaneously accommodate the sample, the organic phase, and the sensing phase with the organic phase separating and preventing contact between the sample and the sensing phase while enabling transport of the at least one analyte from the sample to the sensing phase. In some aspects, the system further comprises at least one detector configured to detect the optical response from the sensing phase, and / or at least one accelerator configured to accelerate transport of the at least one analyte through the organic phase. In further aspects, the at least one detector is or includes one or more of: spectrophotometers, fluorimeters, photodiodes, photomultiplier tubes (PMTs), avalanche photodiodes (APDs), single-photon counting detectors (SPCs), charge-coupled device (CCD) detectors, complementary metal-oxide-semiconductor (CMOS) sensors, cameras, smartphones, imaging systems, optical readers, or other light-detection devices capable of measuring intensity, wavelength, temporal, or spatial characteristics of the optical signal. In additional aspects, the at least one accelerator is one or more of: at least one vibrator, at least one pump, and and at least one source of or means of generating an electric field. In some aspects, the system comprises one or more reservoirs containing the sensing phase and the organic phase, wherein the channel is loadable with a volume of the sensing phase from the one or more reservoirs and with a volume of the organic phase from the one or more reservoirs. In additional aspects, the channel is preloaded with the sensing phase and the organic phase.

[0027] DESCRIPTION OF THE DRAWINGS

[0028] Figure 1. Introduction of the sample into a channel with loaded organic and sensing phases.-1- Figure 2. Loading of the sensing phase and organic phase and aspiration of the sample phase into the channel.

[0029] Figure 3. Optical detection on the sensing phase.

[0030] Figure 4A and B. Fluorescence-based MDPV detection in plasma (A) and in blood (B) in a triphasic sensing system using a dye displacement assay.

[0031] Figure 5. Fluorescence response of lactate in a triphasic sensing system using enzymatic assays. The fluorescence signal corresponds to the sensing phase measured at an excitation wavelength of 350 nm.

[0032] Figure 6. Colorimetric response of calcium ions in a triphasic sensing system using nanoparticle sensors.

[0033] Figure 7. Colorimetric response of calcium ions in a triphasic sensing system using a molecular probe.

[0034] Figure 8A-C. Fluorescence-based cocaine detection in a triphasic sensing system based on strand displacement assays. The sensing oil is dioctyl sebacate without an additive (A and C). The sample is pH 7.4 buffer in A and B, and whole human blood in C.

[0035] Figure 9. Fluorescence-based blood theophylline detection in a triphasic sensing system based on strand displacement assays.

[0036] Figure 10. A block diagram of an exemplary system for sensing at least one analyte.

[0037] Figure 11. Exemplary microfluidic chip design with a cross junction for generating segmented flow of the sample phase, organic phase, and sensing phase.

[0038] Figure 12 A. Schematic depiction of microfluidic flow segmentation. A three inlet design is chosen for generation of alternating segments of sample, organic (e.g., oil), and sensing fluids. Serpentine channel is intended to enhance fluid mixing withing each segment to increase, e.g., ion transfer and interaction efficiency.

[0039] Figure 12B. General outline of a portable sensing system that comprises a microfluidic chip, an excitation source, a PMT / detector for signal detection, optical filters, a portable pump, and an oil / sensor fluid reservoir.

[0040] DETAILED DESCRIPTION

[0041] The triphasic system disclosed herein comprises at least three discrete liquid phases arranged within a channel or other structure (e.g., fluidic structure). One phase is a samplephase, which is an aqueous solution containing, or suspected of containing, at least one target analyte. As used herein an aqueous phase is any mixture, solution, or liquid where water is the primary solvent dissolving solutes. A second phase is a sensing phase, which is a separate aqueous phase containing one or more sensing reagents capable of generating an optical response upon interaction with an analyte. It is noted that herein, “reagent” and “agent” may be used interchangeably. A third phase is an organic phase that is immiscible with both aqueous phases and positioned between the sample phase and the sensing phase to maintain physical separation between the two phases. However, the organic phase permits one or more analytes of interest to pass through from the sample phase to the sensing phase, i.e. the one or more analytes are able to be transported from the sample, phase, across or through the organic phase and into the sensing phase where they interact with an agent or agents to produce a detectable optical signal.

[0042] Figure 1 depicts, by way of example, introduction of a sample into a channel 100 with preloaded organic and sensing phases. Figure 1 shows both pressure-driven sample aspiration (figure left) and pump-free sample aspiration (figure right). Depictions 151 and 152 show channel 100 preloaded with organic phase and sensing phase. For pressure-driven sample aspiration, a negative pressure source 153 is used to draw sample phase into the channel 100 through opening 154. For pump-free sample aspiration, exposure of opening 154 to the sample may be sufficient to draw the sample into the channel 100.

[0043] Figure 2 depicts, by way of example, a channel 120 that is not preloaded with organic and sensing phases. Rather, the system of Figure 2 includes, prior to use, a channel 120, (a volume of) sensing phase, and (a volume of) organic phase which are physically separate from one another. The sensing phase and organic phase may be provided in respective reservoirs 121 and 122, for example. As Figure 2 shows progressively from figure left to figure right, at the time of use the channel 120 is successively loaded with sensing phase, then with organic phase, then with sample phase. As was the case in Figure 1, the loading may be made by, for example, aspiration of each phase into the channel 120 by a negative pressure source 153.

[0044] This system is a platform technology that can be applied to an unlimited number and type of analytes and sensing chemistries, as long as the analytes are soluble in the sample phase, can be transported into and out of the organic phase into the sensing phase, and can react with an optical sensing agent to generate a detectable signal.SAMPLE PHASE

[0045] In general, the aqueous sample phase is or comprises a sample that contains, is likely to contain, or is suspected of containing at least one analyte of interest. In some aspects, the sample phase is a “raw” or untreated, undiluted sample. In other aspects, the sample phase comprises a sample which is pretreated, e.g. by removing particles and / or by dilution using an aqueous diluent such as a buffer or water.

[0046] In some aspects, the sample phase is or comprises a biological sample. Exemplary biological samples include those that are or contain materials taken from living organisms such as humans, animals, or plants. The samples may be biological fluids and / or medical samples e.g. blood, serum, plasma, urine, saliva, sweat, cerebrospinal fluid, interstitial fluid, amniotic fluid, semen, an extract of tissues (skin, organs), biopsy tissue, hair, nail clippings, tumor cells, nucleic acids (DNA, RNA, etc.), proteins, lipids and the like. In other aspects, the samples are forensic and / or research samples and may or may not be from living organisms, such as: fluids collected from a crime scene, hair, saliva, semen, and / or any of the biological samples listed above or extracts thereof.

[0047] In other aspects, the sample is a non-biological sample such as from non-living, inorganic, or synthetic material that is collected for analysis rather than organic tissues or fluids. Unlike biological samples, these may or may not contain cellular, genetic, or organic materials derived from a living organism. Examples include fibers, clothing, soil, glass, weapons (e.g. swipes from weapons), weapon residue, environmental debris and / or solids (e.g. soil, sediment, or minerals), sea or lake water, pharmaceutical formulations, chemical reagents and / or laboratory-synthesized substances, industrial / commercial samples from food products, textiles, irrigation water, mine effluent, etc.

[0048] If the sample is a solid or semi-solid, it may be placed in an aqueous solution to dissolve or extract the analytes of interest present in or on the sample. In some aspects, the sample contains both biological and non-biological matter.

