Circular RNA and uses thereof

Abstract

Circular RNA (circRNA) is more stable than linear RNA, mainly due to the absence of free ends necessary for exonuclease-mediated degradation. Embodiments of the invention include vectors and methods for producing circRNA. In aspects, a hammerhead ribozyme catalyzes reversible cleavage and ligation reactions at a specific site within an RNA molecule. Accordingly, embodiments also include methods of treating or preventing a disorder or a disease, first and second medical uses of circular RNA, compositions and vaccines.

Description

PATENT EX1-006WOCIRCULAR RNA AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No.63 / 778,316, filed March 26, 2025, the disclosure of which is herein incorporated by reference in its entirety.REFERENCE TO SEQUENCE LISTING

[0002] This application contains a sequence listing which has been submitted electronically in .xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on March 26, 2026, is named EX1-006WO-SEQID and is 12,191 bytes in size.TECHNICAL FIELD

[0003] The present disclosure relates generally to therapeutics, and more specifically, to circular RNA therapeutics, and methods of producing the same.BACKGROUND

[0004] Circular RNA has emerged as an innovative candidate for a variety of pharmaceutical uses, but efficient purification continues to be a challenge. This is due, in part, to various types and combinations of unwanted contaminants in the sample that need to be separated from the desired RNA species in order to obtain a pure RNA sample. Such contaminants are generally components and by-products of any upstream process, such as RNA production. If in vitro transcription is used to produce large RNAs, after successful transcription, the sample generally contains the desired RNA species, unwanted RNA species, proteins, DN A or fragments thereof, pyrophosphate and free nucleotides.

[0005] The covalently-closed structure of circRNAs offers a significant stability advantage over linear mRNA for therapeutic applications. Without 5' or 3' ends, circular RNAs are more resistant to exonuclease degradation than linear RNA. This increased stability may promote pharmacokinetic accumulation in various cell or tissue types. ThisPATENT EX1-006WOcharacteristic could mean that lower doses are required for therapeutic impact, which would reduce manufacturing costs and potentially improving patient safety. In addition, without a 5' end, circRNA does not require a capping agent, which accounts for about 40 percent of the spend on mRNA raw materials, making circRNA considerably less expensive to manufacture than linear mRNA.

[0006] The protein-coding ability of circular RNAs, coupled with the stability, storage and pharmacokinetic improvements compared to linear mRNA, suggest that circRNA may be the next revolution in nucleic acid therapeutics. There is a need to provide an RNA construct that is capable of being self-circularized via a self-targeting and splicing reaction. The construct should be capable of initiating translation in a eukaryotic cell, thereby enabling efficient production of a desired polypeptide.SUMMARY OF THE INVENTION

[0007] The following summary is provided to facilitate an understanding of some of the innovative features unique to the disclosed embodiment and is not intended to be a full description. A full appreciation of the various aspects of the embodiments disclosed herein can be gained by taking into consideration the entire specification, claims, drawings, and abstract as a whole.

[0008] The present invention may include a vector for producing circular RNA (circRNA). In a preferred embodiment, the vector comprises: a promoter; at least one homology arm comprising a self-kissing loop (SKL) sequence; a ribozyme sequence; at least one splice site recognition sequence (SSRS) region; and a gene of interest (GOI) region.

[0009] In some embodiments, the promoter is a T7 promoter, a T3 promoter, an SP6 promoter, or a eukaryotic RNA polymerase II promoter. In embodiments, the ribozyme sequence is an Azoarcus ribozyme.

[0010] In some embodiments, the vector may comprise a 5’ homology arm comprising a SKL and a 5’ SSRS region before the GOI region, and a 3’ homology arm comprising a SKL and a 3’ SSRS region after the GOI region.

[0011] The at least one SSRS region may comprise a 5’ terminal sequence and a 3’PATENT EX1-006WOterminus structured RNA element, such as a tRNA fragment, a ribosomal RNA fragment, a small nuclear RNA (snRNA) stem-loop, a synthetic RNA hairpin, an aptamer, or a ribozyme domain.

[0012] In some embodiments, the SSRS region may comprise a nucleotide selected from guanine (G), adenine (A), cytosine (C), or uracil (II) at the 5' end, and a structured RNA element at the 3' end. In some embodiments, the polynucleotide sequence encoding a gene of interest (GOI) may comprise an internal ribosome entry site (IRES) operably linked to an open reading frame (ORF).

[0013] The invention includes vectors and methods of producing circular RNA (circRNA) in a solution. In some aspects, the method results in circular RNA that is greater than 80% circular. In aspects, the method results in circular RNA that contains no detectable double-stranded RNA (dsRNA). In aspects, the invention may be a pharmaceutical composition comprising circRNA and a pharmaceutically acceptable excipient or carrier. In a preferred embodiment, the pharmaceutically acceptable carrier is a lipid nanoparticle that encapsulates the circular RNA. In some embodiments, the pharmaceutical composition may be a vaccine or component of a vaccine.

[0014] In aspects, the circRNA encodes at least one antigenic peptide or protein of a virus that induces an efficient antigen-specific immune responses against the encoded antigenic peptide or protein.

[0015] In some aspects, the GOI region may encode a therapeutic protein or immunogenic antigen. The GOI may encode a wide range of therapeutic proteins, including chimeric antigen receptors (CARs), T-cell receptors (TCRs), antibodies, cytokines, growth factors, hormones, or biochemical enzymes. Alternatively, the vector may encode immunogenic antigens derived from viral, bacterial, parasitic, fungal pathogens, tumor antigens or neoantigens.

[0016] In aspects, the compositions described herein include high stability, low immunogenicity, protein / peptide-coding capacity and special closed-loop construction, circRNA vaccine and circRNA-based therapeutic platforms.

[0017] In aspects, the constructs described herein improve the efficiency (e.g., recovery)PATENT EX1-006WOof circRNA compared to conventional constructs. In aspects, the constructs described herein improve the purity (e.g., yield of circRNA) compared to conventional constructs.

[0018] Embodiments also include polynucleotides (e.g., a DNA sequences) encoding a circular RNA molecule; wherein the circular RNA molecule has a sequence of at least 80%, at least 85%, at least 90% or at least 95% identity to one of SEQ ID NO: 1 - 6.

[0019] Embodiments also include a vector for making circular RNA. In one aspect, the vector may comprise, in a 5’ to 3’ direction: a) a T7 promoter and a hammerhead ribozyme; b) a 5' homology arm with self-kissing loop (SKL); c) a ribozyme sequence capable of catalyzing a circularization reaction; d) a splice site recognition sequence (SSRS) region; e) a gene of interest (GOI) region; f) a fragment containing a target splice site comprising a 3’ terminus structured RNA element; and h) a 3’ homology arm with self-kissing loop (SKL).

[0020] In aspects, the vector allows production of a circular RNA that is translatable or biologically active inside eukaryotic cells.

[0021] Embodiments also include composition that includes one or more of the circular RNA molecules and / or the nucleic acids described herein.

[0022] Embodiments also include host cells that include one or more of the circular RNA molecules and / or the nucleic acids described herein.

[0023] Embodiments may include methods for producing a protein in vitro, the method comprising contacting a cell with a circular RNA molecule or a nucleic acid described herein under conditions whereby the protein-coding nucleic acid sequence of the circular RNA is translated and the protein is produced.

[0024] Embodiments also include methods for producing a protein a cell, the method comprising contacting a cell-free extract with a circular RNA molecule or a nucleic acid under conditions whereby the protein-coding nucleic acid sequence of the circular RNA is translated and the protein is produced in the cell. Aspects of the invention further include methods of inducing an immune response in a subject by administering a pharmaceutical composition comprising the circular RNA at a dose of about 0.1 pg to about 1000 pg.PATENT EX1-006WO

[0025] In aspects, encapsulation and drug delivery modalities are used such as lipid nanoparticles (LNP), synthetic or natural exosomes, lipid bilayers, liposomal and alginate formulation or other synthetic or natural polymer encapsulation techniques. In aspects, the miRNAs and / or small molecules described herein are administered by sublingual, acid-stable capsules, and / or transdermal methods.

[0026] Embodiments also include methods of treating an ailment as well as inducing an immune response in a subject. The methods can include administering to a subject a composition that includes a circRNA with a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 1 - 6.BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The accompanying drawings illustrate aspects of the present invention. In such drawings:

[0028] FIG. 1A is nucleotide construct for a circular RNA (“Construct 1”).

[0029] FIG. 1 B is nucleotide construct for a circular RNA (“Construct 2”).

[0030] FIG. 1 C is nucleotide construct for a circular RNA (“Construct 3”).

[0031] FIG. 1 D is nucleotide construct for a circular RNA (“Construct 4”).

[0032] FIG. 1 E is nucleotide construct for a circular RNA (“Construct 5”).

[0033] FIG. 1 F is nucleotide construct for a circular RNA (“Construct 6”).

[0034] FIG. 2 is a depiction of RNA (“Construct 5”) with component sequences labelled.

[0035] FIG. 3A depicts the secondary structure of trans-splicing group I intron ribozymes from Azoarcus. The 5' terminus of the trans-splicing ribozymes (black) is truncated at or near the splice site G:U base pair (filled circle) such that the P1 helix (P1 ) is formed between the ribozyme 5' terminus and the target site on the substrate (red). This helix is extended on the Azoarcus ribozyme construct by a P1 helix extension (P1ex) to ribozyme substrate complex stability. A 5'-terminal guanosine was added for better in vitro transcription yields. Filled triangles indicate the 5' splice sites, whereas empty triangles denote the 3' splice sites. Empty squares denote nucleotides that differPATENT EX1-006WObetween splice sites.

[0036] FIG. 3B is a schematic of a trans-splicing reaction. The colors for substrate and ribozyme 3' exon are as FIG. 2B, whereas sequences are denoted by solid lines (with the exception of the splice site G:U pair), and the ribozyme is denoted by a solid black line. During the trans-splicing reaction, the ribozyme 3' exon (blue) replaces the 3' portion of the substrate.

[0037] FIG. 3 is a depiction of steps in producing a circular RNA using nucleotide constructs described herein.Definitions

[0038] Reference in this specification to "one embodiment / aspect" or "an embodiment / aspect" means that a particular feature, structure, or characteristic described in connection with the embodiment / aspect is included in at least one embodiment / aspect of the disclosure. The use of the phrase "in one embodiment / aspect" or "in another embodiment / aspect" in various places in the specification are not necessarily all referring to the same embodiment / aspect, nor are separate or alternative embodiments / aspects mutually exclusive of other embodiments / aspects. Moreover, various features are described which may be exhibited by some embodiments / aspects and not by others. Similarly, various requirements are described which may be requirements for some embodiments / aspects but not other embodiments / aspects. Embodiment and aspect can in certain instances be used interchangeably.

[0039] The terms used in this specification generally have their ordinary meanings in the art, within the context of the disclosure, and in the specific context where each term is used. Certain terms that are used to describe the disclosure are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner regarding the description of the disclosure. It will be appreciated that the same thing can be said in more than one way.

[0040] Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein. Nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms arePATENT EX1-006WOprovided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification including examples of any terms discussed herein is illustrative only, and is not intended to further limit the scope and meaning of the disclosure or of any exemplified term. Likewise, the disclosure is not limited to various embodiments given in this specification.

[0041] The term “isolated” refers to a nucleic acid, peptide or protein free from at least some of the components with which it naturally occurs.

[0042] The term “peptides,” “polypeptides” and “proteins” are used interchangeably and are defined herein as chains of amino acids (typically L-amino acids) in which the carbonyl group of one amino acid is linked to the amino group of a second amino acid by an amide linkage. The terminal amino acid at one end of the chain (i.e. , the amino terminal) has a free amino group, while the terminal amino acid at the other end of the chain (i.e., the carboxy terminal) has a free carboxyl group. Typically, the amino acids making up a peptide are numbered in order, starting at the amino terminal and increasing in the direction of the carboxy terminal of the peptide. Thus, when one amino acid is said to “follow” another, that amino acid is positioned closer to the carboxy terminal of the peptide than the “preceding” amino acid.

[0043] The term “residue” refers to an amino acid (D or L) or an amino acid mimetic that is incorporated into a peptide by an amide bond or an amide bond mimetic. As such, the amino acid may be a naturally occurring amino acid or, unless otherwise limited, may encompass known analogs of natural amino acids that function in a manner similar to the naturally occurring amino acids (i.e. amino acid mimetics). Moreover, an amide bond mimetic includes peptide backbone modifications well known to those skilled in the art.

[0044] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double-PATENT EX1-006WOand single-stranded molecules.

[0045] The term "polyribonucleotide" refers to a polymer of ribonucleotides, which may be linear or circular, and may be used interchangeably with vector in the context of the present invention

[0046] The term "structured RNA element" refers to an RNA sequence capable of forming a secondary or tertiary structure, including but not limited to a tRNA fragment, a ribosomal RNA fragment, a small nuclear RNA (snRNA) stem-loop, a synthetic RNA hairpin, an aptamer, or a ribozyme domain.

[0047] A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.

[0048] The term "recombinant," as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature. A recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.

