Canine adenovirus assembly methods

Abstract

Methods for the modular assembly of canine adenovirus (CAV) genomes, referred to as CAVSLIC and CAVsembly, are described. The modular assembly platform allows a CAV genome to be split into functional modular plasmid units that can be engineered and systematically and rapidly assembled in different combinations. The modular units are assembled using multi-site recombination or a seamless cloning method to create synthetic CAV vectors or fully replication-competent virus that can be produced to high titers for gene therapy, oncolytic therapy and vaccine applications.

Description

[0001] 7158-101791-02

[0002] CANINE ADENOVIRUS ASSEMBLY METHODS CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Application No. 63 / 779,125, filed March 27, 2025, which is herein incorporated by reference in its entirety.

[0004] FIELD

[0005] This disclosure concerns a modular assembly platform for canine adenovirus (CAV) that allows for the assembly of recombinant CAV genomes in a scalable, high-throughput, single recombination reaction and / or precision scarless assembly of recombinant CAV genomes in no more than three steps.

[0006] INCORPORATION OF ELECTRONIC SEQUENCE LISTING

[0007] The electronic sequence listing, submitted herewith as an XML file named 1017 1-02. xml (753,534 bytes), created on March 16, 2026, is herein incorporated by reference in its entirety.

[0008] BACKGROUND

[0009] Adenoviruses are non-enveloped (80-100 nm) viruses that possess a double-stranded DNA genome encased in a protein capsid. Adenoviruses have evolved and adapted to infect humans, monkeys, dogs, mice, chickens, snakes, and pigs. However, the understanding of adenovirus biology is almost exclusively based upon and extrapolated from studies with human subgroup C adenovirus, particularly adenovirus type 5 (Ad5). A need exists for tools and methods that enable the study and engineering of adenoviruses from other species, such as canine adenoviruses (FIG. 4), which significantly diverge from human adenoviruses and by comparison are poorly characterized and lack tools to engineer them systematically.

[0010] Canine adenovirus genomes present a challenge for genetic manipulation due to their large size (—32 kb) and complex genome organization. Traditional methods for modifying the genome rely on inefficient homologous recombination or other cumbersome molecular cloning approaches. These approaches lack scalability and throughput, making it difficult to generate large libraries of viral variants for studying CAV replication and gene functions, and their application in research, gene therapy, vaccine and oncolytic virus development.

[0011] SUMMARY

[0012] The present disclosure provides a flexible modular' plasmid assembly system for constructing and engineering recombinant canine adenovirus (CAV) genomes in a combinatorial and systematic platform through assembly of four genomic plasmid modules (FIG. 1) that can be individually modified and then assembled together for scalable high-throughput and precision scarless engineering of CAV-based vectors, viruses, vaccines, and therapeutics. This system utilizes seamless sequence-independent cloning7158-101791-02

[0013] and / or Gateway cloning for the assembly of replication-competent or replication-incompetent CAV vectors. The modular assembly of functional genomic plasmid libraries allows for genetic manipulation and the creation of customized CAV-based vectors, such as for vaccination, gene therapy, and oncolytic virus therapeutic applications. The assembly system provides flexibility in designing replication-competent or incompetent viruses, incorporating genetic deletions, insertions, or mutations to enhance viral safety, expression efficiency, and host specificity.

[0014] Described herein is a modular genome assembly platform that enables canine adenovirus (CAV) to be split into genomic modular plasmid units that can be engineered, customized and efficiently assembled with each other in different combinations to create recombinant CAV genomes. The modular genome plasmid units can be assembled using multi-site recombination (“CAVsembly”) and / or a seamless cloning method (“CAVSLIC”) to create recombinant CAV genomes that can be transfected into and produced in canine cells to high titers.

[0015] Provided herein are methods of generating a recombinant CAV genome. In some aspects, the method includes assembling a nucleic acid molecule from four CAV plasmid modules, wherein each plasmid module corresponds to a portion of the CAV genome, and wherein the four CAV plasmid modules include: a CAV El plasmid module including CAV genome sequence from the left inverted terminal repeat (ITR) to non-coding sequence located between the E1B-55K open reading frame (ORF) and the pIX ORF; a CAV core plasmid module including CAV genome sequence from non-coding sequence prior to the pIX ORF to non-coding sequence immediately prior to the pVIII ORF; a CAV E3 plasmid module including CAV genome sequence from the non-coding sequence prior to the pVIII ORF to non-coding sequence following the fiber ORF; and a CAV E4 plasmid module including CAV genome sequence from the non-coding sequence following the fiber ORF to the right ITR. Also provided are recombinant CAV genomes produced by the methods disclosed herein. Further provided are recombinant CAVs that include a recombinant CAV genome produced according to the method disclosed herein.

[0016] Also provided are libraries that include at least one or a plurality of different CAV El plasmid modules, at least one or a plurality of different CAV core plasmid modules, at least one or a plurality of different CAV E3 plasmid modules, at least one or a plurality of different CAV E4 plasmid modules, or any combination thereof. In some aspects, tire CAV El plasmid modules include CAV genome sequence from tire left ITR to non-coding sequence located between the E1B-55K ORF and the pIX ORF; the CAV core plasmid modules include CAV genome sequence from non-coding sequence prior to the pIX ORF to non-coding sequence immediately prior to the pVIII ORF; tire CAV E3 plasmid modules include CAV genome sequence from the non-coding sequence prior to tire pVIII ORF to non-coding sequence following the fiber ORF; and / or tire CAV E4 plasmid modules include CAV genome sequence from the non-coding sequence following the fiber ORF to the right ITR.7158-101791-02

[0017] The foregoing and other features of this disclosure will become more apparent from the following detailed description of several aspects which proceeds with reference to the accompanying figures.

[0018] BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1: Schematic depiction of CAVsembly and CAVSLIC, which enable the combinatorial assembly of recombinant CAV genomes from libraries of modular El, core, E3 and E4 plasmids that can be individually modified and then assembled together for scalable high-throughput as well as precision scarless engineering of CAV-based vectors, viruses, vaccines, and therapeutics.

[0019] FIG. 2: ClustalW alignment and phylogenetic tree comparing nucleic acid sequences between canine adenovirus 1 (CAV1), canine adenovirus 2 (CAV2), several human adenovirus members, including the most extensively studied human Ad5, and other animal adenoviruses. CAV2 is most similar to CAV1, with the next closest species being bat and skunk adenoviruses.

[0020] FIG.3: Genomic map of the human Ad5 (hAd5) reference genome. The hAd5 genes and transcriptional units are annotated. hAd5 is the most extensively studied member of the adenovirus family and provides a general model for the genes, structure, transcription and functions of the Adenoviridae.

[0021] FIG. 4: Genome map of the CAV2 Toronto A26 / 61 strain reference genome, which is 31,232 base pairs in length. The nomenclature of protein coding genes follows the accepted schema of transcriptional units, and genes therein, of Adenoviridae, the subgroup C hAd genes and the CAV GENBANK annotation.

[0022] FIGS. 5A-5B: (FIG. 5A) Nucleotide sequence comparison of CAV1 , CAV2, and hAd5, with CAV2 used as the reference sequence. There is significant divergence between the nucleotide sequence of hAd5 and CAV1 / CAV2. In contrast, CAV1 and CAV2 have highly similar nucleotide sequences and predicted genes. The most notable difference between CAV1 and CAV2 is that CAV1 has a deletion in the E3 region, which corresponds to E3-ORF2. (FIG. 5B) Nucleotide sequence comparison of CAV1, CAV2, and bat adenovirus, with CAV2 used as the reference sequence. CAV1 and bat adenoviruses have high homology to CAV2, including at genomic junctions chosen to split genomes for CAVSLIC / CAVsembly genomic module plasmids.

[0023] FIG. 6: Schematic comparing hAd5 (top) and CAV2 (bottom) genome organization. Despite their sequence divergence and differences, the major early (E), intermediate and late (L) transcriptional units and their 5’ to 3’ genomic order is conserved between adenoviruses across species. The El and E4 early genes are on tire left and right ends, respectively (flanked by ITRs). The early / intermediate genes are between the El genes and tlie ‘core’ central unit that comprises the Tate' capsid structure and assembly genes (on the positive strand) and early E2 DNA replication genes (on the negative strand). The highly variable and divergent E3 encoded genes are not shared between CAV and hAd5, but the E37158-101791-02

[0024] encoded genes are still flanked by the late pVIII gene on the left and the late fiber gene / U exon on the right.

[0025] FIG.7: Schematic showing CAV genome organization (top) and CAVsembly / SLIC genome modules (bottom). Based on the conserved transcriptional and genome organization of CAV1 / CAV2, the CAV genome was split into four genomic modular parts (El, core, E3 and E4), which were cloned into plasmids to facilitate their genetic engineering and creation of variant libraries for systematic assembly. The four CAVsembly / CAVSLIC functional genomic modules allow for manipulation to confer new and engineered properties, can be assembled together to confer wild type virus as well as emergent properties, and are compatible with exchange of genomic modules in adenoviruses across species, including hAd5.

[0026] FIG.8: Schematic of the CAV El genome module, which spans from the left-hand ITR through the El genes and the TATA box for pIX. The E1A and E1B gene products encoded within this module are essential for viral replication. These genes can be deleted for the assembly and production of recombinant non-replicating CAV vectors.

[0027] FIG.9: Schematic of the CAV core genome module, which includes tire early / intermediate genes, pIX and IV A2; and the major late promoter (MLP) transcriptional unit that drives the expression of CAV capsid and late proteins, including 52 / 55k, pllla, penton, pVII, pV, pX, pVI, hexon, endoproteinase, 100k, 22k, and 33k (putative 22k / 33k) on the positive strand. On the negative strand, the E2 transcriptional unit drives the expression of the viral DNA replication proteins, including E2A DBP, pTP (terminal protein) and E2B DNA polymerase.

[0028] FIG. 10: Schematic of the CAV E3 genome module. This genomic module includes the MLP transcribed late protein pVIII and the E3 protein coding genes (E3-ORF1 , E3-ORF2 and fiber) on the positive strand, and the U exon on the negative strand. The E3 encoded ORFs are highly variable among adenoviruses.

[0029] FIG. 11: Schematic of the CAV E4 genome module, which includes the right ITR and the E4 transcriptional unit and protein coding genes on the negative strand. In human adenoviruses, the E4 genes play important functions in usurping host cell signaling pathways and function to facilitate viral replication. In CAV, there are five predicted and annotated ORFs, which include from right to left, E4-ORF1, E4-ORF2, E4-ORF3, E4-ORF4 and E4-ORF5.

[0030] FIG. 12: Schematic of CAVsembly, a ‘Multisite Gateway’ based genome assembly method. The CAV core module is cloned into a plasmid with ampicillin resistance and made into a Gatewaycompatible destination (DEST) plasmid whereby tire CAV core genome module is flanked on tire left and / or right with multisite Gateway cassettes that have site-specific recombination sequences (att sites) and ccdB counterselection cassettes. The El, E3, and E4 genome modules are cloned into specialized Multisite Gateway compatible entry plasmids that can be combined with, for example, a “dual-DEST” core module in a standard Multisite Gateway LR reaction. The resultant reaction contains fully assembled CAV genomes. Assembled CAV genomes can then be transformed into bacteria and correct7158-101791-02

[0031] assemblies selected by virtue of ampicillin resistance and successful recombination and replacement of ccdB with CAV genome modules. The virus genome can also be transfected into canine cells as only correctly assembled CAV genomes are replication-competent.

[0032] FIG. 13: Schematic of CAVSLIC, a parallel assembly method of CAV genome module plasmids that uses scarless and sequence and ligation independent cloning (SLIC) based assembly of El, E3 and E4 modules to create a complete CAV genome in two (as shown in this example) or three steps. The CAV core genome module plasmid is engineered to have unique restriction sites engineered at the left and right hand sides. The core module is linearized by restriction enzyme digestion and assembled with a PCR linearized E3 and E4 module (in this example) via SLIC / Gibson, generating a macromodule plasmid. Following transformation and selection of core-E3-E4 macromodule plasmids, the El module is added by linearizing it with restriction enzyme digestion and then adding an El module using PCR and then assembly via Gibson / SLIC. This generates fully assembled viral genomes.

[0033] FIG. 14: Illustration of att site placements identified and tested previously in modular assembly of hAd5 genomes using Adsembly. Three different El-core att site junction placements and breakpoints were tested, one core-E3 att placement and two E3-E4 att site placement designs. At El-core and E3-E4 junctions, some att site placements impaired viral functions and packaging, such as for example El -core placements ‘2’ and ‘3’ between IX and IV A2 relative to placement ‘1’ and E3-E4 placement ‘1’ immediately after fiber stop compared to placement ‘2’, indicating that the placement of att site sequences in assembled genomes and breakpoints between modules is important so as to not disrupt recombinant assembled virus functions.

[0034] FIGS. 15A-15B: (FIG. 15A) Ad5 Att site placements at non-coding sequences between pIX and IVA2 (from FIG. 14) and annotated regulatory motifs. (FIG. 15B) CAV2 non-coding sequences between pIX and IV A2 significantly diverge from those in Ad5 and sequence space is much more compact and compressed in CAV2.

[0035] FIG. 16: Alignment of Ad5 and CAV2 sequences at the E1B-55K and pIX junction. There is significant sequence divergence between Ad5 and CAV non-coding sequences. However, a conserved TATA box promoter motif was identified and predicted as well as a Kozak consensus motif at the pIX start codon. The Kozak conserved motif was chosen for the placement of att site and the TATA box motif for engineering a unique restriction site and designing El and core module overlaps for Gibson assembly of core module plasmids with El plasmids (FIG. 19).

[0036] FIG. 17: Schematic showing attR4 site placement at Kozak ATG motif of protein IX in the core module.

[0037] FIG. 18: Illustration of the considerations involved in selecting unique restriction sites that could be used for scarless assembly of a core plasmid module with an El module.

[0038] FIGS. 19A-19B: (FIG. 19A) Illustration of the considerations involved in design of an El -core junction breakpoint and engineering of a unique restriction site for scarless assembly of a core plasmid module with an El module. Overlapping sequences in El and core plasmid modules facilitate assembly7158-101791-02

[0039] in SLIC / Gibson reactions. The TAA sequence in the conserved TATA box are used as half of a Pact site with the remainder (FIG. 19B) cloned into the core plasmid module.

[0040] FIG.20: Illustration of the considerations involved in design and placement of att site sequences in noncoding sequences at die junction between the core module and pVIII in the E3 module. Hie top panel shows a sequence alignment of CAV2 and Ad5. There is very little sequence homology between CAV2 and Ad5 and die CAV222K / 33k proteins are putative and not annotated in reference sequence. However, conserved potential splicing regulatory sequence motifs were predicted. The bottom panel shows die site chosen for placement of an attR5 sequence after a predicted conserved GCA post-transcriptional motif and before die pVIII start codon.

[0041] FIG.21: Illustration of the considerations involved in selecting a core-E3 breakpoint and engineering of a unique restriction site at putative 33k and pVIII non-coding junction. Bglll was chosen for scailess assembly of a core plasmid module with an E3 module, but other common restriction enzymes could also be used, some of examples of which are shown in the figure.