[0049] If the original or raw sample is diluted or extracted prior to assessment, the diluent (solvent) or extractant is also aqueous. Aqueous diluents include but are not limited to: pure water (generally sterile deionized or distilled water); various buffer solutions such as phosphate-buffered saline (PBS) or Tris buffers, dilute acids or bases such as hydrochloricacid (HC1) or sodium hydroxide (NaOH) solutions, alcohol-water mixtures such as ethanol / water or methanol / water mixtures, aqueous salt solutions such as sodium chloride (NaCl), potassium chloride (KC1) or a sulfate salt in water, and / or surfactant solutions such as solutions containing Brij surfactants or polyvinyl alcohols, and the like. Any aqueous diluent may be used as long as it mixes with / is miscible with the sample and does not affect the outcome of the assay e.g. does not denature the analyte or change the properties of the analyte with respect to entering the organic phase and then the sensing phase, and then reacting with the reporter molecules to generate an optical signal.

[0050] THE ORGANIC PHASE

[0051] The organic phase is or comprises a water-immiscible organic solvent and functions as a transport medium for analyte movement between the sample phase and the sensing phase, wherein analyte transport or movement may occur through one or more mechanisms including, but not limited to, passive diffusion, carrier-mediated transport, interfacial reaction-driven transport, facilitated transport, and coupled transport processes. In some embodiments, transport occurs via partitioning and diffusion of analytes that are soluble in the organic phase, wherein the analyte dissolves into the organic phase and diffuses across the phase driven by a concentration gradient. In some embodiments, the organic phase comprises one or more carrier molecules that reversibly bind the analyte to form a carrieranalyte complex that diffuses through the organic phase and subsequently releases the analyte into the receiving phase; such carriers may include cation exchangers, anion exchangers, neutral carriers, and ionophores, wherein ionophores may function as mobile carriers that complex ions and shuttle them across the organic phase or as channel-forming agents that create transient pathways for ion transport. In some embodiments, transport may occur via charge-neutralization or ion-pair formation, wherein ionic analytes associate with oppositely charged lipophilic counterions to form neutral ion pairs that partition into and diffuse through the organic phase. In some embodiments, transport / movement may involve proton-coupled or ion-coupled mechanisms, including reversible protonation or deprotonation processes that facilitate translocation across the organic phase. In some embodiments, transport may be driven or enhanced by interfacial chemical reactions occurring at the boundary between phases, such that the analyte is converted into a more lipophilic or transportable form at the interface, diffuses through the organic phase, and is subsequently regenerated in the receiving phase. In some embodiments, transport may occurvia facilitated diffusion mechanisms involving reversible binding interactions that lower the energetic barrier for transfer of polar or charged species across the organic phase. In some embodiments, transport may be enhanced by co-transport or exchange processes, including coupled movement of multiple species that improves transport efficiency or selectivity. In some embodiments, transport may also be influenced by electrochemical potential gradients, concentration gradients, or partition coefficients between phases, wherein the driving force for analyte movement is the difference in chemical potential across the phases.

[0052] In some embodiments, transport of charged analytes across the organic phase may be driven or modulated by an applied electric field. The electric field establishes an electric potential gradient across the phases, thereby inducing electrophoretic or electrokinetic migration of charged species through the organic phase. Such electrical control may enhance transport rates, improve selectivity, or enable directional movement of analytes from the sample phase to the sensing phase. The applied electric field may be generated by one or more electrodes or field- generating elements and may be configured as direct current, alternating current, pulsed, or spatially varying fields to optimize analyte transport under different conditions.

[0053] In some embodiments, the organic phase may include one or more functional additives that facilitate analyte transport, partitioning, or selective recognition, including but not limited to boronic acids and boronate derivatives for reversible covalent binding to diol-containing analytes; hydrogen-bond donors and acceptors such as ureas, thioureas, amides, and guanidinium-containing compounds; ion exchangers including lipophilic cation exchangers and anion exchangers; ionophores and neutral carriers including macrocyclic and non-macrocyclic compounds; and host-guest receptors including crown ethers, aza-crown ethers, cryptands, calixarenes, calixpyrroles, cucurbiturils, cyclodextrins, pillararenes, and related supramolecular hosts that facilitate analyte solubilization and transport via non-covalent interactions; in some embodiments, the additives may further include phasetransfer catalysts such as quaternary ammonium salts, phosphonium salts, or sulfonium salts that promote transfer of ionic species into the organic phase; in some embodiments, lipophilic acids or bases, including fatty acids, amines, or proton carriers, may be used to facilitate proton-coupled transport or pH-dependent partitioning; in some embodiments, redox-active mediators such as quinones, phenazines, ferrocene derivatives, or other electron-transfer agents may be included to facilitate redox-coupled transport or signaltransduction; in some embodiments, chelating agents and ligands including 13 -diketones, Schiff bases, bipyridines, phenanthrolines, porphyrins, and related coordination compounds may be used to selectively bind and transport metal ions; in some embodiments, surfactants or amphiphilic molecules, including nonionic, anionic, cationic, or zwitterionic surfactants, may be included to modify interfacial properties and enhance mass transport; in some embodiments, polymeric or oligomeric carriers, including functionalized polymers, dendrimers, or block copolymers, may be used to provide multivalent interactions or enhanced analyte affinity; in some embodiments, the additives may include molecular receptors designed for specific analytes, including receptors for amines, carboxylates, phosphates, sulfates, or neutral polar molecules through hydrogen bonding, electrostatic interactions, JI - JI interactions, or van der Waals interactions; in some embodiments, combinations of two or more additives may be employed to achieve synergistic effects in analyte transport, selectivity, or stability; and wherein the selection of additives may be tailored to the chemical properties of the analyte, including charge, polarity, size, and functional groups, and the disclosed system is not limited to the specific additives described herein but encompasses any additive capable of facilitating analyte transport across the organic phase through covalent or non-covalent interactions. The disclosed transport mechanisms are not limited to the specific examples described herein and may include any mechanism by which an analyte can be transferred across a water-immiscible organic phase or organic membrane through diffusion, binding, reaction, or coupled transport processes.