[0049] The terms “coding sequence,” “coding sequence region,” “coding region,” and “CDS” when referring to nucleic acid sequences may be used interchangeably herein to refer to the portion of a DNA or RNA sequence, for example, that is or may be translated to protein. The terms “reading frame,” “open reading frame,” and “ORF,” may be used interchangeably herein to refer to a nucleotide sequence that begins with an initiation codon (e.g., ATG) and, in some embodiments, ends with a termination codon (e.g., TAA, TAG, or TGA). Open reading frames may contain introns and exons, and as such, all CDSs are ORFs, but not all ORF are CDSs.

[0050] The terms “complementary” and “complementarity” refers to the relationship between two nucleic acid sequences or nucleic acid monomers having the capacity to form hydrogen bond(s) with one another by either traditional Watson-Crick base-paring or other non-traditional types of pairing. The degree of complementarity between two nucleic acid sequences can be indicated by the percentage of nucleotides in a nucleicPATENT EX1-006WOacid sequence which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., about 50%, about 60%, about 70%, about 80%, about 90%, and 100% complementary). Two nucleic acid sequences are “perfectly complementary” if all the contiguous nucleotides of a nucleic acid sequence will hydrogen bond with the same number of contiguous nucleotides in a second nucleic acid sequence. Two nucleic acid sequences are “substantially complementary” if the degree of complementarity between the two nucleic acid sequences is at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) over a region of at least 8 nucleotides (e.g., at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, or more nucleotides), or if the two nucleic acid sequences hybridize under at least moderate, or, in some embodiments high, stringency conditions.

[0051] The term “secondary structure,” or “secondary structure element” or “secondary structure sequence region” as used herein in reference to nucleic acid sequences (e.g., RNA, DNA, etc), refers to any non-linear conformation of nucleotide or ribonucleotide units. Such non-linear conformations may include base-pairing interactions within a single nucleic acid polymer or between two polymers. Single-stranded RNA typically forms complex and intricate base-pairing interactions due to its increased ability to form hydrogen bonds stemming from the extra hydroxyl group in the ribose sugar. Examples of secondary structures or secondary structure elements include but are not limited to, for example, stem-loops, hairpin structures, bulges, internal loops, multiloops, coils, random coils, helices, partial helices and pseudoknots.

[0052] The term "self-kissing loop" or "SKL" refers to a sequence within a homology arm or other RNA region capable of intramolecular or intermolecular pairing to promote folding of the vector or precursor RNA into a conformation conducive to splicing and circularization. In certain embodiments of the invention, the vector to produce circular RNA may comprise at least one homology arm comprising a self-kissing loop (SKL) sequence. In a preferred embodiment, the vector comprises a 5’ homology arm comprising a SKL sequence before the GOI region, and a 3’ homology arm comprisingPATENT EX1-006WOa SKL sequence after the GOI region.

[0053] The term “antigen” refers to a molecule which can induce an immune response in an animal, preferably a mammal and most preferably a human. It induces the formation of an antibody. The term includes immunogens and immunogenic antigens. Antigens may be selected from a viral antigen, a bacterial antigen, a parasitic antigen, a fungal antigen, a tumor antigen, and a neoantigen, and may comprise at least a portion of a spike protein, a nucleocapsid protein, a membrane protein, an envelope protein, a capsid protein, a surface glycoprotein, or an immunodominant domain thereof.

[0054] The term “therapeutic protein” refers to a peptide or polypeptide sequence encoded by a polynucleotide (e.g., a circular RNA) that, when translated, exerts a desired pharmacologic, physiologic, or biological effect in a subject. This term encompasses a wide range of functional and structural protein classes, including but not limited to: a chimeric antigen receptor (CAR), a T-cell receptor (TCR), a B-cell receptor (BCR), an immune cell activation receptor, an immune cell inhibitory receptor, a recombinant fusion protein, a chimeric mutant protein, an antibody, a nanobody, a nonantibody binding protein, an Fc fusion protein, an immune modulatory ligand, an immune modulatory receptor, a checkpoint inhibitor, a checkpoint agonist, a cytokine, a chemokine, a growth factor, a growth factor receptor, a hormone, a hormone receptor, a transcription factor, a blood clotting factor, an anticoagulant, a biochemical enzyme, a chaperone protein, an antimicrobial protein, a structural protein, a cytoskeletal protein, a tight junction protein, a metal-binding protein, a mitochondrial protein, and a secreted protein.

[0055] The term "secreted therapeutic protein" includes proteins such as an antibody, an Fc fusion protein, an enzyme, a cytokine, a growth factor, a hormone, and a blood clotting factor.

[0056] The term "intracellular protein" includes proteins such as a transcription factor, a biochemical enzyme, a chaperone protein, a cytoskeletal protein, a tight junction protein, a metal-binding protein, and a mitochondrial protein.

[0057] The term “vaccine” refers to the ability to stimulate an immune response in an organism (i.e., to produce specific immune cells that activate, proliferate, differentiate,PATENT EX1-006WOand ultimately produce immune effector-specific antibodies or sensitized lymphocytes, and to be reactive).

[0058] The term “epitope” or “determinant” refers to the antibody binding site on an antigen.

[0059] The term “antibody” refers to a molecule produced by animals in response to antigen which has the particular property of combining specifically with the antigen which induced its formation.

[0060] The term “neutralizing antibody” refers to an antibody that blocks viral infection of a cell.

[0061] The term “neutralizing antigenic epitope” or “neutralizing epitope” refers to an epitope that elicits a neutralizing antibody.

[0062] The phrases “specifically binds to a peptide” or “specifically immunoreactive with”, when referring to an antibody, refers to a binding reaction which is determinative of the presence of the peptide, or an antibody to the peptide, in the presence of a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies bind preferentially to a particular peptide and do not bind in a significant amount to other proteins present in the sample. Specific binding to a peptide under such conditions requires an antibody that is selected for its specificity for a particular protein or a particular epitope. In some embodiments, antibodies bind to a protein of one subtype or clade of influenza and not another, for example, antibodies bind to hemagglutinin from H5N1 subtype of influenza and not to H3N2. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solution or solid phase immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.

[0063] The term “conservative variations” or “conservative modified variations” of a particular sequence refers to amino acids encoded by nucleic acids which encodePATENT EX1-006WOidentical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given peptide. Such nucleic acid variations are silent variations, which are one species of conservatively modified variations. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule by standard techniques.Accordingly, each silent variation of a nucleic acid which encodes a peptide is implicit in any described amino acid sequence. Further, one of skill will recognize that individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids in an encoded sequence are conservatively modified variations where the alterations result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another:1) Alanine (A), Serine (S), Threonine (T);2) Aspartic acid (D), Glutamic acid (E);3) Asparagine (N), Glutamine (Q);4) Arginine (R), Lysine (K);5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

[0064] Two polypeptides are said to be “identical” if the sequence of amino acid residues in the two sequences is the same when aligned for maximum correspondence. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman 1981 Adv Appl Math 2:482-489, by the homology alignment algorithm of Needleman and Wunsch 1970 J Mol Biol 48:443-453, by the search for similarity method of Pearson and Lipman 1988 Proc Natl Acad Sci USA 85:2444-2448, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection. When using BESTFIT or any other sequence alignment program to determine whether a particularPATENT EX1-006WOsequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.

[0065] The term “substantial identity” means that a polypeptide comprises a sequence that has at least 55%, 60%, 65%, 70%, 75%, 80%, or 85% sequence identity, preferably 90%, more preferably 95% or more, compared to a reference sequence. Another indication that polypeptide sequences are substantially identical is if one peptide is immunologically reactive with antibodies raised against the disclosed peptide. Thus, the peptides of the invention include peptides immunologically reactive with antibodies raised against the disclosed immunogenic peptides.

[0066] The term "substantial homology" or "substantial similarity," when referring to a nucleic acid, or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is overfull-length sequence, or an open reading frame thereof, or another suitable fragment which is at least 15 nucleotides in length. Examples of suitable fragments are described herein.

[0067] The terms "sequence identity" "percent sequence identity" or "percent identical" in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired. Similarly, "percent sequence identity" may be readily determined for amino acid sequences, over the full-length of a protein, or a fragment thereof. Suitably, a fragment is at least about 8 amino acids in length, and may be up to about 700 amino acids. Examples of suitablePATENT EX1-006WOfragments are described herein.

[0068] The term "substantial homology" or "substantial similarity," when referring to amino acids or fragments thereof, indicates that, when optimally aligned with appropriate amino acid insertions or deletions with another amino acid (or its complementary strand), there is amino acid sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or a protein thereof, e.g., a cap protein, a rep protein, or a fragment thereof which is at least 8 amino acids, or more desirably, at least 15 amino acids in length. Examples of suitable fragments are described herein.

[0069] By the term "highly conserved" is meant at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. Identity is readily determined by one of skill in the art by resort to algorithms and computer programs known by those of skill in the art.

[0070] Generally, when referring to "identity", "homology", or "similarity" between two different adeno-associated viruses, "identity", "homology" or "similarity" is determined in reference to "aligned" sequences. "Aligned" sequences or "alignments" refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. In the examples, AAV alignments are performed using the published AAV2 or AAV1 sequences as a reference point. However, one of skill in the art can readily select another AAV sequence as a reference. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Examples of such programs include, "Clustal W", "CAP Sequence Assembly", "MAP", and "MEME", which are accessible through Web Servers on the internet.

[0071] The term “artificial nucleic acid” as used herein will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to a nucleic acid molecule, e.g. a DNA or an RNA that does not occur naturally. In other words, an artificial nucleic acid may be understood as a non-natural nucleic acid molecule. Such nucleic acid molecule may be non-natural due to its individual sequence (which does not occur naturally, e.g. G / C content modified coding sequence, UTRs)PATENT EX1-006WOand / or due to other modifications, e.g. structural modifications of nucleotides which do not occur naturally. An artificial nucleic acid may be a DNA molecule, an RNA molecule ora hybrid-molecule comprising DNA and RNA portions. Typically, artificial nucleic acids may be designed and / or generated by genetic engineering methods to correspond to a desired artificial sequence of nucleotides (heterologous sequence). In this context an artificial sequence is usually a sequence that may not occur naturally, i.e. it differs from the wild type sequence by at least one nucleotide.

[0072] The term “wild type” as used herein will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a sequence occurring in nature. Further, the term “artificial nucleic acid” is not restricted to mean “one single molecule” but is, typically, understood to comprise an ensemble of essentially identical molecules. Accordingly, it may relate to a plurality of essentially identical molecules contained in an aliquot or a sample.

[0073] The term “circular RNA” or “circRNA” refers to a type of single-stranded RNA which, unlike linear RNA, comprises a covalently closed continuous loop. circRNAs occur naturally in mammalian cells, and play important roles in various biological processes. circRNAs innately possess greater stability and resistance to intra- and extracellular RNAses than mRNAs, making them attractive candidates for delivery of key payloads where long-lasting expression is necessary. Recently, there has been an interest in using recombinant circRNAs to express a protein of interest, in vitro or in vivo. Introduction of an internal ribosome entry sequence (IRES) into a circular RNA allows translation of a protein encoded by a circRNA. However, IRES elements that exist in nature may or may not support translation from engineered circular RNAs, as IRES elements are often evolved in the context of linear RNA genomes.

[0074] The term “ribozyme” refers to a catalytically active RNA molecule or RNA-protein complex, in which solely the RNA provides catalytic activity. The term also refers to the enzymatic activity and ribonucleic acid nature at the same time. Ribozymes are found in the genomes of species from all kingdoms of life.

[0075] The term “Azoarcus” refers to a genus of nitrogen-fixing bacteria. Species in this genus are usually found in contaminated water, as they are involved in the degradationPATENT EX1-006WOof some contaminants, commonly inhabiting soil. The Azoarcus ribozyme is about half the size of the Tetrahymena ribozyme and folds faster into its active conformation in vitro. Recent studies suggest that in vitro, the Azoarcus and Tetrahymena ribozymes favored the same set of splice sites on a substrate RNA.

[0076] The term “internal ribosome entry sequence” or “IRES” refers to an RNA element that allows for translation initiation in a cap-independent manner, as part of the greater process of protein synthesis. Initiation of eukaryotic translation nearly always occurs at and is dependent on the 5' cap of mRNA molecules, where the translation initiation complex forms and ribosomes engage the mRNA. IRES elements, however allow ribosomes to engage the mRNA and begin translation independently of the 5' cap.

[0077] It will be appreciated that there are two known mechanisms by which translation is initiated in eukaryotes. The first is the canonical cap-dependent mechanism that is used by the vast majority of eukaryotic mRNAs, which requires an m7G cap at the 5'end of the mRNA, initiator Met-tRNAmet, more than a dozen initiation factor proteins, directional scanning, and GTP hydrolysis to place a translationally competent ribosome at the start codon. The second mechanism is cap-independent initiation that is used by some mRNAs as well as many eukaryote-infecting viruses. This mechanism bypasses the need for the cap and often many of the protein factors, using cis-acting IRES RNA elements to recruit the ribosome and initiate protein synthesis. There is great diversity among viral IRES RNAs in terms of their sequences, proposed secondary structures, and functional requirements for protein factors, but all drive a mode of translation initiation that depends on specific RNA sequences and likely specific RNA structures in the IRES.

[0078] An IRES allows ribosomes to bind to an internal part of the mRNA to start translation. IRESs are found in untranslated regions of mRNA. IRESs allow translation to start without the 5' cap-dependent translation initiation mechanism. IRESs are often used when the 5' cap-dependent translation initiation mechanism is blocked or repressed.