[0042] FIG.22: Schematic showing the engineering of a unique Bglll restriction enzyme site in a core module for scarless assembly with E3 modules. The E3 forward primer for PCR linearization of an E3 module plasmid is also shown (top panel). The bottom panel shows an alignment of the core module plasmid, Gibson assembled CAV genome PCMN-1313 and wildtype CAV plasmid PCMN-1312. The engineered Bglll site is absent from the scarless assembled whole genome plasmid, PCMN-1313, which is identical to PCMN-1312 (wildtype CAV2).

[0043] FIG.23: Schematic showing Ad5 non-coding sequences and annotated regulatory motifs at the junction between the fiber and E4-ORF6 / 7 coding sequences. Sites of previously tested Adsembly att site placements in Ad5 (box) are indicated. Att site VI placement after the fiber stop codon negatively impacted assembled Ad5 replication when compared to att site V2 placement before the overlapping fiber / E4 poly A motifs.

[0044] FIG.24: Schematic showing CAV2 non-coding sequences and predicted hypothetical regulatory motifs at the junction between fiber and E4-ORF5 coding sequences. An att site insertion was engineered, as indicated in figure, so as not to disrupt computationally predicted E4-ORF1-5 and fiber gene polyA sequence motifs and optimal spacing for RNA processing and translation.

[0045] FIG.25: Schematic showing an alternative att site placement at Fiber-E4 non-coding junction, that would not disrupt coding sequence of an unannotated but hypothetical alternatively spliced CAV computationally predicted homolog of hAd5 E4-ORF6 / 7.

[0046] FIG.26: Schematic showing the design of a Bglll restriction site at breakpoint designed between E3 and E4 modules and overlapping primers (E4 forward, E3 reverse) for scailess reassembly of E3-fiber and E4 plasmid genomic modules.

[0047] FIG.27: Illustration of SLIC mediated cloning of CAV2 viral genome into a self-excising Seel plasmid backbone that was used as template and resource for generating recombinant CAVs and CAV genome module plasmids.7158-101791-02

[0048] FIG.28: Schematic showing an overview of the construction and synthesis of the CAV El, core, E3 and E4 genome module plasmid constructs that were used as basis for subsequent generation and modification of CAVSLIC and CAVsembly modular El, core, E3 and E4 libraries with different modifications and properties. The CAV2 El, Core, E3, and E4 genomic modules were generated using geneblocks (gBlock) or cloned from the ATCC CAV2 reference viral genome plasmid, PCMN-1312. The El, E3, and E4 genomic modules were inserted into entry plasmids containing a kanamycin resistance gene and flanking sequences compatible with multisite Gateway assembly, sequence and ligation- independent cloning (SLIC), and Gibson assembly. Silent mutations were engineered into E4 genome sequences that ablate Pad and Bglll sites. The CAV core genomic region was made into a destination plasmid containing an ampicillin resistance gene and flanked on tire left and right by either unique Pad and Bglll restriction enzyme sites for assembly with E1 / E3 / E4 modules, and / or Gateway recombination sites with positive and negative selection cassettes. Core plasmid modules for Gateway assembly (Core-D) have compatible SSR sites and ccdB cassettes on tire left and / or right side, while core modules for SLIC lack these cassettes and were assembled by scarless cloning with Bglll and Pad linearization. The core plasmid serves as the central backbone for assembling the complete CAV genome by facilitating the integration of the El, E3, and E4 modules through Gateway, SLIC, and / or Gibson assembly.

[0049] FIG.29: Design and placement of att site sequences at the left and right ITRs in El (top) and E4 (bottom) module plasmids, respectively. An I-Scel restriction site is engineered between the att sites and the ITR sequences, which releases the assembled CAV genome upon I-Scel treatment in vitro, or expression of I-Scel from the assembled core and whole genome plasmid upon transfection into mammalian cells.

[0050] FIG.30: Map of the CAV El module entry plasmid, El-269. The CAV El entry plasmid includes the CAV El genomic module, extending from the right-hand ITR region to include the El A and E1B genes, as well as the TATA box breakpoint before pIX. The plasmid backbone has an attLl site followed by an I-Scel restriction site flanking the left ITR, an att L4 site before tire pIX Kozak sequence, a kanamycin resistance gene and an origin of replication (ori) for bacterial selection.

[0051] FIG.31: Map of the CAV E3 module entry plasmid, E3-522. The E3 entry plasmid includes the late pVIII through the E3 predicted genes, E3-ORF1 and E3-ORF2, and the late fiber gene on tire positive strand and the U exon on the negative strand. The 5’ attL5 site was placed before pVIII coding sequences, at an insertion point between 33k and pVIII as shown in the figure, and a 3’ attR3 site engineered after the fiber gene and placed between computationally predicted fiber and E4 polyA motifs so as not to disrupt gene expression from MLP and E4 transcription units. The entry plasmid has a kanamycin resistance gene for selection and an ori for bacterial propagation.

[0052] FIG.32: Map of tire CAV E4 module entry plasmid, E4-099. The E4 entry plasmid includes the right-hand ITR and the E4 transcriptional unit, encoding tire annotated E4orfl, E4orf2, E4orf3, E4orf4, and E4orf5 early viral genes. The E4 module was constructed using three primer extension PCR7158-101791-02

[0053] products amplified from the CAV2 genome. Two silent degenerate base-pair modifications were engineered within the E4 coding region to eliminate Bglll and Pad restriction sites while preserving the encoded amino acid sequences. The E4 plasmid backbone includes a kanamycin resistance gene and an ori for bacterial selection and propagation, respectively. The right ITR is flanked by an attL2 recombination sequence and an I-Scel restriction site. An attL3 recombination site was engineered at the non-coding junction between the fiber and E4 transcription units, and placed as shown in figure.

[0054] FIG.33: Plasmid map of the CAV core SLIC module (Core-059), used for the engineering of CAV core module libraries and recombinant CAV viral genomes described herein. The Core-059 plasmid module includes the CAV2 core genomic region spanning from the early pIX gene to the putative late 33k gene. The plasmid backbone has a low-copy pl5A bacterial origin of replication, bacterial transcriptional terminator sequences and ampicillin resistance genes that enable viral genome plasmid propagation and selection in bacteria. There is also an I-Scel expression cassette that includes a mammalian RSV viral promoter that drives tire I-Scel restriction enzyme upon plasmid transfection into mammalian (including canine) cells. The mammalian promoter and expression of tire I-Scel restriction enzyme specifically in mammalian cells cuts the CAV vaccine plasmid backbone at the I-Scel cleavage sites that flank the left and right assembled CAV genome ITRs linearizing and releasing the CAV genome so that it can be recognized by CAV E2-TP and undergo E2B mediated Type I and II viral genome replication and virion production. The key elements that were engineered to facilitate viral genome fragmentation and scarless module assembly via core module linearization with unique restriction sites were: (1) an engineered PacI site, which enables linearization of the plasmid for the scarless assembly of El and core genomic modules; and (2) a Bglll site, which facilitates the seamless cloning of El and / or E4 genomic modules with the core module.

[0055] FIG.34: Map of the core destination plasmid module (Core-074D), used for the assembly of recombinant CAV viral genomes via multi-site SSR recombination described herein. The Core-074D plasmid module includes the CAV2 core genomic region spanning from the early pIX gene to the putative late L433k gene. The plasmid backbone has a low-copy pl5A bacterial origin of replication, bacterial transcriptional terminator sequences and ampicillin resistance genes that enable viral genome plasmid propagation and selection in bacteria. There is also an I-Scel expression cassette. The mammalian promoter and expression of the I-Scel restriction enzyme specifically in mammalian cells cuts the CAV vaccine plasmid backbone at the I-Scel cleavage sites that flank the left and right assembled CAV genome ITRs linearizing and releasing the CAV genome so that it can be recognized by CAV E2-TP and undergo E2B mediated Type I and II viral genome replication and virion production. The key elements that were engineered to facilitate viral genome fragmentation and scarless module assembly via core module linearization with unique restriction sites were: (1) attRl and attR4 SSR sites on the left hand side of the core module, which have ccdB negative selection and chloramphenicol positive selection cassettes that are recombined out upon successful recombination with an El module; and (2) on the right side of the core module, there are attR5 and attR2 sites with ccdB negative selection7158-101791-02

[0056] and chloramphenicol positive selection cassettes that are recombined out upon successful recombination with an E3 module.

[0057] FIG.35: Schematic showing how the CAV El, E3, E4 and core genome module plasmids are designed and engineered such that they can be assembled via multi-site gateway recombination and / or scarless assembly methods: CAVSLIC (left) and CAVsembly (right). The CAVSLIC method results in a “scarless” viral genome product. This method can be performed, for example, using SLIC or Gibson assembly. CAVsembly uses site-specific recombination (e.g., Multisite Gateway recombination). The products of CAVsembly retain the recombination site sequences.

[0058] FIG.36: Schematic of an exemplary CAVSLIC assembly using the order El-core, followed by E4 and then E3. The generic seamless assembly process depicted can be performed using Gibson assembly, SLIC, In-Fusion, restriction enzyme and ligation cloning, or other approaches.

[0059] FIG.37: Schematic showing scarless CAVSLIC assembly of a wildtype CAV genome from El, core, E3 and E4 modules and macromodules in the order shown.

[0060] FIG.38: Map of the ASMM-149 El-core assembled macromodule plasmid.

[0061] FIG.39: Map of the ASMM-150 El-core-E4 assembled macromodule plasmid.

[0062] FIG. 40: Map of the PCMN-1313 whole CAV genome plasmid generated by scarless assembly of El, core, E3 and E4 modules and macromodule intermediates.

[0063] FIG. 41: Schematic showing an alignment of a CAV2 reference genome at the core-El junction for wildtype CAV2, core module plasmid sequences, El module sequences and the CAVSLIC scarless assembled PCMN-1313 plasmid, which was assembled from El, core, E3 and E4 modules. The sequence of PCMN-1313 is identical to that of the wildtype CAV2 reference genome, demonstrating the scarless assembly of El and Core module plasmids.

[0064] FIG. 42: Schematic showing an exemplary scarless assembly of a recombinant CAV genome, PCMN-1324, that has a modified El plasmid module, El-271, wherein El A was genetically fused inframe to a P2A sequence and a YPet fluorescent protein. El-271 was assembled with Core, E3 and E4 plasmids similar to the PCMN-1313 example in FIGS. 36-39.

[0065] FIG. 43: Map of the El module plasmid, El-271, which was engineered to express a heterologous ORF (in this example YPet, via a P2A fusion with El A).

[0066] FIG. 44: Workflow illustrating the process of evaluating CAV vaccine composition replication competence, starting from plasmid transfection in MDCK or DK cells, leading to plaque formation and cytopathic effects (CPE). The timeline and conditions for detecting productive replication and secondar infection are shown.

[0067] FIG. 45: Fluorescence microscopy images following transfection of MDCK cells with PCMN-1324 (ElA-P2A-YPet) whole genome plasmids. In these and subsequent fluorescence images, fluorescent cells appear as bright cells against a dark background. At 3 days post-transfection (dpt), fluorescent plaques were apparent in the MDCK monolayer, indicating successful transfection, first-round replication, and productive infection of tire recombinant CAV genome, as well as YPet fluorescent7158-101791-02

[0068] payload expression. The increase and spread of fluorescent cells across the entire monolayer by day 10 indicates productive log-phase replication. Viral supernatants were harvested at day 13 and used to infect fresh MDCK cells in secondary and tertiary rounds of infection. Productive replication and payload expression was demonstrated by an increase in the number of YPet-positive cells over time.

[0069] FIG. 46: Photographs of cesium chloride density gradient purification and characterization of PCMN-1324 virus particles propagated in DK cells. (Left) CsCl gradients of Ad5 virus propagated in human 293 cells are shown for comparison. (Right) Productive CAV particle production is demonstrated by the visible and strong lower white band of concentrated recombinant CAV virus particles and the absence of upper ‘empty’ defective virus particles.

[0070] FIG. 47: Fluorescence-based viral kinetics (FBVK) assay measuring CAV-2 (ElA-P2A-YPet) replication in MDCK cells. YPet fluorescence (arbitrary units) was quantified over time across a range of MOIs (individual curves). At sufficient MOI, log-phase viral replication curves capturing primary and secondary infection cycles are resolved. The slope of the log-phase growth curve is a measure of the replication rate. The height of the cu ve reflects tire YPet expression levels when operably linked to El A via P2A. A dashed horizontal line indicates the plateau YPet expression level, and the dashed diagonal line indicates the slope (rate of replication).

[0071] FIG. 48: Comparison showing FBVK assay fluorescent curves, productive log replication and YPet expression levels from E1A-P2A fusion in Ad5 and CAV2 (left).

[0072] FIG. 49: Example of scarless assembly of recombinant CAV genome PCMN-1326, using an E3 modified plasmid module, E3-527, wherein E3-ORF1 coding sequences are deleted. An El plasmid module that expresses an El A-P2A-YPet fluorescent reporter, a wildtype core and E4 module plasmid were assembled with E3-527 in the order shown.

[0073] FIG. 50: Map of E3-527, an E3 module plasmid with a deletion of the E3-ORF1 coding sequence.

[0074] FIG. 51: Schematic showing scarless assembly of PCMN-1327 using an E3 modified plasmid module, E3-528, wherein E3-ORF2 coding sequences are deleted. An El plasmid module that expresses an El A-P2A-YPet fluorescent reporter, a wildtype core and E4 module plasmid were assembled with E3-527 in the order shown.

[0075] FIG. 52: Map of E3-528, an E3 module plasmid with a deletion of the E3-ORF2 coding sequence.

[0076] FIG. 53: Schematic showing scarless assembly of PCMN-1328 using an E3 modified plasmid module, E3-529, wherein E3-ORF1 and E3-ORF2 coding sequences are deleted. An El plasmid module that expresses an ElA-P2A-YPet fluorescent reporter, a wildtype core and E4 module plasmid were assembled with E3-529 in the order shown.

[0077] FIG. 54: Map of E3-529, an E3 module plasmid with a deletion of the E3-ORF1 and E3-ORF2 coding sequences.7158-101791-02

[0078] FIG. 55: FBVK assay and quantification of viral replication kinetics in MDCK cells infected with the indicated viruses. Log slope is shown.

[0079] FIG. 56: Photographs showing CsCl gradients of PCMN-1324 harvested from DK cells and PCMN-1327 and PCMN-1328 harvested from MDCK cells.

[0080] FIG. 57: Schematic showing two-step scarless assembly with the order 1) El+core and 2) El-Core + E3 and E4 together.

[0081] FIG. 58: Schematic showing a 2-step scarless assembly of PCMN-1466 from a modified Core-065 plasmid module that was engineered to have a YPet-P2A-DNA polymerase fusion, and then assembled with a wildtype El plasmid module to form the ASMM-176 macromodule plasmid. The ASMM-176 macromodule plasmid was then assembled with E3 and E4 plasmid modules.

[0082] FIGS. 59A-59B: Maps of (FIG. 59A) Core-065 and (FIG. 59B) ASMM-176 macromodule plasmids.

[0083] FIG. 60: Images from a fluorescence assay following transfection with PCMN-1466. MDCK cells were transfected with PCMN-1466 whole genome plasmid. At 10 days post infection (dpi), fluorescent plaques were apparent in the MDCK monolayer, indicating productive infection of the recombinant CAV genome, as well as YPet fluorescent pay load expression. Productive replication and payload expression was demonstrated by an increase in the number of YPet cells infected over time.

