Synthetic antibody for trimeric SOD1 biomarker and use thereof for diagnosing als

Abstract

A method for screening a subject in need thereof for amyotrophic lateral sclerosis (ALS) or slowing a progression of ALS, wherein the method includes measuring a level of at least a biomarker in the subject, such as without limitation by using a synthetic antibody, determining an ALS status indicator as a function of the measurement, and optionally providing a treatment to slow the progression of ALS as a function of the ALS status indicator, wherein the at least a biomarker includes a trimeric superoxide dismutase 1 (SOD1).

Description

Attorney Docket No. 0073605-001205 SYNTHETIC ANTIBODY FOR TRIMERIC SOD1 BIOMARKER AND USE THEREOF FOR DIAGNOSING ALS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application No. 63 / 821,647, filed June 11, 2025, and U.S. Provisional Application No. 63 / 777,929, filed March 26, 2025, which are incorporated herein by reference in their entireties.STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under Grant No. GM134864 awarded by the National Institutes of Health. The Government has certain rights in the invention.FIELD OF THE INVENTION

[0003] The present invention generally relates to the field of medical diagnosis. In particular, the present invention is directed to a synthetic antibody for trimeric superoxide dismutase 1 (SOD1) biomarker and its use thereof for diagnosing amyotrophic lateral sclerosis (ALS) and treating ALS. REFERENCE TO SEQUENCE LISTING

[0004] This specification includes a sequence listing submitted herewith, which includes the file entitled 0073605-001034. xml having the following size: 8,592 bytes which was created June 11, 2025, the contents of which are incorporated by reference herein.BACKGROUND

[0005] ALS, also known as Lou Gehrig's disease, is a devastating neurodegenerative disease resulting in a loss of motor neurons, eventual paralysis, and death typically within three to five years of initial symptom onset.

[0006] The exact cause of ALS is unknown but is speculated to be a combination of genetic and environmental factors. ALS typically begins with gradual weakness in the hands, feet, or limbs. Over time, the weakness progresses and affects other muscle groups, including those involved in speaking, swallowing, and breathing. Other symptoms of ALS may include muscle cramps and twitching, difficulty walking and using hands, slurred speech, and respiratory problems. The diagnosis of ALS is based on already manifested symptoms and often relies on a limited number of tools and resources such as physical exams, neurological tests, and the medical history of a patient. There are currently no specific biomarkers that can be used to specifically detect ALS.BRIEF SUMMARY OF THE DISCLOSURE

[0007] In an aspect, disclosed herein is a method of screening a subject in need thereof for ALS. The method may include measuring a level of at least a biomarker in the subject, wherein the at leastAttorney Docket No. 0073605-001205 a biomarker includes trimeric SOD1. The method may further include determining an ALS status indicator as a function of the measurement.

[0008] In some embodiments, determining the ALS status indicator may include tracking a progression of ALS in the subject as a function of the measurement.

[0009] In some embodiments, measuring the level of at least a biomarker may include measuring the level of the at least a biomarker using a blood test.

[0010] In some embodiments, measuring the level of the at least a biomarker may include detecting a level of trimeric SOD1 using a synthetic antibody. In some embodiments, the synthetic antibody includes a means for selectively binding trimeric SOD1. In some embodiments, at least a functional fragment of the synthetic antibody may be encoded by a nucleic acid sequence, such as a DNA sequence, that is at least 80% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be characterized by one or more members selected from a group consisting of at least 85% identical to SEQ ID NO: 1, at least 90% identical to SEQ ID NO: 1, at least 95% identical to SEQ ID NO: 1, and at least 99% identical to SEQ ID NO: 1.

[0011] In some embodiments, measuring the level of the at least a biomarker may include measuring the level of the at least a biomarker using a biomarker assay. In some embodiments, the biomarker assay may include an enzyme-linked immunosorbent assay (ELISA).

[0012] In another aspect, disclosed herein is a synthetic antibody for diagnosis of ALS, as described above. In some embodiments, at least a functional fragment of the synthetic antibody may be encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1 and has a specific binding affinity towards trimeric SOD1. In some embodiments, the synthetic antibody may include a means for selectively binding trimeric SOD1. In some embodiments, the nucleic acid sequence may be characterized by one or more members selected from a group consisting of at least 85% identical to SEQ ID NO: 1, at least 90% identical to SEQ ID NO: 1, at least 95% identical to SEQ ID NO: 1, and at least 99% identical to SEQ ID NO: 1.

[0013] In some embodiments, the synthetic antibody may be expressed using genetically modified BL21 cells. In some embodiments, genetically modifying the BL21 cells may include removing a phage region from a phagemid to produce a plasmid, wherein the plasmid encodes the synthetic antibody. In some embodiments, removing the phage region may include removing the phage region using a double restriction digestion with Spel and Nhel enzymes. In some embodiments, genetically modifying the BL21 cells may further include transforming the plasmid into the BL21 cells to produce the genetically modified BL21 cells.Attorney Docket No. 0073605-001205

[0014] In another aspect, disclosed herein is a biomarker assay for diagnosis of ALS. The biomarker assay may be configured to detect the presence of trimeric SOD1 using the synthetic antibody described above.

[0015] In some embodiments, the biomarker assay may include an ELISA. In some embodiments, the synthetic antibody may be conjugated with a horseradish peroxidase (HRP) tag.

[0016] In another aspect, disclosed herein is a medical kit for diagnosis of ALS. The medical kit may include at least a biomarker assay including the synthetic antibody described above and at least an instruction for using the at least a biomarker assay.

[0017] In some embodiments, the biomarker assay may include an ELISA, consistent with details described above. In some embodiments, the synthetic antibody may be conjugated with an HRP tag, consistent with details described above.

[0018] In another aspect, disclosed herein is a use of the synthetic antibody described above for diagnosis of ALS. In some embodiments, the synthetic antibody may be conjugated with an HRP tag, consistent with details described above.

[0019] In another aspect, disclosed herein is a method for slowing a progression of ALS in a subject in need thereof. The method may include measuring a level of at least a biomarker in the subject, wherein the at least a biomarker includes trimeric SOD1. The method may further include determining an ALS status indicator as a function of the measurement. The method may further include providing a treatment to slow the progression of ALS as a function of the ALS status indicator.

[0020] In some embodiments, measuring the level of the at least a biomarker may include detecting a level of trimeric SOD1 using a synthetic antibody, as described above, wherein the synthetic antibody comprises a means for selectively binding trimeric SOD1 or at least a functional fragment of the synthetic antibody is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1.

[0021] In some embodiments, the composition(s), method(s), biomarker assay(s), and / or medical kit(s) described herein may be used for diagnosis, screening, or treatment of frontotemporal dementia (FTD).

[0022] These and other aspects and features of nonlimiting embodiments of the present invention will become apparent to those skilled in the art upon review of the following description of specific nonlimiting embodiments of the invention in conjunction with the accompanying drawings.Attorney Docket No. 0073605-001205 BRIEF DESCRIPTION OF THE DRAWINGS

[0023] For the purpose of illustrating the invention, the drawings show aspects of one or more embodiments of the invention. However, it should be understood that the present invention is not limited to the precise arrangements and instrumentalities shown in the drawings except as may be required by one or more claims.

[0024] FIG. 1 A depicts exemplary data of measured antibody concentrations, showing a significant increase (p = 0.001) in concentration for antibodies against trimeric SOD1 in ALS patient samples versus healthy controls; antibody concentrations are measured as absorbances at 450 nm under the SpectraMax plate reader.

[0025] FIG. IB depicts exemplary data of measured antibody concentrations, showing no statistically significant difference in antibody binding between trimeric SOD Is with His tags and trimeric SODls without His tags; both FH and HG mutations of trimeric SOD1 are included in the comparison; antibody concentrations are measured as absorbances at 450 nm under the SpectraMax plate reader.

[0026] FIG. 1C depicts exemplary data of measured antibody concentrations, showing no statistically significant difference in antibody binding between whole blood and serum samples; six types of SOD1 proteins are included in the comparison; antibody concentrations are measured as absorbances at 450 nm under the SpectraMax plate reader.

[0027] FIG. ID depicts exemplary data of measured antibody concentrations, showing a significant increase (p < 0.05) in concentration for antibodies against FH, HG-His, and HG proteins in ALS patient samples versus healthy controls; antibody concentrations are measured as absorbances at 450 nm under the SpectraMax plate reader.

[0028] FIG. 2A depicts exemplary ELISA data of original eight antibody “hits”, performed in technical triplicates; an Ml 3 antibody is used for the ELISA; absorbances measured at 450 nm under the SpectraMax plate reader.

[0029] FIG. 2B depicts exemplary images from native PAGE testing of the initial eight antibody hits in FIG. 2A.

[0030] FIG. 2C depicts exemplary data collected using late-stage disease patient samples showing the first ELISA serum test based on five healthy controls and five ALS patients of three narrowed-down antibody “hits”; antibody 9 is selected for additional optimization; an M13 antibody is used for the ELISA; absorbances are measured at 450 nm under the SpectraMax plate reader.Attorney Docket No. 0073605-001205

[0031] FIG. 2D depicts exemplary data collected using early-stage disease patient samples showing that removal of phage reduces nonspecific binding and contributes to a more statistically significant difference between patient and control samples; absorbances measured at 450 nm under the SpectraMax plate reader.

[0032] FIG. 2E depicts an exemplary workflow of an antibody purification process.

[0033] FIG. 2F depicts exemplary western blots showing the initial IPTG-induced expression of antibody 9 and antibody 10. Supernate refers to the medium the cells were growing in prior to lysis, while pellet refers to the cellular lysate.

[0034] FIG. 2G depicts an exemplary chromatograph for the purification of antibody 9 from a His column.

[0035] FIG. 3A depicts an exemplary native-PAGE blot (bottom) and the intensity measured therefrom (top). Antibody 9 is used to detect SOD1 trimer in NSC-34 (motor neuron-like) cell lysate overexpressing dimer (wild-type or WT) and two levels of trimer stabilization (A4V or FH), respectively. FH showed a statistically significant increase (p = 0.0204) in native western blot intensity compared to the healthy control.

[0036] FIG. 3B depicts exemplary data of ELISA quantification. Trimeric SOD1 is quantified in healthy control, Alzheimer’s Disease (AD), and ALS patient serum samples using antibody 9 at a 1:100 dilution.

[0037] FIG. 4 depicts exemplary data summarizing ELISA results based on samples collected from various patient groups. All samples from ALS patients showed a statistically significant increase (p < 0.0001) in trimeric SOD1 levels (measured as the absorbance at 450 nm) compared to samples collected from healthy controls and Alzheimer’s disease (AD) patients.

[0038] FIG. 5 A depicts exemplary data showing concentrations of trimeric SOD1 across healthy controls, Alzheimer’s disease (AD) patients, Parkinson’s disease (PD) patients, and ALS patients. 42 newly collected plasma samples from ALS patients were tested in a direct ELISA using freshly purified, HRP-crosslinked antibody, and results were compared to a titration curve of purified HG-His from 1 pg / mL to 100 pg / mL to calculate the titer (pg / mL trimer). A significant increase (p < 0.0001) in trimeric SOD1 concentration was observed among ALS patient samples compared to healthy controls. In contrast, the difference in trimeric SOD1 concentration is statistically insignificant between AD / PD patients and the control. Tests were performed on serum samples using antibody 9 at a 1:100 dilution (at a working concentration 1.6 pg / mL).Attorney Docket No. 0073605-001205

[0039] FIG. 5B depicts an exemplary titration curve used to calculate the titer of trimeric SOD1 (pg / mL trimer). The titration curve shows a correlation between absorbances at 450 nm in ELISA and concentrations of purified HG-His (antibody 9) from 1 pg / mL to 100 pg / mL.

[0040] FIG. 6 depicts an exemplary receiver operating characteristic (ROC) curve illustrating the diagnostic performance of trimeric SOD1 in distinguishing ALS from control samples, with an AUC of 1.00 and an optimal threshold of 196.58 pg / mL based on Youden’s J statistic.

[0041] FIG. 7A depicts a DNA agarose gel of the plasmids for antibodies 9 and 10 before (start) and after (digest) to remove the phage region. The M13 phage region was removed from the isolated antibody plasmids by restriction digestion with .S / and Nhel, followed by ligation with T4 ligase and transformation into B121 E. coll.

[0042] FIG. 7B depicts a genetic map of phagemid vector pComb3, containing Spel and Nhel restriction sites.

[0043] FIG. 8A depicts a surface plasmon resonance affinity curve for the steady-state binding of trimeric SOD1 FH-His to antibody 9 (57 pM, 7.5 nM, 75 nM).

[0044] FIG. 8B depicts surface plasmon resonance fitted and reference curves for the binding of WT dimeric SOD1 to antibody 9 (green = 2.33 nM, red = 23.3 nM, blue = 233 nM). Using surface plasmon resonance (SPR), the binding affinity of antibody 9 with purified trimeric SOD1 (FH-His) compared to WT SOD1 was elucidated. The novel antibody has strong binding (KD of 7.92 x 10'9M (± 1.01 x 10’9)) with trimeric SOD1.

[0045] FIG. 9A-9C depicts first round ELISA panning for phages. Phage panning was performed to screen against NSC34 cell lysate control or cell lysate overexpressing trimeric SOD1 to rule out antibodies with non-specific binding to the lysate. The numbering system represents panning round (7), plate number (1 or 2), then the row number. Nearly 400 possible antibodies were screened.

[0046] FIG. 10 depicts a schematic summarizing the process between the phage display antibody to a purified, tagged antibody for detection assays.

[0047] The drawings are not necessarily to scale and may be illustrated by phantom lines, diagrammatic representations, and fragmentary views. In certain instances, details that are not necessary for an understanding of the embodiments or that render other details difficult to perceive may have been omitted.

[0048] DETAILED DESCRIPTION OF THE INVENTIONAttorney Docket No. 0073605-001205

[0049] Over 5,000 people are diagnosed with ALS each year. Only 10% of these cases are familial (fALS) (family history) while the remaining 90% are sporadic (sALS). Similar proteins are found misfolded in both fALS and sALS. Mutations in over 46 different genes have been linked to ALS since 1993, and more are still being identified, leading researchers to question whether ALS is one disease mechanism triggered by multiple factors (convergent) or a cluster of separate diseases with similar phenotypes and symptoms (divergent).

[0050] Since there is not one established pathology for ALS, it is difficult to design a universal biomarker that could diagnose both fALS and sALS patients. Reliable biomarkers are necessary for a quick diagnosis of ALS, fortracking the disease progression and severity thereof, and for quantifying the effect of new therapeutics thereon. Specifically, since the expected life span after symptom onset is only three to five years, earlier diagnosis is necessary not only to allow patients and families more time to process the diagnosis but also to allow for earlier intervention if a new successful treatment method is developed.

[0051] There are currently no specific biomarkers for ALS. Candidate biomarkers currently being investigated are typically either broad biomarkers for neurodegeneration, such as without limitation p75ECD, phosphorylated neurofilament heavy chain, and neurofilament light, or inflammatory cytokines that require complex combinations to create an observable difference in ALS patient samples. Currently, diagnosing ALS requires ruling out all other potential conditions, a process that can take a long time. By the time patients receive an official diagnosis, they may have only 2-5 years left to live. The difficulty in diagnosing patients also makes it difficult to design treatments that can be effective in the late stages of the disease, as opposed to being able to treat patients in the early stages and prevent further disease progression.

[0052] Superoxide dismutase 1 (SOD1) is a cytosolic antioxidant enzyme that natively forms a dimer, with copper and zinc metals, and converts superoxide radicals into oxygen and hydrogen peroxide8. Mutations in SOD1 destabilize the dimer interface, leading to the loss of metals and aggregation into soluble and insoluble oligomers9. Mutant SOD1 (G93A) mouse models were shown to develop a loss of motor function. While SOD 1 -knockdown mouse models do not display the same phenotype, this study led to the conclusion that SOD1 misfolding causes a toxic gain of function as opposed to a loss of function10,11.

[0053] While mutations in SOD1 are only found in 1-3% of all patients, misfolded SOD1 has been found throughout patients with other ALS-related mutations, such as without limitation fused in sarcoma (FUS) and TDP-4, and in sporadic patients. Many other factors besides mutations mayAttorney Docket No. 0073605-001205 cause S0D1 to destabilize and aggregate, including without limitation post-translational modifications such as glutathionylation, loss of metals, crowding from overexpression, and environmental toxins such as BMAA and ammonia. Misfolded SOD1 has been reported in both sporadic and familial ALS patients, among both familial SOD1 and non-SODl patients, yet controversy throughout SODl’s role in ALS still exists. Whether misfolded SOD1 is present in sporadic and non-SODl familial ALS patients has been highly disputed over the past decade, most likely due to drastic differences in the abundance of misfolded SOD1 in patient samples when different antibodies are used, as well as the inconsistencies across different tissue types and preparations. Forsberg, Pare, Grad, and Pokrishevsky all observed misfolded SOD1 in non-SODl fALS and sALS patient spinal cord sections using either immunohistochemistry or immunoprecipitation. In contrast, Da Cruz and Liu did not identify differences in misfolded SOD1 between ALS patients and controls. However, it is worth noting that Da Cruz used very low concentrations of antibody, and Liu tested using only one monoclonal SOD1 antibody. Altogether, there is more evidence for misfolded SOD1 being a universal component in ALS than there is in contrary.

[0054] The invention described in this disclosure provides support for the assumption that ALS is a convergent disease. Under such assumption, it is speculated that trimeric SOD1 may be a viable biomarker to diagnose ALS in both sporadic and familial ALS patients with and without SOD1 mutations. Indeed, in this disclosure, trimeric SOD1 was tested and confirmed as a diagnostic biomarker for ALS, as described in further detail below in this disclosure.

[0055] When the SOD1 dimer interface is disrupted, SOD1 aggregates and forms a wide range of soluble oligomers and insoluble fibrils. Most previous studies consider misfolded SOD1 a mixture of all aggregate sizes, yet the differently sized oligomers have drastically independent toxicities and structures.

[0056] Specifically, SOD1 may misfold into a trimer during ALS. It has been shown that trimers of SOD1 may have a toxic effect, while larger aggregates of SOD1 may serve certain protective function(s) instead. In 2016, Proctor et al. determined that small soluble trimeric oligomers of SOD1 had the highest toxicity in cell models and that the toxicity correlated with the thermodynamic stability of trimeric SOD1. Zhu et al. expanded on the toxicity of trimers by demonstrating that larger SOD1 oligomers and insoluble fibrils are protective to cells. In 2022, Hnath and Dokholyan investigated the aggregation mechanism of SOD1 using structural characterization assays and determined that trimeric SOD1 is a structurally independent species thatAttorney Docket No. 0073605-001205 forms in direct competition with larger aggregates, opposed to trimeric SOD1 being a preliminary step in larger aggregate formation. In other words, the toxic SOD1 trimer is structurally independent of monomeric and other aggregates of SOD 1.

[0057] It is speculated that ALS patients have a significantly increased level of antibodies against SOD1 trimers in their blood compared to healthy control patients. However, there are no antibodies specifically designed to detect SOD1 trimers. Additionally, due to the differences between SOD1 trimers and larger aggregates of SOD1, most antibodies are not able to selectively detect the SOD1 trimers. The inability for most antibodies to detect trimeric SOD1 may account for the drastic inconsistencies between studies quantifying misfolded SOD1 in patient samples. It is speculated that trimeric SOD1 has an expansive role in ALS that has been hidden due to such limitations in antibody specificity.

[0058] The commercially available anti-C4F6 antibody is the only known antibody that can consistently recognize trimeric SOD1. However, it is worth noting that the anti-C4F6 antibody was not originally designed specifically for trimeric SOD1, as the mouse was immunized with G93A holo-SODl instead. As a result, the anti-C4F6 antibody may bind to not only trimeric SOD1, but also other sizes of SOD1 oligomers.

[0059] Due to the toxicity of trimeric SOD1 to cells, it is anticipated that challenges may arise when creating a monoclonal antibody using animal models. Therefore, a bacterial phage librarybased synthetic antibody design was chosen instead. Such synthetic antibody design made it possible to quickly screen several potential antibodies for their binding affinity, with respect to not only trimeric SOD1 but also other forms of SOD1 not intended to be bound by the antibody, such as without limitation dimeric and fibril SOD1. This approach provides for a more specific antibody compared to the traditional monoclonal antibody design.

[0060] While preparation of antibodies described herein is conducted primarily through phage display technology, those of skill in the art will recognize that unless required in the claims the methods and concepts may be practiced effectively using techniques involving, for example, transgenic mice, single B Cell screening, and other effective methods.

[0061] To facilitate the understanding of this invention, a number of terms are defined below and throughout the disclosure. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control. The terminology herein is used to describe specific embodiments of the invention, but theirAttorney Docket No. 0073605-001205 usage does not limit the invention, except as outlined in the claims. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0062] It should be appreciated that the words “first”, “second”, and so on, in the description and claims, are used to distinguish or identify, and not to show a serial or numerical limitation.

[0063] As used herein, unless stated otherwise, the terms “about” or “approximately” refer to a value that is within 10% above or below the value being described.

[0064] As used herein, including the claims, singular forms of terms are to be construed as also including the plural form and vice versa, unless the context indicates otherwise. Thus, it should be noted that as used herein, the singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. In other words, terms such as “a”, “an”, and “the” are not intended to refer to only a singular entity but include the general class of which a specific example may be used for illustration.

[0065] As used herein, “synthetic” means that the antibody, amino acid sequence, nucleotide sequence, or other compound is not naturally occurring, but should not be read to imply any particular means of generation or synthesis.

[0066] Throughout the description and claims, the terms “comprise”, “including”, “having”, “contain”, and their variations should be understood as meaning “including but not limited to” and are not intended to exclude other components unless specifically so stated.

[0067] As used herein, the terms “administration” or “administering” refer to a method of giving a dosage of a compound or pharmaceutical composition to a subject. A composition described herein may be administered to a subject by any one of a variety of manners or a combination of varieties of manners. For example, a composition may be administered orally, nasally, intraperitoneally, or parenterally, by intravenous, intramuscular, topical, or subcutaneous routes, or by injection into tissue.