[0079] The term “hammerhead ribozyme” refers to an RNA motif that catalyzes reversible cleavage and ligation reactions at a specific site within an RNA molecule. It isPATENT EX1-006WOone of several catalytic RNAs (ribozymes) known to occur in nature. It serves as a model system for research on the structure and properties of RNA, and is used for targeted RNA cleavage experiments, some with proposed therapeutic applications. Named for the resemblance of early secondary structure diagrams to a hammerhead shark, hammerhead ribozymes were originally discovered in two classes of plant viruslike RNAs: satellite RNAs and viroids. They are also known in some classes of retrotransposons, including the retrozymes. The hammerhead ribozyme motif has been ubiquitously reported in lineages across the tree of life.

[0080] The term “region” generally refers to a contiguous nucleotide sequence (e.g., RNA sequence) of a certain length. For example, the term “GOI region,” “IRES region,” “target site region (or splice target site region or cleavage target site region)” used herein mean nucleotide sequences (e.g., RNA sequences) of the GOI, IRES, and the sequence containing target cleavage or splicing site, respectively.

[0081] The term “junction sequence” generally refers to a specific nucleotide sequence formed at the point ef fusion between the 5’ terminal and 3’ terminal of a linear RNA precursor during a circularization process. This sequence, often characterized as a “scar” or “splice remnant,” comprises the remaining residues of the flanking elements, such as ribozymes ortRNA, that facilitated the back-splicing or ligation reaction. The junction sequence serves as the structural and functional bridge that maintains the covalent continuity of the circular RNA (circRNA) molecule and may further include one or more structured RNA elements designed to enhance the stability, translation efficiency, or immunogenicity profile of the resulting circularized transcript.

[0082] The terms used in the example embodiments are used for description purposes only, and should not be construed as being limited by these example embodiments. The terms in singular form may include plural forms unless otherwise specified. It will be understood that the terms “comprising” or “having,” when used herein, specify the presence of stated features, integers, steps, operations, elements, components, or combinations thereof, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, or combinations thereof.

[0083] As used herein, a “homology arm” is any contiguous sequence that is 1)PATENT EX1-006WOpredicted to form base pairs with at least about 75% (e.g., at least about 80%, at least about 85%, at least about 90%, at least about 95%, about 100%) of another sequence in the RNA, such as another homology arm 2) at least 7 nt long and no longer than 250 nt 3) located before and adjacent to, or included within, the 3' intron fragment and / or after and adjacent to, or included within, the 5' intron fragment and, optionally, 4) predicted to have less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, less than 25%) base pairing with unintended sequences in the RNA (e.g., non-homology arm sequences). A “strong homology arm” refers to a homology arm with a Tm of greater than 50 degrees Celsius when base paired with another homology arm in the RNA.

[0084] The term “group I intron” refers to a large self-splicing ribozymes. They catalyze their own excision from mRNA, tRNA and rRNA precursors in a wide range of organisms. The core secondary structure consists of nine paired regions (P1-P9).These fold to essentially two domains - the P4-P6 domain (formed from the stacking of P5, P4, P6 and P6a helices) and the P3-P9 domain (formed from the P8, P3, P7 and P9 helices).

[0085] As used herein, a 3' group I intron fragment is a contiguous sequence that is at least 75% (e.g., at least 80%, at least 85%, at least 90%, at least 95%, 100%) homologous to a 3' proximal fragment of a natural group I intron, including the 3' splice site dinucleotide, and, optionally, the adjacent exon sequence at least 1 nucleotide in length (e.g., at least 5 nucleotides in length, at least 10 nucleotides in length, at least 15 nucleotides in length, at least 20 nucleotides in length, at least 25 nucleotides in length, at least 50 nucleotides in length). In one embodiment, the included adjacent exon sequence is about the length of the natural exon. In some embodiments, a 5' group I intron fragment is a contiguous sequence that is at least 75% (e.g., at least 80%, at least 85%, at least 90%, at least 95%, 100%) homologous to a 5' proximal fragment of a natural group I intron, including the 5' splice site dinucleotide and, optionally, the adjacent exon sequence at least 1 nucleotide in length (e.g., at least 5 nucleotides in length, at least 10 nucleotides in length, at least 15 nucleotides in length, at least 20 nucleotides in length, at least 25 nucleotides in length, at least 50 nucleotides in length). In one embodiment, the included adjacent exon sequence is about the length of thePATENT EX1-006WOnatural exon.

[0086] As used herein, a “spacer” refers to any contiguous nucleotide sequence that is 1) predicted to avoid interfering with proximal structures, for example, from the IRES, coding or noncoding region, or intron 2) at least 7 nucleotides long (and optionally no longer than 100 nucleotides) 3) located downstream of and adjacent to the 3' intron fragment and / or upstream of and adjacent to the 5' intron fragment and / or 4) contains one or more of the following: a) an unstructured region at least 5 nt long b) a region predicted base pairing at least 5 nt long to a distal (i.e. , non-adjacent) sequence, including another spacer, and / or c) a structured region at least 7 nt long limited in scope to the sequence of the spacer. Spacer sequences as described herein can have two functions: (1) promote circularization and (2) promote functionality by allowing the introns and IRES to fold correctly.

[0087] The term “interfering” with regard to sequences refers to sequence(s) predicted or empirically determined to alter the folding of other structures in the RNA, such as the IRES or group I intron-derived sequences.

[0088] The term “unstructured” with regard to RNA refers to an RNA sequence that is not predicted by the RNAFold software or similar predictive tools to form a structure (e.g., a hairpin loop) with itself or other sequences in the same RNA molecule.

[0089] The term "substrate recognition duplex" refers to a region or structure within a double-stranded RNA (dsRNA) or RNA-DNA hybrid that is specifically recognized by enzymes or proteins, guiding them to a particular location for further action (i.e., transcription).

[0090] An "infectious" virus or viral particle is one that comprises a polynucleotide component that it is capable of delivering into a cell for which the viral species is tropic. The term does not necessarily imply any replication capacity of the virus. As used herein, an "infectious" virus or viral particle is one that can access a target cell, can infect a target cell, and can express a heterologous nucleic acid in a target cell. Thus, "infectivity" refers to the ability of a viral particle to access a target cell, infect a target cell, and express a heterologous nucleic acid in a target cell. Infectivity can refer to in vitro infectivity or in vivo infectivity. Assays for counting infectious viral particles arePATENT EX1-006WOdescribed elsewhere in this disclosure and in the art. Viral infectivity can be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles can be expressed as the number of viral genome copies. The ability of a viral particle to express a heterologous nucleic acid in a cell can be referred to as "transduction." The ability of a viral particle to express a heterologous nucleic acid in a cell can be assayed using a number of techniques, including assessment of a marker gene, such as a green fluorescent protein (GFP) assay (e.g., where the virus comprises a nucleotide sequence encoding GFP), where GFP is produced in a cell infected with the viral particle and is detected and / or measured; or the measurement of a produced protein, for example by an enzyme-linked immunosorbent assay (ELISA).

[0091] The term "control element" or "control sequence" refers to a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3' direction) from the promoter.

[0092] The term "operatively linked" or "operably linked" refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For example, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.

[0093] The term "expression vector" refers to a vector comprising a region which encodes a polypeptide of interest, and is used for effecting the expression of the protein in an intended target cell. An expression vector also comprises control elements operatively linked to the encoding region to facilitate expression of the protein in the target. The combination of control elements and a gene or genes to which they arePATENT EX1-006WOoperably linked for expression is sometimes referred to as an "expression cassette," a large number of which are known and available in the art or can be readily constructed from components that are available in the art. Expression is meant to include the transcription of any one or more of a recombinant nucleic acid encoding a circular RNA, or mRNA from a DNA or RNA template and can further include translation of a protein from a recombinant circular RNA comprising an IRES sequence (e.g., a non-native IRES). Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and a coding sequence and the promoter sequence can still be considered to be “operably linked” to the coding sequence.

[0094] "Heterologous" means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous gene product is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally-occurring, wild-type AAV.

[0095] The terms "genetic alteration" and "genetic modification" (and grammatical variants thereof), are used interchangeably herein to refer to a process wherein a genetic element (e.g., a polynucleotide) is introduced into a cell other than by mitosis or meiosis. The element may be heterologous to the cell, or it may be an additional copy or improved version of an element already present in the cell. Genetic alteration may be effected, for example, by transfecting a cell with a recombinant plasmid or other polynucleotide through any process known in the art, such as electroporation, calcium phosphate precipitation, or contacting with a polynucleotide-liposome complex. Genetic alteration may also be effected, for example, by transduction or infection with a DNA or RNA virus or viral vector. Generally, the genetic element is introduced into a chromosome or mini-chromosome in the cell; but any alteration that changes the phenotype and / or genotype of the cell and its progeny is included in this term.PATENT EX1-006WO

[0096] A cell is said to be "stably" altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro. Generally, such a cell is "heritably" altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell.

[0097] An "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this invention are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some embodiments purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.

[0098] The term “nanoparticle” refers to a particle of matter, generally between about 1 and 100 nanometers (nm) in diameter. As used herein, a nanoparticle can refer to a liposome, virus, viral vector or other viral particle.

[0099] The term “liposome” refers to a spherical vesicle having at least one lipid bilayer (i.e. an aqueous solution core surrounded by a hydrophobic membrane). Liposomes can be prepared by disrupting biological membranes (such as by sonication).Liposomes are formed when phospholipids and their derivatives are dispersed in water. Upon dispersion in water the phospholipids form closed vesicles called “liposomes,” which are characterized by lipid bilayers encapsulating an aqueous core. Various liposomes have been used as carriers for entrapped therapeutic agents, such as drugs, enzymes and genetic sequences for use in medical science, in pharmaceutical science and in biochemistry. Specific uses include delivery of nutrients and pharmaceutical drugs, such as lipid nanoparticles in mRNA pharmaceutical compositions and DNAPATENT EX1-006WOpharmaceutical compositions. Liposomes can be modified by the incorporation of polyethylene glycol or other hydrophilic polymers (e.g., a PEG liposome where one or more of the constituent lipids is modified by attachment of PEG). Liposomes can also be modified to target particular cell types by incorporating targeting factors (e.g., “targeting ligands”) for particular cell types. Examples include asialoglycoprotein, folate, transferrin, antibodies, etc.

[0100] The term “exosome” refers to a membrane-bound extracellular vesicles that are produced in the endosomal compartment of most eukaryotic cells. In multicellular organisms, exosomes and other EVs are found in biological fluids including saliva, blood, urine and cerebrospinal fluid. Exosomes are similar to liposomes in terms of consisting of bilayered phospholipids, but the biogenesis of exosomes ensures their biocompatibility and low toxicity. It also significantly complicates pharmaceutical development, production and safety profiling (immunogenicity, and potential biological impurities).

[0101] As used herein, the terms "treatment," "treating," and the like, refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete cure for a disease and / or adverse affect attributable to the disease. "Treatment," as used herein, covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease or at risk of acquiring the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e. , arresting its development; and (c) relieving the disease, i.e. , causing regression of the disease.

[0102] The terms "individual," "host," "subject," and "patient" are used interchangeably herein, and refer to a mammal, including, but not limited to, human and non-human primates, including simians and humans; mammalian sport animals (e.g., horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.).

[0103] The term “adaptive immune response” as used herein will be recognized andPATENT EX1-006WOunderstood by the person of ordinary skill in the art, and is for example intended to refer to an antigen-specific response of the immune system. Antigen specificity allows for the generation of responses that are tailored to specific pathogens or pathogen-infected cells. The ability to mount these tailored responses is usually maintained in the body by “memory cells” (B-cells). In the context of the invention, the antigen (e.g. Bunyavirales peptide, protein, polyprotein) is provided by the artificial nucleic acid coding sequence encoding at least one antigenic peptide, protein or polyprotein of the invention.

[0104] The term “adaptive immune system” as used herein will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a highly adaptable system typically regulating the adaptive immune response by providing the vertebrate immune system with the ability to recognize and remember specific pathogens (to generate immunity), and to mount stronger attacks each time the pathogen is encountered. The system is highly adaptable because of somatic hyper mutation (a process of accelerated somatic mutations), and V(D)J recombination (an irreversible genetic recombination of antigen receptor gene segments). This mechanism allows a small number of genes to generate a vast number of different antigen receptors, which are then uniquely expressed on each individual lymphocyte. Because the gene rearrangement leads to an irreversible change in the DNA of each cell, all of the progeny (offspring) of such a cell will then inherit genes encoding the same receptor specificity, including the Memory B cells and Memory T cells that are the keys to induce long-lived specific immunity.

[0105] The term “antigen” as used herein will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a substance which may be recognized by the immune system, preferably by the adaptive immune system, and is capable of triggering an antigen-specific immune response, e.g. by formation of antibodies and / or antigen-specific T cells as part of an adaptive immune response. Typically, an antigen may be or may comprise a peptide or protein which may be presented by the MHC to T-cells. In the context of the present invention, an antigen, e.g. a Bunyavirales antigen, may be the product of translation of a provided inventive artificial nucleic acid of the, preferably of the mRNA as specified herein. Also fragments, variants and derivatives of peptides, proteins, or polyproteins of a virus of the orderPATENT EX1-006WOBunyavirales comprising at least one epitope are understood as antigens in the context of the invention.