[0054] Water-immiscible organic solvents suitable for forming the organic phase include a wide variety of oils, plasticizers, esters, ethers, alcohols, hydrocarbons, halogenated solvents, and other organic liquids that are substantially immiscible with water. Such organic solvents may optionally contain one or more electronegative atoms such as oxygen, nitrogen, and / or sulfur that facilitate analyte solvation or transport. Exemplary plasticizers include, but are not limited to, dioctyl sebacate, dioctyl adipate, diethylhexyl adipate, diisodecyl adipate, diisopropyl adipate, diethyl adipate, dibutyl adipate, dimethyl adipate, dimethyl glutarate, dimethyl succinate, diethyl succinate, dibutyl sebacate, diisodecyl sebacate, triethyl citrate, tributyl citrate, acetyl tributyl citrate, triacetin, acetylated monoglycerides, glyceryl triacetate, glyceryl oleate, glyceryl linoleate, glyceryl palmitate, glyceryl stearate, sorbitan monostearate, sorbitan distearate, sorbitan tristearate, sucrose distearate, isosorbide ester, isosorbide diester, tri(ethylene glycol) bis(2-ethylhexanoate),tri(ethylene glycol) bis(n-octanoate), tetra(ethylene glycol) bis(2-ethylhexanoate), tetra(ethylene glycol) dihexanoate, di(propylene glycol) bis(2-ethylhexanoate), tri(propylene glycol) bis(2-ethylhexanoate), tri(propylene glycol) dihexanoate, triethylene glycol bis(2-ethylhexanoate), polyethylene glycol derivatives having hydrophobic substituents, phthalate esters such as diethyl phthalate, dibutyl phthalate, dioctyl phthalate, diisodecyl phthalate, diisononyl phthalate, and benzyl butyl phthalate, as well as benzoate esters such as diethylene glycol dibenzoate and dipropylene glycol dibenzoate. Other suitable organic solvents include aromatic ether plasticizers such as 2-nitrophenyl octyl ether, o-nitrophenyl octyl ether, o-nitrophenyl pentyl ether, and related nitrophenyl ethers. Vegetable oils and triglyceride oils may also be used, including castor oil, soybean oil, epoxidized soybean oil, olive oil, rapeseed oil, sunflower oil, corn oil, linseed oil, cottonseed oil, palm oil, coconut oil, and derivatives thereof such as rape seed methyl ester or other fatty acid methyl esters. Additional suitable water-immiscible organic solvents include long-chain esters such as ethyl oleate, methyl oleate, butyl oleate, octyl oleate, methyl palmitate, ethyl palmitate, methyl stearate, ethyl stearate, and related fatty acid esters. Long-chain alcohols may also be employed, including octanol, 2-octanol, nonanol, decanol, dodecanol, tetradecanol, hexadecanol, oleyl alcohol, and related higher alcohols. Ethers may include dibutyl ether, dihexyl ether, dioctyl ether, diisopropyl ether, methyl tert-butyl ether, tert-amyl methyl ether, anisole, diphenyl ether, and related hydrophobic ether solvents. Hydrocarbon solvents may include alkanes, cycloalkanes, and aromatic hydrocarbons such as hexane, heptane, octane, nonane, decane, dodecane, hexadecane, mineral oil, paraffin oil, cyclohexane, methylcyclohexane, benzene, toluene, ethylbenzene, xylene, mesitylene, cumene, and other substituted aromatic hydrocarbons. Halogenated organic solvents may include dichloromethane, chloroform, carbon tetrachloride, chlorobenzene, dichlorobenzene, trichloroethylene, tetrachloroethylene, and related halogenated hydrocarbons. Other organic solvents containing heteroatoms may include long-chain amides such as N,N-diethylhexanamide and N,N-dimethyldodecanamide, sulfoxides such as dialkyl sulfoxides, sulfones such as dialkyl sulfones, and other hydrophobic heteroatom-containing organic liquids capable of dissolving transporters or facilitating analyte transport. These organic solvents are used individually or in mixtures. The organic phase may comprise or consist of a water-immiscible ionic liquid, which functions as a nonvolatile and tunable medium for analyte transport and partitioning, wherein the ionic liquid is selected to be substantiallyimmiscible with the aqueous phases while providing favorable solvation and transport properties for the analyte. Exemplary ionic liquids include, but are not limited to, imidazolium-based ionic liquids (e.g., l-butyl-3-methylimidazolium hexafluorophosphate [BMIM][PF<>], l-butyl-3-methylimidazolium bis(trifhioromethylsulfonyl)imide [BMIM][NTf2]), pyrrolidinium-based ionic liquids (e.g., N-butyl-N-methylpyrrolidinium bis(trifhioromethylsulfonyl)imide [BMPyrr][NTf2]), ammonium-based ionic liquids, phosphonium-based ionic liquids (e.g., trihexyl(tetradecyl)phosphonium chloride or bis(trifluoromethylsulfonyl)imide), and other hydrophobic ionic liquids comprising fluorinated or weakly coordinating anions such as PFe , BF4 , or NTfz". In some embodiments, the composition of the ionic liquid may be tailored to modulate analyte solubility, transport kinetics, selectivity, or compatibility with sensing reagents.

[0055] THE AQUEOUS SENSING PHASE

[0056] The sensing phase of the system is an aqueous phase and in some aspects it is or comprises any of the aqueous liquids or solvents described above for diluents.

[0057] In addition, the sensing phase includes at least one sensing reagent that generates a detectable optical signal upon interacting with at least one analyte. As used herein, “interacting” or “interacts with” encompasses an analyte reacting with (e.g. binding to) a sensing agent / reagent via any known interaction, including but not limited to through: weak, reversible non-covalent interactions (such as hydrogen bonds between polar molecules, ionic bonds via electrostatic attraction between positively and negatively charged ions which can be broken by pH changes, hydrophobic interactions between nonpolar molecules or groups which associate together to avoid water, and Van der Waals Forces caused by transient dipole-dipole interactions; strong covalent bonds; peptide bonds, phosphodiester bonds, glycosidic bonds, and the like, and combinations of these. A variety of modes of molecular recognition (structural fit) are known in the art and include but are not limited to: specific binding, which relies on complementary surfaces; cooperative binding in which one molecule binds and changes the affinity for subsequent molecules, either increasing or decreasing the likelihood of further binding; collision-based interactions which occur when molecules with complementary shapes and favorable charges meet; etc., and combinations of these.

[0058] The sensing reagent includes but is not limited to organic or biological molecular probes that undergo measurable changes in absorbance, fluorescence, phosphorescence, chemiluminescence, or related optical properties upon interaction with an analyte, suchinteraction including binding, complexation, reaction, or environmental perturbation; such molecular probes may include, without limitation, chromoionophores, solvatochromic dyes, pH indicators, redox indicators, chromogenic and Anorogenic dyes, environmentally sensitive Auorophores, intramolecular charge-transfer dyes, and probes exhibiting Forster resonance energy transfer (FRET), photoinduced electron transfer (PET), internal charge transfer (ICT), excimer or exciplex formation, aggregation-induced emission (AIE), or fluorescence quenching or enhancement. Enzymatic assays may also be employed, including enzymes that catalyze reactions of the analyte or of a coupled substrate to generate chromogenic, Anorogenic, or luminescent products, such enzymes including but not limited to oxidases, dehydrogenases, hydrolases, esterases, peroxidases, luciferases, and A -galactosidase (LacZ), as well as multi-enzyme cascade systems and cofactor-dependent reactions (e.g., NADH / NAD , FAD / FADH2) that amplify or transduce the signal. Aptamer-based optical assays may be utilized, including but not limited to molecular beacon probes, strand displacement assays, dye displacement assays, conformational switching assays, split-aptamer systems, and aptamer-based FRET or Auorescence quenching platforms, wherein analyte binding induces a structural or environmental change that modulates the optical signal; nanoparticle / microparticle-based sensing systems may also be incorporated, including ion-selective optode nanoparticles, polymeric nanoparticles, quantum dots, metal nanoparticles (e.g., gold or silver nanoparticles), and other nanostructured materials, wherein detection is achieved through changes in absorbance, Auorescence, scattering, plasmonic properties, or energy transfer processes. Bioluminescent and Auorescent protein-based systems may be employed, including luciferase-based assays that generate light through enzymatic reactions, as well as genetically encoded or synthetic Auorescent proteins such as Green Fluorescent Protein (GFP), Cyan Fluorescent Protein (CFP), Yellow Fluorescent Protein (YFP), and variants thereof, including split-protein and resonance energy transfer-based systems. The sensing platform may utilize signal transduction mechanisms involving optical intensity changes, wavelength shifts, lifetime changes, anisotropy, or other photophysical parameters, and may incorporate amplification strategies including enzymatic turnover, catalytic cycling, or nucleic acid-based amplification. The disclosed sensing platform is not limited to the specific assay formats described herein and is configured to accommodate any assay chemistry or sensing modality capable of producing a detectable optical or luminescent signalin response to the presence or concentration of the analyte in a sample that is separated from the assay via an organic phase.