[0084] FIG. 61: Schematic showing exemplary CAVsembly of the CMBT-1426 virus genome that has a modified E3 genomic module, E3-541, in which mCherry was engineered to replace E3-ORF1 coding sequences and in which E3-ORF2 coding sequences were also deleted. E3-541 was assembled with Core-074D, El-269 and E4-099 plasmids using a multi-site gateway LR recombination reaction.

[0085] FIGS. 62A-62B: Map of the (FIG. 62A) E3-541 plasmid and the (FIG. 62B) Core-074D plasmid.

[0086] FIG. 63: Map of CMBT-1426 assembled using CAVsembly.

[0087] FIG. 64: Schematic showing that recombination of Core-074D with an El entry plasmid generates the expected attB site placement at the Kozak consensus motif for pIX at the El-core module junction.

[0088] FIG. 65: Schematic showing that recombination of an E3 entry plasmid with an E4 entry plasmid generates the expected attB site placement at tire E3-E4 module junction and assembled viral genome.

[0089] FIG. 66: Schematic showing an exemplary hybrid assembly whereby the El module is first assembled with a Core-073 Dest module by scarless SLIC / Gibson assembly, and El and E4 entry plasmids are recombined and assembled with the El-Core-DEST macromodule via multi-site att recombination in an LR reaction to produce a whole genome plasmid.

[0090] FIG. 67: Map of tire Core-073 E3 / E4 single Dest plasmid.

[0091] FIG. 68: Plasmid map of the CMBT-1424 virus genome, which was generated by a similar SLIC and recombination assembly scheme as in FIG. 66.7158-101791-02

[0092] FIGS. 69A-69B: Plasmid maps of (FIG. 69 A) El-285, a modified El module with an ElB-55k-P2A-YPet fluorescent reporter placement and (FIG. 69B) E3-574, a modified E3 module that expresses a heterologous therapeutic ORF, an immunogenic antigen from canine distemper virus (CDV H), instead of E3-ORF1 and has an additional deletion of E3-ORF2 coding sequence. The El and E3 modified plasmids were assembled with a Core-74D plasmid (FIG. 62B) and wildtype E4 plasmid in an LR reaction to create the whole genome plasmid CMBT-1460.

[0093] FIG. 70: Plasmid map of the CMBT-1460 virus genome, which was assembled in an LR reaction from a Core-74D plasmid (FIG. 62B), El-285 and E3-574 modules (FIG. 69) and wildtype E4 plasmid in an LR reaction to create the whole genome plasmid.

[0094] FIG. 71: Fluorescent images of MDCK cells transfected with CMBT-1460 virus genome at 6 and 12 days post- transfection. At 6 days post-transfection, virally infected YPet fluorescent expressing cells and plaques were visible. Productive viral replication is demonstrated by the increase in virally infected YPet expressing cells over time, culminating in cell lysis and destruction of the cell monolayer by day 12.

[0095] FIG. 72: Map of the E4- 114 plasmid module in which E4-ORF5 coding sequences were deleted.

[0096] FIG. 73: Map of the CMBT-1501 whole genome plasmid, which was assembled from E4-114, E3-541 and ASMM-173D in a multi-site Gateway LR recombination reaction, using an assembly schema similar to the one depicted in FIG. 66.

[0097] FIG. 74: Fluorescent images of cells transfected with CMBT-1501 at 3 and 15 days posttransfection. The virally driven expression of the mCherry fluorescent reporter in place of E3-ORF1 was clearly visualized, demonstrating expression of an exogenous gene from internal viral promoters, and productive virus replication and spread from initial transfected cells to the entire monolayer by day 15. These data show that multi-site gateway assembly can be used to assemble a replication competent CAV whole genome plasmid, that the E3-ORF1 gene sequences can be replaced to express an exogenous gene, and if that gene is, for example, a fluorescent protein, used as an assay to determine which viral genes are dispensable for replication in cell culture. These data also show that E4-ORF5, together with E3-ORF1 and E3-ORF2 are not critical for virus replication (although replication is attenuated compared to wildtype virus), at least in cell culture, and can be deleted to create genomic space for therapeutic pay loads or heterologous ORFs.

[0098] SEQUENCE LISTING

[0099] The nucleic acid and amino acid sequences listed in tire accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and single letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but tire complementary strand is understood as included by any reference to the displayed strand. In tire accompanying sequence listing:

[0100] SEQ ID NO: 1 is the nucleotide sequence of PCMN-1312.7158-101791-02

[0101] SEQ ID NO: 2 is the nucleotide sequence of PCMN-1313.

[0102] SEQ ID NO: 3 is the nucleotide sequence of PCMN-1324.

[0103] SEQ ID NO: 4 is the nucleotide sequence of PCMN-1326.

[0104] SEQ ID NO: 5 is the nucleotide sequence of PCMN-1327.

[0105] SEQ ID NO: 6 is the nucleotide sequence of PCMN-1328.

[0106] SEQ ID NO: 7 is the nucleotide sequence of CMBT-1426.

[0107] SEQ ID NO: 8 is the nucleotide sequence of CMBT-1424.

[0108] SEQ ID NO: 9 is the nucleotide sequence of CMBT-1501.

[0109] SEQ ID NO: 10 is die nucleotide sequence of the El-269 plasmid module.

[0110] SEQ ID NO: 11 is die nucleotide sequence of die El-271 plasmid module.

[0111] SEQ ID NO: 12 is the nucleotide sequence of the Core-059 plasmid module.

[0112] SEQ ID NO: 13 is the nucleotide sequence of the Core-74D plasmid module.

[0113] SEQ ID NO: 14 is the nucleotide sequence of the E3-522 plasmid module.

[0114] SEQ ID NO: 15 is the nucleotide sequence of the E3-527 plasmid module.

[0115] SEQ ID NO: 16 is the nucleotide sequence of the E3-528 plasmid module.

[0116] SEQ ID NO: 17 is the nucleotide sequence of the E3-529 plasmid module.

[0117] SEQ ID NO: 18 is the nucleotide sequence of the E3-541 plasmid module.

[0118] SEQ ID NO: 19 is the nucleotide sequence of the E4-099 plasmid module.

[0119] SEQ ID NO: 20 is the nucleotide sequence of the ASMM-149 El-Core macromodule plasmid.

[0120] SEQ ID NO: 21 is the nucleotide sequence of the ASMM-150 macromodule plasmid.

[0121] SEQ ID NOs: 22-23 are modified E4 region nucleic acid fragments.

[0122] SEQ ID NOs: 24-48 are nucleic acid primer sequences.

[0123] SEQ ID NOs: 49-56 are 2A peptide sequences.

[0124] SEQ ID NOs: 57-61 are att site nucleic acid sequences.

[0125] SEQ ID NO: 62 is the nucleotide sequence of PCMN-1466.

[0126] SEQ ID NO: 63 is the nucleotide sequence of CMBT-1437.

[0127] SEQ ID NO: 64 is the nucleotide sequence of CMBT-1460.

[0128] SEQ ID NO: 65 is the nucleotide sequence of the ASMM-176 macromodule plasmid.

[0129] SEQ ID NO: 66 is the nucleotide sequence of the El-285 plasmid module.

[0130] SEQ ID NO: 67 is the nucleotide sequence of the Core-073 E3 / E4 Dest plasmid module. SEQ ID NO: 68 is the nucleotide sequence of the E3-574 module plasmid.

[0131] SEQ ID NO: 69 is the nucleotide sequence of the E4-114 module plasmid.

[0132] SEQ ID NO: 70 is die nucleotide sequence of the Core-065 module plasmid.

[0133] SEQ ID NO: 71 is die nucleotide sequence of a fragment of an El module.

[0134] SEQ ID NO: 72 is die nucleotide sequence of a fragment of an E4 module.7158-101791-02

[0135] DETAILED DESCRIPTION

[0136] I. Abbreviations

[0137] Ad adenovirus

[0138] Ad5 adenovirus type 5

[0139] CAV canine adenovirus

[0140] CDV canine distemper virus

[0141] DBP DNA binding protein

[0142] dpi days post-infection

[0143] liAd human adenovirus

[0144] ITR inverted terminal repeat

[0145] MDCK Madin-Darby canine kidney

[0146] MLP the major late promoter

[0147] ORF open reading frame

[0148] ori origin of replication

[0149] OV oncolytic virus

[0150] SLIC sequence- and ligation-independent cloning

[0151] SSR site-specific recombination

[0152] IL Summary of Terms

[0153] Unless otherwise noted, technical terms are used according to conventional usage. Definitions of many common terms in molecular biology may be found in Krebs et al. (eds.), Lewin’s genes XII, published by Jones & Bartlett Learning, 2017. As used herein, the singular forms “a,” “an,” and “the,” refer to both the singular as well as plural, unless the context clearly indicates otherwise. For example, the term “a module” includes singular or plural modules and can be considered equivalent to the phrase “at least one module.” As used herein, the term “comprises” means “includes.” It is further to be understood that any and all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for descriptive purposes, unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particular suitable methods and materials are described herein. In case of conflict, the present specification, including explanations of terms, will control. In addition, die materials, methods, and examples are illustrative only and not intended to be limiting. To facilitate review of the various aspects, the following explanations of terms are provided:

[0154] 2A peptide: A type of self-cleaving peptide encoded by some RNA viruses, such as picornaviruses. 2A peptides function by making tlie ribosome skip the synthesis of a peptide bond at the C -terminus of a 2A element, leading to separation between the end of the 2A sequence and the downstream peptide (Kim et al.,PLoS One 6(4):el8556, 2011). The "cleavage" occurs between the glycine and proline residues found on the C-terminus of the 2A peptide. Exemplary 2A peptides include,7158-101791-02

[0155] but are not limited to, the 2A peptides encoded by Thosea asigna virus (TaV; T2A), equine rhinitis A virus (ERAV; E2A), porcine teschovirus-1 (PTV1; P2A) and foot and mouth disease virus (FMDV; F2A), having the following sequences:

[0156] P2A: ATNFSLLKQAGDVEENPGP (SEQ ID NO: 49)

[0157] F2A: VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 50)

[0158] E2A: QCTNYALLKLAGDVESNPGP (SEQ ID NO: 51)

[0159] T2A: EGRGSLLTCGDVEENPGP (SEQ ID NO: 52)

[0160] In some examples, the 2A peptide is modified to include Gly-Ser-Gly at the N-terminus to improve cleavage efficiency. The sequences of modified P2A, F2A, E2A and T2A are provided below:

[0161] Modified P2A: GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 53)

[0162] Modified F2A: GSGVKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 54)

[0163] Modified E2A: GSGQCTNYALLKLAGDVESNPGP (SEQ ID NO: 55)

[0164] Modified T2A: GSGEGRGSLLTCGDVEENPGP (SEQ ID NO: 56)

[0165] Att sites: Site-specific recombination sequences for the multi-site Gateway recombination method. There are four classes of att sites called attB, attP, attL, and attR. attB sites react with attP in a BP clonase reaction, generating attL and attR sites. AttL and attR sites recombine with each other in an LR reaction, regenerating attB and attP sites.

[0166] Canine adenovirus (CAV): A type of virus with a double-stranded linear DNA genome belonging to the genus Mast adenovirus, family Adenoviridae. There are two types of canine adenoviruses - CAV-1 and CAV-2, which cause canine hepatitis and infectious tracheobronchitis, respectively, in canines.

[0167] CAV core genomic module: A portion of the CAV genome that includes the early / intermediate genes, pIX and IV A2, the major late promoter (MLP) and transcriptional unit that drives the expression of CAV capsid and late proteins, including: 52 / 55k, pllla, penton, pVII, pV, pX, pVI, protease, hexon, 100k, 22k, and 33k (putative) on the positive strand. On the negative strand, the CAV E2 transcriptional unit drives the expression of the viral DNA replication proteins, including E2A DBP, pTP and E2B DNA polymerase.

[0168] CAV core plasmid module: A nucleic acid molecule corresponding to a portion of a CAV genome that extends 5’ from the early protein IX to tire putative L4-33K gene on tire positive strand and from tire 3’ direction includes the E2 transcriptional unit and E2 encoded proteins E2A, E2B polymerase and terminal protein genes on the negative strand (see FIG. 6). This region of the genome includes the following ORFs: IX, IVa2, DNA pol, pTP, 52K, pllla, penton, pVII, V, pX, pVI, hexon, protease, DNA binding protein (DBP), 100K, 22K and 33K (22k and 33k are putative). Most of the genes in this module are responsible for viral DNA replication and assembly into a protein capsid.

[0169] CAV El genomic module: A portion of the CAV genome that spans from the left-hand internal terminal repeat (ITR) through the E1B-55K gene and the TATA box for pIX. The E1A and E1B gene7158-101791-02

[0170] products encoded within this module are essential for viral replication. These genes can be deleted for the assembly and production of recombinant non-replicating CAV vectors.

[0171] CAV El plasmid module: A nucleic acid molecule corresponding to a portion of a CAV genome that includes the left-hand inverted terminal repeat (ITR), and the El A, ElB-19k and ElB-55k ORFs and El A and E1B transcriptional regulatory sequences and units (see FIGS. 7 and 8). The El genes and promoters may be partially or wholly deleted, mutated, or replaced with heterologous open reading frames (ORFs) to generate replication-incompetent viral vectors for gene delivery, gene therapy and vaccines.

[0172] CAV E3 genomic module: A portion of the CAV genome that includes the MLP transcribed late protein pVIII, the E3 transcriptional unit and protein coding genes (E3-ORF1 and E3-ORF2), and the fiber gene on the positive strand, and the U exon on the negative strand.

[0173] CAV E3 plasmid module: A nucleic acid molecule corresponding to a portion of a CAV genome that includes pVIII, the E3 promoter and genes, the U-exon, and the fiber gene (see FIG. 6). This region includes the following ORFs: pVIII, E3-ORF1, E3-ORF2, U exon, and Fiber. pVIII is predicted to be transcribed from the major late promoter. An E3 promoter element is predicted to be embedded within the pVIII coding sequence. Also predicted are E3-ORF1 alternative ATG-methionine start codons at the end of pVIII gene in an alternative reading frame. The E3 genes can be partially or completely deleted to expand packaging capacity, regulate host immune responses, and / or encode heterologous genes and are not essential for virus replication in most adenoviruses.

[0174] CAV E4 genomic module: A portion of the CAV genome that includes the right ITR and the E4 transcriptional unit and protein coding genes on the negative strand. The E4 genes have important functions in usurping host cell signaling pathways and function to facilitate viral replication in human Ads and likely canine Ads. In CAV, there are five predicted and annotated ORFs, which include from right to left, E4-ORF1, E4-ORF2, E4-ORF3, E4-ORF4 and E4-ORF5.

[0175] CAV E4 plasmid module: A nucleic acid molecule corresponding to a portion of a CAV genome that includes the right hand ITR, E4-ORF1, E4-ORF2, E4-ORF3, E4-ORF4 and E4-ORF5 (see FIGS. 7 and 11).

[0176] CAVsembly: A ‘Multisite Gateway’ based genome assembly method. In some aspects of this assembly method, the CAV core module is cloned into a plasmid with ampicillin resistance and made into a Gateway-compatible destination (DEST) plasmid whereby the CAV core genome module is flanked on the left anchor right with multisite Gateway cassettes that have site-specific recombination sequences (att sites) and ccdB counterselection cassettes. The El, E3, and E4 genome modules are cloned into specialized Multisite Gateway compatible entry plasmids that can be combined with, for example, a “dual-DEST” core module in a standard Multisite Gateway LR reaction. The resultant reaction contains fully assembled CAV genomes. Assembled CAV genomes can then be transformed into bacteria and correct assemblies selected by virtue of ampicillin resistance and successful recombination7158-101791-02

[0177] and replacement of ccdB with CAV genome modules. The virus genome can also be transfected into canine cells as only correctly assembled CAV genomes are replication-competent.