[0106] The terms “cellular immunity” or “cellular immune response” or “cellular T-cell responses” as used herein will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to the activation of macrophages, natural killer cells (NK), antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen. In more general terms, cellular immunity is not based on antibodies, but on the activation of cells of the immune system. Typically, a cellular immune response may be characterized e.g. by activating antigen-specific cytotoxic T-lymphocytes that are able to induce apoptosis in cells, e.g. specific immune cells like dendritic cells or other cells, displaying epitopes of foreign antigens on their surface. In the context of the invention, the antigen (e.g. Bunyavirales peptide, protein, polyprotein) is provided by the artificial nucleic acid coding sequence encoding at least one antigenic peptide, protein or polyprotein of the invention.

[0107] The term “derived from” as used throughout the present specification in the context of a nucleic acid, i.e. for a nucleic acid “derived from” (another) nucleic acid, means that the nucleic acid, which is derived from (another) nucleic acid, shares at least 50%, preferably at least 55%, preferably at least 60%, preferably at least 65%, preferably at least 70%, more preferably at least 75%, more preferably at least 80%, 81%, 82%, 83%, 84%, more preferably at least 85%, 86%, 87%, 88%, 89% even more preferably at least 90%, 91%, 92%, 93%, 94%, even more preferably at least 95%, 96%, 97%, and particularly preferably at least 98%, 99% sequence identity with the nucleic acid from which it is derived. The skilled person is aware that sequence identity is typically calculated for the same types of nucleic acids, i.e. for DNA sequences or for RNA sequences. Thus, it is understood, if a DNA is “derived from” an RNA or if an RNA is “derived from” a DNA, in a first step the RNA sequence is converted into the corresponding DNA sequence (in particular by replacing the uracils (U) by thymidines (T) throughout the sequence) or, vice versa, the DNA sequence is converted into the corresponding RNA sequence (in particular by replacing the thymidines (T) by uracils (II) throughout the sequence). Thereafter, the sequence identity of the DNA sequences or the sequence identity of the RNA sequences is determined. Preferably, a nucleic acidPATENT EX1-006WO“derived from” a nucleic acid also refers to nucleic acid, which is modified in comparison to the nucleic acid from which it is derived, e.g. in order to increase RNA stability even further and / or to prolong and / or increase protein production. It goes without saying that such modifications are preferred, which do not impair RNA stability, e.g. in comparison to the nucleic acid from which it is derived.

[0108] The term “epitope” (also called “antigen determinant” in the art) as used herein will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to T cell epitopes and B cell epitopes. T cell epitopes or parts of the antigenic peptides or proteins may comprise fragments preferably having a length of about 6 to about 20 or even more amino acids, e.g. fragments as processed and presented by MHC class I molecules, preferably having a length of about 8 to about 10 amino acids, e.g. 8, 9, or 10, (or even 11 , or 12 amino acids), or fragments as processed and presented by MHC class II molecules, preferably having a length of about 13 to about 20 or even more amino acids, wherein these fragments may be selected from any part of the amino acid sequence. These fragments are typically recognized by T cells in form of a complex consisting of the peptide fragment and an MHC molecule, i.e. the fragments are typically not recognized in their native form. B cell epitopes are typically fragments located on the outer surface of (native) protein or peptide antigens (e.g. Bunyavirales antigens), preferably having 5 to 15 amino acids, more preferably having 5 to 12 amino acids, even more preferably having 6 to 9 amino acids, which may be recognized by antibodies, i.e. in their native form. Such epitopes of proteins or peptides may furthermore be selected from any of the herein mentioned variants of such proteins or peptides. In this context antigenic determinants can be conformational or discontinuous epitopes which are composed of segments of the proteins or peptides as defined herein that are discontinuous in the amino acid sequence of the proteins or peptides as defined herein but are brought together in the three-dimensional structure or continuous or linear epitopes which are composed of a single polypeptide chain.

[0109] The term “immune response” will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a specific reaction of the adaptive immune system to a particular antigen (so called specific or adaptivePATENT EX1-006WOimmune response) or an unspecific reaction of the innate immune system (so called unspecific or innate immune response), or a combination thereof.

[0110] The term “immune system” will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a system of the organism that may protect the organisms from infection. If a pathogen succeeds in passing a physical barrier of an organism and enters this organism, the innate immune system provides an immediate, but non-specific response. If pathogens evade this innate response, vertebrates possess a second layer of protection, the adaptive immune system. Here, the immune system adapts its response during an infection to improve its recognition of the pathogen. This improved response is then retained after the pathogen has been eliminated, in the form of an immunological memory, and allows the adaptive immune system to mount faster and stronger attacks each time this pathogen is encountered. According to this, the immune system comprises the innate and the adaptive immune system. Each of these two parts typically contains so called humoral and cellular components.

[0111] The term “innate immune system” (also known as non-specific or unspecific immune system) will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a system typically comprising the cells and mechanisms that defend the host from infection by other organisms in a non-specific manner. This means that the cells of the innate system may recognize and respond to pathogens in a generic way, but unlike the adaptive immune system, it does not confer long-lasting or protective immunity to the host. The innate immune system may be, e.g. activated by ligands of Toll-like receptors (TLRs) or other auxiliary substances such as lipopolysaccharides, TNF-alpha, CD40 ligand, or cytokines, monokines, lymphokines, interleukins or chemokines, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IFN-alpha, IFN-beta, IFN-gamma, GM-CSF, G-CSF, M-CSF, LT-beta, TNF-alpha, growth factors, and hGH, a ligand of human Toll-like receptor TLR1 , TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, a ligand of murine Toll-like receptor TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11 , TLR12 or TLR13, a ligand of a NOD-likePATENT EX1-006WOreceptor, a ligand of a RIG-1 like receptor, an immunostimulatory nucleic acid, an immunostimulatory RNA (isRNA), a CpG-DNA, an antibacterial agent, or an anti-viral agent.

[0112] The terms “isolate” or “isolate of a virus” as used herein, will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to a specific isolated virus of a certain virus species. In the context of the invention, a natural Bunyavirales isolate is an instance of a particular natural virus or of a particular genetic strain (or variant). Isolates can be identical or slightly different in consensus or individual sequence from each other.

[0113] The term “peptide” will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to a polymer of amino acid monomers, linked by peptide bonds. It typically contains less than 50 amino acid monomers. Nevertheless, the term peptide is not a disclaimer for molecules having more than 50 amino acid monomers.

[0114] The terms “pharmaceutically effective amount” or “effective amount” will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to an amount of a compound (e.g. the artificial nucleic acid of the invention) that is sufficient to induce a pharmaceutical effect, such as, in the context of the invention, an immune response (e.g. against an antigenic peptide, protein, polyprotein as defined herein).

[0115] The term “strain” or “strain of a virus” is a group of viruses that are genetically distinct from other groups of the same species. Accordingly, a “strain” is a variant of a given virus (species) that is recognizable because it possesses some unique phenotypic characteristics that remain stable under natural conditions. In the context of the invention, the terms “variant” of a virus and “strain” of a virus are used interchangeably.

[0116] The term “stabilized nucleic acid molecule” or “stabilized RNA” refer to is a nucleic acid molecule, preferably an RNA molecule that is modified such, that it is more stable to disintegration or degradation, e.g., by environmental factors or enzymatic digest, such as by an exo- or endonuclease degradation, than the nucleic acid molecule without the modification. Preferably, a stabilized nucleic acid molecule, e.g. stabilizedPATENT EX1-006WORNA, in the context of the present invention is stabilized in a cell, such as a prokaryotic or eukaryotic cell, preferably in a mammalian cell, such as a human cell. The stabilization effect may also be exerted outside of cells, e.g. in a buffer solution etc., for example, in a manufacturing process for a pharmaceutical composition comprising the stabilized nucleic acid molecule.

[0117] The term “variant” as used herein in the context of a nucleic acid sequence will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a variant of nucleic acid sequences which forms the basis of a nucleic acid sequence. For example, a variant nucleic acid sequence may exhibit one or more nucleotide deletions, insertions, additions and / or substitutions compared to the nucleic acid sequence from which the variant is derived. Preferably, a variant of a nucleic acid sequence is at least 40%, preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% identical to the nucleic acid sequence the variant is derived from. Preferably, the variant is a functional variant. A “variant” of a nucleic acid sequence may have at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% nucleotide identity over a stretch of 10, 20, 30, 50, 75 or 100 nucleotide of such nucleic acid sequence.

[0118] The term “variant” as used herein in the context of proteins or peptides will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a proteins or peptide variant having an amino acid sequence which differs from the original sequence in one or more mutation(s), such as one or more substituted, inserted and / or deleted amino acid(s). Preferably, these fragments and / or variants have the same biological function or specific activity compared to the full-length native protein, e.g. its specific antigenic property. “Variants” of proteins or peptides as defined in the context of the present invention may comprise conservative amino acid substitution(s) compared to their native, i.e. non-mutated physiological, sequence. Those amino acid sequences as well as their encoding nucleotide sequences in particular fall under the term variants as defined herein. Substitutions in which amino acids, which originate from the same class, are exchanged for one another are called conservative substitutions. In particular, these are amino acids having aliphatic sidePATENT EX1-006WOchains, positively or negatively charged side chains, aromatic groups in the side chains or amino acids, the side chains of which can enter into hydrogen bridges, e.g. side chains which have a hydroxyl function. This means that e.g. an amino acid having a polar side chain is replaced by another amino acid having a likewise polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain is substituted by another amino acid having a likewise hydrophobic side chain (e.g. serine (threonine) by threonine (serine) or leucine (isoleuine) by isoleuine (leucine)). Insertions and substitutions are possible, in particular, at those sequence positions which cause no modification to the three-dimensional structure or do not affect the binding region.Modifications to a three-dimensional structure by insertion(s) or deletion(s) can easily be determined e.g. using CD spectra (circular dichroism spectra). A“variant” of a protein or peptide may have at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% amino acid identity over a stretch of 10, 20, 30, 50, 75 or 100 amino acids of such protein or peptide. Preferably, a variant of a protein comprises a functional variant of the protein, which means that the variant exerts the same effect or functionality as the protein it is derived from.

[0119] The term “immunodominant antigen” refers to an antigen that elicits in at least one stage of the disease production of one or more types of antibodies (e.g., IgG, IgA, IgE, IgM, etc.) in at least 40%, more typically at least 70%, and most typically at least 90% of a population exposed to the antigen, and wherein, when compared to other antigens of the same pathogen, the average binding affinity and / or average quantity of the antibodies produced in the patient in at least one stage of the disease is at least in the upper tertile, more typically upper quartile, and most typically upper quintile. Most typically, the average binding affinity and / or average quantity of the antibodies is reflected in the signal intensity and signal intensity can therefore be used as a surrogate marker for average binding affinity and / or average quantity of the antibodies. In further aspects, preferred immunodominant antigens are also characterized by a response in the test group that is considered statistically significant when compared with control signal intensity, wherein the significance level p is preferably equal or less than 0.1, more preferably equal or less than 0.05, and most preferably equal or less than 0.01.PATENT EX1-006WODETAILED DESCRIPTION

[0120] The particular configurations discussed in the following description are nonlimiting examples that can be varied and are cited merely to illustrate at least one embodiment and are not intended to limit the scope thereof.

[0121] Among other advantages, it should be recognized that contemplated compositions and methods presented herein allow for preparation of therapeutics, such as pharmaceutical and diagnostic compositions, comprising a plurality of antigens with known and predetermined affinity. As individual immune systems are known to exhibit significant variation with respect to antigen recognition, methods and compositions contemplated herein will allow statistically supported antigen identification to identify immunodominant antigens. Consequently, multiple targets can be used to elicit an immune response and / or detect a prior exposure, even where one or more of the targets may be evasive for detection or provide only a weak response.Circular RNAs

[0122] Circular RNAs (circRNAs) are a class of single-stranded RNAs with covalently linked head-to-tail topology. Unlike the linear mRNA therapeutics which applications were limited by its instability, inefficiency, and innate immunogenicity, circRNA therapeutics which incorporate internal ribosome entry sites (IRESs) and open reading frame (ORF) provides an improved approach to RNA-based vaccination with safety, stability, simplicity of manufacture, and scalability.

[0123] Recombinant circRNA molecules can be generated or engineered according to several methods. For example, recombinant circRNA molecules can be generated by back- splicing of linear RNAs. In some embodiments, a recombinant circular RNA is produced by back-splicing of a downstream 5’ splice site (splice donor) to an upstream 3’ splice site (splice acceptor). The splice donor and / or splice acceptor may be found, for example, in a human intron or portion thereof that is typically used for circRNA production at endogenous loci. In some embodiments, a recombinant circular RNA is produced by contacting a cell with a DNA plasmid, wherein the DNA plasmid encodes a linear RNA, and the linear RNA is back- spliced to produce a recombinant circular RNA.

[0124] In other embodiments, circular RNAs are generated by a non-mammalian splicing method. For example, linear RNAs containing various types of introns, includingPATENT EX1-006WOself-splicing group I introns, self-splicing group II introns, spliceosomal introns, and tRNA introns can be circularized. In particular, group I and group II introns have the advantage that they can be readily used for production of circular RNAs in vitro as well as in vivo because of their ability to undergo self-splicing due to their autocatalytic ribozyme activity.