[0059] In some aspects, one sensing agent is present in the sensing phase. In other aspects, a plurality of sensing agents (e.g. from about 1-10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0060] The analytes that are detected in the sensing phase include any substances that can be detected by binding to a detectable optical reporter molecule. The analyte comprises any chemical or biochemical species capable of being recognized, directly or indirectly, by a molecular probe, aptamer, enzyme, receptor, or other sensing component, and wherein the analyte may be a cation, an anion, a zwitterion, or an electrically neutral molecule, and may exist in free, bound, complexed, solvated, or conjugated forms, and may be present in an aqueous sample including, but not limited to, biological fluids, environmental samples, food samples, pharmaceutical compositions, or industrial process streams; wherein the analyte includes, without limitation, inorganic ions including alkali metal ions (e.g., sodium, potassium, lithium), alkaline earth metal ions (e.g., calcium, magnesium), transition metal ions (e.g., iron, copper, zinc, manganese, cobalt, nickel), ammonium, and other inorganic ions such as chloride, bromide, iodide, fluoride, nitrate, nitrite, sulfate, phosphate, bicarbonate, and the like; small-molecule metabolites including, but not limited to, glucose, lactate, pyruvate, creatinine, urea, uric acid, cholesterol, triglycerides, ketone bodies (e.g., 13 -hydroxybutyrate, acetoacetate), amino acids, nucleosides and nucleotides (e.g., adenosine, adenosine triphosphate (ATP), adenosine diphosphate (ADP), cyclic AMP), and metabolic intermediates; pharmaceutical agents and / or their metabolites including prescription drugs, over-the-counter drugs, and recreational drugs, such as anesthetics (e.g., propofol), antibiotics (e.g., vancomycin, aminoglycosides such as kanamycin and streptomycin, 13 -lactams, tetracyclines, chloramphenicol), antivirals, antifungals, anticancer agents, immunosuppressants, cardiovascular agents, analgesics, antiinflammatory agents, antidepressants, antipsychotics, bronchodilators (e.g., theophylline), and drugs of abuse including opioids, cannabinoids, amphetamines, cocaine, fentanyl, benzodiazepines, and the like, including their metabolites, prodrugs, degradation products, and derivatives; neurotransmitters and related signaling molecules including, but not limited to, dopamine, serotonin, norepinephrine, epinephrine, histamine, acetylcholine, y -aminobutyric acid (GABA), glutamate, and related metabolites; hormones and other smallmolecule signaling compounds including steroid hormones (e.g., cortisol, testosterone,estradiol), thyroid hormones, and endocrine modulators; vitamins, cofactors, and nutrients including water-soluble vitamins (e.g., vitamin C, B-complex vitamins including riboflavin and flavin adenine dinucleotide (FAD)) and fat-soluble vitamins (e.g., vitamins A, D, E, and K), as well as dietary components and micronutrients; small-molecule lipids and lipid-related species including fatty acids, sterols (e.g., cholesterol), lipid metabolites, and hydrophobic small molecules; environmental and industrial analytes including pesticides, herbicides, fungicides, endocrine-disrupting compounds, heavy metals, organic pollutants (e.g., polycyclic aromatic hydrocarbons, polychlorinated biphenyls), per- and polyfluoroalkyl substances (PFAS), solvents, plasticizers, and other hazardous chemicals; toxins and small-molecule contaminants including mycotoxins (e.g., aflatoxin), bacterial toxins, and foodborne contaminants; disease-associated small-molecule biomarkers including markers of inflammation, metabolic disorders, neurological conditions, and infectious diseases; and reactive species including reactive oxygen species (ROS), reactive nitrogen species (RNS), peroxides, and redox-active compounds; wherein the sensing platform is not limited to the foregoing analytes and is configured to detect any analyte for which a compatible recognition element or sensing chemistry can be incorporated into the sensing phase, and wherein the analyte may be detected through mechanisms including, but not limited to, molecular binding, chemical reaction, enzymatic transformation, ion exchange, partitioning, or transport across one or more phases.

[0061] The sensing phase may further comprise one or more reagents configured to modulate, enhance, or regulate transport of the analyte from the sample phase through the organic phase into the sensing phase, wherein such reagents may function by altering chemical potential gradients, driving interfacial reactions, stabilizing transported species, or coupling transport to chemical or physical processes in the sensing phase. Some of these reagents may have dual functions for both sensing and transport. In some embodiments, the sensing phase may include binding agents or trapping reagents that selectively and reversibly or irreversibly bind the analyte, including chelators, ligands, host-guest receptors, or molecular probes, thereby lowering the free analyte concentration in the sensing phase and promoting continued analyte flux across the organic phase; in some embodiments, the sensing phase may include reactive reagents that chemically convert the analyte into a different species, including chromogenic, Anorogenic, or redox-active products, thereby shifting equilibrium and enhancing transport through consumption of the analyte; in someembodiments, enzymes or enzyme systems may be present to catalyze analyte transformation, including single-enzyme or multi-enzyme cascade reactions, optionally involving cofactors such as NAD / NADH, NADP / NADPH, FAD / FADH2, ATP, or other coenzymes, thereby coupling analyte transport to enzymatic turnover; in some embodiments, the sensing phase may include redox-active species, including oxidants, reductants, mediators, or electron-transfer agents, that participate in redox-coupled transport processes or facilitate conversion of the analyte into a detectable or more hydrophilic or lipophilic form; in some embodiments, the sensing phase may include pH-modulating agents, buffers, acids, or bases that control the protonation state of the analyte or carrier species, thereby enabling proton-coupled transport or pH-dependent partitioning; in some embodiments, surfactants or amphiphilic molecules may be included to modify interfacial properties, enhance mass transfer, or stabilize transported species at the phase boundary; in some embodiments, the sensing phase may include counterions or complexing agents that promote dissociation of ion pairs or carrier-analyte complexes upon entry into the sensing phase, thereby facilitating release of the analyte from the transport medium; in some embodiments, the sensing phase may include competitive binding agents or displacement reagents that shift equilibria to favor analyte accumulation in the sensing phase; in some embodiments, ionic strength modifiers, salts, or osmolytes may be used to influence partitioning, activity coefficients, or transport kinetics; in some embodiments, the sensing phase may include nucleophiles, electrophiles, or derivatization reagents that convert the analyte into a more detectable or retained form; and in some embodiments, combinations of two or more such reagents may be employed to achieve synergistic effects in transport enhancement, selectivity, or signal generation; wherein the sensing phase is not limited to the specific reagents described herein and may include any reagent capable of modulating analyte transport through chemical, physical, or biochemical interactions that influence partitioning, reaction kinetics, or thermodynamic driving forces.

[0062] METHODS

[0063] Further provided herein are methods of detecting an analyte of interest using the disclosed assay system. In some aspects, the methods comprise providing a sample comprising an analyte of interest and placing the sample in contact with an organic phase as described herein (i.e. contacting the organic phase with the sample). In some aspects, the sample phase and organic phase are mixed or agitated, such as by mechanical or automatedmixing in order to facilitate the movement of the analyte(s) from the sample phase, through the organic phase, and into the sensing phase. Note that the mixing is not of three phases with one another, but rather mixing within a respective volume (e.g., an aliquot) of a single phase. Such mixing encourages movement of dissolved and / or suspended elements within the phase. In other aspects, the step of mixing is optional and the analyte moves from the sample phase, through the organic phase and into the sensing phase without the application of external force, e.g. by simple diffusion. More commonly, a step of mixing is included. Movement (transport, migration, etc.) of the analyte is via mechanism such as a concentration gradient, partition-driven diffusion, facilitated transport, ion exchange, or carrier-mediated interactions. Example carriers are supramolecular host molecules that form complexes with the analyte. Ionophore is a carrier for ions.