[0178] CAVSLIC: An assembly method of CAV genome module plasmids that uses scarless and sequence ligation independent cloning (SLIC) based assembly of El, E3 and E4 modules to create a complete CAV genome in two or three steps. In some aspects of this assembly method, the CAV core genome module plasmid is engineered to have unique restriction sites engineered at the left and right hand sides. The core module is linearized by restriction enzyme digestion and assembled with a PCR linearized E3 and E4 module via SLIC / Gibson, generating a macromodule plasmid. Following transformation and selection of core-E3-E4 macromodule plasmids, the El module is added by linearizing it with restriction enzyme digestion and then adding an El module using PCR and then assembly via Gibson / SLIC. This generates fully assembled viral genomes.

[0179] Degenerate variant: A polynucleotide encoding a peptide that includes a sequence that is degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences encoding a peptide are included as long as the amino acid sequence of the peptide encoded by the nucleotide sequence is unchanged.

[0180] Deletion: An adenovirus genome that has a “deletion” of an adenovirus ORF (such as an E3-ORF1 or E3-ORF2 deletion) refers to an adenovirus having a complete deletion of the ORF, or a partial deletion of the ORF that results in the absence of expression of a protein sequence encoded by the ORF. In some aspects herein, E3-ORF1 and / or E3-ORF2 are completely deleted. In other aspects, E3-ORF1 and / or E3-ORF2 are partially deleted, such as 50%, 60%, 70%, 80%, 90%, 95% or 99% deleted.

[0181] Embedded gene promoter: A regulatory DNA sequence capable of initiating transcription that is located within the coding region of another gene. This overlapping genetic architecture enables the regulation of an alternative transcriptional unit while existing within the sequence of a distinct, independently transcribed gene. Such embedded promoters may be naturally occurring, facilitating the expression of alternative or overlapping transcripts, and may be exploited or synthetically engineered to enable co-regulation of heterologous genes with applications in gene therapy, vaccines, recombinant protein expression, and viral vector systems.

[0182] Fluorescent protein: A protein that emits light of a certain wavelength when exposed to a particular wavelength of light. Fluorescent proteins include, but are not limited to, green fluorescent proteins (such as GFP, EGFP, AcGFPl, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP and ZsGreen), blue fluorescent proteins (such as EBFP, EBFP2, Sapphire, T-Sapphire, Azurite and mTagBFP), cyan fluorescent proteins (such as ECFP, mECFP, Cerulean, CyPet, AmCyanl, Midori-Ishi Cyan, mTurquoise and mTFPl), yellow fluorescent proteins (EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana), orange fluorescent proteins (Kusabira Orange, Kusabira Orange2, mOrange, mOrange2 and mTangerine), red fluorescent proteins (mRuby, mApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, HcRedl, m Raspberry, dKeima-Tandem, HcRed-Tandem, mPlum, AQ143, tdTomato and E2-Crimson), orange / red fluorescence proteins7158-101791-02

[0183] (dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (Tl) and DsRed-Monomer) and modified versions thereof.

[0184] Frame-dependent synonymous mutation: A nucleotide substitution occurring within a single open reading frame (ORF) where the mutation is synonymous, preserving the amino acid sequence in that frame, while simultaneously inducing a non-synonymous mutation in an overlapping ORF, resulting in an amino acid substitution or functional modification in the alternate reading frame. Such mutations leverage the degeneracy of the genetic code to engineer precise genetic modifications in overlapping coding regions, allowing for targeted alteration of one protein sequence while maintaining functional integrity of anodier in dual-coding sequences.

[0185] Fusion protein: A protein containing amino acid sequence from at least two different (heterologous) proteins or peptides. Fusion proteins can be generated, for example, by expression of a nucleic acid sequence engineered from nucleic acid sequences encoding at least a portion of two different (heterologous) proteins. To create a fusion protein, the nucleic acid sequences must be in the same reading frame and contain no internal stop codons. Fusion proteins, particularly short fusion proteins, can also be generated by chemical synthesis.

[0186] Gateway® cloning: A cloning method based on the site-specific recombination (SSR) system used by phage to integrate its DNA into bacterial chromosomes. This method relies on specific recombination (“att”) sites, which can be 25-242 base pairs. In this method, a gene of interest is cloned into an “entry vector” using the BP reaction. The gene of interest is then subcloned from the entry vector into a “destination vector” using the LR reaction. The BP clonase enzyme reaction recombines attB sites (flanking the gene of interest) with attP sites (in the donor vector), which generates attL sites. The LR reaction is a recombination reaction between attL and attR sites. See, for example, Reece-Hoyes and Walhout (Cold Spring Harb Protoc, January 2, 2018, pdb.top094912), Katzen (Expert Opin. Drug Discov. 2, 571-589, 2007) and Hartley (Curr Protoc Protein Sci, Chapter 5, unit 5.17, February 2003).

[0187] Gibson assembly: A sequence-independent, seamless DNA assembly method that enables the joining of one or more linear DNA fragments in a single reaction. The process is based on the coordinated use of enzymatic activities, including exonuclease, DNA polymerase, and DNA ligase, to facilitate the precise and scarless assembly of DNA molecules. A 5’ exonuclease digests DNA ends, creating single-stranded complementary overhangs. Overlapping regions hybridize via complementary base pairing. A high-fidelity DNA polymerase extends and synthesizes missing nucleotides. A DNA ligase enzyme covalently seals the assembled DNA fragments into a contiguous molecule. Gibson assembly is described in Gibson et al. (Nat Methods 6:343-345, 2009).

[0188] Heterologous: A heterologous protein or polypeptide refers to a protein or polypeptide derived from a different source or species.

[0189] I-Scel: A member of a class of restriction enzymes with a very rare-cutting endonuclease recognition site, which are characterized by a recognition sequence of at least 12 base pairs in length, and in some instances 15-22 base pairs or longer. As such, the recognition site occurs infrequently in natural7158-101791-02

[0190] genomes, thereby enabling site-specific cleavage, linearization, or recombination with minimal off-target activity. Other examples of this class of enzymes with long recognition sites and that could replace I-Scel in the assembly methods disclosed herein: I-Ceul, I-Ppol, I-Crel, PI-PspI, Pl-Scel, and other homing endonucleases (e.g., LAGLIDADG and GIY-YIG families). In the context of the present disclosure, a “rare-cutting restriction endonuclease” refers to any of the class of enzymes listed above, including, for example, I-Scel, I-Ceul, I-Ppol, I-Crel, PI-PspI, Pl-Scel, or any other homing endonucleases, such as one from the LAGLIDADG or GIY-YIG family.

[0191] Macromodule: A nucleic acid molecule that contains at least two CAV genome modules, such as the El module combined with the core module (El-core macromodule), or the El module combined with both the core module and the E4 module (El-core-E4 macromodule).

[0192] Modification: A change in the sequence of a nucleic acid or protein sequence. Amino acid sequence modifications include, for example, substitutions, insertions and deletions, or combinations thereof. Insertions include amino and / or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence (or the removal of one or more nucleotides / ribonucleotides from a nucleic acid sequence). In some aspects herein, the modification (such as a substitution, insertion or deletion) results in a change in function, such as a reduction or enhancement of a particular activity of a protein. Substitutional modifications are those in which at least one residue has been removed and a different residue inserted in its place. Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final mutant sequence. These modifications can be prepared by modification of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the modification. Techniques for making insertion, deletion and substitution mutations at predetermined sites in DNA having a known sequence are known. A “modified” protein, nucleic acid or virus is one that has one or more modifications as outlined above.

[0193] Modular assembly: A method or system for constructing a nucleic acid sequence (e.g., a viral genome) from discrete, interchangeable, and pre-defined CAV genomic plasmids (“modules”) that are designed to be functionally and physically compatible with one another. Each module includes a distinct CAV genomic region, which can be independently modified, inserted, or exchanged, to assemble a recombinant genome without requiring redesign of the entire genome.

[0194] Module: One of several parts that is made separately but can be joined with other parts to build a structure. In the context of the present disclosure, a CAV “genomic module” is a defined portion of the CAV genome (see FIG. 7) and a CAV “plasmid module” is a nucleic acid molecule that corresponds to a portion of a CAV genome that is engineered and designed with defined boundaries and standardized interfaces (e.g., overhangs, recombination sites, homology arms, restriction sites) to enable seamless integration and / or recombination with other modules using a common framework to assemble a whole genome structure. The CAV plasmid modules disclosed herein include tire El module, the core module,7158-101791-02

[0195] the E3 module and the E4 module. The assembly of all four genomic plasmid modules produces a complete CAV genome.

[0196] Open reading frame (ORF): A span of DNA sequence that begins with a start codon and ends with a stop codon. In the context of the present disclosure, an open reading frame (ORF) sequence refers to a contiguous nucleotide sequence within a viral genome that initiates with a start codon (typically AUG), extends uninterrupted by in-frame stop codons, and encodes a functional viral polypeptide. ORF sequences in viral genomes may be arranged as monocistronic or polycistronic transcripts, with some ORFs overlapping within alternative reading frames, allowing for the compact encoding of multiple viral proteins from a constrained genomic region.

[0197] Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with tire second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.

[0198] Overlapping open reading frame: In the context of the present disclosure, an alternative overlapping reading frame refers to a nucleotide sequence within a genetic element that is encoded in a different reading frame relative to a primary coding sequence and is capable of directing the translation of a distinct polypeptide. Such alternative ORFs may be located within the same nucleic acid strand but shifted by +1 or -1 nucleotides relative to the primary ORF, or may exist as dual -coding sequences where a single genomic region encodes functionally distinct proteins depending on the frame utilized during translation. These overlapping reading frames may be endogenous viral ORFs or may be engineered to allow for co-expression of multiple or individual proteins within a compact complex genetic region. The presence of an alternative ORF can contribute to regulatory complexity, functional diversity, and optimization of genetic constructs for use in therapeutics, synthetic biology, vaccine development, and recombinant expression systems.

[0199] Polyadenylation sequence (poly A): The poly (A) consensus sequence refers to a conserved nucleotide motif found near the 3’ untranslated region (3’ UTR) of mRNAs. This sequence is recognized by the cleavage and polyadenylation machinery, leading to the addition of a poly(A) tail, which is important for mRNA stability, nuclear export, and translation efficiency. Poly(A) consensus motifs include tire canonical sequence AAUAAA and tire non-canonical sequences AUUAAA (most common alternative), AGUAAA, UAUAAA, AAGAAA, and AACAAA.

[0200] Polypeptide, peptide or protein: A polymer in which the monomers are amino acid residues which are joined together through amide bonds. When tire amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used. The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein. These terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well7158-101791-02

[0201] as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. The term “residue” or “amino acid residue” includes reference to an amino acid that is incorporated into a protein, polypeptide, or peptide.

[0202] A conservative substitution in a polypeptide is a substitution of one amino acid residue in a protein sequence for a different amino acid residue having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting polypeptide. For example, a protein or peptide including one or more conservative substitutions (for example no more than 1, 2, 3, 4 or 5 substitutions) retains die structure and function of die wild-type protein or peptide. A polypepdde can be produced to contain one or more conservative substitutions by manipulating die nucleotide sequence that encodes that polypeptide using, for example, standaid procedures such as site-directed mutagenesis or PCR. In one example, such variants can be readily selected by testing antibody crossreactivity or its ability to induce an immune response. Examples of conservative substitutions are shown below.

[0203] Original Residue Conservative Substitutions

[0204] Ala Ser

[0205] Arg Lys

[0206] Asn Gin, His

[0207] Asp Glu

[0208] Cys Ser

[0209] Gin Asn

[0210] Glu Asp

[0211] His Asn; Gin

[0212] He Leu, Vai

[0213] Leu He ; Vai

[0214] Lys Arg ; Gin ; Glu

[0215] Met Leu ; He

[0216] Phe Met; Leu; Tyr

[0217] Ser Thr

[0218] Thr Ser

[0219] Trp Tyr

[0220] Tyr Trp ; Phe

[0221] Vai He ; Leu

[0222] Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) die bulk of the side chain.7158-101791-02

[0223] The substitutions that in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, seryl or threonyl, is substituted for (or by) a hydrophobic residue, for example, leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, for example, glutamyl or aspartyl; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine.

[0224] Promoter: A region of DNA tliat directs / initiates transcription of a nucleic acid (e.g., a gene). A promoter includes necessary nucleic acid sequences near the start site of transcription. Typically, promoters are located near the genes they transcribe. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. A “constitutive promoter” is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an “inducible promoter” is regulated by an external signal or molecule (for example, a transcription factor or tetracycline). A “tissue-specific promoter” is a promoter that is only active in a particular tissue or cell (e.g., a musclespecific promoter or a liver- specific promoter).

[0225] Recombinant: When used with reference to, e.g., a cell, vims, nucleic acid, protein, or vector, indicates that the cell, virus, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.

[0226] Replication-competent genome: A recombinant or synthetic viral genome that, when introduced into a permissive host cell, is capable of undergoing a complete primary and secondary viral replication cycle, including genome transcription, protein translation, genome replication, capsid assembly, and production of infectious progeny virions that infect surrounding cells, at levels that are comparable to or within an acceptable threshold (e.g., >50-100%) of wild-type vims replication kinetics.

[0227] Scalable genome assembly platform: “Scalable,” as used herein, refers to the capacity of the disclosed genome assembly platform, system, or method to support the efficient construction, modification, and evaluation of multiple viral genomes — individually or in parallel — using a modular and systematic approach. A scalable system is compatible with the incorporation of distinct genome modules or libraries of genetic elements, enabling high-throughput generation of recombinant viral constructs without requiring one-at-a-time designs and assembly for each variant to be tested. Scalability includes the ability to adapt the assembly process to varying numbers of constructs, such as precision and scarless assembly of clinical candidates and screening of large numbers of constructs using7158-101791-02

[0228] recombination based assembly, genome sizes within and between Ad species, or configurations without a loss of efficiency, fidelity, or reproducibility.

[0229] Scarless cloning: Cloning methods that do not leave recombination sites or other heterologous nucleotides in the final product. Scarless cloning is also called seamless cloning. Scarless cloning methods include, for example, sequence- and ligation-independent cloning (SLIC) and Gibson assembly. Scarless assembly enzyme site refers to a recognition sequence for an enzyme that enables the joining of DNA fragments without leaving any unintended residual nucleotides (“scars”) at the junction.

[0230] Self-cleaving peptides: Peptides that induce the ribosome to skip the synthesis of a peptide bond at the C-terminus, leading to separation of the peptide sequence and a downstream polypeptide. Virally encoded 2A peptides are a type of self-cleaving peptide. Virally encoded 2A peptides include, for example, 2A peptides from porcine teschovirus-1 (PTV1), foot and mouth disease virus (FMDV), equine rhinitis A virus (ERAV) and Thosea asigna virus (TaV).