[0125] Alternatively, circular RNAs can be produced in vitro from a linear RNA by chemical or enzymatic ligation of the 5’ and 3’ ends of the RNA. Chemical ligation can be performed, for example, using cyanogen bromide (BrCN) or ethyl-3 -(3 -dimethylaminopropyl) carbodiimide (EDC) for activation of a nucleotide phosphomonoester group to allow phosphodiester bond formation (Sokolova, FEBS Lett, 232: 153-155 (1988); Dolinnaya et al., Nucleic Acids Res., 19: 3067-3072 (1991); Fedorova, Nucleosides Nucleotides Nucleic Acids, 15: 1137-1147 (1996)). Alternatively, enzymatic ligation can be used to circularize RNA. Exemplary ligases that can be used include T4 DNA ligase (T4 Dnl), T4 RNA ligase 1 (T4 Rnl 1), and T4 RNA ligase 2 (T4 Rnl 2).

[0126] In some embodiments, splint ligation may be used to generate circular RNA. Splint ligation involves the use of an oligonucleotide splint that hybridizes with the two ends of a linear RNA to bring the ends of the linear RNA together for ligation.Hybridization of the splint, which can be either a deoxyribo-oligonucleotide or a ribooligonucleotide, orients the 5 - phosphate and 3 -OH of the RNA ends for ligation. Subsequent ligation can be performed using either chemical or enzymatic techniques, as described above. Enzymatic ligation can be performed, for example, with T4 DNA ligase (DNA splint required), T4 RNA ligase 1 (RNA splint required) or T4 RNA ligase 2 (DNA or RNA splint). Chemical ligation, such as with BrCN or EDC, is more efficient in some cases than enzymatic ligation if the structure of the hybridized splint-RNA complex interferes with enzymatic activity (see, e.g., Dolinnaya et al. Nucleic Acids Res, 27(23): 5403-5407 (1993); Petkovic et al., Nucleic Acids Res, 43(4): 2454-2465 (2015)).

[0127] While circular RNAs generally are more stable than their linear counterparts, primarily due to the absence of free ends necessary for exonuclease-mediatedPATENT EX1-006WOdegradation, additional modifications may be made to the recombinant circRNA described herein to further improve stability. Still other kinds of modifications may improve circularization efficiency, purification of circRNA, and / or protein expression from circRNA. For example, the recombinant circRNA may be engineered to include “homology arms” (i.e., 9 - 19 nucleotides in length placed at the 5’ and 3’ ends of a precursor RNA with the aim of bringing the 5’ and 3’ splice sites into proximity of one another), spacer sequences, and / or a phosphorothioate (PS) cap (see, e.g., Wesselhoeft et al., Nat. Common ., 9: 2629 (2018)). The recombinant circRNA also may be engineered to include 2'-O-methyl-, -fluoro- or -O-methoxyethyl conjugates, phosphorothioate backbones, or 2',4'-cyclic 2 '-(9-ethyl modifications to increase the stability (see, e.g., Holdt et al., Front Physiol., 9: 1262 (2018); Kriitzfeldt et al., Nature , 435(7068): 685-9 (2005); and Crooke et al., Cell Metab., 27(4): 714-739 (2018)). The recombinant circRNA molecule also may include one or more modifications that reduce the innate immunogenicity of the circRNA molecule in a host, such as at least one N6-methyladenosine (m6A).

[0128] FIG. 1 A - 1 F depict exemplary vectors for making circular DNA. The T7 promoter sequence is shown in purple. In aspects, the vectors include a hammerhead ribozyme sequence (green) which generates optimal T7 promoter start sequence. In aspects, the vectors include an Azoarcus ribozyme (black). Proper folding is promoted using a self-resolving “kissing loop” sequence (blue) to promote proper folding. In aspects, an internal RNA element is present at the splice site (red). The constructs can also include a tRNA mimicking the natural context of the Azoarcus ribozyme.

[0129] As used herein, the term “Splice Site Recognition Sequence” or “SSRS” refers to the sequence of the ribozyme that uses nucleotides on both sides of the ribozyme's splice site G to position this G at the splice site II in the substrate to form a substrate recognition duplex. As shown in FIG. 3A, the Azoarcus group I intron ribozyme forms two base pairs on the 3' -side of the splice site G (in contrast to others such as Tetrahymena ribozyme which form five). Because the 3-basepair IGS of the Azoarcus ribozyme is relatively short, it uses an extension on the other side of the splice site G.PATENT EX1-006WO

[0130] In certain embodiments of the invention, the vector may include at least one SSRS region. In a preferred embodiment, the invention includes a 5’ SSRS region before the GOI region, and a 3’ SSRS region after the GOI region. The SSRS region may further comprise a 5’ terminus splice site sequence and a 3’ terminus structured RNA element. In certain embodiments, the SSRS region incorporates a natural structural element that facilitates splicing and produces circular RNA that has a law reactogenicity.

[0131] In a preferred embodiment, the junction sequence of the present invention may be comprised from one or more structured RNA elements. In a more preferred embodiment, the junction sequence may be comprised of an entire tRNA. This leads to a structure having a low reactogenicity.

[0132] Embodiments also include a vector for making circular RNA. As shown in FIG.2, the vector can include the following (from the 5’-terminus to the 3’-terminus): a) a T7 promoter + hammerhead ribozyme; b) a 5' homology arm with self-kissing loop “SKL,”; c) a ribozyme sequence capable of catalyzing the circularization reaction; d) an Splice Site Recognition Sequence (SSRS)region comprising guanine (G) at the 5’ end and tRNA fragment (5’) at the 3’ end; e) a gene of interest (space + IRES + ORF + spacer); and f) a fragment containing target splice site comprising tRNA fragment (3’) uracil (U) at the 3’ end.

[0133] In aspects, the vector allows production of a circular RNA that is translatable or biologically active inside eukaryotic cells.

[0134] In aspects, the constructs described herein include a promoter such as a T7 promoter. The T7 promoter is a sequence of DNA 18 base pairs long up to transcription start site at +1 (5‘ - TAATACGACTCACTATAG - 3') that is recognized by T7 RNA polymerase.

[0135] A limitation for a universal use of T7 RNA polymerase for in vitro tRNA transcription lies in the nature of the often unfavorable 5'-terminal sequence of the gene to be transcribed. To overcome this drawback, a hammerhead ribozyme sequence was introduced between a strong T7 RNA polymerase promoter and the tDNA sequence. Transcription of this construct gives rise to a 'transzyme' molecule, the autocatalyticPATENT EX1-006WOactivity of which liberates a 5'-OH tRNA transcript starting with the proper nucleotide.

[0136] As shown in FIG. 1E, the catalytic center of hammerhead ribozyme sequences can include 13 highly conserved nucleotides that form a three-way junction with stem l / ll / lll. Hammerhead ribozymes self-cleave at 3' end of the sequence NUH (N can be any of the four nucleotides and H can be A U or C).

[0137] Another challenge associated with circular RNA is that it lacks the 5' end necessary for cap-dependent translation. However, circRNA can be modified to enable protein translation through an internal ribosome entry site or by incorporating m6A modifications upstream of the open reading frame. Introduction of an internal ribosome entry sequence (IRES) into a circular RNA allows translation of a protein encoded by a circRNA.

[0138] The recombinant circular RNAs described herein can include an internal ribosome entry site (IRES) operably linked to a protein-coding sequence of the circRNA in a non-native configuration. Inclusion of an IRES permits the translation of one or more open reading frames from a circular RNA. The IRES element attracts a eukaryotic ribosomal translation initiation complex and promotes translation initiation.

[0139] Accordingly, embodiments include IRES sequences which, when present in a circRNA, may drive translation of a protein. In some embodiments, the IRES of a circRNA is operably linked to a protein-coding nucleic acid sequence. In some embodiments, the IRES is operably linked to a protein-coding nucleic acid sequence in a non-native configuration. In some embodiments, the IRES is a human IRES. In some embodiments, the IRES is a viral IRES.

[0140] In some embodiments, the IRES includes (i) at least one RNA secondary structure element and (ii) a sequence that is complementary to an 18S rRNA. In some embodiments, the IRES includes (i) at least one RNA secondary structure element and (ii) a sequence that is complementary to an 18S rRNA.

[0141] The IRES may be of any length or size. For example, the IRES can be about 100 nucleotides to about 600 nucleotides in length (e g., about 200, about 225, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425,PATENT EX1-006WOabout 450, about 475, about 500, about 525, about 550, or about 575 nucleotides in length, or a range defined by any two of the foregoing values). In some embodiments, the IRES is about 200 nucleotides to about 800 nucleotides in length (about 200, about 210, about 220, about 240, about 260, about 280, about 320, about 340, about 360, about 380, about 420, about 440, about 460, about 480, about 500, about 520, about 540, about 560, about 580, about 600, about 620, about 640, about 660, about 680, about 700, about 720, about 740, about 760, about 780, or about 800 nucleotides in length, or a range defined by any two of the foregoing values). In some embodiments, the IRES is about 200 to about 400, about 400 to about 600, about 600 to about 700, or about 600 to about 800 nucleotides in length. In some embodiments, the IRES is about 210 nucleotides in length. In some embodiments, the IRES is about 100 to about 3000 nucleotides in length.

[0142] In embodiments, the IRES has a sequence of an IRES from Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian Virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1 , Plautia stali intestine virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus-1, Human Immunodeficiency Virus type 1, Homalodisca coagulata virus-1 , Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna-like virus, Encephalomyocarditis virus, Drosophila C Virus, Human coxsackievirus B3, Crucifer tobamovirus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black Queen Cell Virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1 , Drosophila antennapedia, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPI, Human c-myc, Human elF4G, Mouse NDST4L, Human LEF1, Mouse HIF1 alpha, Human n.myc, Mouse Gtx, Human p27kip1, Human PDGF2 / c-sis, Human p53, Human Pim-1, Mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae YAP1 , tobacco etch virus, turnip crinkle virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, Picobirnavirus, HCV QC64, Human Cosavirus E / D,PATENT EX1-006WOHuman Cosavirus F, Human Cosavirus JMY, Rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus A SH1 , Salivirus FHB, Salivirus NG-J1, Human Parechovirus 1, Crohivirus B, Yc-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A 2, Echovirus E14, Human Parechovirus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivirus A 1220, Pasivirus A 3, Sapelovirus, Rosavirus B, Bakunsa Virus, Tremovirus A, Swine Pasivirus 1, PLV-CHN, Pasivirus A, Sicinivirus, Hepacivirus K, Hepacivirus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Dicistrovirus, Hubei Picoma-like Virus, CRPV, Salivirus A BN5, Salivirus A BN2, Salivirus A 02394, Salivirus A GUT, Salivirus A CH, Salivirus A SZ1, Salivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24 or an aptamer to elF4G.

[0143] FIG. 3 shows steps 100 in producing a circular RNA using nucleotide constructs described herein. A gene of interest (GOI) can be inserted as shown 105. The construct with the GOI 110 can form a circular RNA via joining of the homology arms. The “homology arms” include DNA sequences that flank a target sequence in a genome. The sequence of the HDR template matches the intended sequence of the targeted genomic locus, including the desired edit flanked by 5' and 3' ends that share homology with the wild-type genomic locus.

[0144] In aspects, the vectors include a hammerhead ribozyme sequence (hatched region) which generates optimal T7 promoter start sequence. In aspects, the vectors include an Azoarcus G1-I ribozyme. Proper folding is promoted using a self-resolving “kissing loop” sequence to promote proper folding 115. In aspects, an internal RNA element is present at the splice site. The constructs can also include a tRNA mimicking the natural context of the Azoarcus ribozyme.

[0145] The self-circularization RNA construct described herein can be expressed in a DNA vector and simultaneously circularized through a self-targeting and splicing reaction to form a circRNA. The circRNA containing the gene of interest (GOI), according to embodiments, has the advantage of rapidly expressing a peptide or protein from the gene of interest, including an IRES region, an initiation codon and aPATENT EX1-006WOtermination codon. In addition, a circRNA has a circular structure and has a stable and high half-life because 5' and 3' ends are not exposed. Accordingly, functional RNA such as miRNA, anti-miRNA, siRNA, shRNA, aptamer, guide RNA (gRNA) for gene / RNA editing, RNA for base-editing including ADAR (adenosine deaminase acting on the RNA)-recruiting RNA, mRNA vaccine, mRNA therapeutic agent, vaccine adjuvant, and CAR-T mRNA can be produced as a circRNA to have high stability in cells.

[0146] While circular RNAs generally are more stable than their linear counterparts, additional modifications may be made to the recombinant circRNA described herein to further improve stability. Still other kinds of modifications may improve circularization efficiency, purification of circRNA, and / or protein expression from circRNA. For example, the recombinant circRNA may be engineered to include “homology arms” (i.e. , 9-19 nucleotides in length placed at the 5' and 3' ends of a precursor RNA with the aim of bringing the 5' and 3' splice sites into proximity of one another), spacer sequences, and / or a phosphorothioate (PS) cap (see, e.g., Wesselhoeft et al., Nat. Commun., 9: 2629 (2018)). The recombinant circRNA also may be engineered to include 2'-O-methyl-, -fluoro- or — O-m ethoxyethyl conjugates, phosphorothioate backbones, or 2',4'-cyclic 2'-O-ethyl modifications to increase the stability thereof (see, e.g., Holdt et al., Front Physiol., 9: 1262 (2018); Krutzfeldt et al., Nature, 438(7068): 685-9 (2005); and Crooke et al., Cell Metab., 27(4): 714-739 (2018)). The recombinant circRNA molecule also can also include one or more modifications that reduce the innate immunogenicity of the circRNA molecule in a host, such as at least one N6-methyladenosine (m6A).