[0068] As used herein, an “effective amount” or “therapeutically effective amount” is the amount of a composition of this disclosure which, when administered to a subject, is sufficient to effect treatment of a disease or condition in the subject. The amount of a composition of this disclosure which constitutes a “therapeutically effective amount” may vary depending on the composition, the condition and its severity, the manner of administration, and the age of the subject to be treated.Attorney Docket No. 0073605-001205

[0069] As used herein, the terms “treat”, “treating”, or “treatment” refer to administration of a compound or pharmaceutical composition for a therapeutic purpose. To “treat a disorder” or use for “therapeutic treatment” refers to administering treatment to a patient already suffering from a disease to ameliorate the disease or one or more symptoms thereof to improve the patient’s condition (e.g., by reducing one or more symptoms of a neurological disorder). The term “therapeutic” includes the effect of mitigating deleterious clinical effects of certain processes (i.e., consequences of the process, rather than the symptoms of processes). As nonlimiting examples, a treatment may include (i) preventing a disease or condition from occurring in a subject, in particular, when such subject is predisposed to the condition but has not yet been diagnosed as having it; (ii) inhibiting a disease or condition, i.e., arresting its development; (iii) relieving a disease or condition, i.e., causing regression of the disease or condition; or (iv) relieving the symptoms resulting from a disease or condition, i.e., relieving pain without addressing the underlying disease or condition. Examples of treatments for ALS include, for example, but are not limited to, administration of therapeutically effective amounts of riluzole, edaravone, or toferson.

[0070] While the invention has been described in connection with what is presently considered to be the most practical and embodiments thereof are further described in the examples below, it is to be understood that the invention is not to be limited to the disclosed embodiment, but on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

[0071] The following description sets forth various examples along with specific details to provide a thorough understanding of claimed subject matter. It will be understood by those skilled in the art, however, that claimed subject matter may be practiced without one or more of the specific details disclosed herein. Further, in some circumstances, well-known methods, procedures, systems, and / or components have not been described in detail in order to avoid unnecessarily obscuring claimed subject matter. The illustrative embodiments described in the detailed description and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented here. It will be readily understood that the aspects of the present disclosure, as generally described herein, can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are explicitly contemplated and make part of this disclosure.

[0072] In an aspect, disclosed herein is a method of screening a subject in need thereof for ALS. The method may include measuring a level of at least a biomarker in the subject, wherein the at leastAttorney Docket No. 0073605-001205 a biomarker includes trimeric superoxide dismutase 1 (SOD1). The method may further include determining an ALS status indicator as a function of the measurement.

[0073] As used herein, a “subject” includes, but is not limited to, humans and non-human vertebrates such as wild, domestic, and farm animals. The terms “subject” and “patient” may be used interchangeably throughout this disclosure. As a nonlimiting example, a subject or patient may include a human of any age, sex, gender, race, ethnicity, health record, etc., as deemed relevant and / or suitable by a person of ordinary skill in the art, upon reviewing the entirety of this disclosure.

[0074] As used herein, a “biomarker” is an indication that signifies a normal or abnormal physiological process and / or marks a certain condition or disease. Tn some cases, a biomarker may be used to determine whether a patient has a certain disease or condition. In some cases, a biomarker may be used to evaluate the severity of a certain disease or condition in a patient. In some cases, a biomarker may be used to evaluate how well a patient or subject responds to a treatment for a certain disease or condition. In some cases, a biomarker may include a detected presence of, a measured amount or concentration of, and / or another qualitative or quantitative metric based on one or more chemical / biochemical species. Additional details will be provided below in this disclosure.

[0075] As used herein, a “superoxide dismutase 1 trimer”, “trimeric superoxide dismutase 1”, “SOD1 trimer”, or “trimeric SOD1” is a misfolded form of superoxide dismutase 1 that includes an assembly of three superoxide dismutase 1 units. As used herein, “superoxide dismutase 1” or “SOD1”, also known as Cu, Zn superoxide dismutase 1, superoxide dismutase [Cu-Zn], or hSodl, is primarily an antioxidant enzyme present in the cytosol, outer-mitochondrial membrane, and intermembrane space of the mitochondria. SOD1 is capable of protecting cells from damage by breaking down superoxide radicals into molecular oxygen (O2) and hydrogen peroxide (H2O2). SOD1 may be encoded by the SOD1 gene, which is located on chromosome 21 in humans.

[0076] It is worth noting that this disclosure describes, for the first time, the use of SOD1 trimer as a viable biomarker for both sporadic and familial ALS. More specifically, in some cases, a recombinantly purified mutant of SOD1, which is stable as a trimer, may be used as a model biomarker for testing of ALS. Such a diagnostic biomarker may be used in clinics to evaluate whether a patient with ALS-like symptoms has ALS.

[0077] SOD1 trimers are toxic to motor neurons. SOD1 trimers are recognized as off-pathway intermediates that compete with insoluble agregate (fibril) formation and mutations have been identified that promote of stabilize the trimeric form. Engineered SOD1 trimers, including but not limited to trimer-stabilized mutants are useful for screening and identifying SOD1 trimer-specificAttorney Docket No. 0073605-001205 binding agents such as antibodies. Such binding agents are useful at least to identify trimeric S0D1 in subject samples, isolate and purify trimeric S0D1 from test samples and solutions, and filter or remove trimeric SOD1 from body fluids. The mutants are also used to identify binding agents that prevent, inhbit, or reverse formation of SOD1 trimers or remove SOD1 trimers.

[0078] Trimer-stabilizing mutants include, e.g., F20L, E21Q, P74G, H96Q, G108H, D124Q, K136H, G147P, and double mutants H96Q / G108H and F20L / H96Q. The SOD1 proteins may be modified to facilitate purification and immobilization. In a non-limiting example, trimer-stabilized double mutants H96Q / G108H and F20L / H96Q optionally with his tails (referred to herein as HG-His or FH-His) can be used to screen and obtain trimeric SOD1 -specific antibodies.

[0079] Selective Trimeric SOD1 binding agents

[0080] In an aspect, the invention provides binding proteins specific for trimeric SOD1 and methods of making such binding proteins. In certain embodiments, a human SOD1 transgenic mouse is immunized with one of more trimeric SOD 1 -stabilized mutant trimers. For example, the transgenic mouse is immunized with one or more of G147P, H96Q / G108H, and F20L / H96Q stabilized trimers and monoclonal antibodies are prepared and screened. It is expected that the SOD1 trimers are immunogenic whereas the native human SOD1 dimers are not. The CDRs may be grafted to frameworks of different species. In certain embodiments, the SOD1 transgenic mouse is humanized and expresses fully human antibodies.

[0081] In certain embodiments, an antibody library, such as an Fab library or an scFv library, which can be a human Fab or scFv library, or a VHH library or other such library of immunoglobulin variable region sequences, is screened for specific binding to trimeric SOD1 or to trimer-stabilized SOD1. In certain embodiments, the library is a phage display library or a yeast display library or a ribosome display library.

[0082] Library screening involves positive selection for members that bind to trimeric-SODI or timer-stabilized mutants and can include negative selection against members that bind to other SOD1 proteins, such as wild-type SOD1, fibrillar SOD1 and SOD1 mutants that promote other forms of SOD1. Mutants useful for negative selection include, without limitation, G93A and fibril stabilizing mutants such as N53I and D101I. A round of screening or panning for a trimeric SOD1 selective agent typically includes a selection step and a counterselection step, either of which can be performed first. The initial screening round can be repeated 1, 2, 3, 4, 5, 6, 7, 8, 9 or more times. As exemplified herein, a Fab phage display library was panned to remove phage-Fab specific for wild-Attorney Docket No. 0073605-001205 type S0D1 dimers, then panned to select for phage-Fab that bind to HG S0D1 trimers and FH SOD1 trimers. Seven rounds of negative and positive selection were conducted.

[0083] Thus, in an aspect, the invention provides a method making SOD1 trimer-specific binding proteins, which comprises, screening a library of antigen-binding proteins by positive selection on SOD1 trimers and negative selection against native SOD1 dimers. In certain embodiments, screening further includes negative selection against SOD1 oligomers larger than trimers. In certain embodiments, screening further includes negative selection against SOD1 aggregates.

[0084] Synthetic antibody fragments (e g., Fab, Fab’, scFv) and single chain antibodies (single VHH domain or nanobodies) provide binding agents with desirable characteristics, mostly stemming from their reduced size and simplified production.

[0085] A diabody is a bivalent antibody fragment constructed by gene fusion (for example, P. Holliger et al., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993), EP 404,097, WO 93 / 11161). In general, a diabody is a dimer of two polypeptide chains. In the each of the polypeptide chains, a light chain variable region (VL) and a heavy chain variable region (Vn) are connected via a short linker, for example, a linker of about five residues, so that the VL and VH cannot pair with each other, but instead form a dimer. Thus, a diabody has two antigen-binding domains. When the VL and VH regions against the two types of antigens (a and b) are combined to form VLa-Vub and VLb-VHa via a linker of about five residues, and then co-expressed, they are secreted as bispecific Dbs. The antibodies of the present invention may be such Dbs

[0086] DARPins (Designed Ankyrin Repeat Proteins) comprise another platform of engineered binding proteins (Pluckthun, A. Designed Ankyrin Repeat Proteins (DARPins): Binding Proteins for Research, Diagnostics, and Therapy. Anmi. Rev. Pharmacol. Toxicol. 2015, 55, 489- 511.) DARPins are composed of repetitions of a 33 amino acid consensus sequence. The consensus repeat sequence comprises structurally important residues and non-conserved residues that can be randomized. The concatenation of a number of these repeats allows for the formation of highly stable scaffolds that can be engineered for desired binding characteristics.

[0087] DARPins with high affinities towards almost any protein target can be generated using ribosome display, phage display, or yeast display as a selection method. Ribosomal display base on translational machinery from E. coli provides high physical diversities (up to 1012molecules) and random mutagenesis can be employed for affinity maturation. (Walser et al., Designed Ankyrin Repeat Proteins: A New Class of Viral Entry Inhibitors. Viruses. 2022 14(10):2242.)Attorney Docket No. 0073605-001205

[0088] Consensus tetratricopeptide repeat (CTPR) proteins constitute another useful class of engineered proteins. The CTPR unit contains a helix-tum-helix motif of 34 amino acids, of which only 8 are essential for correct folding. CTPR proteins provide a base scaffold that can combine functions such as metal binding with target binding. (Uribe , K.B. et al. Engineered Repeat Protein Hybrids: The New Horizon for Biologic Medicines and Diagnostic Tools, Accounts of Chemical Research 2021, 54(22):4166-77.)

[0089] Aptamers are short single- stranded DNA or RNA oligonucleotides that can selectively bind to small molecular ligands or protein targets with high affinity and specificity. Sequential Evolution of Ligands by Exponential Enrichment (SELEX) is an iterative process, through which non-binding aptamers are discarded and aptamers binding to a proposed target are expanded.Typically, a library of ssRNA or ssDNA is bound to a target, non-binders are eluted, and binders are expanded by PCR. The selection is repeated for the expanded population of binders.

[0090] As used herein, an “ALS status indicator’ is an attribute assigned to a subject regarding their ALS status. In some embodiments, an ALS status indicator may be used to describe, in a binary manner, whether a subject has ALS. In some embodiments, an ALS status indicator may be used to specify the type of ALS, e.g., sporadic ALS or familial ALS, that a subject is associated with. In some embodiments, an ALS status indicator may be used to specify the severity of ALS that a subject is associated with. In some embodiments, an ALS status indicator may be used to specify or categorize a current stage of progression of ALS that a subject is associated with. In some embodiments, determining the ALS status indicator may include tracking a progression of ALS in the subject as a function of the measured level of at least a biomarker.

[0091] In some embodiments, measuring the level of the at least a biomarker may include measuring the level of the at least a biomarker using a blood test. As nonlimiting examples, the blood test may be performed using a sample of whole blood or blood serum of a subject. Such a blood test may be implemented using any suitable means as recognized by a person of ordinary skill in the art, upon reviewing the entirety of this disclosure. Additional details will also be provided below in this disclosure.

[0092] In some embodiments, measuring the level of the at least a biomarker may include detecting a level of trimeric SOD1 using a synthetic antibody. In some embodiments, at least a functional fragment of the synthetic antibody may be encoded by a nucleic sequence that is at least 80% identical to SEQ ID NO: 1. In some embodiments, the synthetic antibody may include a means for selectively binding trimeric SOD1. In some embodiments, the synthetic antibody may be aAttorney Docket No. 0073605-001205 peptide, protein, or amino acid sequence encoded by SEQ ID NO: 1 or a functional variant of a peptide, protein, or amino acid sequence encoded by SEQ ID NO: 1. Additional details will be provided below in this disclosure. Specifically, SEQ ID NO: 1 includes several unique antibody regions (SEQ ID NO: 2-4) and an antibiotic-resistant region (i.e., an Ampicillin-resistant region, SEQ ID NO: 5).

[0093] As used herein, the term "specifically binds" or "binds specifically" means that a trimeric SOD1 binding protein of the invention reacts or associates more frequently, more rapidly, with greater duration and / or with greater affinity with trimeric SOD1 than it does with alternative antigens. For example, trimeric SOD1 binding protein binds to trimeric SOD1 with materially greater affinity (e.g., at least 2-fold or 5-fold or 10-fold or 20-fold or 50-fold or 100-fold or 500-fold or 1000-fold or 10,000-fold or greater) than it does to other proteins or peptides. In certain embodiments, the trimeric SOD 1 -binding protein binds to trimeric SOD1 with an equilibrium dissociation constant KD for the epitope or target to which it binds of, e.g., 10’4M or smaller, e.g., IO’5M, 10’6M, 10’7M, I O’ M, IO’9M, IO’10M, 10’11M, or IO’12M. The term “high affinity” for an IgG antibody refers to an antibody having a Koof 1.0x1 O'6M or less, or 3.0x1 O'7M or less, or 1.0x1 O’7M or less, or 3.0x10'8M or less, or 1.0x1 O'8M or less, or 3.0x1 O’9M or less, or 1.0x1 O’9M or less, or from 1.0x1 O'6M to 3.0x10'7M, or from 3.0x1 O’7M to 1.0x1 O’7M, or from 1.0x1 O'7M to 3.0x10‘8M, or from 3.0x10'8M to 1.0x10'8M, or from l.OxlO’8M to 3.0x1 O’9M, or from 3.0xl0’9M to l.OxlO’9M for a target antigen. The term “very high affinity” for an IgG antibody refers to an antibody having a KD of 3.0x1 O’10M or less, or l.OxlO’10M or less, or 3.0x10’11M or less, or l.OxlO’11M or less, or 3.0x1 O’12M or less or l.OxlO’12M or less, or from l.OxlO’10M to 3. Ox 10’10M, or from 3.0x1 O’10M or to l.OxlO’10M or from l.OxlO’10M to 3.0x10’11M, or from 3.0X10’11M or to l.OxlO’11M, or from l.OxlO’11M to 3.0xl0’12M, or from 3.0xlO’12Mto l.OxlO’12M. It will be recognized by one of skill that an antibody that specifically binds to a target (trimeric SOD1) from one species may also specifically bind to orthologs of trimeric SOD1.

[0094] Antigen-binding fragments of an antibody may be derived, e.g., from full antibody molecules using any suitable standard techniques such as proteolytic digestion or recombinant genetic engineering techniques involving the manipulation and expression of DNA encoding antibody variable and optionally constant domains. Such DNA is known and / or is readily available from, e.g., commercial sources, DNA libraries (including, e.g., phage-antibody libraries), or can be synthesized. The DNA may be sequenced and manipulated chemically or by using molecular biology techniques, for example, to arrange one or more variable and / or constant domains into aAttorney Docket No. 0073605-001205 suitable configuration, or to introduce codons, create cysteine residues, modify, add, or delete amino acids, etc.

[0095] As used herein, a “functional fragment” of an antibody is a portion of the antibody that includes at least an active binding site for its respective antigen or epitope and therefore preserves the biological function of the antibody. In some cases, a functional fragment may be created by truncating or simplifying a synthetic antibody to eliminate peripheral, nonessential structures, thereby improving one or more aspects of its properties, such as without limitation solubility, stability, and / or the like.

[0096] Antigen-binding fragments of an antibody may be derived, e.g., from full antibody molecules using any suitable standard techniques such as proteolytic digestion or recombinant genetic engineering techniques involving the manipulation and expression of DNA encoding antibody variable and optionally constant domains. Such DNA is known and / or is readily available from, e.g., commercial sources, DNA libraries (including, e.g., phage-antibody libraries), or can be synthesized. The DNA may be sequenced and manipulated chemically or by using molecular biology techniques, for example, to arrange one or more variable and / or constant domains into a suitable configuration, or to introduce codons, create cysteine residues, modify, add, or delete amino acids, etc.

[0097] Non-limiting examples of functional fragments or antigen-binding fragments include: (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv (scFv) molecules; (vi) dAb fragments; and (vii) minimal recognition units consisting of the amino acid residues that mimic the hypervariable region of an antibody (e.g., an isolated complementarity determining region (CDR) such as a CDR3 peptide), or a constrained FR3-CDR3-FR4 peptide. Other engineered molecules, such as domain-specific antibodies, single domain antibodies, domain-deleted antibodies, chimeric antibodies, CDR-grafted antibodies, diabodies, triabodies, tetrabodies, minibodies, nanobodies (e.g., monovalent nanobodies, bivalent nanobodies, etc.), small modular immunopharmaceuticals (SMIPs), and shark variable IgNAR domains, are also encompassed within the expression “functional fragment” or "antigen-binding fragment," as used herein.

[0098] Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual “Fc” fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab')2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen.Attorney Docket No. 0073605-001205

[0099] ‘Fv” is the minimum antibody fragment which contains a complete antigen-binding site. This region consists of a dimer of one heavy chain and one light chain variable domain (a VH-VL dimer) configuration so that the three hypervariable regions of each variable domain interact to define an antigen-binding site. Collectively, the six hypervariable regions confer antigen-binding specificity to the antibody.

[0100] A single-chain antibody (also referred to as "scFv") can be prepared by linking a heavy chain V region and a light chain V region of an antibody (for a review of scFv see Pluckthun "The Pharmacology of Monoclonal Antibodies" Vol. 113, eds. Rosenburg and Moore, Springer Verlag, N.Y., pp. 269-315 (1994)). Methods for preparing single-chain antibodies are known in the art (see, for example, U.S. Pat. Nos. 4,946,778; 5,260,203; 5,091,513; and 5,455,030). In such scFvs, the heavy chain V region and the light chain V region are linked together via a linker, preferably, a flexible polypeptide linker (e.g., a Ser-Gly linker) with an optimized length and / or amino acid composition. (Huston, J. S. et al., Proc. Natl. Acad. Sci. U.S.A, 1988, 85, 5879-5883). The scFv can comprise a polypeptide linker sequence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more amino acid residues between its VL and VH regions. In certain embodiments, the peptide linker used to ligate the V regions may be any single-chain peptide consisting of 12 to 19 residues. The flexible polypeptide linker sequence may comprise any naturally occurring amino acid. In some embodiments, the flexible polypeptide linker sequence comprises amino acids glycine and serine. In certain embodiments, the flexible polypeptide linker sequence comprises sets of glycine and serine repeats such as (Gly4Ser)n, where n is a positive integer equal to or greater than 1. In certain embodiments, the flexible polypeptide linkers include, but are not limited to, (Gly4Ser)4 or (Gly4Ser)3. Variation in the flexible polypeptide linker length may retain or enhance activity, giving rise to superior efficacy in activity studies. The heavy chain V region and the light chain V region in a scFv may be derived from the same antibody, or from different antibodies.

[0101] A single domain antibody (or “nanobody”) is an antibody fragment consisting of a single variable antibody domain. Like a whole antibody, it is able to bind selectively to a specific antigen. Single domain antibodies can be derived from antibodies found in nature, for example in camelids (VHH) and cartilaginous fishes (VNAR). Nurse Shark Antigen Receptor (NAR) protein is a dimer of two heavy chains, each composed of one variable (V) and five constant domains, with no associated light chains. Single domain antibodies can also be engineered, for example by modifying andAttorney Docket No. 0073605-001205 selecting a single monomeric VH or VL variable domain of an immunoglobulin (IgG) from a human, mouse, or other suitable animal.

[0102] The term “intrabody” refers to an antibody that has been designed to be expressed intracellularly and that recognizes and specifically binds to an antigen within a cell, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing, through at least one antigen recognition site within the variable region of the molecule. Commonly, an intrabody is a single chain variable fragment, or “scFv,” comprising a heavy chain variable region and a light chain variable region interconnected by a linker. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.

[0103] An Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CHI domain including one or more cysteine(s) from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[0104] Various forms of the antibody are contemplated herein. For example, without limitation the anti-SODl-trimer antibody may be a full length antibody (e.g., having an intact Fc region) or an antibody fragment (e.g., a Fab, Fab' or F(ab')2), or engineered to contain an antigen binding site (e.g. scFv, diabody, or nanobody).