[0231] Sequence- and ligation-independent cloning (SLIC): A scarless cloning method that allows for assembly of one or more linear nucleic acid fragments (e.g., assembly of a linearized vector and one or more inserts). The fragments to be joined are linearized via restriction enzyme digestion, PCR or gene synthesis and are treated with T4 polymerase. The 3' to 5' exonuclease activity of T4 polymerase produces 3' overhangs on each DNA fragment, allowing for annealing of complementary DNA sequences. In the case of SLIC assembly of plasmid sequences, plasmids are transformed into bacteria where DNA molecules are repaired and ligated and propagated. SLIC is described in Li and Elledge (2012, SLIC: A Method for Sequence- and Ligation-Independent Cloning. In: Peccoud J. (eds) Gene Synthesis. Methods in Molecular Biology (Methods and Protocols), vol 852. Humana Press).

[0232] Sequence identity: The identity or similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity / similarity when aligned using standard methods. This homology is more significant when the orthologous proteins or cDNAs are derived from species which are more closely related (such as human and mouse sequences), compared to species more distantly related (such as human and C. elegans sequences).

[0233] Methods of alignment of sequences for comparison are known. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. In the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol.7158-101791-02

[0234] Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

[0235] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.

[0236] Splicing motifs: In the context of the present disclosure, splicing sequences and regulatory motifs refer to conserved or semi-conserved nucleotide sequences within a nucleic acid molecule drat mediate the processing of precursor mRNA (pre-mRNA) into mature mRNA through splicing. These sequences include canonical splice donor, splice acceptor, and branch point sites, which are recognized by the spliceosome to facilitate exon-exon ligation and intron removal.

[0237] A splicing consensus sequence refers to the highly conserved nucleotide pattern found at essential splicing junctions, such as the GT-AG rule for most introns, wherein the 5' splice donor sequence (typically GU in RNA) and the 3' splice acceptor sequence (typically AG in RNA) define exonintron boundaries. Additionally, the branch point sequence (BPS), polypyrimidine tract (PPT), and exon splicing enhancers (ESEs) contribute to splicing efficiency and alternative splicing regulation.

[0238] Degeneracy within splicing sequences refers to the allowance for nucleotide variability at certain positions while maintaining functional recognition by the splicing machinery. This degeneracy enables alternative splicing, exon skipping, and regulatory flexibility while preserving transcript fidelity.

[0239] Regulatory motifs such as splicing silencers (ESS, ISS) and splicing enhancers (ESE, ISE) further modulate exon recognition, affecting gene expression and protein diversity.

[0240] These splicing sequences and regulatory motifs may be engineered or optimized for applications in gene therapy, viral vector design, synthetic biology, and recombinant protein production, enabling precise control over transcript processing, exon inclusion, and alternative splicing events.

[0241] Synthetic: Produced by artificial means in a laboratory, for example a synthetic nucleic acid or protein can be chemically synthesized in a laboratory.

[0242] TATA Box: A highly conserved cis-regulatory DNA element found in eukaryotic and viral core promoters, typically positioned 25 to 35 nucleotides upstream of the transcription start site (TSS). The TATA box is characterized by the consensus sequence TATAWAWR (where W = A / T and R = A / G) and serves as a binding site for the TATA-binding protein (TBP), a key component of the transcription factor IID (TFIID) complex, which facilitates RNA polymerase II recruitment and transcription initiation. This sequence element plays an important role in gene expression regulation, influencing transcription efficiency, promoter strength, and chromatin accessibility. Variations in the TATA box sequence can modulate transcriptional output, contributing to differential gene expression patterns. The TATA box may be naturally occurring or synthetically engineered to enhance promoter activity, enable tissuespecific expression, or integrate regulatory elements in recombinant DNA constructs, with applications in gene therapy, vaccine development, synthetic biology, and biopharmaceutical production.7158-101791-02

[0243] Translational read-through: In the context of the present disclosure, translational read-through of multiple open reading frames (ORFs) refers to a molecular mechanism wherein ribosomal decoding continues beyond a canonical stop codon, enabling translation of downstream overlapping or distinct ORFs within a single mRNA transcript. This read-through process may be naturally occurring or engineered through sequence modifications, including stop codon suppression, RNA structural elements, programmed ribosomal frameshifting, or alternative translational signals. The ability to bypass termination codons and extend translation across multiple ORFs allows for the coordinated expression of functionally linked polypeptides, production of polyproteins, or regulatory modulation of gene expression. Such translational control mechanisms are applicable to viral genome engineering, synthetic biology, recombinant protein expression systems, and gene therapy platforms, where precise modulation of translational termination and read-through can enhance therapeutic efficacy or enable novel genetic architectures.

[0244] III. Introduction

[0245] Unlike human Ad5 (FIG. 3), CAV genomes (FIG. 4) and biology are still relatively uncharacterized and there are a paucity of tools to study and engineer CAVs for research and therapeutic applications. There are two CAV subgroups, designated CAV1 and CAV2, which share 83% sequence homology (FIG. 5). The CAV genome is smaller than the genome of human adenoviruses, approximately 31 kb compared to 36 kb for human Ad5, and shares only 45% homology to human adenovirus (FIGS. 2-5). Human Ad and CAV exhibit the most significant diversity in the El, E3 and E4 regions (FIG. 5), whereas the structural proteins, while still divergent, share the greatest homology. CAVs have unique E3 genes and low homology to hAds and also have more compact genomes, limiting the potential for insertion of foreign sequences.

[0246] CAVs have several attractive properties for gene therapy, vaccine and oncolytic virus (OV) applications in both companion animals and humans. For example, a major limitation for human Ad5 is the high prevalence of neutralizing antibodies in the human population (60%). However, adenoviruses from other species, such as canines, would not be expected to be limited by pre-existing or cross-reactive immunity. In addition, CAVs that express additional payloads, such as other canine pathogen peptide / protein vaccines, present the ability for tire development of multivalent vaccines. Similarly, canine OVs that can be engineered to selectively replicate in and kill tumors or express therapeutic payloads have several applications.

[0247] A key requirement to enable tire development of CAVs is a platform to systematically modify and assemble recombinant CAV genomes. Canine adenovirus genomes present a challenge for genetic manipulation due to their large size (~31 kb), compact and complex gene organization and relatively un characterized transcriptional and post-transcriptional regulation. Traditional methods for modifying the genome rely on homologous recombination or other cumbersome ‘one-at-a time’ molecular cloning or synthesis approaches that are not scalable. These approaches lack scalability and throughput, making it7158-101791-02

[0248] difficult to generate large libraries of viral variants for research, vaccine and vector development. To address this, disclosed herein is a platform to engineer and assemble recombinant CAVs from libraries of modular parts in one, two or three steps, with high efficiencies, amenable to high-throughput screening of modular plasmid libraries and virus assembly and whereby the engineered recombination sites and / or restriction sites do not impact wild-type virus replication.

[0249] IV. Modular Assembly of Recombinant CAV Genomes

[0250] Disclosed herein is a platform to engineer and assemble recombinant CAVs from libraries of modular' parts in a single recombination step, or alternatively, in two or three steps, with high efficiencies, amenable to scalable screening of virus variants, as well as scarless assembly methods, with modifications in genomic modules, and combinatorial assembly, whereby the engineered recombination sites and / or assembly methods do not diminish vims replication competence.

[0251] The understanding of adenovirus biology and engineering Ads for therapeutic and research applications is almost exclusively based upon and extrapolated from studies with human subgroup C adenovirus, particularly Ad5 and Ad2. The latter were among the first to be discovered. In addition, a convenient legacy of shuttle plasmids has been developed over decades to enable engineering of human adenoviruses as gene therapy vectors, vaccines and oncolytic viral therapies. Ad5 is the best studied member and much of what is known about adenovirus genes, structure, transcription and functions are extrapolated and based upon Ad5, including genome annotation (FIG. 3). However, a need exists for tools and methods that enable the study and engineering of adenoviruses from other species, such as canine adenovirus (FIG. 4), which significantly diverge from human adenoviruses (FIG. 2 and 5) and by comparison are poorly characterized and with a dearth of tools to engineer them systematically.

[0252] There are two canine adenovirus subgroups, designated CAV1 and CAV2, which share 83% sequence homology (FIG. 5). The CAV genomes are smaller than the genomes of human adenoviruses, approximately 31 kb compared to 36 kb for human Ad5. CAV1 / CAV2 have only 45% homology to human adenovirus. Human Ad and CAV exhibit the most significant diversity in tire El, E3 and E4 regions (FIG. 5), whereas the structural proteins, while still divergent, share the greatest homology. In contrast CAV1 and CAV2 are highly similar to each other (FIG. 5A), and also to tire genomes of other animal adenovirus species, such as bat and skunk adenoviruses (FIGS. 2 and 5B). The most notable difference between CAV1 and CAV2 is that CAV1 has a deletion in the E3 region, which corresponds to the putative E3-ORF2 annotated coding sequence and would result in truncation. Thus, in view of this genomic similarity, the assembly methods disclosed herein, which are exemplified using CAV2, can be extended to all CAVs. The design principles and assembly methods disclosed herein can also be extrapolated to other adenovirus species with genomic similarity, such as bat and skunk adenoviruses.

[0253] A major aspect of synthetic biology is tire design of genetic systems that can be assembled in a modular fashion (Purnick and Weiss, Nat Rev Mol Cell Biol 10(6) :410-422, 2009). Modular systems have the advantage of containing libraries of standardized compatible parts that can quickly and easily be7158-101791-02

[0254] assembled into new genetic devices. No such platform exists for the assembly, engineering and screening of wildtype and recombinant CAV genomes. While smaller sized viral genomes can be easily manipulated on a single plasmid using standard cloning techniques, larger genomes are more difficult to alter. Some methods that have been used previously to create modified CAV genomes include: (1) homologous recombination (De Vleeschauwer etal., Vaccine 36(16): 2193-2198, 2018; Szelechowski et al., J Vis Exp 82: 50833, 2013; Le et al., J Gen Virol 86(Pt 12): 3201-3208, 2005; Fischer et al., Vaccine 20(29-30): 3485-3497, 2002) and (2) restriction enzyme cloning using available endogenous restriction sites (Li el al., Infect Genet Evol 45: 447-453, 2016; Yu el al., Plasmid 77:1-6, 2015). Neither of these methods are amenable for both efficient high-throughput production, modular and combinatorial engineering and assembly of CAV functional modules in different permutations. The present disclosure meets an unmet need by providing modular' CAV genome assembly platforms that allow for tire rapid and systematic assembly of a wide variety of recombinant CAVs.

[0255] A. CAVsembly and CAVSLIC genome module design

[0256] The methods disclosed herein apply the principle of modularity to CAV genome construction in order to provide a platform for the rapid assembly of whole viral genomes from a library of standardized compatible parts.

[0257] Adenoviral genomes have a natural modular-like genomic structure whereby genes cluster in groups of shared transcriptional elements and general protein functions, which is conserved between Ads of different species including hAd5 and CAV1 / CAV2 (FIG. 6). The disclosed methods exploit some of the natural modularity based on (1) native conserved viral gene clusters and organization that are predicted to have shared functional and transcriptional regulation; (2) the estimated frequency of desired engineering within each module; and (3) identification of genomic regions between genomic modules / regions that were predicted to be amenable to engineering and segmentation and tolerate the introduction of additional sequences, such as SSRs or restriction enzyme sites that facilitate modular assembly but do not negatively impact viral replication competence.

[0258] To facilitate the assembly and engineering of synthetic recombinant CAVs, the CAV genome (FIG. 7, top panel) was split into four CAVsembly / CAVSLIC functional genomic fragments and modules (FIG. 7, bottom panel). The CAV genome was defined and fragmented into modules based on the following principles and specifications:

[0259] (1) native conserved viral gene clusters and organization that are predicted to have shared functional and transcriptional regulation across species and enable assembly of potentially chimeric CAVs (FIG. 6). Adenoviral genomes have a natural modular-like genomic structure whereby genes cluster in groups of shared transcriptional elements and general protein functions, which is conserved between Ads of different species including hAd5 and CAV1 / 2 (FIG. 6);

[0260] (2) the estimated frequency of desired engineering within each module;

[0261] (3) identification of genomic regions between genomic modules / regions that were predicted to be amenable to engineering and segmentation and tolerate the introduction of additional sequences such as7158-101791-02

[0262] SSRs or restriction enzyme sites that facilitate modular assembly but do not negatively impact wild type virus replication kinetics. To avoid amino acid sequence changes, module segmentation within coding regions was avoided, and regions outside of suspected regulatory regions and sequences were chosen to minimize disruption from introduction of SSR sites or restriction enzyme site engineering / ablation. Genomic regions containing sequences amenable to the creation of “scarless” unique restriction enzyme sites for linearization of module plasmids were also designed and genetically engineered and modified (see below); and

[0263] (4) have conserved sequence motifs that would facilitate and enable the exchange and assembly of Ad genomic modules across and between species, such as, for example, between Ad5 and canine Ads or more closely related Ad species, such as bat and canine adenoviruses.

[0264] To facilitate the assembly and engineering of synthetic recombinant CAVs, the CAV genome was defined and split into four CAVsembly / CAVSLIC functional genomic fragments and modules. The CAV2 genome, which is 31,232 base pairs in length, was divided into four genome modules (FIG. 7), referred to as the CAV El genome module, the CAV core genome module, the CAV E3 genome module and the CAV E4 genome module, which are defined as follows:

[0265] CAV El genome module (FIG. 8): Spans from the left-hand internal terminal repeat (1TR) through the El genes and the predicted TATA box for pIX. The E1A and E1B gene products encoded within this module are essential for viral replication. These genes can be deleted for the assembly and production of recombinant non-replicating CAV vectors.

[0266] CAV core capsid genome module (FIG. 9): Includes the early / intermediate genes, pIX and IV A2; the major late promoter (MLP) and transcriptional unit that drives the expression of CAV capsid and late proteins, including: 52 / 55k, pllla, penton, pVII, pV, pX, pVI, hexon, endoproteinase, 100k, 22k, 33k (22k / 33k are putative annotations) on the positive strand. On the negative strand, the E2 transcriptional unit drives the expression of the viral DNA replication proteins, including E2A DNA binding protein (DBP), pTP (terminal protein) and E2B DNA polymerase.

[0267] CAV E3 genome module (FIG. 10): Includes the MLP transcribed late protein pVIII and fiber genes, and the E3 protein coding genes (E3-ORF1, E3-ORF2) on the positive strand, and the U exon on the negative strand. The E3 encoded ORFs are highly variable among adenoviruses and diverge within and between subgroups and animal species.

[0268] CAV E4 genome module (FIG. 11): Includes the right ITR and the E4 transcriptional unit and protein coding genes are on the negative strand. The E4 genes play important functions in usurping host cell signaling pathways and functions to facilitate viral replication in human Ads and likely canine Ads. In CAV, there are five predicted and annotated ORFs, which include from right to left, E4-ORF1, E4-ORF2, E4-ORF3, E4-ORF4 and E4-ORF5.

[0269] The modular organization and genomic module design are identical in CAV1 and CAV2, despite sequence-level differences (FIG. 5A). Although the CAV2 genome is exemplified herein, the disclosed7158-101791-02

[0270] methods extend to and include CAV1 and other CAV strains, which have a conserved viral genome module architecture and organization.

[0271] The CAV genomic modules can then be assembled together to create whole recombinant CAV genomes in either a single reaction using multi-site specific recombination or seamless cloning methods, where genomes are sequentially assembled and manipulated via intermediary macromodule plasmids to create whole genomes.