[0147] In some embodiments, the circular polyribonucleotide includes one or more expression sequences and each expression sequence may or may not have a termination element. In some embodiments, the circular polyribonucleotide includes one or more expression sequences and the expression sequences lack a termination element, such that the circular polyribonucleotide is continuously translated. Exclusion of a termination element may result in rolling circle translation or continuous expression of expression product, e.g., peptides or polypeptides, due to lack of ribosome stalling or fall-off. In such an embodiment, rolling circle translation expresses a continuous expression product through each expression sequence. In some other embodiments, a termination element of an expression sequence can be part of a stagger element. InPATENT EX1-006WOsome embodiments, one or more expression sequences in the circular polyribonucleotide comprises a termination element.Methods of Use

[0148] In embodiments the constructs described herein are used as part of a pharmaceutical composition. In some aspects, the pharmaceutical composition may elicit an immune response against a bacteria. Examples of bacteria include, for example, Neisseria meningitidis, Streptococcus pneumoniae, Streptococcus pyogenes, Moraxella catarrhalis, Bordetella pertussis, Staphylococcus aureus, Clostridium tetani, Corynebacterium diphtheriae, Pseudomonas aeruginosa, Streptococcus agalactiae, Chlamydia trachomatis, Chlamydia pneumoniae, Helicobacter pylori, Escherichia coli, Bacillus anthracis, Yersinia pestis, Staphylococcus epidermis, Clostridium perfringens or Clostridium botulinums, Legionella pneumophila, Coxiella burnetiid, Brucella, (e.g., B. abortus, B.canis, B.melitensis, B.neotomae, B.ovis, B.suis, B.pinnipediae), Francisella, (e.g., F.novicida, F.philomiragia, F.tularensis). Neisseria gonorrhoeae, Treponema pallidum, Haemophilus ducreyi, Enterococcus faecalis or Enterococcus faeciumi, Staphylococcus saprophyticus, Yersinia enterocolitica, Mycobacterium tuberculosis, Rickettsia, Listeria monocytogenes, Vibrio cholerae, Salmonella typhi, Borrelia burgdorferi, Porphyromonas gingivalis and Kiebsiella.

[0149] In aspects, the pharmaceutical composition may elicit an immune response against a virus. Examples of viruses include, for example, Orthomyxovirus, Paramyxoviridae viruses, Poxviridae, Picomavirus, enterovirus (e.g., EV71, coxsackie A or B), Bunyavirus, Orthobunyavirus (e.g., California encephalitis virus, a Phlebovirus, such as Rift Valley Fever virus, or a Nairovirus, such as Crimean-Congo hemorrhagic fever virus), Heparnavirus (e.g., hepatitis A virus), Filovirus, Togavirus (e.g., Rubivirus, an Alphavirus, or an Arterivirus. rubella virus, Flavivirus (e.g., Tick-borne encephalitis (TBE) virus, Dengue ( types 1 , 2, 3 or 4) virus, Yellow Fever virus, Japanese encephalitis virus, Kyasanur Forest Virus, West Nile, Encephalitis virus (e.g, St. Louis encephalitis virus, Russian spring-summer encephalitis virus, Powassan encephalitis virus), Pestivirus (e.g., Bovine viral diarrhea, “BVDV” Classical swine fever “CSFV” or Border disease), Hepadnavirus (e.g., Hepatitis B virus, hepatitis C virus, delta hepatitis virus hepatitis E virus, or hepatitis G virus, Rhabdovirus (e.g. a Rabies virus andPATENT EX1-006WOVesiculovirus), Caliciviridae (e.g., Norovirus and Norwalk-like Viruses, such as Hawaii Virus and Snow Mountain Virus), Coronavirus: (e.g., SARS coronavirus, avian infectious bronchitis (IBV), Mouse hepatitis virus (MEV), and Porcine transmissible gastroenteritis virus (TGEV), Retrovirus (e.g., Oncovirus, Lentivirus (e.g. HIV-1 or HIV-2) or a Spumavirus, Reovirus: (e.g., Orthoreovirus, a Rotavirus, an Orbivirus, or a Coltivirus) Parvovirus, Herpesvirus: (e.g., Herpes Simplex Viruses (HSV) (e.g. HSV types 1 and 2), Varicella-zoster Virus (VZV), Epstein-Barr virus (EBV, Cytomegalovirus (CMV), Human Herpesvirus 6 (HHV6), Human Herpesvirus 7 (HHV7), and Human Herpesvirus 8 (HHV8), Papovaviruses and Adenovirus.

[0150] In aspects, the pharmaceutical composition may elicit an immune response against a fungus. Fungal immunogens can be derived from Dermatophytres, including: Epidermophyton floccusum, Microsporum audouini, Microsporum canis, Microsporum distortum, Microsporum equinum, Microsporum gypsum, Microsporum nanum, Trichophyton concentricum, Trichophyton equinum, Trichophyton gallinae, Trichophyton gypseum, Trichophyton megnini, Trichophyton mentagrophytes, Trichophyton quinckeanum, Trichophyton rubrum, Trichophyton schoenleini, Trichophyton tonsurans, Trichophyton verrucosum, T. verrucosum var. album, var. discoides, var. ochraceum, Trichophyton violaceum, and / or Trichophyton favifornie; or from Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus nidulans, Aspergillus terreus, Aspergillus sydowi, Aspergillus flavatus, Aspergillus glaucus, Blastoschizomyces capitatus, Candida albicans, Candida enolase, Candida tropicalis, Candida glabrata, Candida krusei, Candida parapsilosis, Candida stellatoidea, Candida kusei, Candida parakwsei, Candida lusitaniae, Candida pseudotropicalis, Candida guilliermondi, Cladosporium carrionii, Coccidioides immitis, Blastontyces dermatidis, Cryptococcus neoformans, Geotrichum clavatum, Histoplasma capsulatum, Klebsiella pneumoniae, Microsporidia, Encephalitozoon spp., Septata intestinalis and Enterocytozoon bieneusi; the less common are Brachiola spp, Microsporidium spp., Nosema spp., Pleistophora spp., Trachipleistophora spp., Vittaforma spp Paracoccidioides brasiliensis, Pneumocystis carinii, Pythiumn insidiosum, Pityrosporum ovale, Sacharomyces cerevisae, Saccharomyces boulardii, Saccharomyces pombe, Scedosporium apiosperum, Sporothrix schenckii, Trichosporon beigelii, Toxoplasma gondii, PenicilliumPATENT EX1-006WOmarneffei, Malassezia spp., Fonsecaea spp., Wangiella spp., Sporothrix spp., Basidiobolus spp., Conidiobolus spp., Rhizopus spp., Mucor spp, Absidia spp, Mortierella spp, Cunninghamella spp, Saksenaea spp., Alternaria spp, Curvularia spp, Helminthosporium spp, Fusarium spp, Aspergillus spp, Penicillium spp, Rhizoctonia spp, Paecilomyces spp, Pithomyces spp. and Cladosporium ssp.

[0151] In aspects, the pharmaceutical composition may elicit a response against a parasite. The parasite can be from, for example, the Plasmodium genus, such as P.falciparum, P.vivax, P.malariae or P. ovale. Thus, the invention can be used for immunizing against malaria. In aspects, the immunogen elicits an immune response against a parasite from the Caligidae family (e.g., from the Lepeophtheirus and Caligus genera (sea lice) such as Lepeophtheirus salmonis or Caligus rogercresseyi).

[0152] In embodiments, the constructs described herein are used in a circRNA pharmaceutical composition that is effective against cancer. The immunogen can be a tumor antigen selected from: (a) cancer-testis antigens such as NY-ESO-1, SSX2, SCP1 as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-1, GAGE-2, MAGE-1, MAGE-2, MAGE-3, MAGE-4, MAGE-5, MAGE-6, and MAGE-12 (which can be used, for example, to address melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumors; (b) mutated antigens, for example, p53 (associated with various solid tumors, e.g., colorectal, lung, head and neck cancer), p21 / Ras (associated with, e.g., melanoma, pancreatic cancer and colorectal cancer), CDK4 (associated with, e.g., melanoma), MUM1 (associated with, e.g., melanoma), caspase-8 (associated with, e.g., head and neck cancer), CIA 0205 (associated with, e.g., bladder cancer), HLA-A2-R1701, beta catenin (associated with, e.g., melanoma), TCR (associated with, e.g., T-cell non-Hodgkins lymphoma), BCR-abl (associated with, e.g., chronic myelogenous leukemia), triosephosphate isomerase, KIA 0205, CDC-27, and LDLR-FUT; (c) over-expressed antigens, for example, Galectin 4 (associated with, e.g., colorectal cancer), Galectin 9 (associated with, e.g., Hodgkin's disease), proteinase 3 (associated with, e.g., chronic myelogenous leukemia), WT 1 (associated with, e.g., various leukemias), carbonic anhydrase (associated with, e.g., renal cancer), aldolase A (associated with, e.g., lung cancer), PRAME (associated with, e.g., melanoma), HER-2 / neu (associated with, e.g., breast, colon, lung and ovarianPATENT EX1-006WOcancer), mammaglobin, alpha-fetoprotein (associated with, e.g., hepatoma), KSA (associated with, e.g., colorectal cancer), gastrin (associated with, e.g., pancreatic and gastric cancer), telomerase catalytic protein, MUC-1 (associated with, e.g., breast and ovarian cancer), G-250 (associated with, e.g., renal cell carcinoma), p53 (associated with, e.g., breast, colon cancer), and carcinoembryonic antigen (associated with, e.g., breast cancer, lung cancer, and cancers of the gastrointestinal tract such as colorectal cancer); (d) shared antigens, for example, melanoma-melanocyte differentiation antigens such as MART-1 / Melan A, gp1OO, MCIR, melanocyte-stimulating hormone receptor, tyrosinase, tyrosinase related protein-1 / TRP I and tyrosinase related protein-2 / TRP2 (associated with, e.g., melanoma); (e) prostate associated antigens such as PAP, PSA, PSMA, PSH-P1, PSM-P1, PSM-P2, associated with e.g., prostate cancer; (1) immunoglobulin idiotypes (associated with myeloma and B cell lymphomas, for example). In certain embodiments, tumor immunogens include, but are not limited to, p15, Hom / Mel-40, H-Ras, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens, including E6 and E7, hepatitis B and C virus antigens, human T-cell lymphotropic virus antigens, TSP-180, p185erbB2, p180erbB-3, c-met, mn-23H1, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, p16, TAGE, PSCA, CT7, 43-9F, 5T4, 791 Tgp72, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA), CA 195, CA242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, M0V18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein / cyclophilin C-associated protein), TAAL6, TAG-72, TLP, TPS, and the like.

[0153] Embodiments also include a pharmaceutical composition containing a circRNA described herein that is administered to the subject by injection. Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye), oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.

[0154] The composition containing a circRNA can be delivered in a volume of from about 0.1 pL to about 1 mL, including all numbers within the range, the route of administration, and the desired effect of the method. In one embodiment, the volume isPATENT EX1-006WOabout 50 pL. In another embodiment, the volume is about 70 pL. In another embodiment, the volume is about 100 pL. In another embodiment, the volume is about 125 pL. In another embodiment, the volume is about 150 pL. In another embodiment, the volume is about 175 pL. In yet another embodiment, the volume is about 200 pL. In another embodiment, the volume is about 250 pL. In another embodiment, the volume is about 300 pL. In another embodiment, the volume is about 450 pL. In another embodiment, the volume is about 500 pL. In another embodiment, the volume is about 600 pL. In another embodiment, the volume is about 750 pL. In another embodiment, the volume is about 850 pL. In another embodiment, the volume is about 1000 pL. An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the cell-specific promoter sequence desirably ranges from about 107and 1013vector genomes per milliliter (vg / mL) (also called genome copies / mL (GC / mL)). The rAAV infectious units are measured as described in S. K. McLaughlin et al, 1988 J. Virol., 62:1963, which is incorporated herein by reference. Preferably, the concentration in the retina is from about 1.5 x 109vg / mL to about 1.5 x 1012vg / mL, and more preferably from about 1.5 x 109vg / mL to about 1.5 x 1011vg / mL. In one embodiment, the effective concentration is about 1.4 x 108vg / mL. In one embodiment, the effective concentration is about 3.5 x 1010vg / mL. In another embodiment, the effective concentration is about 5.6 x 1011vg / mL. In another embodiment, the effective concentration is about 5.3 x 1012vg / mL. In yet another embodiment, the effective concentration is about 1.5 x 1012vg / mL. In another embodiment, the effective concentration is about 1.5 x 1013vg / mL. In one embodiment, the effective dosage (total genome copies delivered) is from about 107to 1013vector genomes. It is desirable that the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity, retinal dysplasia and detachment. Still other dosages and administration volumes in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular ocular disorder and the degree to which the disorder, if progressive, has developed. For extra-ocular delivery, the dosage will be increased according to the scale-up from the retina. Intravenous delivery, for example may require doses on thePATENT EX1-006WOorder of 1.5 x 1013vg / kg.