[0064] The signal detected in the sensing phase may comprise an optical signal including, but not limited to, absorbance, transmittance, reflectance, fluorescence, phosphorescence, chemiluminescence, bioluminescence, or a visually observable color change, for example within the visible spectrum, and may further include changes in optical properties such as emission intensity, excitation intensity, wavelength, spectral shift, peak position, bandwidth, fluorescence lifetime, phosphorescence lifetime, anisotropy, polarization, or quantum yield; in some embodiments, the signal may arise from chromogenic or Anorogenic reactions, binding-induced spectral changes, or environment- sensitive probes; in some embodiments, the signal may involve Forster resonance energy transfer (FRET), bioluminescence resonance energy transfer (BRET), photoinduced electron transfer (PET), internal charge transfer (ICT), aggregation-induced emission (AIE), excimer or exciplex formation, or fluorescence quenching or enhancement mechanisms; in some embodiments, the signal may be detected as a change in color intensity or hue observable by the naked eye or quantified using an optical detector, including spectrophotometers, fluorimeters, photodiodes, cameras, smartphones, or imaging systems; in some embodiments, the signal may be time-dependent, including kinetic or real-time measurements, or may be integrated over time to provide quantitative output; in some embodiments, the signal may be spatially resolved within a channel or segmented Row system; in some embodiments, the signal may be measured at a single wavelength, multiple wavelengths, or across a spectrum; and in some embodiments, the signal may be processed through calibration curves, ratiometric measurements, or internal standards to enable quantitative determination of analyte concentration; wherein thedisclosed sensing platform is not limited to the specific signal modalities described herein and may utilize any detectable optical or photophysical change associated with the presence or concentration of the analyte.

[0065] The optical signal is then detected using instrumentation known in the art, or even by eye if the signal is a color change.

[0066] THE SYSTEM

[0067] The triphasic sensing system disclosed herein may be implemented in multiple configurations. In one embodiment, the system (which is or includes a device or apparatus) comprises at least one channel or conduit, i.e. a specialized, structural channel or tubular system designed to facilitate the rapid, efficient, and often automated transport of substances to a target area for analysis. In some aspects, the channel is preloaded with the sensing phase and the organic phase, and an aqueous sample is subsequently introduced so that it interfaces with the organic phase while remaining physically separated from the sensing phase.

[0068] Introduction of the sample may be achieved by negative pressure applied at an opposing end of the channel, by capillary-driven wicking, or by other fluidic actuation methods. The sensing phase and / or the organic phase may be preloaded during manufacturing or loaded by a user at the point of use (Figures 1 and 2). In alternative embodiments, the sensing phase and the organic phase may be introduced from reservoirs using a liquid control module, such as a programmable syringe pump in combination with multi-port valves, allowing automated loading at the site of use.

[0069] The relative volumes of the three phases may be adjusted to modulate assay performance. The volume ratio between any two phases may range from approximately 100:1 to 1:100, and more preferably from approximately 5:1 to 1:5. Reducing the volume of the organic phase decreases the transport distance between the sample and sensing phases and may enhance transport speed and efficiency. Adjusting the ratio between the sample phase and sensing phase may modulate assay sensitivity and dynamic range. Increasing the sample-to-sensing phase volume ratio may enrich analyte concentration in the sensing phase and thereby enhance sensitivity, whereas decreasing this ratio may effectively dilute highly concentrated analytes to bring them within the dynamic range of the optical assay.

[0070] The channel used for implementing the triphasic sensing system may have a variety of cross-sectional geometries. For example, the cross section of the channel may be round, rectangular, square, oval, or another suitable geometry capable of supporting multiphaseflow and maintaining separation between the sample phase, organic phase, and sensing phase. The cross-sectional area of the channel typically ranges from approximately 100 pm2to 10 cm2, and more preferably from approximately 1,000 pm2to 10 mm2, although other dimensions may be used depending on the desired flow conditions, transport distance, and device configuration. Channels within this range may be implemented in microfluidic devices, millifluidic systems, pipette tips, tubing, or other fluidic structures capable of supporting segmented or layered multiphase flow.

[0071] The channel may be fabricated from a variety of materials compatible with the fluids and sensing reagents used in the system. Suitable materials include plastics, glass, elastomers, and other chemically resistant materials commonly used in fluidic devices. Examples of plastics include polypropylene, polyethylene, polystyrene, polycarbonate, cyclic olefin copolymer, cyclic olefin polymer, and poly(methyl methacrylate). Glass materials may include borosilicate glass, fused silica, or other glass substrates used in microfluidic devices. Elastomeric materials may include silicone-based rubbers such as poly dimethylsiloxane or other flexible polymers capable of forming sealed channels. The channel may be fabricated using methods such as molding, machining, lithography, extrusion, or bonding of layered substrates to form enclosed fluidic pathways.

[0072] The transporters and sensing reagents may be incorporated into their respective solvents prior to loading into the channel. In certain embodiments, the organic phase may be pre-formulated with transporters dissolved therein, and the sensing phase may be preformulated with sensing components dissolved therein before introduction into the device. Alternatively, dry transporters and / or sensing reagents may be deposited within designated regions of the channel and subsequently dissolved in situ upon introduction of the corresponding solvent. The latter approach is particularly suitable for transporters and sensing reagents that exhibit limited stability in solution or that are susceptible to degradation during storage when dissolved. In such embodiments, the solvents in the channel dissolve the pre-deposited dry reagents to form the functional organic and sensing phases immediately prior to use, thereby improving storage stability and shelf life.

[0073] To enhance analyte transport across the organic phase and improve detection efficiency, one or more acceleration techniques may be employed. In one embodiment, repeated push-pull fluid motion within the channel is applied to generate internal convection and localized turbulence, thereby increasing interfacial contact and mass transfer rates between phases. Inanother embodiment, external mechanical vibration is applied to the device to promote analyte transport by enhancing diffusion and reducing boundary layer thickness at the phase interfaces. Additional agitation or flow-based methods may also be used to increase transport kinetics without compromising phase separation.

[0074] The optical response generated in the sensing phase may be measured either after separating the sensing phase from the channel or directly within the channel. In some embodiments, the sensing phase may be collected and transferred to a separate optical detection instrument, such as a microplate reader, spectrophotometer, or fluorimeter, for analysis. In preferred embodiments, however, the optical signal is acquired directly from the sensing phase while it remains inside the channel, without requiring physical separation. In such configurations, the optical detector is aligned to interrogate only the sensing phase and to acquire its optical signal independently from the sample phase. Example detector configurations may include absorbance or fluorescence detection geometries positioned to selectively illuminate and collect signals from the sensing phase (Figure 3). Because the sensing phase and the sample phase are spatially separated by the organic phase, optical interference from the sample phase is negligible. Turbidity, coloration, or autofluorescence of the sample phase does not significantly affect optical detection of the sensing phase when the excitation source and emission collection optics are directed exclusively toward the sensing phase during measurement. Signals obtained when other phases are aligned with the optical detector are generally disregarded for analytical purposes. This spatial and temporal separation of optical interrogation reduces background interference from complex sample matrices.

[0075] In certain embodiments, in situ fluorescence detection may be performed using an optical detector designed for pipette tips, such as those described in Sensors and Actuators B: Chemical, Volume 456, 1 June 2026, 139694.

[0076] The response time of the system may be modified by adjusting the thickness of the organic layer and / or adjusting other variables. For example, the response time is further reduced by decreasing the thickness of the organic layer, applying stronger mixing protocols, increasing temperature, or employing other techniques that enhance analyte transport across the phase interfaces. If an air segment is present between the organic phase segment and an aqueous phase segment, the transport may still happen via the thin layer of liquid on the inner surface of the channel wall. For example, when the channel ishydrophobic, there is usually a thin layer of organic phase covering the inner surface of the channel. This thin layer connects the aqueous segment and the bulk organic segment even though there is an air segment between these bulk organic and aqueous phases. In other words, the organic phase comprises the bulk organic segment and a thin layer covering a much larger area of the channel including the region where the aqueous phase segment resides. In this example, the aqueous segment is not in direct contact with the channel material due to the presence of this organic layer that wets the inner surface of the channel.