[0272] The goal was to create a scalable platform in which a complete CAV genome could be assembled via multi-site specific recombination and seamless cloning methods (FIGS. 12-13) from smaller functional genomic plasmids that could be systematically propagated in bacteria, modified and assembled in different combinations.

[0273] El, E3 and E4 plasmid modules are compatible with both CAVSLIC and CAVsembly cloning systems. Core modules are designed to be used with CAVSLIC and / or CAVsembly. The CAVSLIC core modules contain restriction enzyme cleavage sites at the module junctions, while the CAVsembly core modules contain negative selection cassettes, such as for example ccdB or Phe / S flanked by Gateway® recombination sites at the left and right module junctions (FIG. 12).

[0274] B. CAVsembly / CAVSLIC platform plasmids and design

[0275] For the assembly methods disclosed herein, the CAV genome was fragmented into four CAVsembly / SLIC module plasmids that can be assembled into a complete genome via engineered site specific recombination (SSR) sites or scarless assembly methods to create recombinant CAV genomes. To avoid amino acid sequence changes in CAV protein coding genes due to insertion of SSRs or restriction sites, module segmentation within coding regions was avoided as well as predicted regulatory regions and sequence motifs. Genomic regions containing sequences amenable to the creation of “scarless” unique restriction enzyme sites for linearization of module plasmids were also designed. Furthermore, consideration was given to the presence of native viral gene clusters, and the estimated frequency of desired mutagenesis within each module. To facilitate the introduction of genome modifications, as well as PCR amplification and Gibson assembly without introducing PCR errors at high frequency, the El, E3 and E4 modules were designed to be of a size that would be amenable to faithful PCR amplification (generally <10,000 bp).

[0276] C. Multi-site CAVsembly recombination

[0277] Of the available methods for tire assembly of multiple genetic parts in a single reaction, Multisite Gateway SSR assembly methods and sequences were selected. This strategy allows for tire joining of four segments of DNA contained within circular ‘entry plasmids’ with a circular destination (DEST) plasmid.

[0278] Recombiiiational cloning techniques, such as tire Gateway® cloning system, uti lize paired DNA sequences and a cocktail of site-specific recombinase enzymes with endonuclease and ligase properties. Multiple paired sites can be used in a single reaction tube. With unique pairs of DNA sequences for each insert location, ordered assembly of modules can occur in a single reaction tube. This rapid method7158-101791-02

[0279] allows for complete genome assembly without module linearization, but consequentially leaves residual recombination sequences at the module junctions. This system is referred to as CAVsembly.

[0280] CAVsembly is a single-tube reaction requiring just the plasmids and LR Clonase II plus enzyme mix (FIG. 35).

[0281] Muti-site Gateway recombination involves the use of site-specific recombination sequences, called att sites. In multi-site Gateway recombination, att site sequences are designed and inserted at module junctions to enable multisite gateway assembly. There are 4 classes of att sites called atB, attP, allL, and atR.

[0282] CTGCTTTTTTGTACAAACTTG attBl (SEQ ID NO: 57) CAGCTTTCTTGTACAAAGTTG attB2 (SEQ ID NO: 58) CAACTTTATTATACAAAGTTG attB3 (SEQ ID NO: 59) CAACTTTTGTATACAAAGTTG attB4 (SEQ ID NO: 60) CAACTTTTGTATACAAAGTTG attB 5 (SEQ ID NO: 61)

[0283] attB sites react with attP in a BP clonase reaction, generating attL and attR sites. attL and attR sites recombine with each other in an LR reaction, regenerating attB and attP sites. Since attB sites are the smallest sequences, the modular assembly system was designed such that CAV genome modules El, E3, E4 and core Dest plasmids had attL and / or attR sequences, such that upon recombination, they would assemble CAV genome modules in a site-specific manner, leaving the smaller attB sequence in the completely assembled CAV genome. This design was to ensure that the insertion of foreign sequences from att site recombination was minimized. This is one aspect, based on this design consideration, but other aspects include engineering attB and / or attP sites in CAV genome modules and performance of a BP reaction instead. This system is referred to as CAVsembly. CAVsembly is a single-tube reaction requiring just the plasmids and LR Clonase II plus enzyme mix (FIG. 12 ).

[0284] To increase the efficiency of the reaction, the CAV core module was converted and cloned into either a dual DEST plasmid with left and right att-ccdB cassettes (FIG. 61 and 62B) that can be assembled with El, E3 and E4 modules, or alternatively, single DEST plasmids, where El and E3 / E4 modules are assembled via a combination of LR recombination and scarless Gibson cloning methods (FIG. 66).

[0285] The El, E3 and E4 modules are cloned into specialized Entry plasmids with compatible multi-SSR recombination sites and other engineered features. The att sites shown in exemplary sequences are an example of one aspect and different att sites in El, E3, E4 and core can be used as long as the final genome is assembled in tire correct linear sequence via complementary SSR sites between the El, core, E3 and E4 plasmid modules. The process of in vitro whole genome reassembly in a single reaction then simply involves combining at least one of each of the four modules in a multisite gateway LR reaction (Invitrogen).

[0286] In some aspects, performing an in vitro multi-site LR recombination reaction with El, E3 and E4 module plasmids with a core destination plasmid includes (i) transforming into a bacterial host, wherein7158-101791-02

[0287] only correctly recombined plasmids are selected and propagated based on different antibiotic resistance and negative selection cassettes in entry and Dest plasmids; or (ii) alternatively, transfecting the LR reaction directly into a mammalian cell, wherein only a correctly recombined plasmid containing all viral genome modules in correct linear assembly and flanking ITRs supports genome linearization and productive viral replication in the mammalian cell.

[0288] Thus, complete CAV genomes can be assembled from four modular parts in a Multisite Gateway reaction with LR clonase enzyme mix II in vitro. This process is termed “CAVsembly”.

[0289] (1) Design considerations and specifications for El-core module att site placement Due to the insertion of foreign att site sequences in the recombined CAV genome, the att site sequences and placements in tire CAV genome were carefully designed using tire following considerations:

[0290] 1. Att site sequences were placed in CAV genome non-coding elements to ensure that attB sequences in an assembled CAV genome did not contribute to or alter predicted CAV protein coding genes.

[0291] 2. Splitting CAV genome modules at non-coding junctions between CAV genes, and placement of att sequences at sequences that were predicted to minimally impact the replication and functions of assembled recombinant CAV genomes.

[0292] 3. Compatibility of recombination sequences and genome modules with hAd5 Adsembly modules and across Ad species.

[0293] In a previous design of a multi-site gateway recombination system for Ad5 (U.S. Patent No. 9,217,160), three different att site placements at the El module junction were empirically determined and tested (FIG. 14), two of which were between pIX and IVA2 sequences and the other between El B-55k and PIX. Of these, the placement at the ElB-55k-pIX junction had the least impact on recombinant Ad genome virus replication. Given the lack of homology between Ad5 and CAVs (FIG. 5), it was unknown where to place att sites in a CAV genome. However, based on significant compaction of non-coding sequences between CAV pIX and IV A2 compared to Ad5 (FIGS. 15A-15B), it was hypothesized that placement of att sequences at that site would have greater potential to disrupt CAV gene expression, packaging or replication, although one design is immediately following the pIX stop codon before predicted poly A sequence (FIG. 15). Therefore, El / core modules were split for assembly via an engineered attR4 site preceding a predicted conserved Kozak consensus motif (G(A)CC ATG) sequence for pIX (FIGS. 16 and 17).

[0294] (2) Design considerations for placement of att sites at Core and E3 module junctions The present disclosure provides a method for designing breakpoints between E3 and core modules, ensuring compatibility with both scarless and multisite recombination assembly systems, while maintaining functional viral replication.

[0295] In hAd5, the promoter for the E3 immunomodulatory genes is embedded in the pVIII sequences. Since it was desirable to engineer E3 genes and exploit this region for heterologous ORF expression, the7158-101791-02

[0296] core module was split before the start of pVIII. There is a large divergence in sequence homology between Ad5 and CAVs at the predicted pVIII junction (FIG. 20). The annotation of CAV genes in the NCBI database is largely hypothetical, relying on computational predictions rather than experimental validation. Thus, it is not known whether CAVs encode a homologue of tire 22k and 33k genes, which are hypothetical. Therefore, selecting an appropriate breakpoint between the E3 and core modules was challenging.

[0297] It was desirable for the CAV genome modules to be compatible wi th previously described human Adsembly modules (see U.S. Patent No. 9,217,160) and to minimally impact CAV assembled genomes. The design also required that assembly of core modules with E3 modules be achieved using two general methods, multisite-SSR recombination and scarless assembly.

[0298] The following sites were selected and engineered with these general specifications:

[0299] 1. A breakpoint before pVIII ensuring compatibility with human adenovirus Adsembly modular recombination platform.

[0300] 2. Exploit conserved motifs to define breakpoint selection and avoid disruption of viral gene expression.

[0301] 3. Engineering a unique restriction in core plasmid sequences, such that it could be linearized and assembled with E3 and E4 modules without leaving or adding additional sequences in SLIC / Gibson protocols.

[0302] The noncoding regulatory sequence before pVIII and hypothetical 22k and 33k sequences in CAV are not well annotated and very poorly conserved, as indeed are coding sequences. Also, differential splicing has not been studied between human and canine Ad species and is poorly understood. However, upon further consideration and analysis, it was chosen to design the insertion site for the right att site in the core module after a predicted stop for a putative 33k spliced product and a potential conserved alternative splicing sequence GCA motif upstream of ATG for pVIII (FIG. 20). However, it was unknown if this would be compatible with CAV replication.

[0303] By implementing this genomic segmentation strategy, tire present disclosure enables efficient, high-throughput assembly of CAV-based recombinant vectors and vaccines, facilitating precise modular recombination while maintaining viral integrity.

[0304] (3) Design considerations for breaking and engineering att site sequences at the E3 module and E4 module junction

[0305] In prior Ad5 engineering, placing a recombination site after the fiber stop codon negatively impacted viral replication, which was hypothesized to be due to interruption of fiber poly A sequences at the junction (FIG. 14). However, placement of an att site upstream of predicted Fiber and E4 poly A sequences was better tolerated and conferred improved virus replication properties of assembled Ad5 genomes (FIG. 23).

[0306] However, the CAV E4 and fiber gene coding and non-coding sequences are poorly conserved (FIGS. 5, 23 and 24), presenting a major challenge. There is a lack of knowledge on post-transcriptional7158-101791-02

[0307] regulatory motifs, poly A usage and alternative splicing patterns in CAVs. Thus, it was unknown prior to the present disclosure where to place att sites such that attB site sequences in assembled genomes would not impact CAV virus replication and result in a significant loss in titer.

[0308] Given the lack of sequence conservation in CAVs, the challenge was to engineer a recombination site that (1) did not interfere widr viral replication; (2) allowed seamless recombination of E3 and E4 modules; and (3) maintained viral replication competency.

[0309] Shown in FIG. 24 are predicted non-canonical motifs and possible conserved regulatory motifs in CAV at fiber and E4 gene non-coding junctions. Based on these analyses and desirability to be compatible with Ad5 modular exchange, an att site was placed before a possible E4 poly A sequence motif on the minus strand and before a predicted fiber poly A on tire plus strand. This is tire general specification for die placement of att sites at the E3-E4 junction. The recombined attB sequence predicted in the CAV genome assembled upon E3 and E4 module LR reaction and multi-site gateway recombination is shown.

[0310] A second alternative att site placement is also disclosed herein, as indicated in FIG. 25, in case att site insertion at the first placement disrupted a non-annotated but hypothetical alternative splicing event that could produce an E4-ORF6 / 7 homolog to that in hAd5. No such ORF is predicted or annotated in the CAV reference genome. However, the proposed and specified alternative att site placement would also satisfy the criteria and is predicted not to interfere with fiber poly A sequences but prevent changes due to inclusion of attB sequences to the last 6 amino acids in the C-terminus of a theoretical alternative splicing event that produces an E4-ORF6 / 7 homolog.

[0311] D. Seamless assembly of CAV genomes

[0312] While CAVsembly provides a system to rapidly generate viral genomes from multiple parts in a single in vitro reaction, there are instances where the presence of recombination sites would be undesirable, for example in a clinical candidate or due to attenuation of recombinant viral replication or functions. In order to address this, a parallel approach to genome construction was developed that uses the same modular entry vectors as CAVsembly, but reassembles the whole CAV genome in a seamless fashion. This can be accomplished using sequence and ligation independent cloning (SLIC), Gibson or Infusion, which seamlessly link linear DNA fragments containing short lengths of overlapping sequences. Seamless cloning can also be achieved using other methods, such as restriction enzyme digestion and ligation-dependent cloning, but drese methods are less efficient, especially for multifragment assemblies of large nucleic acids (> 12 kb). In order to reassemble the CAV genome using SLIC, the core module was linearized with unique restriction sites that were engineered on each end of the CAVsembly / SLIC core genome plasmid module sequence. In addition, other instances of these restriction enzymes in the E4 genome module were ablated.

[0313] Ligation-independent cloning techniques, such as Gibson assembly and one-step SLIC, utilize a combination of enzymes (exonuclease, polymerase and ligase) to allow for seamless cloning without junction scars. For efficient assembly with large genome plasmids, such as with core, modular' assembly7158-101791-02

[0314] can be performed sequentially with El, E3 and / or E4 modules (FIGS. 36, 37, 42, 49, 51, 53). As complete modular assembly decreases with the number of modules in the reaction, “macromodule” plasmids of intermediate assemblages lacking one or more modules can be generated (e.g., El-core macromodule or E3-E4 macromodule). Macromodule plasmids are then combined with the missing module(s) to create plasmids containing the full virus genome. This approach is advantageous for generating multiple viruses with a host of genome variations common to a defined module. CAVSLIC can be used to assemble modules in the following orders:

[0315] 1. Core + El, +E3, +E4

[0316] 2. Core +E1, +E4, +E3

[0317] 3. Core +E1, +E3 and E4

[0318] 4. Core+E3, +E4, +E1

[0319] 5. Core-i- E3 and E4, +E1

[0320] 6. Core+E4, +E3, +E1

[0321] 7. Core+E4, +E1, +E3

[0322] CAVSLIC (and Gibson) requires DNA linearization for module assembly (see Examples). El, E3 and E4 modules can be linearized, for example, using PCR (generally <10,000 bp). Core and macromodule plasmids are large and amplification and linearization by PCR risk die introduction of PCR enzyme induced mutations even with the highest fidelity PCR enzymes, and has a low yield that is not optimal for systematic assembly and cloning. Therefore, for linearization of core plasmids, unique restriction enzyme sites were engineered that enable scarless assembly of El modules on the left, and E3 and / or E4 modules on the right, respectively (FIG. 35, left).

[0323] The core module is linearized with unique restriction sites that were engineered and designed at module junctions. The linearized core is then joined by SLIC / Gibson with PCR linearized El or E3 and / or E4 modules with overlapping homologies (generally 22bp). In another aspect, the El, E3 and E4 plasmids could be linearized via unique restriction sites flanking homology sequences cloned within plasmids. CAVSLIC assembly is a two or three step process that requires transformation and screening after each round of SLIC / Gibson. However, this also presents the opportunity to create “macromodule” plasmids that contain a core module along with 1 or 2 of either an El, E3, or E4 module. These macromodules then allow for a simple one-step SLIC assembly when making frequent manipulations within only one or two genomic regions. Thus, using the same modular vectors designed for CAVsembly, PCR and SLIC / Gibson can be used in two steps in order to complete a CAV genome with few or no nucleotide insertions.