[0105] In a typical antibody, each heavy chain comprises a heavy chain variable region (VH) and a heavy chain constant region. The heavy chain constant region comprises three domains, CHI, CH2 and CH3. Each light chain comprises a light chain variable region (VL) and a light chain constant region. The light chain constant region normally comprises one domain (CL). The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from aminoterminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0106] Antibody residues that have a substantial impact on affinity and specificity of binding to target antigen are primarily located in CDRs. Kabat et al. compiled and aligned immunoglobulin heavy and light chain sequences and were the first to propose a standardized numbering scheme for the variable regions of immunoglobulins identifying conserved and hypervariable regions andAttorney Docket No. 0073605-001205 residues. (Kabat EA et al., 1979, Sequences of Immunoglobulin Chains: Tabulation and Analysis of Amino Acid Sequences of Precursors, V-regions, C-regions, J-Chain and BP-Microglobulins, Department of Health, Education, and Welfare, Public Health Service, National Institutes of Health). While the Kabat system is a widely adopted standard for numbering antibody residues, the hypervariable regions defined by Kabat do not exactly match with the structural aspects of antigenbinding loops. Chothia and Lesk developed a structure-based numbering scheme by aligning crystal structures of antibody variable regions and classified CDR loops in a small number of “canonical” classes (Chothia C, et al., 1987, Canonical structures for the hypervariable regions of immunoglobulins. J. Mol. Biol. 196:901-17. doi: 10.1016 / 0022-2836(87)90412-8). A feature of the Chothia numbering scheme is that topologically aligned residues from different antibodies are localized at the same position number and the Chothia CDR definition corresponds in most antibody sequences to the structural antigen-binding loop. Lefranc introduced a new system based on germline sequences intended to standardize numbering for all proteins of the immunoglobulin superfamily, including T cell receptor chains. (Giudicelli V et al., 1997, IMGT, the international ImMunoGeneTics database. Nucleic Acids Res. 25:206-11), which was then extended to entire variable domains (Lefranc M-P et al., 2003, IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev Comp Immunol. 27:55-77. doi: 10.1016 / S0145-305X(02)00039-3). Additional numbering systems have been proposed to align unconventional frameworks (Abhinandan KR et al., 2008, Analysis and improvements to Kabat and structurally correct numbering of antibody variable domains. Mol Immunol. 45:3832-9. doi:10.1016 / j.molimm.2008.05.022) and to subdivide variable chain sequences into multiple fragments including structurally invariant “cores” (Gelfand et al., 1998, Algorithmic determination of core positions in the VL and VH domains of immunoglobulin molecules. J Comput Biol. (1998) 5:467-77). In certain embodiments of the invention, CDR residues are identified according to such a standard system as set forth above. In certain embodiments, antibodies of the invention are identified by all or a subset of Kabat CDR residues of the antibody sequences set forth herein. In certain embodiments, antibodies of the invention are identified by all or a subset of Chothia CDR residues of the antibody sequences set forth herein. In certain embodiments, antibodies of the invention can be identified by all or a subset of IMGT CDR residues of the antibody sequences set forth herein. In certain embodiments, antibodies of the invention can be identified by CDR residues defined by two or more systems, comprising e.g., but not limited to, all or a subset of amino acids of VH-CDR1 according to first system, e.g. Kabat, all or a subset of residues of VH-CDR2 according to a secondAttorney Docket No. 0073605-001205 system e.g. Chothia, all or a subset of residues of VH-CDR3 according to Kabat, all or a subset of residues of VL-CDR1 according to Kabat, all or a subset of residues of VL-CDR2 according to IMGT, and all or a subset of residues of VL-CDR3 according to Chothia. In certain embodiments, CDRs may be most conveniently or most accurately described to include amino acids selected by the Applicant. According to the invention, CDRs can be described or identified based on amino acids observed to strongly determine antigen binding and amino acids observed not to participate in antigen binding.

[0107] As used herein, a “functional variant” of an antibody is a modified antibody that differs from the original antibody by one or more amino acids while maintaining most, if not all, of the functional characteristics of the original antibody. As a nonlimiting example, a functional variant of an antibody can bind to an antigen with a comparable specificity and affinity as the antibody itself. A functional variant can be created via amino acid substitutions, additions, or deletions, but none of such changes should significantly alter the tertiary structure of the antigen binding site within the antibody from which the functional variant is derived.

[0108] In some embodiments, a functional variant can be created via one or more conservative or non-conservative amino acid substitutions. As used herein, a “conservative amino acid substitution” is a change in amino acid sequence where an amino acid is replaced with a different amino acid with broadly similar properties. As used herein, a “non-conservative amino acid substitution” is a change in amino acid sequence where one amino acid is replaced with another amino acid of a different type. As nonlimiting examples, common amino acids can be categorized as follows: nonpolar amino acids include Ala, Vai, Leu, He, Pro, Met, Phe, and Trp; uncharged polar amino acids include Gly, Ser, Thr, Cys, Tyr, Asn, and Gin; acidic amino acids include Asp and Glu; and basic amino acids include Lys, Arg, and His. Since side chains of amino acids in the same category have similar polarities and are capable of establishing or participating in similar electrostatic interaction(s), hydrogen bond(s), and / or van der Waals contact(s), altering the primary structure of a peptide or antibody by a conservative substitution may not significantly alter the activity of that peptide or antibody. Non-conservative substitutions are also possible provided that these substitutions do not disrupt the tertiary structure of the antigen-binding region. Broadly speaking, fewer non-conservative substitutions will be possible without altering the biological activity of the peptide. Suitably, functional variants can be at least 50% identical, at least 60% identical, at least 75% identical, at least 90% identical, etc., with respect to the base sequence. A person of ordinary skill in the art, upon reviewing the entirety of this disclosure, will be able toAttorney Docket No. 0073605-001205 identify suitable strategies for creating functional variants of an antibody without compromising the tertiary structure of the antigen-binding region therein.

[0109] Sequence identity between two amino acid sequences can be determined by comparing an alignment of the sequences. When an equivalent position in the compared sequences is occupied by the same amino acid or base, then the molecules are identical at that position. Scoring an alignment as a percentage of identity is a function of the number of identical amino acids at positions shared by the compared sequences. When comparing sequences, optimal alignments may require gaps to be introduced into one or more of the sequences to take into consideration possible insertions and deletions in the sequences. Sequence comparison methods may employ gap penalties so that, for the same number of identical molecules in sequences being compared, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. Calculation of maximum percent identity involves the production of an optimal alignment, taking into consideration gap penalties.

[0110] For the purposes of the present invention, sequence identity or homology is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity may be determined using any of a number of mathematical algorithms. A non-limiting example of a mathematical algorithm used for comparison of two sequences is the algorithm of Karlin & Altschul, Proc. Natl. Acad. Sci. USA 1990; 87: 2264-2268, modified as in Karlin & Altschul, Proc. Natl. Acad. Sci. USA 1993;90: 5873-5877.[OHl] Another example of a mathematical algorithm used for comparison of sequences is the algorithm of Myers & Miller, CABIOS 1988;4: 11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package.

[0112] When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 may be used. Yet another useful algorithm for identifying regions of local sequence similarity and alignment is the FASTA algorithm as described in Pearson & Lipman, Proc. Natl. Acad. Sci. USA 1988; 85: 2444-2448.

[0113] Advantageous for use according to the present invention is the WU-BLAST (Washington University BLAST) version 2.0 software. WU-BLAST version 2.0 executable programs for several UNIX platforms may be downloaded from blast.wustl.edu / blast / executables. This program is based on WU-BLAST version 1.4, which in turn is based on the public domain NCBLBLAST version 1.4 (Altschul & Gish, 1996, Local alignment statistics, Doolittle ed., Methods in Enzymology 266: 460-480; Altschul et al., lournal of Molecular Biology 1990, 215: 403-410;Attorney Docket No. 0073605-001205 Gish & States, 1993, Nature Genetics 3: 266-272; and Karlin & Altschul, 1993, Proc. Natl. Acad. Sci. USA 90: 5873-5877; all of which are incorporated by reference herein).

[0114] Effector Functions and Isotypes

[0115] A main determinant of cellular effector functions is antibody isotype. Human antibodies are classified into five isotypes (IgM, IgD, IgG, IgA, and IgE) according to their H chain constant regions, with each isotype having a different FcyR binding profile and cellular response. Isotype interactions with the FcR family have been extensively described. Bruhns investigated the binding of polyclonal and monoclonal IgGl, IgG2, IgG3, and IgG4 to FcyRI; FcyRIIA, IIB, and IIC; FcyRIIIA and IIIB; and all known polymorphic variants. (Bruhns, P. et al., Specificity and affinity of human Fc receptors and their polymorphic variants for human IgG subclasses. Blood 2009, 113, 3716— 3725). Bruhns reported that IgGl and IgG3 bind to all hFcyRs and identified parameters that determine the specificity and affinity of hFcyRs for IgG subclasses.

[0116] Cellular effector functions are modulated by binding of antibody constant regions to FcyR cellular receptors, which may be activatory or inhibitory. In humans, the cellular receptors include hFcyRI, hFcyRIIA, hFcyRIIB, hFcyRIIC, hFcyRIIIA,and hFcyRIIIB. hFcyRI contains three extracellular immunoglobulin domains and is the only high-affinity FcyR, able to effectively bind monomeric IgG. Other FcyR contain two extracellular immunoglobulin domains and are low to intermediate affinity, sufficient for binding IgG in immune complexes or when bound to a pathogen or cell surface.

[0117] FcyRs impact the efficacy of anti-cancer antibodies through activation of Fc-effector functions such as antibody-dependent cellular cytotoxicity (ADCC) and antibody dependent cellular phagocytosis (ADCP). ADCC is thought to be principally mediated by NK cells, which bind to the Fc of antibody -labeled tumor cells, predominantly through FcyRIIIA. (See, Lo Nigro et al., NK-mediated antibody -dep endent cell-mediated cytotoxicity in solid tumors: Biological evidence and clinical perspectives. Ann. Transl. Med. 2019, 7, 105). Clinically relevant anti-cancer antibodies such as rituximab, Herceptin and cetuximab have been shown to evoke ADCC in vitro. ADCP is mediated by phagocytic cells, such as macrophages, monocytes and neutrophils and is triggered when antibodies interact with their Fc. (See, e.g., Herter et al., Glycoengineering of therapeutic antibodies enhances monocyte / macrophage-mediated phagocytosis and cytotoxicity. J. Immunol. 2014, 192, 2252-2260). The anti-CD30 antibody, SGN-30 and Rituximab and other anti-CD20 antibodies elicit ADCP both in vitro and in vivo.

[0118] Affinity MaturationAttorney Docket No. 0073605-001205

[0119] In an aspect, the instant invention provides anti -trimeric SOD1 antibodies with improved properties. According to the invention, CDR residues may be varied and the products examined for enhanced properties, such as but not limited to affinity, specificity, on-rate, off-rate, and stability. Such a mutation / selection procedure also identifies CDR residues that are free or relatively free to be changed while maintaining affinity and / or specificity. In certain embodiments, CDRs from antibodies of interest can be grafted into different frameworks. In certain embodiments, antibodies of the invention are humanized. To produce intrabodies, CDRs from antibodies of interest can be grafted into frameworks compatible with the intracellular environment.

[0120] In some embodiments, the nucleic acid sequence that encodes the anti-trimeric SOD1 antibody may be characterized by one or more members selected from a group consisting of at least 85% identical to SEQ ID NO: 1, at least 90% identical to SEQ ID NO: 1, at least 95% identical to SEQ ID NO: 1, and at least 99% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 85% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 90% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 95% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 99% identical to SEQ ID NO: 1.

[0121] In some embodiments, anti -SOD1 -trim er antibody promotes sequestration or clearance of an anti-SODl-trimer. In some embodiments, the anti-SODl-trimer antibody may be labeled with a detectable label, immobilized on a solid phase, and / or conjugated with a heterologous compound.

[0122] In some embodiments, measuring the level of the at least a biomarker may include measuring the level of the at least a biomarker using a biomarker assay. As used herein, a “biomarker assay” is an assay used for detection and / or quantification of a biomarker. As used herein, an “assay” is an investigative, analytic procedure for qualitative assessment and / or quantitative measurement regarding the presence, amount, and / or functional activity of an analyte.

[0123] In some embodiments, the biomarker assay may include an enzyme-linked immunosorbent assay (ELISA). As used herein, an “enzyme-linked immunosorbent assay” or “ELISA” is a widely used technique in immunology to detect and quantify specific antigens or antibodies in a sample. An ELISA may include a direct ELISA or an indirect ELISA. An ELISA typically involves immobilizing a target molecule (e.g., an antigen) on a surface, adding a sample that potentially contains an analyte (e.g., an antibody) or an enzyme-labeled analyte, adding an enzyme-labeled ligand (e.g., an enzyme-labelled antibody) that binds with the analyte (only for unlabeled analytes), and then adding a substrate that reacts with the enzyme to produce a detectableAttorney Docket No. 0073605-001205 signal, usually a color change. ELISA is commonly used in diagnostics including disease detection, vaccine development, and measuring immune responses. A person of ordinary skill in the art, upon reviewing the entirety of this disclosure, will be able to recognize how ELISA may be applied to the invention described herein.

[0124] In another aspect, disclosed herein is a synthetic antibody for diagnosis of ALS, consistent with details described elsewhere in this disclosure. In some embodiments, at least a functional fragment of the synthetic antibody may be encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1 and have a specific binding affinity towards trimeric SOD1. In some embodiments, the synthetic antibody may include a means for selectively binding trimeric SOD1. In some embodiments, the nucleic acid sequence may be characterized by one or more members selected from a group consisting of at least 85% identical to SEQ ID NO: 1, at least 90% identical to SEQ ID NO: 1, at least 95% identical to SEQ ID NO: 1, and at least 99% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 85% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 90% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 95% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 99% identical to SEQ ID NO: 1. In some embodiments, the synthetic antibody may be a peptide, protein, or amino acid sequence encoded by SEQ ID NO: 1 or a functional variant of a peptide, protein, or amino acid sequence encoded by SEQ ID NO: 1.

[0125] It is worth noting that disclosure describes the first antibody designed to selectively interact with and detect SOD1 trimers. This antibody is identified using a bacterial phage librarybased synthetic antibody design.

[0126] As used herein, a “phage display library” or “phage library” is a diverse collection of genetically engineered phages, each carrying a unique protein or peptide fragment. As a result, a phage library effectively represents a vast repertoire of potential binding molecules. A phage library may be constructed by cloning a gene encoding a protein or peptide of interest into a phage vector, such as without limitation the M13 phage system. Random mutagenesis or combinatorial techniques may also be employed to introduce additional diversity into a phage library. A phage library may serve as a resource for scientists, providing them with a powerful tool to identify novel proteinprotein interactions, generate antibody libraries, and / or even design new therapeutics.

[0127] As used herein, a “phage display” is a technique that uses phages as a platform to display a diverse array of protein fragments or peptides on their surface. Phage display originated in the lateAttorney Docket No. 0073605-001205 1980s, pioneered by George P. Smith and Sir Gregory P. Winter, and enables the study and selection of proteins or peptides with specific binding properties. A phage library operates by genetically fusing a first gene encoding a protein or peptide of interest to a second gene encoding a phage coat protein; as a result, the desired protein fragment is displayed on the surface of the phage particle. Such direct linkage between genotype and phenotype allows for the selection and isolation of phages that bind specifically to a target molecule. The procedures for phage display involve a series of meticulous steps to ensure successful selection and isolation of phages that bind to the desired target molecule. While the specific details may vary depending on the experiment and target of interest, a phage display generally follows the procedure of i) construction of a phage display library; ii) target immobilization; iii) incubation with the phage library; iv) washing steps; v) elution of bound phages; vi) iterative rounds of selection or panning; and vi) characterization and isolation of individual phage clones. Additional details will be provided below in this disclosure.

[0128] As used herein, “panning” is a process of isolating bacterial phages that express antibodies specific to an antigen of interest. This targeted selection process typically begins with exposing the bacterial phage library to a surface-immobilized antigen of interest. The bacterial phage with antibodies specific to the antigen of interest may bind to its respective epitopes. This step may be followed by stringent washing to remove weakly bound or non-specific bacterial phages. After the wash step, the bacterial phages that are bound to the antigen of interest may be eluted via enzymatic cleavage or pH change and used to infect host cells for amplification of the antigenspecific bacterial phage. Such panning cycle is typically repeated multiple times in order to enrich the bacterial phage with the highest affinity and / or specificity. More specifically, each round of panning increases the stringency of selection and enriches the phage population for those with higher affinity towards the target molecule.

[0129] As used herein, a “phage” is a virus that infects and replicates within bacteria and / or archaea. Phages include proteins that encapsulate a DNA or RNA genome and may have structures that are either simple or elaborate. Phages replicates within a bacterium following the injection of its genome into the cytoplasm of the bacterium. In some cases, the terms phage, bacteriophage, and bacterial phage may be used interchangeably throughout this disclosure. As a nonlimiting example, a commonly employed phage for phage display is the M13 phage. Its long, filamentous structure and non-lytic life cycle make it suitable candidate for this technique.

[0130] As used herein, a “phagemid” is a hybrid of a plasmid and a phage that is used as a cloning vector in biotechnology. A phagemid contains the origin of replication and packaging signalAttorney Docket No. 0073605-001205 of a filamentous phage. Following bacterial transformation, a phagemid can be replicated and amplified as a plasmid, using a double-stranded DNA origin of replication, or as a single-stranded DNA for packaging into filamentous phage particles. The use of phagemids enables phage display of proteins, such as antibody fragments, consistent with details described elsewhere in this disclosure. As a nonlimiting example, a phagemid may include the pComb3 family, such as without limitation pComb3, pComb3H, pComb3X, and pC3C. pComb3 was among the first phage display vectors used for the generation and selection of antibody libraries in the 50-kDa fragment antigen-binding (Fab) format, a monovalent proxy of natural antibodies.

[0131] As used herein, a “plasmid” is a circular, double-stranded DNA molecule. Plasmids are distinct from a cell’s chromosomal DNA and are capable of autonomous replication. Plasmids may be used as vectors for insertion, expression, and propagation of foreign genes within a host organism. Such vectors may include specific sequences for an origin of replication, selectable markers, and cloning sites, enabling manipulation and study of genetic material for applications in research, biotechnology, and therapeutic development.

[0132] In some embodiments, the synthetic antibody may be expressed using genetically modified BL21 cells. As used herein, a “genetically modified” or “genetically engineered” cell is a cell whose genetic material has been manipulated to alter one or more of its hereditary traits. Such manipulation may include without limitation inserting, deleting, or otherwise modifying one or more specific DNA sequences; as a result of such manipulation, a genetically modified cell may exhibit one or more different traits in its structure, function, or the like, compared to its naturally occurring counterparts. As used herein, “BL21 cell” or “Escherichia coli BL21” is a commonly used protein production strain of Escherichia coli. This strain is derived from the B lineage of Escherichia coli and combines several features that allow for excessive expression of heterologous proteins. As used herein, a “heterologous” protein is a protein that is absent from a naturally occurring species. A heterologous protein may originate from a different species or be artificially designed. A heterologous protein may be expressed in a host cell using genetic engineering tools.

[0133] In some embodiments, genetically modifying the BL21 cells may include removing a phage region from a phagemid to produce a plasmid, wherein the plasmid encodes the synthetic antibody. In some embodiments, genetically modifying the BL21 cells may further include transforming the plasmid into the BL21 cells to produce the genetically modified BL21 cells.

[0134] In some embodiments, removing the phage region may include removing the phage region using a double restriction digestion. As used herein, a “double restriction digestion” is aAttorney Docket No. 0073605-001205 procedure that cuts DNA using two restriction enzymes simultaneously. As used herein, a “restriction enzyme” is an enzyme that that cut DNA at specific, short sequences called restriction sites, essentially acting as a molecular scissor to cleave DNA molecules into smaller fragments. As a nonlimiting example, the double restriction digestion may be performed using restriction enzymes such as Spel and Nhel. These enzymes generate DNA fragments with complementary sticky ends (i.e., 5’ overhangs), which may be ligated together after digestion. Spel recognizes the sequence “ACTAGT” while Nhel recognizes the sequence “GCTAGC” instead.

[0135] In another aspect, disclosed herein is a biomarker assay for diagnosis of ALS. The biomarker assay may be configured to detect a presence of trimeric SOD1 using the synthetic antibody described above. In some embodiments, the biomarker assay may include an ELISA. In some specific cases, the trimer-stabilizing mutant of SOD1 may be used as a biomarker in ELISA to diagnose patients with ALS. The biomarker assay described herein may be used as a diagnostic biomarker assay for evaluation of ALS. As a nonlimiting example, such diagnosis may be performed through a blood test, consistent with details described elsewhere in this disclosure.

[0136] Diagnostic Methods

[0137] Immunoassays include a variety of methods, such as chemiluminescent enzyme immunoassay (CLEIA), enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, electrochemiluminescence immunoassay (ECLIA), and fluorescence immunoassay (FIA), and the present invention encompasses all of these methods. The immunoassay of the present invention is not particularly limited, but may be a sandwich method. Sandwich methods include, for example, a one-step sandwich method and a two-step sandwich method.

[0138] In the two-step sandwich method, for example, an anti -trimeric SOD1 antibody immobilized on a solid phase or an anti-trimeric SOD1 antibody (solid-phase antibody) immobilized on a solid phase is first contacted with trimeric SOD1 in the sample, causing an antigen-antibody reaction between the solid-phase antibody and the trimeric SOD1 (primary reaction). If the solidphase antibody is an anti -trimeric SOD1 antibody immobilized on a solid phase, the solid-phase antibody is immobilized on the solid phase after the primary reaction. B / F separation is then performed. The trimeric SOD1 bound to the solid-phase antibody is then contacted with an anti-SOD1 antibody (labeled antibody) bound to a labeling substance for detection, causing an antigenantibody reaction between the trimeric SOD1 and the labeled antibody (secondary reaction). B / F separation is then performed, and the trimeric SOD1 in the sample can be measured by detecting theAttorney Docket No. 0073605-001205 signal derived from the label of the labeled antibody bound to the trimeric SOD1 bound to the solid phase. Washing may be performed after B / F separation.

[0139] In the one-step sandwich method, for example, a solid-phase antibody is contacted with trimeric SOD1 in the sample and a labeled antibody, and an antigen-antibody reaction between the solid-phase antibody and trimeric SOD1 and an antigen-antibody reaction between trimeric SOD1 and the labeled antibody are carried out in a single step. If the solid-phase antibody is an anti-trimeric SOD1 antibody that is immobilized on a solid phase, the solid-phase antibody is immobilized on the solid phase after or simultaneously with the antigen-antibody reaction. B / F separation is then performed, and the trimeric SOD1 in the sample can be measured by detecting the signal derived from the label of the labeled antibody bound to the trimeric SOD1 bound to the solid phase. Washing may be performed after B / F separation.

[0140] The direct competitive method involves immobilizing an antibody against the target antigen to be measured (in this case, trimeric SOD1) on a solid phase (immobilization), then performing a blocking treatment (treating the solid phase with a protein solution such as serum albumin) to prevent nonspecific adsorption. The antibody is then reacted with a test sample (e.g., a specimen) containing the target antigen and a certain amount of labeled antigen. After washing, the amount of label bound to the solid phase is quantified. Because the antigen in the test sample and the labeled antigen bind competitively to the antibody, the greater the amount of antigen in the test sample, the less label binds to the solid phase. Various antigen standard solutions with known concentrations are prepared, and the amount of label immobilized on the solid phase (absorbance, luminescence intensity, fluorescence intensity, etc., depending on the nature of the label; the same applies below) is measured. A calibration curve is then created with antigen concentration on the horizontal axis and label amount on the vertical axis. The amount of label is measured for test samples with unknown antigen amounts, and the amount of antigen in the unknown test samples can be determined by applying the measured label amount to the calibration curve. The direct competition method itself is well known in the art and is described, for example, in US20150166678A.