[0077] Figure 10 is a block diagram of an exemplary system 100 for sensing at least one analyte. The system includes a channel 101 with at least one opening 102 by which a sample is admittable to the channel. Generally, the presence and / or quantity of analyte in the sample is initially unknown, and the system 100 is advantageous for determining whether the sample contains analyte and / or how much analyte the sample contains. The system 100 further includes a sensing phase 105 and an organic phase 104. The sensing phase includes at least one sensing reagent that is reactive with the at least one analyte to generate an optical response. The organic phase is immiscible with the sensing phase and immiscible with the sample (the sample phase) to be tested for the at least one analyte. The organic phase is formulated to enable selective transport of the at least one analyte.

[0078] In Figure 10, the channel 101 is depicted as part of a microfluidic chip 106.

[0079] However, it should be understood that the block 106 in Figure 10A is also representative of a solid structure (e.g., a structure of solid material like a glass and plastic (such as but not limited to polydimethylsiloxane (PDMS)), resin, metal, etc.) which may not qualify as a microfluidic chip or which may qualify as a microfluidic chip.

[0080] In one exemplary arrangement of system 100, the channel 101 may be preloaded with the sensing phase 105 and / or the organic phase 104. In Figure 10 the dotted circles on structure 106 represent this configuration. As an alternative, the system 100 may further include one or more reservoirs (or a reservoir with one or more separate compartments) which contain the sensing phase 105 and / or organic phase 104. In the latter case, the channel 101 is loadable with a volume of the sensing phase 105 from the one or more reservoirs 113 and with a volume of the organic phase 104 from the one or more reservoirs 113. The one or more reservoirs 113 may be distinct from the structure 106, as suggested by Figure 10A. In the alternative, the one or more reservoirs 113 may be subelements on the structure 106. The dotted circles for sensing phase 105 and organic phase 104 on the structure 106 in Figure10A may be treated as representing reservoirs of these respective phases, and volumes of the respective phases are loaded into the channel 101 in connection with use of the structure 106.

[0081] The sensing phase 105 may be assessed for an optical signal that conveys the presence and / or quantity of the at least one analyte of interest to the unaided human eye. Alternatively, the system 100 may further include one or more detectors 111 configured to detect the optical response from the sensing phase. The one or more detectors 111 may include, for example, one or more of a spectrophotometers, fluorimeters, photodiodes, photomultiplier tubes (PMTs), avalanche photodiodes (APDs), single-photon counting detectors (SPCs), charge-coupled device (CCD) detectors, complementary metal-oxide-semiconductor (CMOS) sensors, cameras, smartphones, imaging systems, optical readers, or other light-detection devices capable of measuring intensity, wavelength, temporal, or spatial characteristics of the optical signal. The channel 101 may include or terminate in a sampling region 103 in which at least some of sensing phase 105 is positioned at the time of assessing the optical signal. The structure 106 may be configured so that the sampling region 103 is suitable for optical signal reading, e.g., at least the sampling region 103 is transparent.

[0082] The channel 101 is configured to simultaneously accommodate the sample, (a volume of) the organic phase 104, and (a volume of) the sensing phase 105 with the organic phase separating and preventing contact between the sample and the sensing phase while enabling selective transport of the at least one analyte from the sample to the sensing phase (see, for example, Figures 1, 2, and 3).

[0083] The system 100 may further include at least one accelerator 112 configured to accelerate transport of the at least one analyte through the organic phase. The at least one accelerator 112 is one or more of: at least one vibrator (e.g., a motor, an actuator, etc.), at least one pump and / or at least one source of or means of generating an electric field.

[0084] The channel 101 is not necessarily a single channel, though it may be a single channel. In some arrangements the channel 101 may be configured as a plurality of channels. For exemplary illustration, Figure 11 depicts an intersection of multiple feeder channels 101a, 101b, and 101c which sequentially feed sample phase, organic phase, and sensing phase, respectively, into channel 10 Id where transport of analyte (if present) from the sample phase through the organic phase into the sensing phase occurs.Figure 12A is another exemplary microfluidic structure 1200. The structure 1200 is usable as structure 106 in a system like system 100 of Figure 10. The structure 1200 employs a multifeed arrangement like that which was introduced in Figure 11. Multiple feeder channels 101a, 101b, and 101c are configured to sequentially feed sample phase, organic phase, and sensing phase, respectively, into channel 10 Id where transport of analyte (if present) from the sample phase through the organic phase into the sensing phase occurs. The three-inlet design facilitates generation of alternating segments of sample, organic phase, and sensing phase. The channel 10 Id includes a length serpentine channel that enhances fluid mixing withing each segment to increase ion transfer and interaction efficiency. Detection of optical signal from the segments of sensing phase is performed downstream of the length of serpentine channel.

[0085] Figure 12B is an exemplary system 1250 configured as a portable sensing platform configured for compatibility with structure 1200 of Figure 12 A. The system 1250 includes reservoir 1201 which contains initial amounts of sensing phase and organic phase. A pump 1202 is configured to control flow of these phases and sample fluid admitted at opening 1203. The three respective phases are pumped by pressure from pump 1202 through the microfluidic structure 1200. An excitation source 1204, such as but not limited to a laser diode or light emitting diode (LED), is included in this example system to contribute to inducement of the optical signal to be read from sensing phase on the microfluidic structure 1200. A detector 1205 collects the optical signal from the sensing phase.

[0086] Various optical elements may be included in exemplary devices and systems for influencing the optical signal to be read. For example, system 1250 includes a filter 1207 for excitation source 1204, a dichroic mirror 1208, and a filter 1206 for filtering the optical signal that reaches the detector 1205.

[0087] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits arealso included in the invention.

[0088] In the description of the invention herein, it is understood that a word appearing in the singular encompasses its plural counterpart, and a word appearing in the plural encompasses its singular counterpart, unless implicitly or explicitly understood or stated otherwise. Furthermore, it is understood that for any given component or embodiment described herein, any of the possible candidates or alternatives listed for that component may generally be used individually or in combination with one another, unless implicitly or explicitly understood or stated otherwise. Moreover, it is to be appreciated that the figures, as shown herein, are not necessarily drawn to scale, wherein some of the elements may be drawn merely for clarity of the invention. Also, reference numerals may be repeated among the various figures to show corresponding or analogous elements. Additionally, it will be understood that any list of such candidates or alternatives is merely illustrative, not limiting, unless implicitly or explicitly understood or stated otherwise. In addition, unless otherwise indicated, numbers expressing quantities of ingredients, constituents, reaction conditions and so forth used in the specification and claims are to be understood as being modified by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the subject matter presented herein. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the subject matter presented herein are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical values, however, inherently contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0089] Any and all patents and publications mentioned in the specification are indicative of the level of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0090] The following examples are included to demonstrate preferred embodiments of theinvention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0091] EXAMPLES EXAMPLE 1: Triphasic detection of methylenedioxypyrovalerone (MDPV) using an additive-free oil layer and a dye displacement assay in the sensing phase.