[0324] (1) Design considerations for engineering restriction sites at CAV core genome modules junction breakpoints for scarless reassembly

[0325] As shown in FIGS. 18-19, the non-coding sequence at die junction between the E1B-55K gene and pIX was selected as die breakpoint for cloning El and CAV genome modules into Entry and Dest plasmids, respectively. To design a parallel method for scarless assembly, whereby no residual sequences were left on the CAV modules, and whereby a universal strategy could be envisaged to enable similar methods and plasmids, the following design considerations and features were incorporated:7158-101791-02

[0326] 1) The unique left and right restriction enzyme sites may not be present in the core genome module or plasmid backbone (FIG. 18).

[0327] 2) Enzyme sites are ideally engineered to leave scarless seams upon exonuclease treatment and SLIC / GIBSON of El and core genome modules.

[0328] The following are examples of commercial enzymes that could be used based on consideration (1): AbsI, Ahll, Asci, AsiSI, Bcul, Bglll, Cpol, CspI, Fsel, I-Ceul, I-Ppol, I-Scel, Mssl, Pad, PalAI, PI-PspI, Pl-Scel, Pmel, Rgal, RigI, RsrII, Rsr2I, Sall, SfaAI, Sgfl, SgrDI, Sgsl, Smil, Spel, Srfl, and Swal.

[0329] Some of these were excluded based on criteria (2) and whether readily available, robustness in different conditions and efficiency of digestion and expense. In addition, enzymes that only cut once within the CAV E1 / E3 / E4 genome sequences were considered: Bglll, Pact, Swal, Spel, and Sall.

[0330] Any of these examples could be used but require ablation of sites in E1 / E3 / E4 modules, if sequential assembly (with any order) of an E1 / E3 / E4 module scarless assembly is used.

[0331] Pad is one example that fulfills the above-listed criteria. This was chosen as the enzyme for the assembly methods described herein as the conserved TATA promoter box motif provides half a Pad site, and is conserved across species, enabling compatible assembly and exchange of sequence elements from different Ad species, if desired (FIG. 19).

[0332] The 3-nucleotide sequence TAA in the TATA of pIX can be used to form half a Pad cut site of TT A ATT A A with the remainder engineered on cloning into a core SLIC module plasmid. Upon subsequent cutting with Pad and treatment with exonuclease, there is no residual nucleotides from the engineered plasmid Pad site, enabling scarless assembly in SLIC and Gibson with PCR amplified El modules (FIG. 19). Similar strategies could be used with the sequence AAAT and Swal.

[0333] The right half of the Pad site was engineered into the CAV core plasmid genome backbone, such that upon Pad digestion and exonuclease treatment, scarless assembly could be achieved. Furthermore, overlapping complementary sequences (such as about 15 nucleotides) are included in the core and El plasmid modules to facilitate hybridization and assembly of linearized El and core modules upon exonuclease digestion in SLIC and Gibson protocols. Incorporation of overlapping sequences between El and core modules allows for facile assembly using short primers. An alternative aspect is to incorporate overlaps with core module sequences into design of longer primer sequences for El module linearization via PCR.

[0334] (2) Considerations for design of restriction enzyme sites and breakpoints for Core and E3 module scarless assembly

[0335] To design a parallel method for scarless assembly whereby no residual sequences were left on the CAV modules, and whereby a universal strategy could be envisaged to enable similar methods and plasmids, the following design considerations were incorporated:

[0336] 1) Restriction enzyme site may not be present in the core genome module or plasmid backbone (FIG. 21), and must be distinct to restriction enzyme site at the left of the core module (for example Pad, used for assembly of El modules).7158-101791-02

[0337] 2) Enzyme sites are ideally engineered to leave scarless seams upon exonuclease treatment and SLIC / GIBSON of El and core genome module.

[0338] Bglll is one example that fulfills these criteria (FIG. 21). The “A” of the predicted GCA regulatory motif was chosen as the lefthand of the Bglll site and the GATC to complete site engineered into the CAV core genome module backbone, such that upon linearization of core module with Bglll, scarless assembly where no residual sequences are added can be achieved upon exonuclease digestion and complementary sequences designed in primers to linearize and amplify E3 and / or E4 modules (FIG.

[0339] 22).

[0340] Alternative scarless assembly enzymes include Swal, which is also compatible with a Swal site in AdSLIC, but would require ablation of Swal site in CAV El genome plasmid.

[0341] A third example is RsrII, but this would result in residual base pairs (CG) at the junction between core and pVIII on the E3 module.

[0342] (3) Design considerations for E3 and E4 scarless breakpoints and assembly.

[0343] Since it was desirable to also assemble E4 modules with core-El or El-core-E3 macromodules without leaving any residual sequences, the following specifications and considerations were designed in E3 and E4 genome plasmid modules and / or primers for scarless assembly in SL1C or Gibson.

[0344] To enable assembly of core or El -core macromodules with E3 and E4 modules in a single step or sequential steps and in any order (E3 or E4 first), it was desirable to use the same Bglll site engineered in the core plasmid backbone to assemble the core with E3, E4, or E3+ E4 modules simultaneously.

[0345] Therefore, using Bglll as a non-limiting example, E3 and E4 module breakpoints and assembly junctions were designed (FIG. 26), such that:

[0346] i) A T / A sequence 3’ of att site placement was used as part of a Bglll site for scarless assembly of core or core-E3 modules linearized with Bglll and assembled with primer encoded overlapping sequences between E3 and E4 upon exonuclease treatment in SLIC and Gibson DNA assembly protocols.

[0347] ii) The alternative att site placement that prevents possible disruption of putative unannotated E4- ORF6 / 7 alternative spliced ORF also has a T / A sequence for a similar Bglll scarless assembly schema and principles of design.

[0348] The residual from tire Bglll site will be an “A” when adding an E4 module to a core-E3-containing macromodule. The residual from the Bglll site will be a “T” when adding an E3 module to an E4-con tabling macromodule. The design of module lift out primers leads to no changes from WT sequence for either case. In the case of assembly of an E4 module with a core module, a Bglll site is regenerated at tire 5’ end of die E4 module junction widr core for subsequent incorporation of an E3 module. In case of assembly of an E3 module widi core, a Bglll site is created at die 3’ end for scarless assembly of an E4 module. The Bglll site is absent in the final assembled virus genome plasmid.

[0349] To enable flexible and scarless assembly of core modules with El, E3 and E4 CAV genome modules in any order, a Pact site and a Bglll site in the CAV E4 genome sequence were ablated by7158-101791-02

[0350] engineering degenerate and silent mutations in predicted E4-ORF coding sequences (see Example 2). The predicted coding sequences are unaltered but the Pact and Bglll sites are eliminated, enabling flexible assembly of El and E3 / E4 modules at the left and right end of core module, respectively, in any order.

[0351] E. Cav Entry and Dcst plasmid backbones

[0352] Each of the plasmids making up the whole CAV2 genome (El, E3, E4, and Core) are flanked by specific Gateway reaction sites such float a multisite Gateway reaction will assemble each piece in the proper order. In addition, the core plasmid contains an ampicillin resistance cassette. The core plasmid also has a ccdB negative selection and chloramphenicol resistance cassette flanked by attRl / attR2 on the righthand side of the CAV core genome module, and attR5 / attR2 on the lefthand side of the core module. The El, E3, and E4 plasmids contain a kanamycin resistance cassette. A successful multi-site Gateway reaction between the Core, El, E3 and E4 plasmids, will recombine out the ccdB / chloramphenicol cassettes in the core plasmid for CAV genome sequences and when transformed into bacteria strains without ccdB resistance genes and plated onto LB + ampicillin will only produce colonies when all four plasmids have assembled a complete genome in the proper position and order.

[0353] Instead of tire ccdB gene, alternative negative selection markers could be used to eliminate unwanted plasmid intermediates, such as the following toxin-based counterselection markers:

[0354] • SacB (sucrose sensitivity): Expression of sacB from Bacillus subtilis makes bacteria sensitive to sucrose (e.g., 5-10% sucrose for selection).

[0355] • Hok / Sok toxin-antitoxin system: Hok encodes a lethal toxin, while Sok antisense RNA neutralizes it; loss of Sok leads to bacterial death.

[0356] • MazF toxin system: MazF cleaves cellular mRNA and kills cells unless repressed or removed via recombination.

[0357] • ParE / ParD system: A toxin-antitoxin pair where loss of the protective ParD leads to toxicity from ParE.

[0358] F. Core and whole genome plasmids

[0359] All core and CAV genome plasmids have a low copy origin of replication. In the examples provided herein, the origin of replication is pl5A. However, other low copy origins of replication could be used as a substitute.

[0360] As discussed above, the CAVsembly method leaves Gateway remnants leftover at each of the junctions between El, Core, E3, and E4. To avoid these remnants, CAVSLIC can be used. The same El, E3, E4, and Core plasmids are used as the starting point, but with two unique restriction sites in the core plasmid at locations appropriate for inserting the El and E3 / E4 entry vectors.

[0361] G. Applications and Advantages of CAVSLIC and CAVsembly

[0362] The CAVsembly and CAVSLIC systems enable the efficient generation of recombinant CAV genomes, facilitating the rapid design and production of novel vaccines, OVs and other therapeutics. The modular approach offers several advantages:

[0363] 1. Efficient Heterologous Protein Expression:7158-101791-02

[0364] The E3 region serves as a cargo space for the insertion of heterologous genes, such as genes encoding antigens (for vaccines), enabling the generation of multivalent vaccines expressing protective antigens from pathogens of interest.

[0365] 2. Genomic Integrity and Stability:

[0366] Scarless assembly ensures that the genome architecture remains intact, minimizing the risk of recombination events and genomic instability.

[0367] 3. Customizable Therapeutic Platforms:

[0368] By using modular assembly, researchers can easily swap transgenes, optimize expression cassettes, or introduce therapeutic payloads, creating tailored vaccine or other therapeutic platforms for different indications.

[0369] 4. Rapid Iterative Development:

[0370] The ability to assemble intermediate macromodules facilitates the rapid testing of vaccine or therapeutic candidates, enabling the identification of optimal designs before final genome assembly.

[0371] The CAVsembly and CAVSLIC systems described herein provide an efficient, flexible, and scalable platform for the assembly of synthetic CAV genomes, enabling the development of live, replication-competent CAVs as well as replication-incompetent CAVs. By dividing the genome into functional plasmid modules, this system allows for the precise engineering of viral strains, ensuring efficient transgene expression, genome stability, and high-yield viral production.

[0372] The disclosed methods also provide for the rational design and assembly of CAV genomic modules, enabling recombination across viral species and facilitating the insertion or exchange of functional elements with minimal disruption to viral replication. By selecting optimal breakpoints, leveraging scarless assembly methods, and incorporating functional modularity, this system overcomes existing limitations in CAV vector and vaccine engineering, enabling new therapeutics.

[0373] V. Canine Adenovirus (CAV) Assembly Methods

[0374] Disclosed herein are methods for the modular assembly of canine adenovirus (CAV) genomes, referred to as CAVSLIC and CAVsembly. The present disclosure provides a system for the modular assembly of CAV genomes, facilitating the construction of customized CAV-based vectors, such as for vaccination, gene therapy, and oncolytic virus therapeutic applications. This system, referred to as the CAVsembly and CAVSLIC (sequence and ligation-independent cloning) system, enables the precise and efficient assembly of full-length CAV genomes from plasmid-based genomic modules through sitespecific recombination and scarless assembly techniques.

[0375] The modular assembly platforms allow a CAV genome to be split into four functional genomic modular' plasmid units (“modules”) and libraries of parts that can be engineered and efficiently assembled in different combinations. The modular' units are assembled using multi-site recombination (CAVsembly) and / or a seamless cloning method (CAVSLIC) to create synthetic CAV vectors or fully7158-101791-02

[0376] replication-competent CAV that can be produced to high titers for gene therapy, oncolytic therapy, vaccine and other applications.

[0377] Provided herein are methods of generating a recombinant CAV genome. In some aspects, the method includes assembling a nucleic acid molecule from four CAV plasmid modules, wherein each plasmid module corresponds to a portion of the CAV genome. In some aspects, the four CAV plasmid modules include: a CAV El plasmid module including CAV genome sequence from the left ITR to noncoding sequence located between the E1B-55K ORF and the pIX ORF; a CAV core plasmid module including CAV genome sequence from non-coding sequence prior to tire pIX ORF to non-coding sequence immediately prior to the pVIII ORF; a CAV E3 plasmid module including CAV genome sequence from the non-coding sequence prior to tire pVIII ORF to non-coding sequence following the fiber ORF; and / or a CAV E4 plasmid module including CAV genome sequence from the non-coding sequence following the fiber ORF to the right ITR.

[0378] In some aspects, the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module, and / or the CAV E4 plasmid module include site-specific recombination (SSR) sequences flanking the CAV genome sequence. In some examples, the El plasmid module further includes a recognition site for a rare-cutting restriction endonuclease situated between the recombination site sequence and the left ITR. In some examples, the E4 plasmid module further includes a recognition site for a rare-cutting restriction endonuclease situated between the recombination site sequence and the right ITR. In particular examples, the rare-cutting restriction endonuclease is I-Scel, which has an 18-base pair recognition sequence. In other examples, the rare-cutting restriction endonuclease is Ceul, I-Ppol, I-Crel, PI-PspI, or Pl-Scel. In some examples, the rare-cutting endonuclease has a recognition sequence of at least 12 base pairs, at least 13 base pairs, at least 14 base pairs, at least 15 base pairs, at least 16 base pairs, at least 17 base pairs, at least 18 base pairs, at least 19 base pairs, at least 20 base pairs, at least 21 base pairs, or at least 22 base pairs. In specific examples, the rare-cutting endonuclease has a recognition sequence of about 12 to about 22, about 15 to about 22, or about 18 to about 22 base pairs.

[0379] In some aspects, the CAV El plasmid module, the CAV E3 plasmid module and / or tire CAV E4 plasmid module further include an antibiotic resistance gene. In some examples, the antibiotic resistance gene is a kanamycin resistance gene.

[0380] In some aspects, the CAV El plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module further include an origin of replication. In some examples, the origin of replication is a pMBl origin of replication.

[0381] In some aspects, tire CAV El plasmid module, die CAV E3 plasmid module and / or the CAV E4 plasmid module furdier include one or more terminator sequences. In some examples, die plasmid module includes one or more engineered transcriptional terminators (such as T7Te, rrnB Tl, or tonB) positioned upsteam and / or downstream of the CAV sequences to prevent toxicity and enable scalability and efficiency during propagation of CAV genome modules in the bacterial host. The terminators are7158-101791-02

[0382] configured to prevent unintended transcription initiated from cryptic bacterial promoters within the inserted sequence. In some examples, the transcriptional terminator is a synthetic terminator optimized for E. coli, that flanks the CAV sequences in the CAV modules. In some examples, the transcriptional terminator includes a strong Rho-independent terminator such as Tl / T7Te or synthetic terminator variants optimized for high-efficiency termination in E. coli.