[0141] In the indirect competitive method, for example, a target antigen (trimeric SOD1 in this invention) is immobilized. After blocking the solid phase, a sample containing the target antigen is mixed with a certain amount of anti-target antigen antibody and reacted with the immobilized antigen. After washing, the anti-target antigen antibody bound to the solid phase is quantified. This can be achieved by reacting a labeled secondary antibody against the anti-target antigen antibody,Attorney Docket No. 0073605-001205 washing, and then measuring the amount of label. Various antigen standard solutions with known concentrations are prepared, and the amount of label immobilized on the solid phase is measured for each, creating a calibration curve. The amount of label for an unknown sample is measured, and the measured amount of label is applied to the calibration curve to determine the amount of antigen in the unknown sample. It is also possible to use a labeled primary antibody instead of a labeled secondary antibody. The indirect competitive method itself is well known in the art and is described, for example, in the aforementioned US20150166678A.

[0142] Among the various immunoassays mentioned above, chemiluminescent enzyme immunoassay (CLEIA), chemiluminescent immunoassay (CLIA), enzyme immunoassay (EIA), radioimmunoassay (RIA), and fluorescent immunoassay (FIA) are immunoassays classified based on the type of label used when performing the above-mentioned direct competitive method, indirect competitive method, sandwich method, etc. Chemiluminescent enzyme immunoassay (CLEIA) is an immunoassay that uses an enzyme (e.g., alkaline phosphatase) as a label and a substrate (e.g., AMPPD) that generates a chemiluminescent compound as a substrate. Enzyme immunoassay (EIA) is an immunoassay that uses an enzyme (e.g., peroxidase, alkaline phosphatase, luciferase, 0-galactosidase, etc.) as a label. A compound that can be quantified by absorbance measurement or the like is used as the substrate for each enzyme. For example, in the case of peroxidase, 1,2-phenylenediamine (OPD) or 3,3',5,5'-tetramethylbenzidine (TMB) or the like is used, in the case of alkaline phosphatase, p-nitrophenyl phosphate (pNPP) or 3 -(2'-spiroadamantane)-4-m ethoxy -4-(3 '-phosphoryloxy)phenyl-l,2-dioxetane disodium salt (AMPPD) or the like is used, in the case of 0-galactosidase, 4-methylumbelliferyl galactoside (MG) or nitrophenyl galactoside (NG) or the like is used, and in the case of luciferase, luciferin or the like is used. Radioimmunoassay (RIA) is a method using a radioactive substance as a label, and examples of the radioactive substance include radioactive elements such as 3H , 14C , 32P , 35S , and 1251 . Fluorescent immunoassay (FIA) is a method that uses a fluorescent substance or a fluorescent protein as a label, and examples of the fluorescent substance or fluorescent protein include fluorescein, fluorescein isothiocyanate, rhodamine, green fluorescent protein, red fluorescent protein, etc. Immunoassays using these labels are well known in the art and are described, for example, in US8039223B and US20150309016A1.

[0143] Turbidimetry (TIA) is an immunoassay that utilizes the phenomenon of increased turbidity due to the antigen-antibody complex formed by the binding of the target antigen (in this invention, trimeric SOD1) to an antibody specific forthat antigen. Various known concentrations of antigen are added to an anti-target antigen-antibody solution, and the turbidity is measured for eachAttorney Docket No. 0073605-001205 to create a calibration curve. The turbidity of a test sample with an unknown antigen amount is similarly measured, and the measured turbidity is applied to the calibration curve to determine the amount of antigen in the unknown test sample. Turbidimetry itself is well known and is described, for example, in US 20140186238 Al. Latex agglutination is similar to turbidimetry, but instead of the antibody solution used in turbidimetry, it uses a suspension of latex particles with anti-target antigen antibodies immobilized on their surface. Turbidimetry and latex agglutination themselves are well known in the field and are described, for example, in US 7,820,398 B.

[0144] Immunochromatography is a method in which the above-mentioned sandwich or competitive immunochromatography is performed on a substrate (also called a matrix or strip) made of a porous material such as filter paper, cellulose membrane, glass fiber, or nonwoven fabric. For example, in the case of sandwich immunochromatography, a detection zone with immobilized antitarget antigen antibodies is provided on the substrate. A test sample containing the target antigen is added to the substrate, and a developer is passed from the upstream side to migrate the target antigen to the detection zone, where it is immobilized. The immobilized target antigen in the test sample is detected by sandwiching it with a labeled secondary antibody and detecting the label immobilized in the detection zone. A label zone containing the labeled secondary antibody is formed upstream of the detection zone, allowing the conjugate between the target antigen and the labeled secondary antibody to be immobilized in the detection zone. If the label is an enzyme, a substrate zone containing the enzyme substrate is also provided upstream of the detection zone. In the case of a competitive immunochromatography, for example, the target antigen is immobilized in the detection zone, allowing the target antigen in the test sample to compete with the target antigen immobilized in the detection zone. A labeled antibody zone is provided upstream of the detection zone, and the target antigen in the test sample is reacted with the labeled antibody. Unreacted labeled antibody is immobilized in the detection zone, and the label is detected or quantified, allowing the target antigen in the test sample to be detected or quantified. The immunochromatography method itself is well known in the art and is described, for example, in US Pat. No. 6,210,898B.

[0145] Formulations and Methods of Administration

[0146] For in vivo use, a therapeutic agent as described herein is generally incorporated into a pharmaceutical composition prior to administration. Within such compositions, one or more therapeutic compounds as described herein are present as active ingredient(s) (i.e., are present at levels sufficient to provide a statistically significant effect on trimeric SOD1 levels, as measured using a representative assay). A pharmaceutical composition comprises one or more suchAttorney Docket No. 0073605-001205 compounds in combination with any pharmaceutically acceptable carrier(s) known to those skilled in the art to be suitable for the particular mode of administration. In addition, other pharmaceutically active ingredients (including other therapeutic agents) may, but need not, be present within the composition.

[0147] The antibodies of the present invention can be formulated according to standard methods (see, for example, Remington's Pharmaceutical Science, latest edition, Mark Publishing Company, Easton, U.S.A), and may comprise pharmaceutically acceptable carriers and / or additives. The present invention relates to compositions (including reagents and pharmaceuticals) comprising the binding agents of the invention, and pharmaceutically acceptable carriers and / or additives.Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration, the present methods will typically include intravenous or local subcutaneous or intramuscular injection thus formulation for parenteral administration is desirable. Exemplary carriers include surfactants (for example, PEG and Tween), excipients, antioxidants (for example, ascorbic acid), coloring agents, flavoring agents, preservatives, stabilizers, buffering agents (for example, phosphoric acid, citric acid, and other organic acids), chelating agents (for example, EDTA), suspending agents, isotonizing agents, binders, disintegrators, lubricants, fluidity promoters, and corrigents. However, the carriers that may be employed in the present invention are not limited to this list. In fact, other commonly used carriers can be appropriately employed: light anhydrous silicic acid, lactose, crystalline cellulose, mannitol, starch, carmelose calcium, carmelose sodium, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, polyvinylacetaldiethylaminoacetate, polyvinylpyrrolidone, gelatin, medium chain fatty acid triglyceride, polyoxyethylene hydrogenated castor oil 60, sucrose, carboxymethylcellulose, corn starch, inorganic salt, and so on. The composition may also comprise other low-molecular-weight polypeptides, proteins such as serum albumin, gelatin, and immunoglobulin, and amino acids such as glycine, glutamine, asparagine, arginine, and lysine. When the composition is prepared as an aqueous solution for injection, it can comprise an isotonic solution comprising, for example, physiological saline, dextrose, and other adjuvants, including, for example, D-sorbitol, D-mannose, D-mannitol, and sodium chloride, which can also contain an appropriate solubilizing agent, for example, alcohol (for example, ethanol), polyalcohol (for example, propylene glycol and PEG), and non-ionic detergent (polysorbate 80 and HCO-50).

[0148] If necessary, anti -trimeric SOD1 agents of the present invention may be encapsulated in microcapsules (microcapsules made of hydroxycellulose, gelatin, polymethylmethacrylate, and theAttorney Docket No. 0073605-001205 like), and made into components of colloidal drug delivery systems (liposomes, albumin microspheres, microemulsions, nano-particles, and nano-capsules) (for example, see "Remington's Pharmaceutical Science 16th edition", Oslo Ed. (1980)). Moreover, methods for making sustained-release drugs are known, and these can be applied for the antibodies and binding agents of the present invention (Langer et al., J. Biomed. Mater. Res. 15: 167-277 (1981); Langer, Chem. Tech.12: 98-105 (1982); U.S. Pat. No. 3,773,919; EP Patent Application No. 58,481; Sidman et al., Biopolymers 22: 547-556 (1983); EP: 133,988).

[0149] A preferred route of administration is via subcutaneous injection. Another preferred route is via intramuscular injection. In certain embodiments, the anti-trimeric SOD1 agent is packaged in an integrated delivery system such as a pen or prefilled syringe for subcutaneous administration. Ghil et al. describes administration of an anti-NGF antibody SB5, via prefilled syringe (PFS) and autoinjector (Al) pen based on injection site pain, patient preference, and safety in rheumatoid arthritis (RA) (See Ghil et al., Usability and safety of SB5 (an adalimumab biosimilar) prefilled syringe and autoinjector in patients with rheumatoid arthritis. Curr Med Res Opin 2019 Mar;35(3):497-502.) Compositions of the invention are similarly administered.

[0150] Targeting Extracellular and Vesicular trimeric SOD1

[0151] In an aspect, the invention relates to the use of anti -trimeric SOD1 antibodies to target extracellular and vesicular SOD1 trimers. The antibodies of the invention can be used to treat or slow the progression of ALS and FTD. It has been shown that a human monoclonal antibody derived from a healthy elderly individual that specifically recognizes abnormal SOD1 in postmortem spinal cord tissue from patients with ALS, when administered to animal models of ALS, delayed the onset of motor impairments, extended the survival of the animals, and reduced the degeneration of neurons and accumulation of SOD1 aggregates (Maier et al., A human-derived antibody targets misfolded SOD1 and ameliorates motor symptoms in mouse models of amyotrophic lateral sclerosis. Science Translational Medicine 2018, Vol. 10, No. 470). Likewise, the anti-trimeric SOD1 antibodies of the invention, when administered to a subject, bind to pathogenic SOD1 trimers and reduce their level and pathogenicity.

[0152] Targeting intracellular trimeric SOD1.

[0153] In an aspect, the invention relates to the use of anti -trimeric SOD1 intrabodies to target intracellular SOD1 trimers. As genetically encodable proteins, intrabodies advantageously can be expressed in a cell or tissue-specific manner and can be developed to target specific conformations and post-translational modifications (Marschall ALJ, et al., Specific in vivo knockdown of proteinAttorney Docket No. 0073605-001205 function by intrabodies, MAbs, 2015, 7(6): 1010-1035.) Several strategies have been described to engineer cytoplasmic stable scFvs for cytoplasmic function. One approach involves designing disulfide-free scFvs, as the inability of these bonds to form in reducing conditions is one of the main factors for scFv intrabody misfolding and aggregation. To this end, the amino acid combination Val-Ala has been successfully employed to obtain disulfide-free scFvs for cytoplasmic expression (Worn & Pliickthun, Mutual stabilization of VL and VH in single-chain antibody fragments, investigated with mutants engineered for stability, Biochemistry 1998, 37(38): 13120-71998; Proba et al., Antibody scFv fragments without disulfide bonds made by molecular evolution. J. Mol. Biol. 1998, 16;275(2):245-53). Additionally, grafting the CDRs from scFvs of interest onto frameworks that have been described as stable in the cytoplasmic environment has also been described as a strategy to improve scFv-intrabody stability (Ewert et al., Stability improvement of antibodies for extracellular and intracellular applications: CDR grafting to stable frameworks and structure-based framework engineering. Methods. 2004. 34(2): 184-99).

[0154] An anti -trimeric SOD1 intrabody is preferably encoded by a polynucleotide of the present invention which is delivered to the cell by a vector of the present invention. Thus, the present invention provides a method of binding intracellular trimeric SOD1, the method comprising contacting the cell with a vector that comprises a polynucleotide encoding an anti-trimeric SOD1 intrabody. In another aspect, the present invention provides a method of reducing trimeric SOD1 accumulation in a cell, the method comprising contacting the cell with a vector of the invention that comprises a polynucleotide encoding an anti-trimeric SOD1 intrabody. Examples of a cell may include, but are not limited to, a neuron, an astrocyte, and an oligodendrocyte. In preferred embodiments, the neuronal cell is a neuron.

[0155] In some embodiments, the synthetic antibody, as described elsewhere in this disclosure, may be labelled. Such labeling may be used to produce a detectible signal, such as without limitation a colorimetric change (e.g., a shift in absorbance or emission wavelength), an absorption or scattering of light (e.g., an increase in absorbance), or an emission of light (e.g., fluorescence and / or chemiluminescence). The synthetic antibody may be labelled using any suitable labeling technique recognized by a person of ordinary skill in the art, upon reviewing the entirety of this disclosure. In some embodiments, the synthetic antibody may be conjugated with an alkaline phosphatase (ALP) label. As used herein, an “alkaline phosphatase label” or “ALP label” is a label of alkaline phosphatase attached to another chemical species to be detected in order to produce an amplified signal.Attorney Docket No. 0073605-001205

[0156] As used herein, an “alkaline phosphatase” or “ALP” is an enzyme that catalyzes the hydrolysis of a phosphate ester to form an alcohol and a phosphate. Since various chromogenic substrates can be hydrolyzed by ALP and turned into colorful precipitates, ALP may be used as a reporter molecule for immunoassays. In some embodiments, the synthetic antibody may be conjugated with a horseradish peroxidase (HRP) tag. As used herein, a “horseradish peroxidase tag” or “HRP tag” is a label of horseradish peroxidase attached to another chemical species to be detected in order to produce an amplified signal. As used herein, “horseradish peroxidase” or “HRP” is a heme-containing peroxidase that catalyzes a H2O2-dependent one-electron oxidation of organic substrates to produce a color change. Additionally, and / or alternatively, the synthetic antibody may be conjugated with glucose oxidase (GOx), catalase (CAT), and / or the like.

[0157] In another aspect, disclosed herein is a medical kit for diagnosis of ALS. The medical kit may include at least a biomarker assay including the synthetic antibody described above and at least an instruction for using the at least a biomarker assay. As used herein, a “medical kit” is a set of usually prepackaged reagents, devices, etc., that allows a subject or medical professional to easily test for, screen, diagnose, monitor, alleviate the symptoms of, and / or treat a certain health condition.

[0158] In some embodiments, the biomarker assay may include an ELISA, consistent with details described elsewhere in this disclosure. In some embodiments, the synthetic antibody may be conjugated with an HRP tag, consistent with details described elsewhere in this disclosure.

[0159] In another aspect, disclosed herein is a use of the synthetic antibody described above for diagnosis of ALS, consistent with details described elsewhere in this disclosure. In some embodiments, the synthetic antibody may be conjugated with an HRP tag, consistent with details described elsewhere in this disclosure.

[0160] In another aspect, the invention provides trimeric SOD1 binding agents immobilized to a solid support.

[0161] In certain embodiments, the immobilized trimeric SOD1 binding agent is used to purify or isolate trimeric SOD1 from a mixture or solution. As discussed herein, in certain embodiments, trimeric SOD1 is separated or isolated from other components and detected or measured. In certain embodiments, the immobilized trimeric SOD1 binding agent is used to bind to and remove trimeric SOD1 from a body fluid.

[0162] Liquorpheresis (CSF filtration) is a therapeutic technique where cerebrospinal fluid is removed, passed through filters to remove substances, and returned to the body. Gonzalez et al. describes systems for CSF shunting and replacement with filters with immobilized antibodies thatAttorney Docket No. 0073605-001205 remove target molecules. (Gonzalez et al., Implantable Systems for Continuous Liquorpheresis and CSF Replacement. Cureus, 2017, 9(2):el022.) The invention provides SODl-trimer specific antibodies for use in liquorpheresis.

[0163] Detection Reagents and Assays

[0164] For purposes of the diagnostic methods of the invention, the binding molecule or “ligand” of the invention (e.g., binding molecules such as, without limitation an antibody, Fab, scFv, nanobody, etc.) may be conjugated to a detecting reagent that facilitates detection of the ligand. For example, example, the detecting reagent may be a direct label or an indirect label. The labels can be directly attached to or incorporated into the detection reagent by chemical or recombinant methods.

[0165] In certain embodiments, a label is coupled to the ligand through a chemical linker.Linker domains are typically polypeptide sequences, such as poly gly sequences of between about 5 and 200 amino acids. In some embodiments, proline residues are incorporated into the linker to prevent the formation of significant secondary structural elements by the linker. In certain embodiments, linkers are flexible amino acid subsequences that are synthesized as part of a recombinant fusion protein. In certain embodiments, the flexible linker is an amino acid subsequence that includes a proline, such as Gly(x)-Pro-Gly(x) where x is a number between about 3 and about 100. In other embodiments, a chemical linker is used to connect synthetically or recombinantly produced recognition and labeling domain subsequences. Such flexible linkers are known to persons of skill in the art. For example, polyethylene glycol) linkers are available from Shearwater Polymers, Inc. Huntsville, Ala. These linkers optionally have amide linkages, sulfhydryl linkages, or heterofunctional linkages.

[0166] The detectable labels can be used in the assays of the present invention to diagnose, e.g., ALS or FTD. The labels attached to the ligand of the invention can be primary labels (where the label comprises an element that is detected directly or that produces a directly detectable element) or secondary labels (where the detected label binds to a primary label, e.g., as is common in immunological labeling). An introduction to labels, labeling procedures and detection of labels is found in Polak and Van Noorden (1997) Introduction to Immunocytochemistry, 2nd ed., Springer Verlag, N.Y. and in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals, a combined handbook and catalogue Published by Molecular Probes, Inc., Eugene, Oreg. Patents that described the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.Attorney Docket No. 0073605-001205

[0167] Primary and secondary labels can include undetected elements as well as detected elements. Useful primary and secondary labels in the present invention can include spectral labels such as green fluorescent protein, fluorescent dyes (e.g., fluorescein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon Green™, rhodamine and derivatives (e.g., Texas red, tetrarhodimine isothiocynate (TRITC), etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDyes™, and the like), radiolabels (e.g.,3H,1251,35S,14C,32P,33P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), spectral calorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads. The label can be coupled directly or indirectly to a component of the detection assay (e.g., the detection reagent) according to methods well known in the art. As indicated above, a wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.

[0168] Exemplary labels that can be used include those that use: 1) chemiluminescence (using horseradish peroxidase and / or alkaline phosphatase with substrates that produce photons as breakdown products as described above) with kits being available, e.g., from Molecular Probes, Amersham, Boehringer-Mannheim, and Life Technologies / Gibco BRL; 2) color production (using both horseradish peroxidase and / or alkaline phosphatase with substrates that produce a colored precipitate (kits available from Life Technologies / Gibco BRL, and Boehringer-Mannheim)); 3) fluorescence using, e.g., an enzyme such as alkaline phosphatase, together with the substrate AttoPhos (Amersham) or other substrates that produce fluorescent products, 4) fluorescence (e.g., using Cy-5 (Amersham), fluorescein, and other fluorescent tags); 5) radioactivity. Other methods for labeling and detection will be readily apparent to one skilled in the art.

[0169] In some embodiments, the imaging agent is a magnetic resonance imaging contrast agent. Examples of magnetic resonance imaging contrast agents include, but are not limited to, 1,4,7, 10-tetraazacyclododecane-N,N',N"N"'-tetracetic acid (DOTA), diethylenetriaminepentaacetic (DTP A), 1,4,7, 10-tetraazacyclododecane-N,N', N",N"' -tetraethylphosphorus (DOTEP), 1,4,7,10-tetraazacyclododecane-N,N',N" -triacetic acid (DOTA) and derivatives thereof. In some embodiments, the imaging agent is an X-Ray contrast agent. X-ray contrast agents already known in the art include a number of halogenated derivatives, especially iodinated derivatives, of 5-amino-isophthalic acid.

[0170] Where the ligand-based compositions of the invention are contemplated to be used in a clinical setting, the labels are preferably non-radioactive and readily detected without the necessityAttorney Docket No. 0073605-001205 of sophisticated instrumentation. In certain embodiments, detection of the labels will yield a visible signal that is immediately discernable upon visual inspection. One example of a detectable secondary labeling strategy uses an antibody that recognizes trimeric-SODl in which the antibody is linked to an enzyme (typically by recombinant or covalent chemical bonding). The antibody is detected when the enzyme reacts with its substrate, producing a detectable product. In certain embodiments, enzymes that can be conjugated to detection reagents of the invention include, e.g., 0-galactosidase, luciferase, horse radish peroxidase, and alkaline phosphatase. The chemiluminescent substrate for luciferase is luciferin. One embodiment of a fluorescent substrate for 0-galactosidase is 4-methylumbelliferyl-0-D-galactoside. Embodiments of alkaline phosphatase substrates include p-nitrophenyl phosphate (pNPP), which is detected with a spectrophotometer; 5-bromo-4-chloro-3-indolyl phosphate / nitro blue tetrazolium (BCIP / NBT) and fast red / napthol AS-TR phosphate, which are detected visually; and 4-methoxy-4-0-phosphonophenyl) spiro[l,2-dioxetane-3,2'-adamantane], which is detected with a luminometer. Embodiments of horse radish peroxidase substrates include 2,2'azino-bis(3-ethylbenzthiazoline-6 sulfonic acid) (ABTS), 5-aminosalicylic acid (5AS), o-dianisidine, and o-phenylenediamine (OPD), which are detected with a spectrophotometer, and 3,3,5,5'-tetramethylbenzidine (TMB), 3,3' diaminobenzidine (DAB), 3-amino-9-ethylcarbazole (AEC), and 4-chloro-l -naphthol (4C1N), which are detected visually. Other suitable substrates are known to those skilled in the art. The enzyme-substrate reaction and product detection are performed according to standard procedures known to those skilled in the art and kits for performing enzyme immunoassays are available as described above.