[0092] The organic phase consisted of dioctyl sebacate. The sensing phase contains Red Sensitizer Brk 5714 (CAS 23216-67-3) as a reporter dye and an MDPV (methylenedioxypyrovalerone) aptamer (SCA2.1, sequence:

[0093] CTTACGACCTTAAGTGGGGTTCGGGTGGAGTTTATGGGGTCGTAAG (SEQ ID NO: 1) as the recognition element. The sample phase consists of undiluted human plasma containing varying concentrations of MDPV. In this dye displacement assay, binding of the analyte to the aptamer displaces the reporter dye from the aptamer, resulting in a decrease in fluorescence intensity of the dye. Plastic pipette tips are used as exemplary channels for implementing the triphasic sensing configuration. The sensing phase and the organic phase are first loaded into the pipette tip. Subsequently, the sample is aspirated into the pipette tip so that the sample phase interfaces with the organic phase while remaining separated from the sensing phase. An electronic pipette is then used to perform repeated aspiration and dispensing cycles (push-pull operations) to enhance mass transport between the three phases. After approximately 40 minutes of mixing, the sensing segment was collected and analyzed using a microplate reader to measure the fluorescence signal.

[0094] The results are shown in Figure 4A. As can be seen, as the concentration of MDPV increases in the plasma phase (sample phase), the fluorescence in the sensing phase containing the aptamer and Red Sensitizer Brk 5714 decreases. MDPV transports across the oil phase to reach the sample phase. In the sample phase, MDPV binds to the aptamer to displace Red Sensitizer Brk 5714 from the aptamer. The displaced Red Sensitizer Brk 5714 has a lower fluorescence in the buffer background. The dye displacement assay principle has been reported previously in a single aqueous phase: Alkhamis, O., Canoura, J., Bukhryakov,K.V., Tarifa, A., DeCaprio, A.P. and Xiao, Y., 2022. DNA Aptamer-Cyanine Complexes as Generic Colorimetric Small-Molecule Sensors. Angewandte Chemie, 134(3), p.e202112305. Other chemicals cannot induce such a response since the aptamer has specificity.

[0095] Similarly, the triphasic sensing can be conducted for whole blood samples. Figure 4B shows the response toward MDPV in whole human blood. Again, the fluorescence of the sensing phase decreases as MDPV in blood diffuses across the oil to reach the sensing phase. Traditional single-phase aptamer assays are unsuitable for blood analysis due to the dark color, high turbidity, and autofluorescence of blood.

[0096] EXAMPLE 2: Triphasic detection of lactate using a boronic-acid-containing organic phase and a sensing phase configured for enzymatic detection.

[0097] The organic phase consisted of dibutyl phthalate containing 5 mM tridodecylmethylammonium chloride and 5 mM 3,5-bis(trifluoromethyl)phenylboronic acid. The sensing phase consists of a glycine-hydrazine buffer at pH 9 containing 1 mg / mL lactate dehydrogenase and 5 mM nicotinamide adenine dinucleotide (NAD). Lactate molecules in the sample phase were transported through the organic phase and into the sensing phase, where they participated in the enzymatic reaction catalyzed by lactate dehydrogenase, resulting in the production of NADH. The generation of NADH produced a fluorescence signal that was detected in the sensing phase. Optical detection was performed at an excitation wavelength of approximately 350 nm to measure the fluorescence response of the sensing phase.

[0098] The results are shown in Figure 5. As can be seen, as the concentration of lactate increases in the sample phase, the fluorescence in the sensing phase increases.

[0099] EXAMPLE 3: Triphasic detection of calcium ions using an ionophore-loaded organic phase and ionophore-based nanoparticle sensors in the sensing phase.

[0100] The organic phase consisted of a mixture of 2-nitrophenyl octyl ether and dioctyl sebacate at a volume ratio of 3:7. The organic phase further contained 1 mM calcium ionophore III (CAS 52665-69-7, also known as calcium ionophore A23187, antibiotic A23187, or calimycin) and 1 mM sodium tetrakis[3,5-bis(trifhioromethyl)phenyl]borate. The sensing phase contained ion- selective optode nanoparticles consisting of calcium ionophore II (N,N,N',N'-tetra[cyclohexyl]diglycolic acid diamide), sodium tetrakis[3,5-bis(trifluoromethyl)phenyl] borate, and chromoionophore I (3-octadecanoylimino-7-(diethylamino)-l,2-benzophenoxazine) dissolved in dioctyl sebacate and stabilized usingPluronic Fl 27. The preparation of these nanoparticle sensors follows procedures described in the literature (Analytical Chemistry 2014, 86, 2853-2856). During repeated push-pull operations applied to the liquid segments, calcium ions were transported from the sample segment across the organic phase and into the sensing segment, where they interacted with the nanoparticle sensors and induced a color change.

[0101] The results are shown in Figure 6. As can be seen, as the calcium concentration increases in the sample phase, the color of the nanoparticle sensor in the sensing phase shifts from bluish and purplish. The color change indicates deprotonation of chromoionophore I in the sensing phase, caused by extraction of calcium ions into these nanoparticles in the sensing phase.

[0102] EXAMPLE 4: Triphasic detection of calcium ions using an ionophore-containing organic phase and a sensing phase containing a molecular probe for calcium detection.

[0103] The organic phase consisted of 2-nitrophenyl octyl ether containing 0.5 mM calcium ionophore III (CAS 52665-69-7, calcium ionophore A23187, antibiotic A23187, or calimycin). The sensing phase consisted of a HEPES buffer at pH 7.4 containing 0.1 mM Arsenazo III (CAS 1668-00-4), a reagent that undergoes a color change from reddish to bluish upon binding to calcium ions. During repeated push-pull operations applied to the segmented liquids, calcium ions were transported from the sample segment through the organic phase and into the sensing segment, where interaction with Arsenazo III produced a measurable color change.

[0104] The results are shown in Figure 7. As can be seen, as the calcium concentration increases in the sample phase, the sensing phase undergoes a color change from purplish to bluish due to the binding of transported calcium to Arsenazo III.

[0105] EXAMPLE 5: Aptamer sensing using strand displacement assays.

[0106] For cocaine detection, the sensing phase is 20 mM Tris-HCl (pH 7.4 at 25 °C), 140 mM NaCl, 4 mM KC1, 5 mM MgCh containing 500 nM NC195-Cy5 and 1250 nM CDNA13Q. NC195-Cy5 is the cocaine aptamer conjugated with a fluorophore, cyanine 5 ( / 5Cy5 / GGCAGAACTTACGACAGGTTCTGAGGAATCAACGTCGGTGTAGTTGTCGT AAG) (SEQ ID NO: 2). cDNA13Q is a quencher strand, which is a short single stranded DNA conjugated with a fluorescence quencher (GTCGTAAGTTCTG / 3IAbRQSp / ) (SEQ ID NO: 3). In the absence of cocaine, cDNA13Q hybridizes with NC195-Cy5 so the fluorophore and the quencher are in proximity and fluorescence is quenched. In the presenceof cocaine, cocaine binds to the aptamer and dissociates CDNA13Q from the aptamer. As a result, the quencher is far from the fluorophore and the fluorescence is recovered. The detailed principle has been reported in single-phase assays: J. Am. Chem. Soc. 2024, 146, 5, 3230-3240.

[0107] The aqueous sensing phase contains different concentrations of cocaine at physiological pH. The oil phase can be either pure dioctyl sebacate or dioctyl sebacate containing a cation exchanger, sodium tetrakis[3,5-bis(trifluoromethyl)phenyl]borate.

[0108] Cocaine is a weak base with a pKa of 8.6, so it is primarily cationic at pH 7.4 (>90%). The cationic form can be transported with the aid of the cation exchanger. A few percentage of cocaine is also neutral, which allows its transport without a cation exchanger.