[0155] Multiple doses can be administered to an individual in need thereof. Where multiple doses are administered over a period of time, an active agent is administered once a month to about once a year, from about once a year to once every 2 years, from about once every 2 years to once every 5 years, or from about once every 5 years to about once every 10 years, over a period of time. For example, a subject is administered over a period of from about 3 months to about 2 years, from about 2 years to about 5 years, from about 5 years to about 10 years, from about 10 years to about 20 years, or more than 20 years. The actual frequency of administration, and the actual duration of treatment, depends on various factors.

[0156] As an example, a subject at risk of exposure to an infection can be immunized by administering an initial dose of a vaccine; and administering at least a second dose (a subsequent dose). Where two or more subsequent doses are administered, the subsequent dose(s) can be separated in time from each other by at least one month, at least 3 to 6 months, at least 6 months to 1 year, at least 1 year to 5 years, at least 5 years to 10 years, at least 10 years to 20 years, or more than 20 years.

[0157] Optionally, the compositions of the invention may contain other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0158] According to another aspect, a method for forming the above-described pharmaceutical composition is provided. The method includes introducing an expression vector for expressing a heterologous gene product into a cell to form a genetically modified cell and placing the genetically modified cell in a pharmaceutically acceptable carrier.

[0159] Certain embodiments of the present invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects skilledPATENT EX1-006WOartisans to employ such variations as appropriate, and the inventors intend for the present invention to be practiced otherwise than specifically described herein.Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described embodiments in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0160] Groupings of alternative embodiments, elements, or steps of the present invention are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other group members disclosed herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0161] A recombinant circular RNA molecule may be of any length or size. For example, the recombinant circular RNA molecule may comprise between about 200 nucleotides and about 20,000 nucleotides (e.g., about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1,000, about 2,000, about 3,000, about 4,000, about 5,000, about 6,000, about 7,000, about 8,000, about 9,000 nucleotides, about 10,000 nucleotides, about 15,000 nucleotides, about 20,000 nucleotides or more. In some embodiments, the recombinant circular RNA molecule comprises between about 500 and about 6,000 nucleotides (about 550, about 650, about 750, about 850, about 950, about 1,100, about 1,200, about 1,300, about 1,400, about 1,500, about 1 ,600, about 1 ,700, about 1 ,800, about 1 ,900, about 2,100, about 2,200, about 2,300, about 2,400, about 2,500, about 2,600, about 2,700, about 2,800, about 2,900, about 3,100, about 3,300, about 3,500, about 3,700, about 3,800, about 3,900, about 4,100, about 4,300, about 4,500, about 4,700, about 4,900, about 5,100, about 5,300, about 5,500, about 5,700, or about 5,900 nucleotides, or a range defined by any two of the foregoing values). In one embodiment, the recombinant circular RNA molecule comprises about 1,500 nucleotides.PATENT EX1-006WO

[0162] In some embodiments, the circular RNA polynucleotide has an in vivo duration of therapeutic effect in humans of at least about 20 hours. In some embodiments, the circular RNA polynucleotide of has a functional half-life of at least about 20 hours. In some embodiments, the circular RNA polynucleotide of has a duration of therapeutic effect in a human cell greater than or equal to that of an equivalent linear RNA polynucleotide comprising the same expression sequence. In some embodiments, the circular RNA polynucleotide of has a functional half-life in a human cell greater than or equal to that of an equivalent linear RNA polynucleotide comprising the same expression sequence. In some embodiments, the circular RNA polynucleotide of has an in vivo duration of therapeutic effect in humans greater than that of an equivalent linear RNA polynucleotide having the same expression sequence. In some embodiments, the circular RNA polynucleotide of has an in vivo functional half-life in humans greater than that of an equivalent linear RNA polynucleotide having the same expression sequence.

[0163] In another aspect, the present application provides a pharmaceutical composition comprising a circular RNA polynucleotide as described herein, a nanoparticle, and optionally, a targeting moiety operably connected to the nanoparticle. In some embodiments, the nanoparticle is a lipid nanoparticle, a core-shell nanoparticle, a biodegradable nanoparticle, a biodegradable lipid nanoparticle, a polymer nanoparticle, or a biodegradable polymer nanoparticle.

[0164] In some embodiments, the pharmaceutical composition comprises a targeting moiety, wherein the targeting moiety mediates receptor-mediated endocytosis or direct fusion into selected cells of a selected cell population or tissue in the absence of cell isolation or purification. In some embodiments, the pharmaceutical composition comprises a targeting moiety operably connected to the nanoparticle. In some embodiments, the targeting moiety is a scFv, nanobody, peptide, minibody, polynucleotide aptamer, heavy chain variable region, light chain variable region or fragment thereof.

[0165] The pharmaceutical composition may comprise a dose of about 0.1 pg to about 1000 pg of circular RNA. In yet other aspects of this embodiment, the pharmaceutical composition may comprise a therapeutically effective amount circular RNA and may bePATENT EX1-006WOadministered, for example, every 3, 5, 7, 10 or 14 days. In some aspects, the pharmaceutical composition may comprise a dose of about 0.1 pg to about 1000 mg of circular RNA. In aspects of this embodiment, a therapeutically effective amount of circular RNA may be, e.g., at least 0.01 pg, at least 0.05 pg, at least 0.1 pg, at least 0.5 pg, at least 1.0 pg, at least 2.0 pg, at least 2.5 pg, at least 5.0 pg, at least 10 pg, at least 15 pg, at least 20 pg, at least 25 pg, at least 30 pg, at least 35 pg, at least 40 pg, at least 45 pg, at least 50 pg at least 60 pg, at least 70 pg, at least 75 pg, at least 80 pg, at least 90 pg, at least 100 pg, at least 150 pg, at least 200 pg, at least 250 pg, at least 300 pg, at least 400 pg, at least 500 pg, at least 600 pg, at least 700 pg, at least 750 pg, at least 800 pg, at least 900 pg, at least 100 pg, at least 0.2 mg, at least 0.3 mg, at least 0.4 mg, at least 0.5 mg, at least 0.6 mg, at least 0.7 mg, at least 0.8 mg, at least 0.9 mg, at least 1.0 mg, at least 1.5 mg, at least 2.0 mg, at least 2.5 mg, at least 3.0 mg, at least 3.5 mg, at least 4.0 mg, at least 4.5 mg, at least 5.0 mg, at least 6.0 mg, at least 7.0 mg, at least 8.0 mg, at least 9.0 mg, at least 10 mg, at least 20 mg, at least 30 mg, at least 40 mg, at least 50 mg, at least 60 mg, at least 70 mg, at least 80 mg, at least 90 mg, at least 100 mg, at least 200 mg, at least 300 mg, at least 400 mg, at least 500 mg, at least 600 mg, at least 700 mg, at least 800 mg, at least 900 mg, or at least 1000 mg of circular RNA.

[0166] In other aspects of this embodiment, a therapeutically effective amount circular RNA disclosed herein may be in the range of, e.g., about 0.01 pg to about 1 pg, about 0.01 pg to about 2 pg, about 0.01 pg to about 3 pg, about 0.01 pg to about 4 pg, about 0.01 pg to about 5 pg, about 0.01 pg to about 7.5 pg, about 0.01 pg to about 10 pg, about 0.01 pg to about 15 pg, about 0.01 pg to about 20 pg, about 0.01 pg to about 25 pg, about 0.01 pg to about 30 pg, about 0.01 pg to about 35 pg, about 0.01 pg to about 40 pg, about 0.01 pg to about 45 pg, about 0.01 mg / kg to about 50 pg, about 0.01 pg to about 75 pg, about 0.01 pg to about 100 pg, about 0.01 pg to about 150 pg, about 0.01 pg to about 200 pg, about 0.01 pg to about 250 pg, about 0.01 pg to about 300 pg, about 0.01 pg to about 400 pg, about 0.01 pg to about 500 pg, about 0.01 pg to about 600 pg, about 0.01 pg to about 700 pg, about 0.01 pg to about 800 pg, about 0.01 pg to about 900 pg, about 0.01 pg to about 1000 pg, about 0.01 pg to about 1.5 mg, about 0.01 pg to about 2.0 mg, about 0.01 pg to about 3.0 mg, about 0.01 pg to about 4.0 mg,PATENT EX1-006WOabout 0.01 g to about 5.0 mg, about 0.01 pg to about 6.0 mg, about 0.01 pg to about 7.0 mg, about 0.01 pg to about 8.0 mg, about 0.01 pg to about 9.0 mg, about 0.01 pg to about 10 mg, about 0.01 pg to about 20 mg, about 0.01 pg to about 30 mg, about 0.01 pg to about 40 mg, about 0.01 pg to about 50 mg, about 0.01 pg to about 60 mg, about 0.01 pg to about 70 mg, about 0.01 pg to about 80 mg, about 0.01 pg to about 90 mg, about 0.01 pg to about 100 mg, about 0.01 pg to about 200 mg, about 0.01 pg to about 300 mg, about 0.01 pg to about 400 mg, about 0.01 pg to about 500 mg, about 0.01 pg to about 600 mg, about 0.01 pg to about 700 mg, about 0.01 pg to about 800 mg, about 0.01 pg to about 900 mg, or about 0.01 pg to about 1000 mg.

[0167] In other aspects of this embodiment, a therapeutically effective amount circular RNA disclosed herein may be in the range of, e.g., about 1 pg to about 2 pg, about 1 pg to about 3 pg, about 1 pg to about 4 pg, about 1 pg to about 5 pg, about 1 pg to about 7.5 pg, about 1 pg to about 10 pg, about 1 pg to about 15 pg, about 1 pg to about 20 pg, about 1 pg to about 25 pg, about 1 pg to about 30 pg, about 1 pg to about 35 pg, about 1 pg to about 40 pg, about 1 pg to about 45 pg, about 1 mg / kg to about 50 pg, about 1 pg to about 75 pg, about 1 pg to about 100 pg, about 1 pg to about 150 pg, about 1 pg to about 200 pg, about 1 pg to about 250 pg, about 1 pg to about 300 pg, about 1 pg to about 400 pg, about 1 pg to about 500 pg, about 1 pg to about 600 pg, about 1 pg to about 700 pg, about 1 pg to about 800 pg, about 1 pg to about 900 pg, about 1 pg to about 1000 pg, about 1 pg to about 1.5 mg, about 1 pg to about 2.0 mg, about 1 pg to about 3.0 mg, about 1 pg to about 4.0 mg, about 1 pg to about 5.0 mg, about 1 pg to about 6.0 mg, about 1 pg to about 7.0 mg, about 1 pg to about 8.0 mg, about 0.01 pg to about 9.0 mg, about 1 pg to about 10 mg, about 1 pg to about 20 mg, about 0.01 pg to about 30 mg, about 1 pg to about 40 mg, about 1 pg to about 50 mg, about 0.01 pg to about 60 mg, about 1 pg to about 70 mg, about 1 pg to about 80 mg, about 1 pg to about 90 mg, about 1 pg to about 100 mg, about 1 pg to about 200 mg, about 1 pg to about 300 mg, about 1 pg to about 400 mg, about 1 pg to about 500 mg, about 1 pg to about 600 mg, about 1 pg to about 700 mg, about 1 pg to about 800 mg, about 1 pg to about 900 mg, or about 1 pg to about 1000 mg.

[0168] In other aspects of this embodiment, a therapeutically effective amount circular RNA disclosed herein may be in the range of, e.g., about 10 pg to about 15 pg, aboutPATENT EX1-006WO10 g to about 20 pg, about 10 pg to about 25 pg, about 10 pg to about 30 pg, about 10 pg to about 35 pg, about 10 pg to about 40 pg, about 10 pg to about 45 pg, about 10 mg / kg to about 50 pg, about 10 pg to about 75 pg, about 10 pg to about 100 pg, about 10 pg to about 150 pg, about 10 pg to about 200 pg, about 10 pg to about 250 pg, about 10 pg to about 300 pg, about 10 pg to about 400 pg, about 10 pg to about 500 pg, about 10 pg to about 600 pg, about 10 pg to about 700 pg, about 10 pg to about 800 pg, about 10 pg to about 900 pg, about 10 pg to about 1000 pg, about 10 pg to about 1.5 mg, about 10 pg to about 2.0 mg, about 10 pg to about 3.0 mg, about 10 pg to about 4.0 mg, about 10 pg to about 5.0 mg, about 10 pg to about 6.0 mg, about 10 pg to about 7.0 mg, about 10 pg to about 8.0 mg, about 10 pg to about 9.0 mg, about 10 pg to about 10 mg, about 10 pg to about 20 mg, about 10 pg to about 30 mg, about 10 pg to about 40 mg, about 10 pg to about 50 mg, about 10 pg to about 60 mg, about 10 pg to about 70 mg, about 10 pg to about 80 mg, about 10 pg to about 90 mg, about 10 pg to about 100 mg, about 10 pg to about 200 mg, about 10 pg to about 300 mg, about 10 pg to about 400 mg, about 10 pg to about 500 mg, about 10 pg to about 600 mg, about 10 pg to about 700 mg, about 10 pg to about 800 mg, about 10 pg to about 900 mg, or about 10 pg to about 1000 mg.

[0169] In other aspects of this embodiment, a therapeutically effective amount of circular RNA disclosed herein may be, e.g., at least 0.0001 mg / kg, at least 0.001 mg / kg, at least 0.01 mg / kg, at least 0.1 mg / kg, at least 1.0 mg / kg, at least 5.0 mg / kg, or at least 10 mg / kg. In other aspects of this embodiment, a therapeutically effective amount of circular RNA disclosed herein may be in the range of, e.g., about 0.0001 mg / kg to about 10 mg / kg, about 0.0001 mg / kg to about 15 mg / kg, about 0.0001 mg / kg to about 20 mg / kg, or about 0.0001 mg / kg to about 25 mg / kg.