[0171] The presence of a label can be detected by inspection, or a detector which monitors a particular probe or probe combination is used to detect the detection reagent label. Typical detectors include spectrophotometers, phototubes and photodiodes, microscopes, scintillation counters, cameras, film and the like, as well as combinations thereof. Examples of suitable detectors are widely available from a variety of commercial sources known to persons of skill. Commonly, an optical image of a substrate comprising bound labeling moieties is digitized for subsequent computer analysis.

[0172] The ligand compositions of the invention can be used in any diagnostic assay format to determine the presence of trimeric-SODl. A variety of immunodetection methods are contemplated for this embodiment. Such immunodetection methods include enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay, fluoroimmunoassay, chemiluminescent assay, bioluminescent assay, and Western blot, though several others are wellAttorney Docket No. 0073605-001205 known to those of ordinary skill. The steps of various useful immunodetection methods have been described in the scientific literature.

[0173] In general, the binding methods include obtaining a sample suspected of containing a protein, polypeptide and / or peptide (e.g., trimeric-SODl), and contacting the sample with a first antibody in accordance with the present invention, as the case may be, under conditions effective to allow the formation of complexes.

[0174] The binding methods include methods for detecting and quantifying the amount of the target SOD1 trimer component in a sample and the detection and quantification of any complexes formed during the binding process. Here, one would obtain a sample suspected of containing target SOD1 trimers, and contact the sample with an antibody or antibody fragment of the invention, and then detect and quantify the amount of complexes formed under the specific conditions.

[0175] Contacting the chosen biological sample with the antibody or antibody fragment under effective conditions and for a period of time sufficient to allow the formation of complexes (primary complexes) is generally a matter of simply adding the antibody composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form complexes with, i.e., to bind to, any SOD1 trimers present. After this time, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies or antibody fragments specifically bound within the primary complexes to be detected.

[0176] In another aspect, disclosed herein is a method for slowing a progression of ALS in a subject in need thereof. The method may include measuring a level of at least a biomarker in the subject, wherein the at least a biomarker includes trimeric SOD1, consistent with details described elsewhere in this disclosure. The method may further include determining an ALS status indicator as a function of the measurement, consistent with details described elsewhere in this disclosure. The method may further include providing a treatment to slow the progression of ALS as a function of the ALS status indicator. The treatment may include any suitable type or dosage of treatment recognized by a person of ordinary skill in the art, upon reviewing the entirety of this disclosure. As nonlimiting examples, the treatment may include an administration of medication such as Riluzole (Rilutek, Exservan, Tiglutik) and Edaravone (Radi cava). As further nonlimiting examples, the treatment may include one or more treatments for relief of symptoms such as muscle cramps and spasms, constipation, fatigue, excessive saliva and phlegm, pain, depression, sleep problems, uncontrolled outbursts of laughing or crying, an urgent need to urinate, leg swelling, and / or the like.Attorney Docket No. 0073605-001205 In some embodiments, the treatment may include one or more therapies such as breathing care, physical therapy, occupational therapy, speech therapy, nutritional support, psychological / social support, and / or the like.

[0177] In some embodiments, measuring the level of the at least a biomarker may include detecting a level of trimeric SOD1 using a synthetic antibody, as described above, wherein at least a functional fragment of the synthetic antibody is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be characterized by one or more members selected from a group consisting of at least 85% identical to SEQ ID NO: 1, at least 90% identical to SEQ ID NO: 1, at least 95% identical to SEQ ID NO: 1, and at least 99% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 85% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 90% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 95% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence may be at least 99% identical to SEQ ID NO: 1.

[0178] The invention described in this disclosure may also be used to screen patients with the familial form of ALS, to track disease progression thereof, and / or to be used as a universal screening method for sporadic ALS.

[0179] In an aspect, there is provided a method for screening a subject for ALS or FTH, determining a level of a biomarker and treating the subject accordingly. The trimeric-SODl binding proteins of the invention are useful to guide treatment and prevention of ALS and FTH. Examples of treatments for ALS include, without limitation, administration of therapeutically effective amounts of riluzole, edaravone, or tofersen. Riluzole is intended to slow the progression of ALS by blocking the release of glutamate. Edaravone is thought to slow the loss of physical function and the progression of ALS by preventing nerve damage by reactive oxygen species. Tofersen is an antisense oligonucleotide that specifically targets RNA produced from mutated SOD1 genes.

[0180] Woo et al. described a small molecule, PRG-A01, which can block themisfol ding / aggregation of SOD1 or TDP-43 in a human neuroblastoma cell line and its use in a mouse model of ALS results in improvement of muscle strength, motor neuron viability and mobility, highlighting its therapeutic potential in ALS. (Woo et al., Novel chemical inhibitor against SOD1 misfolding and aggregation protects neuron-loss and ameliorates disease symptoms in ALS mouse model. Communications Biology, 2021, 4:1397.)Attorney Docket No. 0073605-001205

[0181] Beyond the antibody’s potential as a biomarker assay to diagnose ALS patients, the antibody may also help test whether ALS is a convergent disease.Specific Embodiments

[0182] The following numbered embodiments may be useful in consideration of the teachings including herein. Recitation of a numbered embodiment should not be construed as a requirement that the claims require any particular facet of a similarly numbered embodiment or embodiments.

[0183] Numbered embodiment 1 : A method for screening a subject in need thereof for amyotrophic lateral sclerosis (ALS), wherein the method comprises:measuring a level of at least a biomarker in the subject, wherein the at least a biomarker comprises trimeric superoxide dismutase 1 (SOD1); anddetermining an ALS status indicator as a function of the measurement.

[0184] Numbered embodiment 2: The method according to numbered embodiment 1, wherein determining the ALS status indicator comprises tracking a progression of ALS in the subject as a function of the measurement.

[0185] Numbered embodiment 3: The method according to numbered embodiment 1, wherein measuring the level of the at least a biomarker comprises measuring the level of the at least a biomarker using a blood test.

[0186] Numbered embodiment 4: The method according to numbered embodiment 1, wherein measuring the level of the at least a biomarker comprises detecting a level of trimeric SOD1 using a synthetic antibody, wherein the synthetic antibody comprises a means for selectively binding trimeric SOD1, or at least a functional fragment of the synthetic antibody is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1.

[0187] Numbered embodiment 5: The method according to numbered embodiment 4, wherein the nucleic acid sequence is characterized by one or more members selected from a group consisting of at least 85% identical to SEQ ID NO: 1, at least 90% identical to SEQ ID NO: 1, at least 95% identical to SEQ ID NO: 1, and at least 99% identical to SEQ ID NO: 1.

[0188] Numbered embodiment 6: The method according to numbered embodiment 1, wherein measuring the level of the at least a biomarker comprises measuring the level of the at least a biomarker using a biomarker assay.Attorney Docket No. 0073605-001205

[0189] Numbered embodiment 7: The method according to numbered embodiment 6, wherein the biomarker assay comprises an enzyme-linked immunosorbent assay (ELISA).

[0190] Numbered embodiment 8: A synthetic antibody for diagnosis of ALS, wherein at least a functional fragment of the synthetic antibody:is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1; and has a specific binding affinity towards trimeric SOD1.

[0191] Numbered embodiment 9: The synthetic antibody according to numbered embodiment 8, wherein the nucleic acid sequence is characterized by one or more members selected from a group consisting of at least 85% identical to SEQ ID NO: 1, at least 90% identical to SEQ ID NO: 1, at least 95% identical to SEQ ID NO: 1, and at least 99% identical to SEQ ID NO: 1.

[0192] Numbered embodiment 10: The synthetic antibody according to numbered embodiment 8, wherein the synthetic antibody is expressed using genetically modified BL21 cells.

[0193] Numbered embodiment 11 : A biomarker assay for diagnosis of ALS, wherein the biomarker assay is configured to detect a presence of trimeric SOD1 using the synthetic antibody according to numbered embodiment 8.

[0194] Numbered embodiment 12: The biomarker assay according to numbered embodiment 11, wherein the biomarker assay comprises an ELISA.

[0195] Numbered embodiment 13: The biomarker assay according to numbered embodiment 11, wherein the synthetic antibody is conjugated with a horseradish peroxidase (HRP) tag.

[0196] Numbered embodiment 14: A medical kit for diagnosis of ALS, wherein the medical kit comprises:at least a biomarker assay comprising the synthetic antibody according to numbered embodiment 8; andat least an instruction for using the at least a biomarker assay.

[0197] Numbered embodiment 15: The medical kit according to numbered embodiment 14, wherein the biomarker assay comprises an ELISA.Attorney Docket No. 0073605-001205

[0198] Numbered embodiment 16: The medical kit according to numbered embodiment 14, wherein the synthetic antibody is conjugated with an HRP tag.

[0199] Numbered embodiment 17: A use of the synthetic antibody according to numbered embodiment 8 for diagnosis of ALS.

[0200] Numbered embodiment 18: The use of the synthetic antibody according to numbered embodiment 17, wherein the synthetic antibody is conjugated with an HRP tag.

[0201] Numbered embodiment 19: A method for slowing a progression of ALS in a subject in need thereof, wherein the method comprises:measuring a level of at least a biomarker in the subject, wherein the at least a biomarker comprises trimeric SOD1;determining an ALS status indicator as a function of the measurement; andproviding a treatment to slow the progression of ALS as a function of the ALS status indicator.

[0202] Numbered embodiment 20: The method according to numbered embodiment 19, wherein measuring the level of the at least a biomarker comprises detecting a level of trimeric SOD1 using a synthetic antibody, wherein at least a functional fragment of the synthetic antibody is encoded by a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1.

[0203] Numbered embodiment 21 : A method for screening a subject in need thereof for amyotrophic lateral sclerosis (ALS), wherein the method comprises:measuring a level of at least a biomarker in the subject, wherein:the at least a biomarker comprises trimeric superoxide dismutase 1 (SOD1); and measuring the level of the at least a biomarker comprises measuring the at least a biomarker using a synthetic antibody comprising a means for selectively binding to trimeric SOD1; anddetermining an ALS status indicator as a function of the measurement.

[0204] Numbered embodiment 22: A synthetic antibody for diagnosis of ALS, comprising a means for selectively binding trimeric SOD1.Attorney Docket No. 0073605-001205

[0205] Numbered embodiment 23: The synthetic antibody according to numbered embodiment 22, wherein the synthetic antibody is a peptide or protein encoded by SEQ ID NO: 1 or a functional variant thereof.

[0206] Numbered embodiment 24: A method for slowing a progression of ALS in a subject in need thereof, wherein the method comprises:measuring a level of at least a biomarker in the subject, wherein:the at least a biomarker comprises trimeric superoxide dismutase 1 (SOD1); and measuring the level of the at least a biomarker comprises measuring the at least a biomarker using a synthetic antibody comprising a means for selectively binding to trimeric SOD1;determining an ALS status indicator as a function of the measurement; andproviding a treatment to slow the progression of ALS as a function of the ALS status indicator.EXAMPLE

[0207] To assess trimeric SOD1 as a diagnostic biomarker for ALS, the titer of patient antibodies in serum was quantified against trimeric, dimeric, or fibrillar SOD1 in ALS patients and healthy controls.

[0208] The first antibody specific for trimeric SOD1 was isolated using synthetic antibody design. Specifically, a human Fab antibody phage display library was used to isolate a synthetic antibody that has a specific binding affinity for SOD1 and does not bind to native (i.e., dimeric) or other misfolded forms of SOD1. The phage DNA was modified to isolate the purified Fab antibody, and a horseradish peroxidase (HRP) tag was added thereto.

[0209] The new antibody was tested as a new biomarker assay to specifically diagnose ALS by comparing the trimer level in ALS patient samples to healthy controls and other neurological controls (e.g., Alzheimer’s Disease and Parkinson’s Disease). Specifically, the antibody was tested as a diagnostic biomarker assay for ALS by performing direct ELISAs on serum samples from human patients compared to healthy controls, Alzheimer's disease controls, and Parkinson's disease controls. In initial testing, only the ALS patient samples (n = 12 early time point of disease progression, n = 85 later time points of disease progression) showed a significant increase in trimeric SOD1 compared to control samples (n = 86), as quantified using the developed antibody. In contrast, Alzheimer's (n = 10) and Parkinson's (n = 10) disease samples did not show a significant increase inAttorney Docket No. 0073605-001205 trimeric S0D1 compared to the control samples. The sample size may be further expanded to 200 ALS patient samples stratified by sporadic ALS or specific disease-related genetic mutations.Additional details are provided below in this disclosure.

[0210] Results

[0211] ALS patients develop antibodies specifically against trimeric SOD1

[0212] To initially determine if trimeric SOD1 was present in ALS patient samples without the use of misfolded SOD1 antibodies, 20 ALS patient samples and 3 healthy control samples were tested for antibodies against dimeric, trimeric, or large insoluble fibrils of SOD1 (FIG. 1A). It is worth noting that the His-tag on the purified trimer had no significant effect on the binding of patient antibodies, and whole blood and serum showed no significant difference either, as seen in FIGS. 1B-C. Both FH and HG are specific forms of stabilized SOD1 trimer, and HG-His is an HG trimer with a polyhistidine (His) tag. Most prior studies investigating the presence of misfolded SOD1 in non-SOD1 mutant ALS used immunohistochemistry of spinal cord sections. However, SOD1 immunohistochemistry has two main problems: first, antibodies against misfolded SOD1 are highly inconsistent and do not identify all misfolded forms; second, these antibodies must be used at very high concentrations, making it expensive to screen large sample sets. To avoid these issues, mutations of SOD1 that stabilize different conformations of the protein were chosen, which made it possible to observe differences due to specific species (dimer, trimer, fibril) without the need for SOD 1 -specific antibodies. Purified dimer, trimer, or large insoluble fibril SOD1 was coated on ELISA plates. Whole blood or serum was added at a 1:10 dilution after the plates were blocked with 1% bovine serum albumin (BSA). The patient antibodies were quantified using an anti-human IgG HRP antibody.

[0213] A significant increase (p-value = 0.001) was observed in anti-trimeric SOD1 antibodies between ALS patients and healthy controls. In contrast, no significant difference was observed in antibodies against dimer or insoluble SOD1 between ALS patients and healthy controls (FIG. 1A). The level of antibodies against dimeric and insoluble SOD1 is likely elevated in both the healthy control and ALS patient samples due to structural similarities between intracellular SOD1 and extracellular SOD3. 20 ALS patient samples and three whole-blood control samples were obtained through the Penn State Health ALS Clinic biorepository and Penn State IPM biorepository, respectively. Although the exact genetics of these patients were unknown, it is assumed that very few (if any) of the samples come from patients with SOD1 genetic mutations, which account forAttorney Docket No. 0073605-001205 only 2% of all ALS cases. This assay provides initial and unexpected evidence that specifically toxic trimeric SOD1 is present in all ALS patients.

[0214] FIG. ID shows additional data supporting these findings. Specifically, a significant increase (p < 0.05) in concentration was observed for antibodies against FH, HG-His, and HG proteins in ALS patient samples versus healthy controls. Detailed data used to create FIGS. 1A-D are summarized below in Table 1 below.Table 1: Antibody Concentrations of Various Forms of SOD1 Measured as Absorbance at 450 nm. Protein Value Group Protein Value GroupDimer 0.43185 Ctrl Dimer 0.43185 Ctrl p values whole vs serum Dimer 0.5172 Ctrl Dimer 0.5172 Ctrl FH His 0.6847 Dimer 0.80285 Ctrl Dimer 0.80285 Ctrl FH 0.0594 Dimer 0.9046 ALS Dimer 0.9046 ALS whole blood HG His 0.9793 Dimer 0.6714 ALS Dimer 0.6714 ALS whole blood HG 0.4205 Dimer 0.58695 ALS Dimer 0.58695 ALS whole blood WT Fibril 0.4333 Dimer 0.5645 ALS Dimer 0.5645 ALS whole blood A4V Fibril 0.5367 Dimer 0.6 ALS Dimer 0.6 ALS whole bloodDimer 0.7235 ALS Dimer 0.7235 ALS whole bloodDimer 0.52295 ALS Dimer 0.52295 ALS whole bloodDimer 0.66035 ALS Dimer 0.66035 ALS whole bloodDimer 0.55235 ALS Dimer 0.55235 ALS whole bloodDimer 0.6867 ALS Dimer 0.6867 ALS whole bloodDimer 0.6116 ALS Dimer 0.6116 ALS whole bloodDimer 0.77555 ALS Dimer 0.77555 ALS whole bloodDimer 0.68955 ALS Dimer 0.68955 ALS whole bloodDimer 0.7803 ALS Dimer 0.7803 ALS whole bloodDimer 0.80845 ALS Dimer 0.80845 ALS whole bloodDimer 0.40645 ALS Dimer 0.40645 ALS whole bloodDimer 0.547 ALS Dimer 0.547 ALS whole bloodDimer 0.69945 ALS Dimer 0.69945 ALS whole bloodDimer 0.88195 ALS Dimer 0.88195 ALS whole bloodDimer 0.7868 ALS Dimer 0.7868 ALS whole bloodTrimer 0.43825 Ctrl FHHis 0.52465 CtrlTrimer 0.33835 Ctrl FHHis 0.57145 CtrlTrimer 0.453 Ctrl FH His 0.82535 Ctrl average stdev Trimer 0.70515 ALS FH His 0.82225 ALS whole blood whole 0.81673 0.237056Attorney Docket No. 0073605-001205 Trimer 1.0313 ALS FH His 1.18045 ALS whole blood serum 0.8534 0.148337 Trimer 0.8503 ALS FH His 0.86105 ALS whole blood 5 15 Trimer 0.64 ALS FH His 0.65985 ALS whole bloodTrimer 0.6061 ALS FH His 0.56005 ALS whole bloodTrimer 0.6435 ALS FH His 0.6133 ALS SerumTrimer 0.7227 ALS FH His 0.66515 ALS SerumTrimer 0.7235 ALS FH His 0.8653 ALS SerumTrimer 0.88505 ALS FH His 0.95565 ALS SerumTrimer 0.4801 ALS FH His 0.7843 ALS SerumTrimer 0.78505 ALS FHHis 0.9731 ALS SerumTrimer 0.53235 ALS FHHis 0.7897 ALS SerumTrimer 1.107 ALS FHHis 1.15625 ALS SerumTrimer 0.77805 ALS FHHis 0.84545 ALS SerumTrimer 0.8472 ALS FHHis 0.96055 ALS SerumTrimer 0.63595 ALS FHHis 0.74325 ALS ScrumTrimer 0.68405 ALS FH His 0.8387 ALS SerumTrimer 1.00185 ALS FH His 0.8028 ALS SerumTrimer 0.77935 ALS FHHis 0.7335 ALS SerumTrimer 0.8573 ALS FHHis 1.074 ALS SerumFibril 0.7572 Ctrl FH 0.32235 CtrlFibril 0.7591 Ctrl FH 0.4122 CtrlFibril 0.92255 Ctrl FH 0.56505 CtrlFibril 0.93225 ALS FH 0.54205 ALS whole blood whole average stdev Fibril 0.83865 ALS FH 0.9243 ALS whole blood 0.62051 0.17463 Fibril 0.9794 ALS FH 0.6102 ALS whole bloodFibril 0.8292 ALS FH 0.52555 ALS whole bloodFibril 0.81605 ALS FH 0.50045 ALS whole bloodFibril 0.7813 ALS FH 0.5713 ALS Serum serum average stdev Fibril 0.8515 ALS FH 0.68705 ALS Serum 0.77906 0.145643 Fibril 0.80315 ALS FH 0.67915 ALS SerumFibril 0.85315 ALS FH 0.8827 ALS SerumFibril 0.98305 ALS FH 0.5691 ALS SerumFibril 0.9727 ALS FH 0.8452 ALS SerumFibril 1.0389 ALS FH 0.6151 ALS SerumFibril 0.9978 ALS FH 1.0931 ALS SerumFibril 0.86095 ALS FH 0.9463 ALS SerumFibril 0.9956 ALS FH 0.88725 ALS SerumAttorney Docket No. 0073605-001205 Fibril 0.7903 ALS FH 0.7976 ALS SerumFibril 0.9171 ALS FH 0.7299 ALS SerumFibril 0.9535 ALS FH 0.814 ALS SerumFibril 0.79425 ALS FH 0.72515 ALS SerumFibril 1.02725 ALS FH 0.843 ALS SerumHG His 0.43825 CtrlHG His 0.33835 CtrlHG His 0.453 Ctrl average stdevHG His 0.70515 ALS whole blood whole 0.76657 0.175097 HG His 1.0313 ALS whole blood serum 0.7642 0.164814 HG His 0.8503 ALS whole bloodHG His 0.64 ALS whole bloodHG His 0.6061 ALS whole bloodHG His 0.6435 ALS SerumHG His 0.7227 ALS ScrumHG His 0.7235 ALS SerumHG His 0.88505 ALS SerumHG His 0.4801 ALS SerumHG His 0.78505 ALS SerumHG His 0.53235 ALS SerumHG His 1.107 ALS SerumHG His 0.77805 ALS SerumHG His 0.8472 ALS SerumHG His 0.63595 ALS SerumHG His 0.68405 ALS SerumHG His 1.00185 ALS SerumHG His 0.77935 ALS SerumHG His 0.8573 ALS SerumHG 0.4109 CtrlHG 0.32935 CtrlHG 0.6019 Ctrl average stdev HG 0.5996 ALS whole blood whole 0.70212 0.172265 HG 0.9997 ALS whole blood serum 0.76123 0.127722 HG 0.6631 ALS whole bloodHG 0.6786 ALS whole bloodHG 0.5696 ALS whole bloodHG 0.7233 ALS SerumAttorney Docket No. 0073605-001205HG 0.71625 ALS SerumHG 0.7458 ALS SerumHG 0.956 ALS SerumHG 0.70155 ALS SerumHG 0.8349 ALS SerumHG 0.56855 ALS SerumHG 1.074 ALS SerumHG 0.7194 ALS SerumHG 0.7074 ALS SerumHG 0.7159 ALS SerumHG 0.64615 ALS SerumHG 0.77025 ALS SerumHG 0.6631 ALS SerumHG 0.8759 ALS SerumWT Fibril 0.7742 CtrlWT Fibril 0.5766 CtrlWT Fibril 0.85085 Ctrl average stdev WT Fibril 0.8084 ALS whole blood whole 0.75124 0.065831 WT Fibril 0.81495 ALS whole blood serum 0.719757 0.078745 WT Fibril 0.76815 ALS whole bloodWT Fibril 0.6931 ALS whole bloodWT Fibril 0.6716 ALS whole bloodWT Fibril 0.6176 ALS SerumWT Fibril 0.6449 ALS SerumWT Fibril 0.72565 ALS SerumWT Fibril 0.85735 ALS SerumWT Fibril 0.73205 ALS SerumWT Fibril 0.81255 ALS SerumWT Fibril 0.662 ALS SerumWT Fibril 0.77045 ALS SerumWT Fibril 0.76785 ALS SerumWT Fibril 0.7469 ALS SerumWT Fibril 0.6097 ALS SerumWT Fibril 0.7494 ALS SerumWT Fibril 0.7687 ALS SerumWT Fibril 0.5855 ALS SerumWT Fibril 0.74575 ALS SerumAttorney Docket No. 0073605-001205A4V Fibril 0.7572 CtrlA4V Fibril 0.7591 CtrlA4V Fibril 0.92255 CtrlA4V Fibril 0.93225 ALS whole blood whole average stdev A4V Fibril 0.83865 ALS whole blood 0.87911 0.072434 A4V Fibril 0.9794 ALS whole bloodA4V Fibril 0.8292 ALS whole bloodA4V Fibril 0.81605 ALS whole bloodA4V Fibril 0.7813 ALS Serum serum average stdev A4V Fibril 0.8515 ALS Serum 0.908033 0.093089 A4V Fibril 0.80315 ALS SerumA4V Fibril 0.85315 ALS SerumA4V Fibril 0.98305 ALS SerumA4V Fibril 0.9727 ALS SerumA4V Fibril 1.0389 ALS ScrumA4V Fibril 0.9978 ALS SerumA4V Fibril 0.86095 ALS SerumA4V Fibril 0.9956 ALS SerumA4V Fibril 0.7903 ALS SerumA4V Fibril 0.9171 ALS SerumA4V Fibril 0.9535 ALS SerumA4V Fibril 0.79425 ALS SerumA4V Fibril 1.02725 ALS Serum