[0109] The oil phase is placed in between two aqueous phases. These phases are moved back and forth in the pipette tip to enhance mass transport. At the end of mixing, the fluorescence in the sensing phase is measured. As shown in Figure 8A and B8, as the concentration of cocaine increases in the pH 7.4 buffer phase (sample phase), the fluorescence in the sensing phase increases. This is because cocaine transports from the sample phase into the sensing phase to dissociate the quencher strand from the aptamer. Similarly, when the sample is whole human blood spiked with cocaine, the fluorescence response is also obtained from the sensing phase.

[0110] The same strand displacement principle can be employed in triphasic sensing of other analytes. Figure 9 shows the detection of theophylline in whole human blood. The oil is dioctyl sebacate. The sensing phase contains 2 micromolar Theo2201-FAM as the aptamer conjugated with a fluorophore, 6-carboxyfluorescein ( / 56-FAM / CTCTCGACGACGATTGTGGTCTATTCATAGGCGTCCGCT GAGTCGTC) (SEQ ID NO: 4). The sensing phase further contains 8 micromolar Theo2201-Q (AGTCGTCGAGAG / 3IABkFQ / ) (SEQ ID NO: 5), which is the quencher strand that binds with the aptamer to quench its fluorescence. The detailed response principle and single¬ phase assay conditions are reported in this publication: ACS Chem. Biol. 2022, 17, 8, 2121— 2129. In the triphasic sensing, theophylline in the sample diffuses across the oil to reach the sensing phase to recover the fluorescence. Other chemicals cannot induce similar responses since they either cannot transport across the oil or cannot effectively bind to the aptamer. EXAMPLE 6: Formation of segmented-flow microfluidics for implementing the triphasic sensing system.In this configuration, the organic phase forms discrete segments that separate the sample phase from the sensing phase within a continuous microfluidic channel. The segmented flow was generated using a microfluidic junction, such as a cross junction, where separate inlets introduce the aqueous sample phase, the sensing phase, and the organic phase. The three streams met at the junction and formed alternating segments, with each sample segment and sensing segment separated by an intervening oil segment. Optical detection was performed at a detection region located downstream near the end of the microchannel, where the sensing segments pass through the interrogation region of an optical detector. The flow itself creates friction between the flow and the wall of the channel, causing advection within segments and between segments to enhance the analyte transport and detection. The continuous flow is a “mixing” mechanism to facilitate mass exchange. Mixing does not mean to blend three phases into one bulk phase.

[0111] An exemplary device with this configuration is shown in Figures 10 and 11.

[0112] While the invention has been described in terms of its preferred embodiments, those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the appended claims. Accordingly, the present invention should not be limited to the embodiments described above but further includes all modifications and equivalents thereof within the spirit and scope of the description provided herein.

Claims

1. CLAIMSWe claim:

1. A method of detecting at least one analyte in an aqueous sample, comprising providing an organic phase and an aqueous sensing phase, wherein the organic phase is in direct contact with and is immiscible with the aqueous sensing phase, and wherein the aqueous sensing phase comprises at least one sensing agent interactive with the at least one analyte to generate a detectable optical signal;contacting the organic phase with the aqueous sample without the aqueous sample and aqueous sensing phase directly contacting one another;maintaining contact of the organic phase with the aqueous sample and aqueous sensing phase for a period of time sufficient to cause the at least one analyte, if present in the aqueous sample, to move through the organic phase and into the sensing phase and interact with the at least one sensing agent;andcollecting an optical signal from the aqueous sensing phase.

2. The method of claim 1, further comprising mixing the aqueous sample, mixing the organic phase, and / or mixing the sensing phase.

3. The method of claim 1 or 2, wherein the organic phase is an oil, a plasticizer, an ester, an ether, an alcohol, a hydrocarbon, an ionic liquid, or a halogenated solvent.

4. The method of any one of the previous claims, wherein the organic phase contains one or more optional additives selected from the group consisting of: ion exchangers, ionophores, phase-transfer catalysts, boronic acids, host-guest receptors, hydrogen-bonding agents, and molecules that interact with the analyte through covalent or non-covalent interactions.

5. The method of any one of the previous claims, wherein the at least one sensing reagent is a chemical or biochemical component capable of generating a detectable optical signal upon interaction with the at least one analyte.

6. The method of any one of the previous claims, wherein the at least one sensing reagent is a molecular probe, an aptamer, an enzyme, a chromogenic substrate, a Anorogenic substrate, a nanoparticle-based sensor, a Auorescent reporter, a luminescent reporter, or a combination thereof.

7. The method of any one of the previous claims, wherein the at least one detectable optical signal is absorbance, transmittance, reAectance, Auorescence, phosphorescence, chemiluminescence, bioluminescence, or a visually observable color change.

8. The method of any one of the previous claims, wherein the aqueous sample phase is a biological sample and is or comprises one or more of: i) blood, serum, plasma, urine, semen, saliva, sweat, milk, cerebrospinal Auid, interstitial Auid, amniotic Auid; or ii) an extract of skin, biopsy tissue, hair, nail clippings or tumor cells.

9. The method of any one of claims 1-7, wherein the aqueous sample phase is a non-biological sample and is or comprises i) sea water, lake water, a pharmaceutical formulation, a chemical reagent, a laboratory- synthesized substance, an industrial / commercial sample from a food product, irrigation water or mine efAuent; or ii) an extract of a textile, fibers, clothing, soil, glass, weapon residue or environmental debris.

10. The method of any one of the previous claims, wherein the at least one analyte is a cation, an anion, a zwitterion, a neutral molecule, a metabolite, a drug, a drug metabolite, a neurotransmitter, a hormone, a vitamin, a lipid, or an environmental contaminant.

11. The method of any one of the previous claims, wherein the at least one analyte moves via a concentration gradient, partition-driven diffusion, facilitated transport, ion exchange, or carrier-mediated interactions.

12. The method of claim 1, wherein the at least one analyte is a charged analyte and movement across the organic phase is driven or modulated by an applied electric field.

13. A system for sensing at least one analyte, comprisinga sensing phase comprising at least one sensing reagent that is reactive with the at least one analyte to generate an optical response;an organic phase immiscible with the sensing phase and immiscible with a sample to be tested for the at least one analyte; anda channel with at least one opening by which the sample is admittable to the channel, wherein the organic phase is formulated to enable transport of the at least one analyte,wherein the channel is configured to simultaneously accommodate the sample, the organic phase, and the sensing phase with the organic phase separating and preventing contact between the sample and the sensing phase while enabling transport of the at least one analyte from the sample to the sensing phase.

14. The system of claim 13, further comprisingat least one detector configured to detect the optical response from the sensing phase, and / orat least one accelerator configured to accelerate transport of the at least one analyte through the organic phase.

15. The system of claim 13, wherein the at least one detector is or includes one or more of: spectrophotometers, fluorimeters, photodiodes, photomultiplier tubes (PMTs), avalanche photodiodes (APDs), single-photon counting detectors (SPCs), charge-coupled device (CCD) detectors, complementary metal-oxide-semiconductor (CMOS) sensors, cameras, smartphones, imaging systems, optical readers, or other light-detection devices capable of measuring intensity, wavelength, temporal, or spatial characteristics of the optical signal.

16. The system of claim 13, wherein the at least one accelerator is one or more of: at least one vibrator, at least one pump, and at least one source of or means of generating an electric field.

17. The system of claim 13 or 14, further comprising one or more reservoirs containing the sensing phase and the organic phase, wherein the channel is loadable with a volume of thesensing phase from the one or more reservoirs and with a volume of the organic phase from the one or more reservoirs.

18. The system of claim 13 or 14, wherein the channel is preloaded with the sensing phase and the organic phase.

Images