[0170] It should be understood that the circular RNA (circRNA) constructs and vectors described herein may be utilized for a variety of therapeutic applications. For example, in some embodiments, the circRNA construct may be used in the production of chimeric antigen receptors (CARs) for use in CAR-T cell therapies. The GOI region may encode a CAR comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, which can be expressed to redirect T-cells, B-cells, or other immune cells toward specific targets. This is particularly suited for CAR-TPATENT EX1-006WOmRNA applications where high stability in cells is required to maintain therapeutic effect without the risks associated with permanent genomic integration.

[0171] In other aspects, the circRNA may encode secreted therapeutic proteins, such as antibodies or Fc fusion proteins. The circRNA can be designed as a delivery platform for full-length monoclonal antibodies, nanobodies, or non-antibody binding proteins that exert pharmacologic effects, including neutralizing pathogens, inhibiting immune checkpoints, or modulating growth factor receptors. For example, secreted proteins may be produced at sustained levels through the utilization of the covalently-closed structure of the circRNA. This allows for a more cost-effective and stable alternative to traditional protein-based biologies. In some embodiments, the circRNA may be used to express recombinant fusion proteins and / or biochemical enzymes. Such constructs can be utilized to replace deficient enzymes in metabolic disorders or to provide essential intracellular proteins, including transcription factors, chaperone proteins, cytoskeletal proteins, and mitochondrial proteins. The high half-life of the circRNA platform ensures that these therapeutic proteins achieve prolonged duration of effect within the target cell or tissue compared to equivalent linear RNA sequences. Unless otherwise indicated, all numbers expressing a characteristic, item, quantity, parameter, property, term, and so forth used in the present specification and claims are to be understood as being modified in all instances by the term "about." As used herein, the term "about" means that the characteristic, item, quantity, parameter, property, or term so qualified encompasses a range of plus or minus ten percent above and below the value of the stated characteristic, item, quantity, parameter, property, or term. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical indication should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and values setting forth the broad scope of the invention are approximations, the numerical ranges and values set forth in the specific examples are reported as precisely as possible. Any numerical range or value, however, inherently contains certain errors necessarily resulting from the standard deviation found in theirPATENT EX1-006WOrespective testing measurements. Recitation of numerical ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate numerical value falling within the range. Unless otherwise indicated herein, each individual value of a numerical range is incorporated into the present specification as if it were individually recited herein.

[0172] The terms "a," "an," "the" and similar referents used in the context of describing the present invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein is intended merely to better illuminate the present invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the present specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0173] All patents, patent publications, and other publications referenced and identified in the present specification are individually and expressly incorporated herein by reference in their entirety for the purpose of describing and disclosing, for example, the compositions and methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0174] In closing, it is to be understood that although aspects of the present specification are highlighted by referring to specific embodiments, one skilled in the art will readily appreciate that these disclosed embodiments are only illustrative of the principles of the subject matter disclosed herein. Therefore, it should be understood thatPATENT EX1-006WOthe disclosed subject matter is in no way limited to a particular methodology, protocol, and / or reagent, etc., described herein. As such, various modifications or changes to or alternative configurations of the disclosed subject matter can be made in accordance with the teachings herein without departing from the spirit of the present specification. Lastly, the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Accordingly, the present invention is not limited to that precisely as shown and described.PATENT EX1-006WOSEQUENCESSEQ ID NO: 1 (Construct 1 - Azo6bpP1ex_tRNA)> AATTTAATACGACTCACTATAGGGAGACATTCACCTGACGAGCTAAGCGAAACTGC GGAAACGCAGTCGTGAATGTGccttgcgccgggaaaccacgcaagggatggtgtcaaattcggcgaaac ctagcgcccgcccgggcgtatggcaacgccgagccaagcttcggcgcctgcgccgatgaaggtgtagagactagacg gcacccacctaaggcaaacgctatggtgaaggcatagtccagggagtggcgaagtcacacaaaccggAATCCGT TGGTGCTGGGTTCGACTCCCAGGGGGCCC GGGCCTCTAGCTCATGCTTGGTT AGAGCAGCGGACTCATATTCACSEQ ID NO: 2 (Construct 2 - Azo 16bpP1ex_tRNA )> AATTTAATACGACTCACTATAGGGAGACTTGCCCCTGACGAGCTAAGCGAAACTGC GGAAACGCAGTCGGGCAAGAATGTGAATGTGccttgcgccgggaaaccacgcaagggatggtgtc aaattcgcgaaacctaagcgcccgcccgggcgtatggcaacgccgagccaagcttcggcgcctgcgccgatgaaggt gtagagactagacggcacccacctaaggcaaacgctatggtgaaggcatagtccaggagtggcgaaagtcacacaa accggAATCCGTTGGTGCTGGGTTCGACTCCCAGGGGGCCC GGGCCTCTAGCT CATGCTTGGTTAGAGCAGCGGACTCATATTCACATTCTTGCCCSEQ ID NO: 3 (Construct 3 - Azo 10bpP9_tRNA )> AATTTAATACGACTCACTATAGGGAGACTCCAACTGACGAGCTAAGCGAAACTGCG GAAACGCAGTCTTGGagtcacacaaaccggAATCCGTTGGTGCTGGGTTCGACTCCCAG GGGGCCC GGGCCTCTAGCTCATGCTTGGTTAGAGCAGCGGACTCATATTTCGA TGTGccttgcgccgggaaaccacgcaagggatggtgtcaaattcggcgaaacctaagcgcccgcccgggcgtatgg caacgcgagccaagcttcggcgcctgcgccgatgaaggtgtagagactagacggcacccacctaaggcaaacgctat ggtgaaggcatagtccagggagtggcTCCAASEQ ID NO: 4 (Construct 4 - Azo 10bpP9wKiss_tRNA )> AATTTAATACGACTCACTATAGGGAGACTCGTCCCTGACGAGCTAAGCGAAACTGC> > GGAAACGCAGTCGGACGAGGCATTTCCCCTTGTTTGGagtcacacaaaccggAATCCGT TGGTGCTGGGTTGACTCCCAGGGGGCCC GGGCCTCTAGCTCATGCTTGGTTA GAGCAGCGGACTCATATTTCGATGTGccttgcgccgggaaaccacgcaagggatggtgtcaaattcggPATENT EX1-006WOcgaaacctaagcgcccgcccgggcgtatggcaacgcgagccaagcttcggcgcctgcgccgatgaaggtgtagagac tagacggcacccacctaaggcaaacgctatggtgaaggcatagtccagggagtggcTCCAAACAAGGGGAA ATGCCTTGTSEQ ID NO: 5 (Construct 5 - Azo6bpP1Kiss_tRNA )> AATTTAATACGACTCACTATAGGGAGACUCGUCCCTGACGAGCTAAGCGAAACTG CGGAAACGCAGTCGGACGAGGCATTTCCCCTTGTGTGAATGTGccttgcgccgggaaacc acgcaagggatgtgtcaaattcggcgaaacctaagcgcccgcccgggcgtatggcaacgccgagccaagcttcggcg cctgcgccgatgaaggtgtagagactagacggcacccacctaaggcaaacgctatggtgaagcatagtccagggagtg gcgaaagtcacacaaaccggAATCCGTTGGTGCTGGGTTCGACTCCCAGGGGGCCC G GGCCTCTAGCTCATGCTTGGTTAGAGCAGCGGACTCATATTCACACAAGGGGAAA TGCCTTGTSEQ ID NO: 6 (Construct 6 - Azo 16bpP1_AntiCodKiss)> AATTTAATACGACTCACTATAGGGAGACTTGCCCCTGACGAGCTAAGCGAAACTGC GGAAACGCAGTCGGGCAAGAATGTGAATGTGccttgcgccgggaaaccacgcaagggatggtgtc aaattcgcgaaacctaagcgcccgcccgggcgtatggcaacgccgagccaagcttcggcgcctgcgccgatgaaggt gtagagactagacggcacccacctaaggcaaacgctatggtgaaggcatagtccaggagtggcgaaagtcacacaa accggAATCCGTACAAGGGGAAATGCCTTGTAA GGACGAGGCATTTCCCCTTGT GCGGACTCATATTCACATTCTTGCCCSEQ ID NO: 7 (T7 promoter sequence)TAATACGACTCACTATAG

Claims

PATENT EX1-006WOCLAIMSWhat is claimed is:

1. A vector for producing circular RNA (circRNA), the vector comprising:a) a promoter;b) at least one homology arm comprising a self-kissing loop (SKL) sequence; c) a ribozyme sequence;d) at least one splice site recognition sequence (SSRS) region; ande) a gene of interest (GOI) region.

2. The vector of claim 1 , wherein the ribozyme sequence is an Azoarcus ribozyme.

3. The vector of claim 1 further comprising a hammerhead ribozyme, a 5’ homology arm comprising a first SKL sequence, a 3’ homology arm comprising a second SKL sequence, a 5’ SSRS region, and a 3’ SSRS region.

4. The vector of claim 1 , wherein the at least one SSRS region comprises a 5’ splice site sequence, a 5’ structured RNA element; a 3’ structured RNA element, and a 3’ splice site target sequence; wherein the 3’ structured RNA element is complementary to the 5’ structured RNA element.

5. The vector of claim 4, wherein the 5’ structured RNA element or the 3’ structured RNA element is selected from the group consisting of: a tRNA fragment, a ribosomal RNA fragment, a small nuclear RNA (snRNA) stem-loop, a synthetic RNA hairpin, an aptamer, or a ribozyme domain.

6. The vector of claim 5, wherein the 5’ structured RNA element or the 3’ structured RNA element is a tRNA fragment.

7. The vector of claim 1, wherein the GOI region comprises an internal ribosome entry site (IRES) operably linked to an open reading frame (ORF).PATENT EX1-006WO8. The vector of claim 1 , wherein the GOI region encodes a therapeutic protein or immunogenic antigen.

9. The vector of claim 8, wherein the therapeutic protein is selected from the group consisting of: a chimeric antigen receptor (CAR), a T-cell receptor (TCR), a B-cell receptor (BCR), an immune cell activation receptor, an immune cell inhibitory receptor, a recombinant fusion protein, a chimeric mutant protein, an antibody, a nanobody, a non-antibody binding protein, an Fc fusion protein, an immune modulatory ligand, an immune modulatory receptor, a checkpoint inhibitor, a checkpoint agonist, a cytokine, a chemokine, a growth factor, a growth factor receptor, a hormone, a hormone receptor, a transcription factor, a blood clotting factor, an anticoagulant, a biochemical enzyme, a chaperone protein, an antimicrobial protein, a structural protein, a cytoskeletal protein, a tight junction protein, a metal-binding protein, a mitochondrial protein, a secreted therapeutic protein, an intracellular protein, an antibody, an Fc fusion protein, an enzyme, a cytokine, a hormone, a transcription factor, a chaperone protein, a cytoskeletal protein, a tight junction protein, a metal-binding protein, and a mitochondrial protein.

10. The vector of claim 9, wherein the therapeutic protein is a CAR comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain.

11. The vector of claim 8, wherein the immunogenic antigen is a viral antigen, a bacterial antigen, a parasitic antigen, a fungal antigen, a tumor antigen, or a neoantigen; and wherein the immunogenic antigen comprises at least a portion of a spike protein, a nucleocapsid protein, a membrane protein, an envelope protein, a capsid protein, a surface glycoprotein, or an immunodominant domain thereof.

12. A method of producing circular RNA in a solution using the vector of claim 1.PATENT EX1-006WO13. A circular RNA molecule produced by the vector of claim 1.

14. A circular RNA molecule produced by the vector of claim 4, wherein the circular RNA molecule comprises a junction sequence comprising the 5’ structured RNA element and the 3’ structured RNA element.

15. A pharmaceutical composition comprising the circular RNA of claim 13 and a pharmaceutically acceptable excipient.

16. The pharmaceutical composition of claim 14, wherein the circular RNA is encapsulated within a lipid nanoparticle (LNP).

17. A method of inducing an immune response in a subject, the method comprising administering to the subject an effective amount of the pharmaceutical composition of claim 14.

18. The method of claim 16, wherein the pharmaceutical composition is administered at a dose of about 0.0001 mg to about 1000 mg of circular RNA.

19. A vector for producing circular RNA, wherein the vector is selected from the group consisting of SEQ ID NOs: 1 - 6.

20. A vector for producing circular RNA, the vector comprising, in a 5’ to 3’ direction: a) a T7 promoter;b) a hammerhead ribozyme sequence;c) a 5' homology arm comprising a first self-kissing loop (SKL) sequence;d) a ribozyme sequence capable of catalyzing a ligation reaction;e) a 5’ splice site recognition sequence (SSRS) region comprising a 5’ splice site sequence and a 3’ structured RNA element;f) a gene of interest (GOI) region;PATENT EX1-006WOg) a fragment containing a 5’ structured RNA element and a target splice site at the 3’ terminus; andh) a 3’ homology arm comprising a second self-kissing loop (SKL) sequence;wherein the vector is configured to produce circular RNA that is translatable or biologically active inside eukaryotic cells.

Images