[0215] Additional details regarding patient samples are summarized below in Tables 2A-B.Table 2A. Patient Profiles.Patient Visit Date Date ALSFRSR* FVC Gender Age at Enrollment Note # enrollment date40 4 Serum 10 / 21 / 2015 24 24 M 47 ALS according Limb 1 / 22 / 2014to revised El- Escorial criteria42 5 Serum 9 / 9 / 2020 41 100 F 72 Primary Lateral 1 / 29 / 2014Sclerosis (PLS)50 3 5 / 4 / 14 blood 5 / 4 / 2014 29 71 M 70 Primary Lateral 2 / 12 / 2014Sclerosis (PLS)Attorney Docket No. 0073605-001205 3 5 / 13 / 15 blood 5 / 6 / 2015 23 47 M 66 ALS according Limb 2 / 17 / 2014to revised El- Escorial criteria4 Serum 9 / 2 / 2015 23 59 M 68 ALS according Limb 8 / 27 / 2014 technically to revised El- NA Escorial criteria3 5 / 13 / 15 blood 5 / 13 / 2015 25 64 M 56 ALS according Limb 2 / 26 / 2014to revised El- Escorial criteria4 serum 2 / 17 / 2016 6 M 50 ALS according Bulbar 3 / 5 / 2014to revised El- Escorial criteria4 serum 10 / 14 / 2015 M 66 Hereditary 3 / 12 / 2014SpasticParaplegia3 serum 10 / 14 / 2015 24 90 M 57 Primary Lateral 4 / 2 / 2014Sclerosis (PLS)4 serum 2 / 3 / 2016 48 94 M 35 ALS according Limb 4 / 9 / 2014to revised El- Escorial criteria3 5 / 6 / 15 blood 5 / 6 / 2015 34 95 F 72 Primary Lateral 4 / 16 / 2014Sclerosis (PLS)3 5 / 13 / 15 blood 5 / 13 / 2015 23 36 F 79 Primary Lateral 5 / 5 / 2014Sclerosis (PLS)2 serum 11 / 2 / 2015 40 56 M 36 ALS according Limb 8 / 13 / 2014to revised El- Escorial criteria3 serum 2 / 10 / 2016 21 37 M 69 ALS according Bulbar 11 / 12 / 2014to revised El- Escorial criteria3 serum 1 / 4 / 2016 31 33 M 71 ALS according Limb 1 / 7 / 2015to revised El- Escorial criteria3 serum 1 / 20 / 2016 23 49 M 54 ALS according Limb 1 / 21 / 2015to revised El- Escorial criteria2 serum 9 / 23 / 2015 39 43 M 62 ALS according Bulbar 3 / 11 / 2015to revised El- Escorial criteria2 serum 9 / 23 / 2015 19 45 M 81 ALS according Limb 4 / 1 / 2015to revised El- Escorial criteriaAttorney Docket No. 0073605-001205 178 2 serum 10 / 7 / 2015 30 47 M 61 ALS according Bulbar 4 / 1 / 2015to revised El- Escorial criteria217 1 serum 11 / 2 / 2015 23 33 M 59 Primary' Lateral 11 / 2 / 2015Sclerosis (PLS)average 27.68421 average 62min 6 min 35max 48 max 81*Revised Amyotrophic Lateral Sclerosis Functional Rating ScaleTable 2B: Clinical characteristics of patients with ALS and controls with no known neurological disorders, Alzheimer’s disease (AD), or Parkinson’s disease (PD).Characteristic Archived ALS ALS Healthy AD PD Samples (2024-2024) Controls (n = 10) (n = 10) (2014-2020) (n = 42) (n = 42)(n = 20)Male, n (%) 17 (85%) 27 (64.3%) 27 (64.3%) 5 (50%) 5 (50%) Age, yr 62 (35-81) 66 (34-83) 64 (46-86) 76.8 (68-85) (61-80) Disease 29.3 (0-326)duration,monthsSite of onset 9 / 4 (7 N / A) 23 / 12(limb / bulbar)ALSFRS-R 27.7 (6-48) 34.9 (20-47)scoreNo genetic 39 (92.9%)mutation (%)

[0216] Designing a synthetic antibody for trimeric SOD1

[0217] Before testing a larger scale of ALS patient samples for trimeric SOD1, an easier way to detect trimeric SOD1 is needed. In this study, a phagemid synthetic human Fab antibody library was used to screen and isolate candidate antibodies that specifically bind to trimeric SOD1.

[0218] The initial strategy to test the panning hits with ELISA was to simply compare the binding to purified dimer, trimer, and insoluble aggregates. In the first round, however, the hits from the initial test had a high level of non-specific binding to other proteins in the cell lysate, as shownAttorney Docket No. 0073605-001205 on the native western blot. Checking for binding to cell lysate at the first stage therefore helps identify antibodies with non-specific binding to other common proteins. Accordingly, to overcome this challenge, the initial screening method was expanded to include cell lysate so that antibodies with non-specific binding would be eliminated in the first step. Over 500 different colonies were screened and narrowed down to 8 potential “hits.” ELISA was performed against purified WT dimer, HG trimer, or A4V Fibril for the top 8 potential antibody hits after screening over 400 possibilities on an initial ELISA screen (using cell lysate to rule out nonspecific binders).

[0219] Eventually, eight potential antibody “hits” were isolated after seven rounds of phage panning, as described in further detail below in this disclosure. These eight initial “hits” all display binding to cell lysate with trimeric SOD1 overexpression but no binding to control cell lysate or purified WT dimeric SOD1 (FIG. 2A). Additional data can be found in FIG. 2H and Table 3 below.Table 3. ELISA Results from Top Hits Based on Absorbance Measured at 450 nm Using an M13 Antibody.7.1.1.8 7.1 5.9 7.1 6.1 72.4.11 7.2.4.12 7.2.7.4 7.2.7.9 7.2.8.10 8.7.1 8.5.9 WT Dimer -0.0046 0.1902 0.1768 0.1015 0.2044 0.0697 0.1957 0.2617 0.0201 0.18650.0235 0.1644 0.0852 0.012 0.037 -0.0381 -00227 0.0384 -00188 -00129 Average 0.00945 0.1773 0.131 0.05675 0.1207 0.0158 0.0865 0.15005 0.00065 0.0868 St dev 0.01405 0.0129 0.0458 0.04475 0.0837 0.0539 0.1092 0.11165 0.01945 0.0997HG Trimer 0.495 0.7181 0.7522 0.6329 0.7264 0.6113 0.9548 1.0545 0.4356 0.926 0.408 0.7541 0.7421 0.6931 0.7378 0.5751 0.7775 0.8477 0.4241 0.7737 Average 04515 07361 0 74715 0663 0 7321 0 5932 0 86615 0 9511 042985 0 84985 St dev 0.0435 0.018 0.00505 0.0301 0.0057 0.0181 0.08865 0.1034 0.00575 0.07615A4V Fibril -0.0318 -0.0738 0.0249 -0.0245 -0.0315 -0.0268 -00404 -00093 -00435 0.0105-00305 00607 0 051 00121 0 0439 -0029 -00925 0 0687 -00267 -0 1 Average -0.03115 -0.00655 0.03795 -0.0062 0.0062 -0.0279 -006645 0.0297 -00351 -004475 St dev 0.00065 0.06725 0.01305 0.0183 0.0377 0.0011 0.02605 0.039 0.0084 0.05525

[0220] The initial eight “hits” were further narrowed down to three “hits” based on native western blots: 7.2.7.4 (4), 7.1.5.9 (9), and 7.2.2.10 (10) (FIG. 2B). The final three “hits” were further narrowed down to “hit” 9 (i.e., antibody 9) through an initial ELISA by comparing the signal from the serum of five healthy control patients and five ALS patients who are at later stages of disease progression. Antibody 9 showed the most significant (p-value = 0.001) difference between theAttorney Docket No. 0073605-001205 healthy control and ALS groups in the initial blood testing (FIG. 2C). The nucleotide sequence of antibody 9 is presented as SEQ ID NO. 1.

[0221] Trimeric SOD1 antibody as a biomarker assay for ALS

[0222] Initial testing of the 3 top antibody hits was conducted with the phage still attached. ELISA was performed using an anti-M13 phage antibody. Detailed testing data are summarized in Table 4 and FIGS. 21-J.Table 4. Initial Testing of the 3 Top Antibody Hits with the Phage Still Attached. ELISA Was Performed Using an Anti-Ml 3 Phage Antibody.Antibody 4 Average stdev p value Ctrl 0.0091 0.0136 0.05335 0.02535 0.024353ALS Old Visit 3* 0.0922 0.0825 0.137 0.07025 0.095488 0.029096 0.02 ALS New** -0.05835 -0.0409 -0.04963 0.012339 0.0301Antibody 9 Average stdev p value Ctrl 0.09945 0.07565 0.12905 0.026752ALS Old Visit 3 0.2328 0.23395 0.29615 0.2427 0.2514 0.030159 0.001 ALS New 0.12265 0.08465 0.10365 0.02687 0.932Antibody 10 Average stdev p value Ctrl 0.0875 0.1682 0.11965 0.040627ALS Old Visit 3 0.22485 0.23015 0.3295 0.24405 0.257138 0.048916 0.013 ALS New 0.12385 0.09245 0.10815 0.022203 0.637Average stdev Ctrl 0.2046: 0.1088 0.0451 0.06775 0.14595 0.11805New Blood 0.1105 0.1624 0.2951 0.13715 0.08105 0.09015Antibody 4 Average stdev p value Ctrl 0.0091 0.0136 0.05335 0.02535 0.024353ALS 0.0922 0.0825 0.137 0.07025 0.095488 0.029096 0.02Antibody 9 Average stdev p value Ctrl 0.09945 0.07565 0.12905 0.026752ALS 0.2328 0.23395 0.29615 0.2427 0.2514 0.030159 0.001Attorney Docket No. 0073605-001205Antibody 10 Average stdev p value Ctrl 0.0875 0.1682 0.11965 0.040627ALS 0.22485 0.23015 0.3295 0.24405 0.257138 0.048916 0.013 *“ALS Old Visit 3” are samples collected between 2014-2020, from the patient’s 3rdvisit to the clinic, and these samples have undergone an unknown number of freeze / thaw cycles.**“ALS New” were patient samples freshly collected between October 2024-December 2024 with no freeze thaw cycles.

[0223] Using antibody 9 with the phagemid still attached caused additional noise when testing patient samples and led to the antibody aggregating during storage, which reduced its activity (FIG.2D). To overcome these challenges, a shortened version of the DNA was created for antibody 9 with the Ml 3 localization region removed from the pComb3 backbone. This step was completed using a double restriction digestion with Spel and Nhel to produce a 3,500bp plasmid. The human Fab protein is expressed in BL21 cells and purified using a His column and size exclusion chromatography (SEC) (FIGS. 2E-G). Since antibody 9 is a human antibody, and the samples were also human, the activated peroxidase was crosslinked directly to the purified antibody to avoid crossreactivity from an anti-human secondary antibody. The crosslinked peroxidase prevents high background noise and reduced signal specificity.

[0224] The purified antibody 9 detected increasing levels of trimeric SOD1 in a native western blot, as different SOD1 mutations incrementally stabilize the trimer in a motor neuron-like cell line (NSC-34) (FIG. 3A). The purified antibody also showed increased specificity in human patient samples compared to the same antibody with the phage still attached (FIG. 2D).

[0225] To further determine if the new antibody for trimeric SOD1 was specific to ALS, the binding behavior of the new antibody was evaluated using serum samples from 87 healthy control patients, ten Alzheimer’s disease control patients, and 12 newly collected ALS patient blood samples. A significant increase in trimer levels was observed in the ALS patients compared to the healthy control group, but no difference was detected between the healthy control and Alzheimer’s disease patients (FIG. 3B). The sample size of ALS patients may further expand to over 100 patient samples, stratified by genetic mutation. A group of Parkinson’s disease (PD) patient samples and a group of Alzheimer’s disease (AD) patient samples may also serve as additional neurological control groups.Attorney Docket No. 0073605-001205

[0226] Additional supporting data are summarized in FIGS. 4-8 and Tables 5A-B, 6A-D, 7A-B, and 8.

[0227] FIG. 4 includes exemplary data summarizing ELISA results based on samples collected from various patient groups. All samples from ALS patients showed a statistically significant increase (p < 0.0001) in trimeric SOD1 levels (measured as the absorbance at 450 nm) compared to samples collected from healthy controls and Alzheimer’s disease (AD) patients.

[0228] Tables 5 A includes ELISA results collected using purified antibody 9 crosslinked to HRP, with the phage region removed, consistent with results shown in FIG. 3B. Such purified antibody 9 was tested at a 1:10 dilution and 1 : 100 dilution, and both conditions produced satisfactory results, consistent with results in FIG. 2D. New ALS samples and Control samples (n = 5) were tested in triplicate, while all other sample groups were single samples.Table 5A. ELISA Results Using Purified Antibody 9 with Phage Region Removed.Purified Ab 1:10 dilution New blood 12.9.241:10 Ctrl ALS 1:100 Ctrl ALS 0.274 0.2396 0.0779 0.0946 0.1373 0.3573 0.0694 0.1554 0.1849 0.3036 0.1878 0.1771 0.132 0.2546 0.0363 0.1521 0.2084 0.3649 0.0231 0.11920.2704 0.124 0.4256 0.2307 0.4358 0.2445 0.3895 0.1828 0.302 0.1916 0.1994 0.1531 0.3006 0.1933

[0229] Tables 5B includes ELISA results collected from both new and old samples, using purified antibody 9 crosslinked to HRP, with the phage region removed, consistent with results shown in FIG. 4. At time point 1, old samples had degraded too much from freeze thaw cycles, butAttorney Docket No. 0073605-001205 the new blood samples had a significant change in signal. Samples from Alzheimer’s disease (AD) patients were also used for comparison.Table 5B. ELISA Results from Both Old and New Samples Using Purified Antibody 9 with Phage Region Removed.Purified Ab 1 : 10 Dilution New blood 12.9.24Ctrl Ctrl AD New ALS Old ALS 1 Old ALS other0.07715 0.09835 0.070683 0.317683 0.28595 0.17705 0.23615 0.27235 0.50395 0.17465 0.06505 0.08785 0.069517 0.281683 0.12155 0.07485 0.16885 0.29715 0.41675 0.22615 0.08775 0.08645 0.084683 0.325883 0.12385 0.08905 0.23615 0.26715 0.40315 0.12345 0.11455 0.12455 0.068283 0.23765 0.14435 0.05935 0.41345 0.26995 0.39105 0.28345 0.14995 0.08725 0.07625 0.20445 0.09235 0.15015 0.36155 0.31855 0.28515 0.10035 0 15765 022115 0 11645 0 158417 0 10155 0 15875 0 31975 027335 028335 0 11055 0.14275 0.08795 0.196017 0.14175 0.23215 0.27635 0.30285 0.27255 0.26105 0.16995 0.04335 0.240017 0.35725 0.27605 0.19065 0.31435 0.28875 0.30215 0.17845 0.04845 0.169083 0.14625 0.15945 0.13615 0.34145 0.26895 0.28915 0.15765 0.02695 0.189783 0.10315 0.14265 0.18715 0.33995 0.27935 0.23955 0.12735 0.02035 0.134883 0.11045 0.13685 0.24745 0.33365 0.22345 0.13045 0.15705 0.03695 0.35165 0.10495 0.07975 0.20945 0.39805 0.27435 0.08575 0.09265 0.06065 0.10395 0.16275 0.17895 0.40355 0.28465 0.24095 0.11375 0.20185 0.15005 0.17795 0.14135 0.30795 0.34555 0.17245 0 16975 009455 027205 026325 025635 0 18995 0 30875 023145 0.04045 0.06695 0.37405 0.21155 0.30335 0.28305 0.21385 0.14985 0.03085 0.11285 0.28475 0.22425 0.28185 0.21165 0.08765 0.11025 0.02155 0.10765 0.17385 0.13785 0.22185 0.28865 0.13195 0.19095 0.07195 0.15655 0.12545 0.18685 0.25615 0.21925 0.16735 0.26615 0.07165 0.16455 0.19675 0.22025 0.21475 0.38155 0.16895 0.28725 0.12735 0.10015 0.14955 0.27605 0.20115 0.32585 0.15255 0.30735 0.19445 0.07865 0.28465 0.32835 0.17885 0.25545 0.26505 0.32445 0.14285 0.02575 0.21055 0.14355 0.21905 0.32935 0.24935 0.21215 0 10685 003265 022855 0 19865 027175 0 30005 0 19895 0 36305 0.07255 0.03295 0.13995 0.15815 0.19645 0.24555 0.27445 0.21235 0.05415 0.03565 0.11995 0.19635 0.16315 0.35345 0.20315 0.19465 0.06345 0.09865 0.11765 0.17875 0.21695 0.35475 0.21445 0.23355 0.05185 0.13795 0.14525 0.24725 0.27425 0.05875 0.23255 0.21845 0.06425 0.15765 0.22765 0.41725 0.12095 0.16445 0.16595 0.37835 0.28155 0.35635 0.10685 0.21025 0.09095 0.18585 0.24675 0.30765 0.10535 0.21915 0.05755 0.15525 0.24785 0.28895 0.10665 0.31845 0 06655 0 17885 025885 027735 0 12265 0 34955 0.13855 0.16675 0.13555 0.27655 0.13115 0.27945Attorney Docket No. 0073605-001205 0.09515 0.12365 0.13005 0.27425 0. 16485 0.08085 0.12715 0.17355 0.18055 0.30405 0. 29455 0.40685 0.10345 0.32675 0.15265 0.38245 0. 46365 0.30065 0 06715 0 19545 023385 0 38315 0 30185 041535 0.04255 0.16235 0.23125 0.30825 0. 29625 0.35065 0.03915 0.11395 0.36005 0.39005 0. 20495 0.16155 0.02055 0.06415 0.23775 0.40505 0. 15775 0.19325 0.03835 0.11665 0.20265 0.38435 0. 17405 0.12785 0.07705 0.15485 0.30985 0.39955 0. 19245 0.15575 0.14565 0.28495 0.32445 0.37765 0. 10065 0.14905 0.10025 0.18285 0.28965 0.48485 0. 04085 0.26405 0.07475 0.10275 0.27345 0.34345 0. 13525 0.21525 0 02035 0 15205 024115 028785 0 17635 0 17815 0.09375 0.10975 0.26545 0.47325 0. 22745 0.26065 0.14445 0.14035 0.28185 0.36845 0. 43755 0.32745 0.19345 0.17925 0.23815 0.33645 0. 35565 0.31455 0.09465 0.32315 0.22755 0.30645 0. 24955 0.28665 0.04795 0.34665 0.19295 0.188050.05635 0.160350.06465 0.171550.02905 0.070350 03145 0 126750.03965 0.139050.10255

[0230] FIG. 5 A includes exemplary data showing concentrations of trimeric SOD1 across healthy controls, Alzheimer’s disease (AD) patients, Parkinson’s disease (PD) patients, and ALS patients. 42 newly collected plasma samples from ALS patients were tested in a direct ELISA using freshly purified, HRP-crosslinked antibody, and results were compared to a titration curve of purified HG-His (see FIG. 5B) from 1 pg / mL to 100 pg / mL to calculate the titer (pg / mL trimer). A significant increase (p < 0.0001) in trimeric SOD1 concentration was observed among ALS patient samples compared to healthy controls. In contrast, the difference in trimeric SOD1 concentration is statistically insignificant between AD / PD patients and the control. Corresponding data are summarized in Tables 6A-D.Table 6A. Concentrations of Trimeric SOD1 of ALS Patients.Average Subtract Background Titer ug / mL 393 Visit 2 2 / 12 / 2025 1.3032 0.9249 1.11405 0.789108 433.2643 394 Visit 2 4 / 30 / 2025 1.18 0.9495 1.06475 0.739808 403.5734Attorney Docket No. 0073605-001205 Visit 2 4 / 22 / 2025 1.153 1.1967 1.17485 0.849908 469.8811 Visit 2 3 / 19 / 2025 1.0672 0.6667 0.86695 0.542008 284.4483 Visit 2 3 / 12 / 2025 0.9032 0.6141 0.75865 0.433708 219.2246 Visit 3, (Sample 1) 3 / 19 / 2025 1 .3248 0.8922 1.1085 0.783558 429.9218 Visit 1 9 / 16 / 2024 1 .1179 0.8323 0.9751 0.650158 349.5817 Visit 1 9 / 16 / 2024 1 .3597 1.1022 1.23095 0.906008 503.6673 Visit 1 9 / 18 / 2024 1 .556 1.2106 1.3833 1.058358 595.4201 Visit 2 2 / 12 / 2025 1 .2812 0.9969 1.13905 0.814108 448.3205 Visit 1 10 / 2 / 2024 1 .3443 1.0971 1.2207 0.895758 497.4943 Visit 2 (Sample 1) 4 / 9 / 2025 1 .1742 0.6981 0.93615 0.611208 326.124 Visit 1 10 / 9 / 2024 1 .4884 1.1469 1.31765 0.992708 555.8824 Visit 1 10 / 16 / 2024 1 .5531 1.2333 1.3932 1.068258 601.3824 Visit 1 10 / 16 / 2024 1 .4826 1.2212 1.3519 1.026958 576.5095 Visit 2 (Sample 1) 2 / 12 / 2025 1 .02 0.7555 0.88775 0.562808 296.9751 Visit 1 2 / 26 / 2025 1 .2883 0.9837 1.136 0.811058 446.4837 Visit 1 11 / 20 / 2024 1 .3435 1.0857 1.2146 0.889658 493.8205 Visit 1 11 / 20 / 2024 1 .1077 0.7897 0.9487 0.623758 333.6823 Visit 1 12 / 2 / 2024 1 .4002 1.094 1.2471 0.922158 513.3937 Visit 1 12 / 4 / 2024 0 .8796 0.5625 0.72105 0.396108 196.58 Visit 1 12 / 4 / 2024 1 .3618 0.9619 1.16185 0.836908 462.0518 Visit 1 12 / 18 / 2024 1 .4294 1.1955 1.31245 0.987508 552.7507 Visit 1 1 / 22 / 2025 1 .4422 1.1902 1.3162 0.991258 555.0091 Visit 1 1 / 22 / 2025 1 .5995 1.159 1.37925 1.054308 592.981 Visit 2 3 / 26 / 2025 1 .5888 1.2648 1.4268 1.101858 621.618 Visit 1 1 / 29 / 2025 1 .1403 0.7881 0.9642 0.639258 343.0171 Visit 1 2 / 5 / 2025 1 .4451 1.1758 1.31045 0.985508 551.5462 Visit 1 3 / 12 / 2025 1 .0477 0.7483 0.898 0.573058 303.1482 Visit 1 3 / 12 / 2025 1 .1823 0.8679 1.0251 0.700158 379.6942 Visit 1 3 / 19 / 2025 1 .6743 1.2797 1.477 1.152058 651.8509 Visit 1 3 / 19 / 2025 1 .445 1.1093 1.27715 0.952208 531.4913 Visit 1 3 / 26 / 2025 1 .0363 0.7382 0.88725 0.562308 296.674 Visit 1 4 / 9 / 2025 1 .3048 0.966 1.1354 0.810458 446.1223 Visit 1 4 / 9 / 2025 1 .3269 1.0926 1.20975 0.884808 490.8996 Visit 1 4 / 9 / 2025 1 .375 1.2879 1.33145 1.006508 564.1934 Visit 1 4 / 21 / 2025 1 .327 1.242 1.2845 0.959558 535.9178 Visit 1 4 / 23 / 2025 1 .0749 0.8457 0.9603 0.635358 340.6684 Visit 1 4 / 30 / 2025 1 .227 1.0966 1.1618 0.836858 462.0217 Visit 1 4 / 30 / 2025 1 .4603 1.2593 1.3598 1.034858 581.2672 Visit 1 4 / 30 / 2025 1 .1957 0.9957 1.0957 0.770758 422.213Attorney Docket No. 0073605-001205 447 Visit 1 4 / 30 / 2025 1.0204 0.833 0.9267 0.601758 320.4328 average 1.286495 451.9333 stdev 0.19177 114.6934 count 42 42 p value <0.0001 <0.0001Table 6B. Concentrations of Trimeric SOD1 of Healthy Controls.Average Subtract Background Titer ug / mL 0.4936 0.168658 59.598280.5072 0.182258 67.788880.49385 0.168908 59.748840.4692 0.144258 44.903380.4435 0.118558 29.425560.47105 0.146108 46.017540.4442 0.119258 29.847130.4598 0.134858 39.242230.48095 0.156008 51.979820.44505 0.120108 30.359040.3914 0.066458 -1.951670.4454 0.120458 30.569830.41485 0.089908 12.171090.50305 0.178108 65.289540.4774 0.152458 49.841830.48105 0.156108 52.040040.4424 0.117458 28.763080.4689 0.143958 44.722710.4594 0.134458 39.001330.47685 0.151908 49.510590.4084 0.083458 8.286580.4482 0.123258 32.256130.40535 0.080408 6.4497180.37425 0.049308 -12.28030.46775 0.142808 44.03012Attorney Docket No. 0073605-001205 0.4545 0.129558 36.050310.4012 0.076258 3.950380.35585 0.030908 -23.36170.39325 0.068308 -0.837510.2209 0.062325 -4.440770.1601 0.001525 -41.05760.1739 0.015325 -32.74650.1138 -0.04478 -68.94170.1499 -0.00867 -47.20050.1707 0.012125 -34.67370.1045 -0.05408 -74.54270.1495 -0.00908 -47.44140.1033 -0.05528 -75.26540.1694 0.010825 -35.45660.1958 0.037225 -19.55720.2215 0.062925 -4.079420.1781 0.019525 -30.21719.70933940.31356Table 6C. Concentrations of Alzheimer’s Disease (AD) Patients.Average Subtract Background Titer ug / mL 0.3831 0.4258 0.40445 0.079508 5.907693 0.4304 0.334 0.3822 0.057258 -7.49237 0.426 0.2991 0.36255 0.037608 -19.3266 0.4517 0.3345 0.3931 0.068158 -0.92784 0.4744 0.3308 0.4026 0.077658 4.79353 0.3261 0.4573 0.3917 0.066758 -1.77099 0.3608 0.3667 0.36375 0.038808 -18.6039 0.4576 0.4 0.4288 0.103858 20.57248 0.4231 0.3711 0.3971 0.072158 1.481156 0.4269 0.3586 0.39275 0.067808 -1.13863Attorney Docket No. 0073605-001205 average 0.066958 -1.65054 stdev 0.018468 11.12253 count 10p value 0.385p value AD PD 0.2329Table 6D. Concentrations of Parkinson’s Disease (PD) Patients.Average Subtract Background Titer ug / mL 0.4864 0.3683 0.42735 0.102408 19.69922 0.4676 0.3174 0.3925 0.067558 -1.28919 0.425 0.2692 0.3471 0.022158 -28.6313 0.4052 0.2724 0.3388 0.013858 -33.630.4682 0.4102 0.4392 0.114258 26.83588 0.4408 0.3851 0.41295 0.088008 11.02682 0.4564 0.3906 0.4235 0.098558 17.38056 0.4165 0.4521 0.4343 0.109358 23.88486 0.409 0.4152 0.4121 0.087158 10.51491 0.4145 0.4804 0.44745 0.122508 31.80444average 0.082583 7.759612 stdev 0.035515 21.38866 count 10p value 0.8841

[0231] Tables 7A-B summarize comparative ELISA results from newly collected ALS patient samples using an antibody with phage attached and a purified antibody without a phage (at a 1 : 10 or 1:100 dilution).FIG. 7A: ELISA Results Based on Newly Collected ALS Patient Samples Using an Antibody with Phage Attached and a Purified Antibody without a Phage (at a 1 : 10 or 1 : 100 Dilution), respectively.Antibody Value Group Phage 0.20465 CtrlPhage 0.1088 CtrlPhage 0.0451 CtrlAttorney Docket No. 0073605-001205 Phage 0.06775 CtrlPhage 0.14595 CtrlPhage 0.11805 CtrlPhage 0.1105 ALSPhage 0.1624 ALSPhage 0.2951 ALSPhage 0.13715 ALSPhage 0.08105 ALSPhage 0.09015 ALSPurified 1:10 0.274 CtrlPurified 1:10 0.1373 CtrlPurified 1:10 0.1849 CtrlPurified 1:10 0.132 CtrlPurified 1:10 0.2084 CtrlPurified 1:10 0.2396 ALSPurified 1:10 0.3573 ALSPurified 1:10 0.3036 ALSPurified 1:10 0.2546 ALSPurified 1:10 0.3649 ALSPurified 1:10 0.2704 ALSPurified 1:10 0.4256 ALSPurified 1:10 0.4358 ALSPurified 1:10 0.3895 ALSPurified 1:10 0.302 ALSPurified 1:10 0.1994 ALSPurified 1:10 0.3006 ALSPurified 1:100 0.0779 CtrlPurified 1:100 0.0694 CtrlPurified 1:100 0.1878 CtrlPurified 1:100 0.0363 CtrlPurified 1:100 0.0231 CtrlPurified 1:100 0.0946 ALSAttorney Docket No. 0073605-001205 Purified 1:100 0.1554 ALSPurified 1:100 0.1771 ALSPurified 1:100 0.1521 ALSPurified 1:100 0.1192 ALSPurified 1:100 0.124 ALSPurified 1:100 0.2307 ALSPurified 1:100 0.2445 ALSPurified 1:100 0.1828 ALSPurified 1 : 100 0.1916 ALSPurified 1:100 0.1531 ALSPurified 1:100 0.1933 ALSTable 7B. Statistical Analysis of Data Presented in Table 7A and FIG. 2D.Average stdev Count p value Phage Ctrl 0.11505 0.051899 6 0.44ALS 0.146058 0.078963 6Pure 1:10 Ctrl 0.18732 0.058151 5 0.003ALS 0.320275 0.07478 12Pure 1:100 Ctrl 0.0789 0.064959 0.005ALS 0.1682 0.044334

[0232] FIG. 6 includes an exemplary an exemplary receiver operating characteristic (ROC) curve illustrating the diagnostic performance of trimeric SOD1 in distinguishing ALS from control samples, with an AUC of 1.00 and an optimal threshold of 196.58 pg / mL based on Youden’s J statistic.

[0233] FIG. 7 shows exemplary results based on native western blot using the purified antibody 9, cell lysate of NSC-34 cells transfected to overexpress nothing (control), dimer (wild-type or WT), or two levels of trimer stabilization (A4V or FH). FH showed a statistically significant increase (p = 0.0204) in native western blot intensity compared to the control.

[0234] FIG. 8 depicts exemplary native western blots showing expression levels of antibody 9 pertaining to the results described in FIG. 7.

[0235] Data Corresponding to FIGS. 7-8 are summarized below in Table 8.Attorney Docket No. 0073605-001205Table 8: Native Western Blot Data Using Purified Antibody 9, Cell Lysate of NSC-34 Cells Transfected to Overexpress Nothing (Ctrl), Dimer (WT), or Two Levels of Trimer Stabilization (A4V or FH).Background 68.829Ctrl 122.634 53.805117.961 49.132145.477 76.648WT 171.736 102.907190.766 121.937171.788 102.959A4V 168.977 100.148196.031 127.202214.881 146.052FH 204.572 135.743235.388 166.559242.613 173.784Average Stdev P value vs WT Ctrl 59.86167 14.72396WT 109.2677 10.972A4V 124.4673 23.07386 0.361FH 158.6953 20.2029 0.0204

[0236] Data summarizing FIGs. 9A, 10A, 10B, and 11 are summarized below.

[0237]

[0238] Methods

[0239] SOD1 Protein Purification

[0240] The His-TEV wild-type (WT) SOD1 plasmid in a pET-28a(+)-TEV backbone was used to perform this step. Point mutations (A4V, F20L-H46Q, H46Q-G108H) were introduced through site-directed mutagenesis using primers from MilliporeSigma. Next, the sequences of the mutated plasmids were confirmed through Genewiz / Azenta. Afterwards, each protein was grown in LB broth at 37 °C, and protein expression was induced with 1 mM IPTG overnight at 18 °C. Subsequently, theAttorney Docket No. 0073605-001205 cells were pelleted by centrifugation at 7,000x g for 30 minutes, resuspended in a buffer containing 20 nM sodium phosphate dibasic, 500 mM NaCl, 20 mM imidazole, 1 mM PMSF, and 1 pM Pepstatin A, and then lysed using probe sonication. Subsequently, the His-tagged SOD1 was purified from the sonicated supernatant using a HisTrap 5-mL column run on the AKTA Pure FPLC instrument. The protein was then eluted using 500 mM imidazole. Afterward, the protein was concentrated using a spin concentrator, and the buffer was changed to 1 x phosphate buffered saline (PBS). Next, the concentrated protein was incubated at 37 °C for 72 hours to aggregate, and the aggregate protein was then passed through a 50-mL S200 size exclusion chromatography (SEC) column. For assays comparing His-trimer to non-His trimer, the His tag was cleaved using TEV protease at a 1 : 100 ratio with respect to total protein. The samples were incubated overnight at 4 °C and passed through an additional SEC column to remove any cleaved His tag. Finally, the WT and A4V fibrils were isolated by incubating the samples at 37 °C for a week and isolating the insoluble fraction therefrom.

[0241] Patient Antibody ELISA

[0242] First, the purified SOD1 protein (WT, FH trimer, HG trimer, WT fibril, or A4V fibril) was diluted to equivalent concentrations, and 50 pL of each solution per well was used to coat the wells on Nunc Maxisorp ELISA plates, which were kept at 4 °C overnight. Afterward, the plates were washed three times with 1 * PBS and incubated with 1% BSA overnight at 4 °C. Next, patient serum or whole blood samples were diluted at a ratio of 1 : 10 in 1 * PBS and added to the blocked plates. The samples were incubated for 3 hours at 37 °C. The plates were washed three times with 1 x PBS, after which an anti-Human HRP secondary antibody was added at a 1: 1,000 ratio in 1% BSA. The plates were incubated overnight at 4 °C. The following day, the plates were washed three times with 1 x PBS and developed for 5 minutes using 100 pL per well of TMB solution. The reaction was terminated by adding 50 pL per well of 2N sulfuric acid. Subsequently, the absorbance at 450 nm was read using the SpectraMax plate reader. To determine the total amount of antibody, a direct ELISA was used with 1:10 diluted patient samples and the same anti-Human HRP secondary antibody. After subtraction of the background ELISA intensity (with no patient sample) from each absorbance reading, the readings were normalized to the total antibody absorbance prior to graphing and statistical analysis using Python.

[0243] Synthetic Antibody Design

[0244] An M13 phagemid phage display human Fab library (2.0 x 109mutants) was used as a starting material. M13K07 helper phage was amplified following the provided protocol. Briefly, theAttorney Docket No. 0073605-001205 helper phage was added to growth-phase XLl-Blue bacteria in 2YT-Tetracycline medium (Bacto tryptone, Bacto yeast extract, NaCl, and 10 pg / mL tetracycline) for 2.5 hours of growth (30 minutes without shaking, 2 hours shaking). Next, kanamycin was added to reach a final concentration of 25 pg / mL, and the culture was incubated overnight at 37 °C with shaking. The following morning, the bacterial mixture was pelleted, and the supernatant containing the helper phage was filtered with a 0.45-pm sterile filter. The phage was titered by growing serial dilutions on agar plates and stored in 50-mL conical tubes with 7% DMSO at -80 °C.

[0245] Similarly, the phage library in growth-phase XLl-Blue bacteria was amplified. After an hour of incubation at 37 °C, ampicillin was added to reach a final concentration of 100 pg / mL. After an additional hour of incubation, the helper phage was added, and the mixture was incubated for two hours (30 minutes without shaking, 1.5 hours shaking). The cells were pelleted by centrifugation, resuspended in a 2YT medium with 100 pg / mL ampicillin, 10 pg / mL tetracycline, and 50 pg / mL kanamycin, and incubated overnight at 30 °C with shaking. The next morning, the bacterial cells were pelleted by centrifugation. The supernatant was combined with 1 / 5 volume of PEG-NaCl buffer (20% PEG 6000, 2.5 M NaCl). The supernatant and buffer were mixed thoroughly and incubated for 1 hour on ice to precipitate the phage. The precipitated phage mixture was then centrifuged at 10,000* g for 25 minutes at 4 °C. The supernatant was discarded, and the pellet was drained and resuspended in 1 mL of 1 * PBS with 1% BSA. Finally, the phage titer was determined before its use for panning.

[0246] Next, the purified dimeric WT, trimeric F20L / H46Q, trimeric H46Q / G108H, insoluble aggregated A4V, and insoluble aggregated WT SOD1 were coated at 10 pg / mL in 1* PBS on an ELISA plate overnight at 4 °C. The following morning, the plate was washed twice with 1 * PBS and blocked with 3% BSA in 1 * PBS for one hour at room temperature. 100 pL of phage library concentrated solution was added to eight dimeric WT-coated wells and allowed to incubate for 2 hours at 37 °C. Afterward, the phage solution was transferred to the A4V insoluble aggregate wells and incubated for 2 hours at 37 °C. Finally, the phage solution was transferred to wells coated with trimeric F20L / H46Q or H46Q / G108H for 2 hours at 37 °C. After discarding the phage solution from the final trimer wells, the wells were washed eight times with 1 * PBS to remove any unbound phage. 100 pL of 0.2 M glycine (pH 2.2) was added into each of the washed wells and incubated for 5 minutes at room temperature to elute the phage. The eluted wells were combined into one tube with 1 M Tris buffer (pH 9) for neutralization. Then the solution was added to 5 mL of log-phase XLl-Blue bacteria and incubated for 30 minutes at 37 °C. The phage library culture was expandedAttorney Docket No. 0073605-001205 following the same methods described above and repeated seven times, as shown in Table 9 below. Library samples and titers were taken after each round of panning.Table 9. A Summary of Seven Rounds of Phage PanningPanning Round Eliminate Bind1 WT His Dimer HG His Trimer2 WT His Dimer FH His Trimer3 WT His Dimer, A4V insoluble fibrils HG His Trimer4 WT His Dimer, A4V insoluble fibrils FH His Trimer5 WT His Dimer, A4V insoluble fibrils HG His Trimer6 WT His Dimer, A4V insoluble fibrils FH His Trimer, HG His Trimer7 WT His Dimer, A4V insoluble fibrils FH His Trimer

[0247] In the seventh round of panning, the culture was plated on 2YT-ampicillin, tetracycline agar plates, and single colonies were inoculated into individual wells of a round-bottom 96-well plate. The colonies were grown overnight at 37 °C and then expanded following the same methods. After expansion, the bacterial cells were pelleted, and the supernatant from each well, which contained the isolated phage, was added to ELISA plates precoated with NSC-34 whole cell lysate, NSC-34 whole cell lysate with overexpressed trimeric SOD1, or purified dimeric WT SOD1. The plates were blocked with 1% BSA, incubated overnight at 4 °C, and washed the next day. An antibody for Ml 3 -phage with an HRP tag was added at a 1 : 1000 ratio in 1% BSA, and the plates were set aside to equilibrate for 1 hour at room temperature. The ELISAs were developed using TMB substrate and sulfuric acid, and the absorbance was measured using the SpectraMax plate reader. Colonies were considered “hits” if they show positive signal (over 0.05 normalized to background signal) for trimer-expressing NSC-34 lysate and no signal for both control NSC-34 lysate and purified dimeric WT. The top eight “hits” were tested in an additional ELISA for WT dimeric, H46Q / G108H trimer, and A4V insoluble aggregated SOD1 at a higher phage concentration in technical triplicates. The top eight “hits” were also tested as the primary antibody on native western blots of NSC-34 lysate with no SOD1 overexpression (C), WT SOD1 overexpression (W), SOD1 mutant A4V overexpression (A), or SOD1 mutant F20L / H46Q overexpression (F). Based on both the ELISA and the western blot, the eight “hits” were narrowed down to three “hits” for further testing. Those “hits” were antibody 4, antibody 9, and antibody 10.Attorney Docket No. 0073605-001205

[0248] Patient Serum ELISA

[0249] Similar to the patient antibody ELISA, patient samples were evaluated for trimeric SOD1 concentration using the newly designed antibodies, with or without an attached bacterial phage. First, patient samples (healthy control, Alzheimer’s disease patient control, stored ALS patient samples, and newly collected ALS patients) were diluted at a 1:10 ratio in 1 * PBS and coated in duplicate on ELISA plates overnight at 4 °C. The following day, the plates were washed three times with 1 * PBS, then blocked for 3 hours at room temperature with 1% BSA. Afterward, the antibody, with or without the phage attached, were added to the plates, and the plates were incubated overnight at 4 °C. The next morning, the plates were washed again three times with 1 x PBS, then the secondary antibody (Ml 3 for bacterial phage, or no secondary for purified HRP -tagged antibody) was added to the plates. The plates were incubated for 1 hour at room temperature. Finally, the plates were washed again and developed for 6 minutes using TMB substrate and sulfuric acid. The plates were read using the SpectraMax plate reader, consistent with details described above. The background signal was subtracted from uncoated wells from all sample wells. Python was used to average the duplicates and perform statistical analysis.

[0250] Antibody Purification and HRP Conjugation

[0251] First, the M13 phage region was removed from the isolated antibody plasmids using digestions at Spel and Nhel (New England Biology) (see FIG. 9A), followed by ligation with T4 ligase and transformation into BL21 bacteria. Then, the antibody was purified using the same methods as the purification of SOD1 described above in this disclosure. Next, a peroxidase was crosslinked to the purified Fab antibody by incubating 1 mg of lyophilized EZ-link activated peroxidase with 1 mg of antibody in 10 mM sodium carbonate buffer for 1 hour. Afterward, 10 pL of sodium borohydride was added to the mixture, which is incubated for 15 minutes at room temperature. The crosslinking reaction was quenched by adding 20 pL of 3 M ethanolamine and incubation for 15 minutes. Finally, the successfully tagged antibody was isolated using SEC.

[0252] Antibody Sequences

[0253] Table 10 summarizes nucleotide sequences discussed in this application. Unique regions of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 are included in the backbone after additional signaling and may correspond to a small fragment for expression.Table 10: Index of Application SequencesSEQ ID NO: Description SequenceAttorney Docket No. 0073605-001205 Sequence of ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgcta Antibody 9 ccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaact ggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttagg ccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgtt accagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaaga cgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcac acagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtg agctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatcc ggtaagcggcagggtcggaacaggagagcgcacgagggagcttccaggggg aaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcg atttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgc ggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgtta tcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgc cgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagc tggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaat gtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgta tgttgtgtggaattgtgagcggataacaattgaattcaggaggaatttaaaatgaag aagacagctatcgcgattgcagtggctctgagggtggcggttccggtggtggct ctggttccggtgattttgattatgaaaagatggcaaacgctaataagggggctatg accgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgatt ctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggcctt gctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaag tcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctcc ctcaatcggttgaatgtcgcccttttgtctttggcgctggtaaaccatatgaattttct attgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgcca cctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaataag ctagctaattaatttaagcggccgcacagctggcgtaatagcgaagaggcccgc accgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcaaattgtaa gcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaa taggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggt tgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacAttorney Docket No. 0073605-001205 gtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatca ccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaa agggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgaga aaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgta gcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctaca gggcgcgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttat ttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgctt caataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattc ccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagta aaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctca acagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagc acttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagag caactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtc acagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgcca taaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggacc gaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatc gttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacg atgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttac tctagcttcccggcaacaattaatagactggatggaggcggataaagttgcagga ccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagcc ggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccc tcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaa atagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagac caagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatcta ggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcc actgagcgtcagaccccgtagaaaagatcaaaggatcttcUnique Region of cattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcg Antibody 9 caacgcaattaatgtgagttagctcactcattaggcaccccaggc Unique Region of aggaggaatttaaaatgaaAntibody 9Unique Region of ttgcagtggctctgagggtAntibody 9Attorney Docket No. 0073605-001205 5 Antibi oti c-resi stant atgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccggg Region (i.e., caagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactc Ampicillin-resistant accagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagt region gctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcg gaggaccgaaggagctaaccgcttttttgcac

[0254] Discussion

[0255] The inability to identify trimeric SOD1 has severely limited the study of ALS convergence. Previous studies have attempted to detect all forms of misfolded SOD1 as a biomarker or target misfolded SOD1 generically as a therapeutic. Researchers have found increased levels of antibodies against misfolded SOD1 in sporadic ALS patient serum, with antibody levels varying depending on disease severity. Additionally, some studies have shown success in slowing disease progression by treating G93A SOD1 mouse models with anti-misfolded SOD1 antibodies or vaccinating these mice with demetallated SOD1 recombinant protein. However, due to inconsistencies in the anti-SODl antibodies used, and the mixed size of demetallated SOD1 aggregates used for immunization, these strategies remain only mildly effective in slowing disease progression in mouse models. Anti-SODl antibodies have potential as both a biomarker for disease progression and as a therapeutic if researchers target the correct conformation of misfolded SOD1.

[0256] We have determined trimeric SOD1 is detected in patient serum samples, and patients develop antibodies against trimeric SOD1, suggesting that trimeric SOD1 is present extracellularly. There is potential evidence that trimeric SOD1 aids in disease spread through its interaction with extracellular vesicles (EVs). Misfolded SOD1 has been identified on the surface of EVs secreted from various ALS cell models (e.g., HEK293, Neuro2a, or NSC-34) or from ALS mouse models. The ability to detect trimeric SOD1 from blood samples makes it increasingly useful as a biomarker assay. Compared to cerebrospinal fluid or muscle biopsy samples, which are commonly used to test for novel ALS biomarkers, blood samples are much easier to collect from patients, which reduces additional discomfort associated with sample collection.

[0257] The patient sample sizes used in these initial studies are scalable. In some embodiments they may be separated by sporadic ALS or familial ALS mutations. These samples may be sourced from the Northeast ALS Consortium. In the initial sample set of 12 patients, a potential bimodal distribution in the violin plot is observed, which may result from different genetic groups within theAttorney Docket No. 0073605-001205 sample set. Longitudinal samples may also be obtained to further evaluate if the new antibody may be used as a monitoring biomarker to track disease progression and quantify whether new therapeutics are having an effect.

[0258] The original sample set contained 87 ALS patients collected at 3-5 different time points across disease progression, totaling over 300 samples. These samples were collected from 2014 to 2020 but were stored incorrectly, leading to multiple freeze / thaw cycles. Although these older samples are used for the first assay in the study, since the antibodies therein were very stable, the trimeric SOD1 had degraded, resulting in a much lower signal compared to samples collected during a later four month period (FIG. 4). The first assay in this study required large amounts of purified SOD1 trimer, which is difficult to obtain in large quantities. Each batch of purified SOD1 was left to aggregate for up to a week, and only the trimeric fraction was collected. This process required multiple purification steps, which drastically reduces the yield. Since concentration can also affect aggregation kinetics, scaling up this production step proved challenging.

[0259] In addition to scaling up the sample set, the DNA sequence for antibody 9 was obtained. The direct binding between the antibody and trimeric SOD1 may be quantified and compared to dimeric SOD1 using surface plasmon resonance (Open-SPR). The structure of trimeric SOD1 may be solved by utilizing the antibody 9-trimer complex. Trimeric SOD1 alone is below the recommended size threshold (60 kDa) for Cryo-EM de novo structure solving, but binding the antibody to trimeric SOD1 may create an antibody -trimeric SOD1 complex with a molecular weight of nearly 100 kDa, which is well above the recommended size threshold. Provided that the binding site for the antibody is determined, a peptide of that region may be synthesized and used to create a concentration curve for the biomarker assay, thereby eliminating the need to purify large amounts of SOD1 trimer or to determine a broader range of absorbance values that may indicate that a patient has ALS. Such a concentration curve may help determine a specific titer cutoff and quantify the titer for each patient in order to reliably identify whether or not they have ALS. This new antibody may provide additional insights regarding the pathology of ALS and holds potential as a new therapeutic.

[0260] The foregoing has been a detailed description of illustrative embodiments of the invention. Various modifications and additions can be made without departing from the spirit and scope of this invention. Features of each of the various embodiments described above may be combined with features of other described embodiments as appropriate in order to provide a multiplicity of feature combinations in associated new embodiments. Furthermore, while the foregoing describes a number of separate embodiments, what has been described herein is merelyAttorney Docket No. 0073605-001205 illustrative of the application of the principles of the present invention. Additionally, although particular methods herein may be illustrated and / or described as being performed in a specific order, the ordering is highly variable within ordinary skill to achieve methods, systems, and software according to the present disclosure. Accordingly, this description is meant to be taken only by way of example, and not to otherwise limit the scope of this invention.

[0261] Exemplary embodiments have been disclosed above and illustrated in the accompanying drawings. It will be understood by those skilled in the art that various changes, omissions and additions may be made to that which is specifically disclosed herein without departing from the spirit and scope of the present invention.

[0262] The following list of documents may be of interest when reviewing this disclosure. Inclusion of any document is not an admission that the document is prior art or otherwise material to patentability of any of the claims.1. Redler, R. L. & Dokholyan, N. V. The Complex Molecular Biology of Amyotrophic Lateral Sclerosis (ALS). in Progress in Molecular Biology and Translational Science vol. 107215-262 (Elsevier, 2012).2. Choi, E. S. & Dokholyan, N. V. SOD1 oligomers in amyotrophic lateral sclerosis. Curr. Opin. Struct. Biol. 66, 225-230 (2021).3. Mathis, S., Beauvais, D., Duval, F., Sole, G. & Le Masson, G. The various forms of hereditary motor neuron disorders and their historical descriptions. J. Neurol. 271, 3978-3990 (2024).4. Swinnen, B. & Robberecht, W. The phenotypic variability of amyotrophic lateral sclerosis. Nat. Rev. Neurol. 10, 661-670 (2014).5. Turner, M. R. et al. Controversies and priorities in amyotrophic lateral sclerosis. Lancet Neurol. 12, 310-322 (2013).6. Staats, K. A., Borchelt, D. R., Tansey, M. G. & Wymer, I. Blood-based biomarkers of inflammation in amyotrophic lateral sclerosis. Mol. Neurodegener. 17, 11 (2022).7. Katzeff, J. S. et al. Biomarker discovery and development for frontotemporal dementia and amyotrophic lateral sclerosis. Brain 145, 1598-1609 (2022).8. Shefner, J. M. et al. A proposal for new diagnostic criteria for ALS. Clin. Neurophysiol. 131, 1975-1978 (2020).Attorney Docket No. 0073605-001205 9. De Carvalho, M. et al. Electrodiagnostic criteria for diagnosis of ALS. Clin. Neurophysiol.119, 497-503 (2008).10. Brooks, B. R. El escorial World Federation of Neurology criteria for the diagnosis of amyotrophic lateral sclerosis. J. Neurol. Sci. 124, 96-107 (1994).11. Goutman, S. A. et al. Recent advances in the diagnosis and prognosis of amyotrophic lateral sclerosis. Lancet Neurol. 21, 480-493 (2022).12. Nguyen, P. H. et al. Amyloid Oligomers: A Joint Experimental / Computational Perspective on Alzheimer’s Disease, Parkinson’s Disease, Type II Diabetes, and Amyotrophic Lateral Sclerosis. Chem. Rev. 121, 2545-2647 (2021).13. Rosen, D. R. et al. Mutations in Cu / Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59-62 (1993).14. Khare, S. D., Caplow, M. & Dokholyan, N. V. The rate and equilibrium constants for a multistep reaction sequence for the aggregation of superoxide dismutase in amyotrophic lateral sclerosis. Proc. Natl. Acad. Sci. 101, 15094-15099 (2004).15. Gurney, M. E. et al. Motor Neuron Degeneration in Mice that Express a Human Cu,Zn Superoxide Dismutase Mutation. Science 264, 1772-1775 (1994).16. Reaume, Andrew. G. et al. Motor neurons in Cu / Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nat. Genet. 13, 43-47 (1996).17. Zeineddine, R. et al. SOD1 protein aggregates stimulate macropinocytosis in neurons to facilitate their propagation. Mol. Neurodegener. 10, 57 (2015).18. Jeon, G. S. et al. Pathological Modification of TDP-43 in Amyotrophic Lateral Sclerosis with SOD1 Mutations. Mol. Neurobiol. 56, 2007-2021 (2019).19. Pare, B. et al. Misfolded SOD1 pathology in sporadic Amyotrophic Lateral Sclerosis. Sci. Rep. 8, 14223 (2018).20. Forsberg, K. et al. Novel Antibodies Reveal Inclusions Containing Non-Native SOD1 in Sporadic ALS Patients. PLoS ONE 5, el 1552 (2010).21. Redler, R. L. et al. Glutathionylation at Cys-111 Induces Dissociation of Wild Type and FALS Mutant SOD1 Dimers. Biochemistry 50, 7057-7066 (2011).22. Banks, C. J. & Andersen, J. L. Mechanisms of SOD1 regulation by post-translational modifications. Redox Biol. 26, 101270 (2019).23. Wilcox, K. C. et al. Modifications of Superoxide Dismutase (SOD1) in Human Erythrocytes. J. Biol. Chem. 284, 13940-13947 (2009).Attorney Docket No. 0073605-001205 24. Khare, S. D. & Dokholyan, N. V. Common dynamical signatures of familial amyotrophic lateral sclerosis-associated structurally diverse Cu, Zn superoxide dismutase mutants. Proc. Natl. Acad. Sci. 103, 3147-3152 (2006).25. Xu, W.-C. et al. Pathological hydrogen peroxide triggers the fibrillization of wild-type SOD1 via sulfenic acid modification of Cy s- 111. Cell Death Dis. 9, 67 (2018).26. Sutedja, N. A. et al. Exposure to chemicals and metals and risk of amyotrophic lateral sclerosis: A systematic review. Amyotroph. Lateral Scler. 10, 302-309 (2009).27. Proctor, E. A., Mowrey, D. D. & Dokholyan, N. V. P-Methylamino-L-alanine substitution of serine in SOD1 suggests a direct role in ALS etiology. PLOS Comput. Biol. 15, el 007225 (2019).28. Atlasi, R. S. et al. Investigation of Anti-SODl Antibodies Yields New Structural Insight into SOD1 Misfolding and Surprising Behavior of the Antibodies Themselves. ACS Chem. Biol. 13, 2794-2807 (2018).29. Rotunno, M. S. & Bosco, D. A. An emerging role for misfolded wild-type SOD1 in sporadic ALS pathogenesis. Front. Cell. Neurosci. 7, (2013).30. Pokrishevsky, E., Grad, L. I. & Cashman, N. R. TDP-43 or FUS-induced misfolded human wild-type SOD1 can propagate intercellularly in a prion -like fashion. Sci. Rep. 6, 22155 (2016). 31. Grad, L. I. et al. Intermol ecular transmission of superoxide dismutase 1 misfolding in living cells. Proc. Natl. Acad. Sci. 108, 16398-16403 (2011).32. Da Cruz, S. et al. Misfolded SOD1 is not a primary component of sporadic ALS. Acta Neuropathol. (Berl.) 134, 97-111 (2017).33. Liu, H.-N. et al. Lack of evidence of monomer / misfolded superoxide dismutase-1 in sporadic amyotrophic lateral sclerosis. Ann. Neurol. 66, 75-80 (2009).34. Redler, R. L., Fee, L., Fay, J. M., Caplow, M. & Dokholyan, N. V. Non-native Soluble Oligomers of Cu / Zn Superoxide Dismutase (SOD1) Contain a Conformational Epitope Linked to Cytotoxicity in Amyotrophic Lateral Sclerosis (ALS). Biochemistry 53, 2423-2432 (2014).35. Proctor, E. A. et al. Nonnative SOD1 trimer is toxic to motor neurons in a model of amyotrophic lateral sclerosis. Proc. Natl. Acad. Sci. 113, 614-619 (2016).36. Zhu, C., Beck, M. V., Griffith, J. D., Deshmukh, M. & Dokholyan, N. V. Large SOD1 aggregates, unlike trimeric SOD1, do not impact cell viability in a model of amyotrophic lateral sclerosis. Proc. Natl. Acad. Sci. 115, 4661-4665 (2018).37. Hnath, B. & Dokholyan, N. V. Toxic SOD1 trimers are off-pathway in the formation of amyloid-like fibrils in ALS. Biophys. J. S0006349522003654 (2022).Attorney Docket No. 0073605-001205 38. Cedarbaum, J. M. et al. The ALSFRS-R: a revised ALS functional rating scale that incorporates assessments of respiratory function. J. Neurol. Sci. 169, 13-21 (1999).39. Vijayakumar, U. G. et al. A Systematic Review of Suggested Molecular Strata, Biomarkers and Their Tissue Sources in ALS. Front. Neurol. 10, 400 (2019).40. Shefner, J. M. et al. Amyotrophic Lateral Sclerosis Clinical Trials and Interpretation of Functional End Points and Fluid Biomarkers: A Review. JAMA Neurol. 79, 1312 (2022).41. Vu, L. T. & Bowser, R. Fluid-Based Biomarkers for Amyotrophic Lateral Sclerosis.Neurotherapeutics 14, 119-134 (2017).42. Shahim, P. et al. Neurofdaments in Sporadic and Familial Amyotrophic Lateral Sclerosis: A Systematic Review and Meta-Analysis. Genes 15, 496 (2024).43. van Blitterswijk, M. et al. Anti-superoxide dismutase antibodies are associated with survival in patients with sporadic amyotrophic lateral sclerosis. Amyotroph. Lateral Scler. 12, 430-438 (2011).44. Gomes, C., Keller, S., Altevogt, P. & Costa, J. Evidence for secretion of Cu,Zn superoxide dismutase via exosomes from a cell model of amyotrophic lateral sclerosis. Neurosci. Lett. 428, 43-46 (2007).45. Grad, L. I. et al. Intercellular propagated misfolding of wild-type Cu / Zn superoxide dismutase occurs via exosome-dependent and -independent mechanisms. Proc. Natl. Acad. Sci. Ill, 3620-3625 (2014).46. Urushitani, M. et al. Chromogranin-mediated secretion of mutant superoxide dismutase proteins linked to amyotrophic lateral sclerosis. Nat. Neurosci. 9, 108-118 (2006).47. Hnath, B. & Dokholyan, N. V. Novel extracellular vesicle release pathway facilitated by toxic superoxide dismutase 1 oligomers. BioRxiv (2025).48. Silverman, J. M. et al. CNS-derived extracellular vesicles from superoxide dismutase 1 (SOD1)G93A ALS mice originate from astrocytes and neurons and carry misfolded SOD1. J. Biol. Chem. 294, 3744-3759 (2019).49. Bums, R. Immunochemical Protocols: Third Edition. (Humana Press, Totowa, NJ, 2005). doi:10.1385 / 1592598730.50. Keon, M. et al. Destination Amyotrophic Lateral Sclerosis. Front. Neurol. 12, (2021).

Claims

Attorney Docket No. 0073605-001205CLAIMS1. A method for screening a subject in need thereof for amyotrophic lateral sclerosis (ALS), comprising:measuring a level of at least a biomarker in the subject, wherein the at least a biomarker comprises trimeric superoxide dismutase 1 (SOD1); anddetermining an ALS status indicator as a function of the measurement.

2. The method of claim 1, wherein determining the ALS status indicator comprises tracking a progression of ALS in the subject as a function of the measurement.

3. The method of claim 1, wherein measuring the level of the at least a biomarker comprises measuring the level of the at least a biomarker using a blood test.

4. The method of claim 1, wherein measuring the level of the at least a biomarker comprises detecting a level of trimeric SOD1 using a synthetic antibody, wherein the synthetic antibody selectively binds trimeric SOD1.

5. The method of claim 1, wherein measuring the level of the at least a biomarker comprises measuring the level of the at least a biomarker through a biomarker assay.

6. The method of claim 5, wherein the biomarker assay comprises an enzyme-linked immunosorbent assay (ELISA).

7. A synthetic antibody for diagnosis of ALS, wherein at least a functional fragment of the synthetic antibody has a specific binding affinity towards trimeric SOD1.

8. The synthetic antibody of claim 7, wherein the synthetic antibody is expressed by genetically modified BL21 cells.

9. A biomarker assay for diagnosis of ALS, wherein the biomarker assay is configured to detect a presence of trimeric SOD1 using the synthetic antibody of claim 7.Attorney Docket No. 0073605-001205 10. The biomarker assay of claim 9, wherein the biomarker assay comprises an ELISA.

11. The biomarker assay of claim 9, wherein the synthetic antibody is conjugated with a horseradish peroxidase (HRP) tag.

12. A medical kit for diagnosis of ALS, wherein the medical kit comprises:at least a biomarker assay comprising the synthetic antibody of claim 7; andat least an instruction for using the at least a biomarker assay.

13. The medical kit of claim 12, wherein the biomarker assay comprises an ELISA.

14. The medical kit of claim 12, wherein the synthetic antibody is conjugated with an HRP tag.

15. A use of the synthetic antibody of claim 7 for diagnosis of ALS.

16. The use of the synthetic antibody of claim 15, wherein the synthetic antibody is conjugated with an HRP tag.

17. A method for treating ALS in a subject in need thereof, wherein the method comprises: measuring a level of at least a biomarker in the subject, wherein the at least a biomarker comprises trimeric SOD1;determining an ALS status indicator as a function of the measurement; andwhere the ALS status indicator indicates the subject is in need of treatment for ALS, treating the subject to slow the progression of ALS as a function of the ALS status indicator.

18. The method according to claim 17, wherein measuring the level of the at least a biomarker comprises detecting a level of trimeric SOD1 using a synthetic antibody.

19. The method according to claim 17, wherein the treating step alleviates symptoms of ALS.

20. The method according to claim 17, wherein the treating step delays onset of ALS.Attorney Docket No. 0073605-001205 21. A method for screening a subject in need thereof for amyotrophic lateral sclerosis (ALS), wherein the method comprises:measuring a level of at least a biomarker in the subject, wherein:the at least a biomarker comprises trimeric superoxide dismutase 1 (SOD1); and measuring the level of the at least a biomarker comprises measuring the at least a biomarker using a synthetic antibody comprising a means for selectively binding to trimeric SOD1; anddetermining an ALS status indicator as a function of the measurement.

22. The method of claim 21, wherein selective binding to trimeric SOD1 is indicative of a subject’s status as having at least ALS and a predisposition to have ALS.

23. A method for slowing a progression of ALS in a subject in need thereof, wherein the method comprises:measuring a level of at least a biomarker in the subject, wherein:the at least a biomarker comprises trimeric superoxide dismutase 1 (SOD1); and measuring the level of the at least a biomarker comprises measuring the at least a biomarker using a synthetic antibody comprising a means for selectively binding to trimeric SOD1;determining an ALS status indicator as a function of the measurement; andproviding a treatment to slow the progression of ALS as a function of the ALS status indicator, where the status indicator indicates the presence of ALS in the subject.

24. A method for screening a subject in need thereof for amyotrophic lateral sclerosis (ALS), comprising:measuring a level of a biomarker in the subject, wherein the biomarker comprises trimeric superoxide dismutase 1 (SOD1);wherein the level of the biomarker is determined using an antibody specific for trimeric SOD1,wherein the antibody was identified by screening a phagemid synthetic human Fab antibody library for candidate antibodies that specifically bind to trimeric SOD1; andAttorney Docket No. 0073605-001205 determining an ALS status indicator as a function of the measurement.

25. The method of claim 24, wherein candidate antibodies specifically bind to trimeric SOD1 relative to dimeric SOD1, and optionally relative to SOD1 aggregates.

26. The method of claim 24 or 25, wherein the trimeric SOD1 is selected from the group consisting of FH stabilized SOD1 trimer and HG stabilized SOD1 trimer.

Images