[0383] In some aspects, the CAV core plasmid module includes restriction site sequences flanking the CAV genome sequence (a different restriction site at each end). In some examples, the restriction site sequences are not found in or are ablated in the CAV El plasmid module, the CAV E3 plasmid module, and the CAV E4 plasmid module. In specific examples, the restriction sites are Pad and Bglll restriction sites. In some aspects, the core module is engineered with one or more rare or Type II restriction sites in a plasmid module. The plasmid is linearized and subjected to scarless reassembly using isothermal or homologous recombination techniques, such as SLIC / Gibson, and the final construct lacks residual recognition sites and preserves native viral sequence context at the junction. In instances in which Pad and Bglll restriction sites (and potentially other restriction enzyme sites) are used, a portion of the recognition site is contained in the CAV genome and the remaining portion is from the plasmid sequence, such that upon Gibson / SLIC and exonuclease, the recognition sites are removed resulting in scarless assembly. In alternative aspects, the restriction site sequences are for Type II restriction enzymes, which cut outside their recognition sites and thereby allow scarless assembly.

[0384] In some aspects, the CAV core plasmid module includes site-specific recombination sequences flanking the CAV genome sequence. In some examples, the CAV core plasmid module includes a first pair of site-specific recombination sequences and a second pair of site-specific recombination sequences flanking the CAV genome sequence, wherein each of the first pair and the second pair of site-specific recombination sequences flank a negative selection cassette and a positive selection cassette. In particular examples, the negative selection cassette is a ccdB negative selection cassette and / or the positive selection cassette is a chloramphenicol selection cassette.

[0385] In some aspects, the CAV core plasmid module further includes an antibiotic resistance gene. In some examples, the antibiotic resistance gene is an ampicillin resistance gene.

[0386] In some aspects, the CAV core module plasmid further includes a low-copy origin of replication. In some examples, the low-copy origin of replication is pl5A.

[0387] In some aspects, the CAV core module plasmid (or the recombinant CAV genome once assembled) further includes a coding sequence for a rare-cutting restriction endonuclease. In some examples, the rare-cutting restriction endonuclease is I-Scel. In other examples, the rare-cutting restriction endonuclease is Ceul, I-Ppol, I-Crel, PI-PspI, or PI-SceL In some examples, the rare-cutting restriction endonuclease is driven by a mammalian promoter. In specific examples, the mammalian promoter is the RSV / LTR promoter.

[0388] In some aspects, tire CAV El plasmid module includes the left ITR, and any combination of an E1A ORF, an E1B-19K ORF, and an E1B-55K ORF. In other aspects, tire CAV El plasmid module7158-101791-02

[0389] includes the left ITR and no CAV ORFs. In some examples, the CAV El plasmid module further includes a heterologous promoter and / or a heterologous ORF.

[0390] In some aspects, the CAV core plasmid module includes any combination of a pIX ORF, an IV A2 ORF, an E2B DNA polymerase ORF, an E2B pTP ORF, a 52 / 55k ORF, a pllla ORF, a penton ORF, a pVII ORF, a pV ORF, a pX ORF, a pVI ORF, a hexon ORF, an endoproteinase ORF, an E2A DBP ORF, a 22k ORF and a 33K ORF.

[0391] In some aspects, the CAV E3 plasmid module includes any combination of a pVIII ORF, an E3-ORF1, an E3-ORF2, a U exon ORF, and a fiber ORF.

[0392] In some aspects, the CAV E4 plasmid module includes die right ITR and any combination of an E4-ORF1, an E4-ORF2, an E4-ORF3, an E4-ORF4, and an E3-ORF5.

[0393] In some aspects, tire CAV El plasmid module, the CAV core plasmid module and / or the CAV E3 plasmid module further include one or more heterologous open reading frames (ORFs) and / or a heterologous expression cassette.

[0394] In some aspects, at least one CAV ORF of the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module, or one or more non-coding sequences of the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module, includes a mutation relative to a wild-type CAV ORF or non-coding sequence. In some examples, the mutation includes a deletion, an insertion, a substitution, or a combination thereof.

[0395] In some aspects, the CAV ORFs of the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module have wild-type CAV sequences.

[0396] In some aspects, the CAV El plasmid module is first assembled with the CAV core plasmid module to produce a CAV El-core macromodule. In some examples, the method further includes assembling the CAV El-core macromodule with the CAV E3 plasmid module and the CAV E4 plasmid module simultaneously. In other examples, the method further includes assembling the CAV El-core macromodule with the CAV E3 plasmid module followed by the CAV E4 plasmid module. In other examples, the method further includes assembling the CAV El-core macromodule with tire CAV E4 plasmid module followed by the CAV E3 plasmid module.

[0397] In some aspects, the CAV core plasmid module is first assembled with the CAV E3 plasmid module to produce a CAV core-E3 macromodule. In some examples, the method further includes assembling tire CAV core-E3 macromodule with the CAV E4 plasmid module followed by the CAV El plasmid module.

[0398] In some aspects, tire CAV core plasmid module is assembled simultaneously with tire CAV E3 plasmid module and the CAV E4 plasmid module, followed by assembly with die CAV El plasmid module.

[0399] In some aspects, die CAV core plasmid module is first assembled with the CAV E4 plasmid module to produce a CAV core-E4 macromodule. In some examples, the method further includes7158-101791-02

[0400] assembling the CAV core-E4 macromodule with the CAV E3 plasmid module followed by assembly with the CAV El plasmid module. In other examples, the method further includes assembling the CAV core-E4 macromodule with the CAV El plasmid module followed by assembly with the CAV E3 plasmid module.

[0401] In some aspects, the CAV plasmid modules are assembled using a seamless cloning method. In some examples, the seamless cloning method is SLIC, Gibson, or In-Fusion.

[0402] In some aspects, the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module and tire CAV E4 plasmid module are assembled simultaneously. In some examples, tire CAV plasmid modules are assembled using site-specific recombination (SSR). In some examples, SSR assembly includes incubating the CAV plasmid modules in the presence of a SSR enzyme system capable of catalyzing recombination between the SSR recognition sequences such that a CAV genome is assembled from left to right: El-core-E3-E4 modules flanked by tire left and right ITRs. In specific examples, the SSR sites are att sites. In particular non-limiting examples, the El plasmid module is flanked by attLl and attL4 sites; the E3 plasmid module is flanked by attL5 and attR3 sites; the E4 plasmid module is flanked by attL3 and attL2 sites; and the core plasmid module comprises attRl and attR4 sites flanking a first ccdB cassette at the left end and attR5 and attR2 sites flanking at second ccdB cassette at the right end (see FIG. 35).

[0403] In some aspects, the CAV plasmid modules are assembled using a combination of a seamless cloning method and SSR (see, e.g., FIG. 66).

[0404] In some examples, the method includes linearizing the CAV core module plasmid by restriction enzyme digestion; assembling the linear CAV core module plasmid with a linear CAV El plasmid module to produce a CAV E1 -core macromodule; assembling the CAV El -core macromodule with a linear CAV E4 plasmid module to produce a CAV El-core-E4 macromodule; and assembling the CAV El-core-E4 macro module with a linear CAV E3 plasmid module to produce a complete CAV genome.

[0405] In other examples, the method includes linearizing the CAV core module plasmid by restriction enzyme digestion; assembling the linear CAV core module plasmid with a linear CAV El plasmid module to produce a CAV El-core macromodule; assembling the CAV El-core macromodule with a linear CAV E3 plasmid module to produce a CAV El-core-E3 macromodule; and assembling the CAV El-core-E3 macromodule with a linear CAV E4 plasmid module to produce a complete CAV genome.

[0406] In other examples, the method includes linearizing the CAV core module plasmid by restriction enzyme digestion; assembling tire linear CAV core module plasmid with a linear CAV El plasmid module to produce a CAV El-core macromodule; and assembling tire CAV El-core macromodule with a linear CAV E3 plasmid module and a linear CAV E4 plasmid module to produce a complete CAV genome.

[0407] In other examples, tire method includes linearizing tire CAV core module plasmid by restriction enzyme digestion; assembling the linear CAV core module plasmid with a linear CAV E3 plasmid module to produce a CAV core-E3 macromodule; assembling the CAV core-E3 macromodule with a7158-101791-02

[0408] linear CAV E4 plasmid module to produce a CAV core-E3-E4 macromodule; and assembling the CAV core-E3-E4 macromodule with a linear CAV El plasmid module to produce a complete CAV genome.

[0409] In other examples, the method includes linearizing the CAV core module plasmid by restriction enzyme digestion; assembling the linear CAV core module plasmid with a linear CAV E3 plasmid module and a linear CAV E4 plasmid module to produce a CAV core-E3-E4 macromodule; and assembling the CAV core-E3-E4 macromodule with a linear CAV El plasmid module to produce a complete CAV genome.

[0410] In other examples, the method includes linearizing the CAV core module plasmid by restriction enzyme digestion; assembling the linear CAV core module plasmid with a linear CAV E4 plasmid module to produce a CAV core-E4 macromodule; assembling the CAV core-E4 macromodule with a linear' CAV E3 plasmid module to produce a CAV core-E3-E4 macromodule; and assembling the CAV core-E3-E4 macromodule with a linear CAV El plasmid module to produce a complete CAV genome.

[0411] In other examples, the method includes linearizing the CAV core module plasmid by restriction enzyme digestion; assembling the linear CAV core module plasmid with a linear CAV E4 plasmid module to produce a CAV core-E4 macromodule; assembling the CAV core-E4 macromodule with a linear CAV El plasmid module to produce a CAV El-core-E4 macromodule; and assembling the CAV El-core-E4 macromodule with a linear CAV E3 plasmid module to produce a complete CAV genome.

[0412] In specific examples, the CAV El plasmid module, the CAV E3 plasmid module and / or die CAV E4 plasmid module are linearized by PCR amplification.

[0413] In some aspects, the method is scalable, for example, at least 12%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of clones screened after CAV genome assembly are correctly assembled.

[0414] Also provided herein are recombinant CAV genomes that are produced according to the methods disclosed herein. Recombinant CAVs that include a recombinant CAV genome are further provided. In some aspects, the recombinant CAV is replication competent. In other examples, the recombinant CAV is replication incompetent.

[0415] VI. Plasmid Module Libraries

[0416] Further provided are libraries of CAV plasmid modules. In some aspects, the library includes at least one or a plurality of different canine adenovirus (CAV) El plasmid modules, at least one or a plurality of different CAV core plasmid modules, at least one or a plurality of different CAV E3 plasmid modules, at least one or a plurality of different CAV E4 plasmid modules, or any combination thereof. In some examples, the CAV El plasmid module(s) include CAV genome sequence from the left ITR to non-coding sequence located between tlie E1B-55K ORF and the pIX ORF; the CAV core plasmid module(s) include CAV genome sequence from non-coding sequence prior to the pIX ORF to noncoding sequence immediately prior to the pVIII ORF; the CAV E3 plasmid module(s) include CAV genome sequence from the non-coding sequence prior to the pVIII ORF to non-coding sequence7158-101791-02

[0417] following the fiber ORF; and / or the CAV E4 plasmid module(s) include CAV genome sequence from the non-coding sequence following the fiber ORF to the right ITR.

[0418] In some aspects of the library, the CAV El plasmid module(s), the CAV core plasmid module(s), the CAV E3 plasmid module(s), and / or the CAV E4 plasmid module(s) include SSR sequences flanking the CAV genome sequence. In some examples, the El plasmid module(s) further includes a recognition site for a rare-cutting restriction endonuclease situated between the recombination site sequence and the left ITR. In some examples, the E4 plasmid module(s) further includes a recognition site for a rare-cutting restriction endonuclease situated between the recombination site sequence and the right ITR. In particular examples, the rare-cutting restriction endonuclease is I-Scel, which has an 18-base pair recognition sequence. In other examples, the rare-cutting restriction endonuclease is Ceul, I-Ppol, I-Crel, PI-PspI, or Pl-Scel. In some examples, the rare-cutting endonuclease has a recognition sequence of at least 12 base pairs, at least 13 base pairs, at least 14 base pairs, at least 15 base pairs, at least 16 base pairs, at least 17 base pairs, at least 18 base pairs, at least 19 base pairs, at least 20 base pairs, at least 21, base pairs, or a at least 22 base pairs. In specific examples, the rare-cutting endonuclease has a recognition sequence of about 12 to about 22, about 15 to about 22, or about 18 to about 22 base pairs.

[0419] In some aspects, the CAV El plasmid module(s), the CAV E3 plasmid module(s) and / or the CAV E4 plasmid module(s) further include an antibiotic resistance gene. In some examples, the antibiotic resistance gene is a kanamycin resistance gene.

[0420] In some aspects, the CAV El plasmid module(s), the CAV E3 plasmid module(s) and / or the CAV E4 plasmid module(s) further include an origin of replication. In some examples, the origin of replication is a pMBl origin of replication.

[0421] In some aspects, the CAV El plasmid module(s), the CAV E3 plasmid module(s) and / or the CAV E4 plasmid module(s) further include one or more terminator sequences.

[0422] In some aspects, the CAV core plasmid module(s) includes restriction site sequences flanking the CAV genome sequence (a different restriction site at each end). In some examples, the restriction site sequences are not found in or are ablated in the CAV El plasmid module(s), the CAV E3 plasmid module(s), and the CAV E4 plasmid module(s). In specific examples, the restriction sites are Pad and Bglll restriction sites.

[0423] In some aspects, the CAV core plasmid module(s) includes site-specific recombination sequences flanking the CAV genome sequence. In some examples, the CAV core plasmid module(s) includes a first pair of site-specific recombination sequences and a second pair of site-specific recombination sequences flanking the CAV genome sequence, wherein each of the first pair and the second pair of site-specific recombination sequences flank a negative selection cassette and a positive selection cassette. In particular examples, the negative selection cassette is a ccdB negative selection cassette and / or the positive selection cassette is a chloramphenicol selection cassette.

[0424] In some aspects, the CAV core plasmid module(s) further includes an antibiotic resistance gene. In some examples, the antibiotic resistance gene is an ampicillin resistance gene.7158-101791-02

[0425] In some aspects, the CAV core module plasmid further includes a low-copy origin of replication. In some examples, the low-copy origin of replication is pl5A.

[0426] In some aspects, the CAV core module plasmid (or the recombinant CAV genome once assembled) further includes a coding sequence for a rare-cutting restriction endonuclease. In some examples, the rare-cutting restriction endonuclease is I-Scel. In other examples, the rare-cutting restriction endonuclease is Ceul, I-Ppol, I-Crel, PI-PspI, or Pl-Scel. In some examples, the rare-cutting restriction endonuclease is driven by a mammalian promoter. In specific examples, the mammalian promoter is the RSV / LTR promoter.

[0427] In some aspects, the CAV El plasmid module(s) includes the left ITR, and any combination of an E1A ORF, an E1B-19K ORF, and an E1B-55K ORF. In other aspects, the CAV El plasmid module(s) includes the left ITR and no CAV ORFs. In some examples, the CAV El plasmid module(s) further includes a heterologous promoter and / or a heterologous ORF.

[0428] In some aspects, the CAV core plasmid module(s) includes any combination of a pIX ORF, an IV A2 ORF, an E2B DNA polymerase ORF, an E2B pTP ORF, a 52 / 55k ORF, a pllla ORF, a penton ORF, a pVII ORF, a pV ORF, a pX ORF, a pVI ORF, a hexon ORF, an endoproteinase ORF, an E2A DBP ORF, a 22k ORF and a 33K ORF.

[0429] In some aspects, the CAV E3 plasmid module(s) includes any combination of a pVIII ORF, an E3-ORF1, and E3-ORF2, a U exon ORF, and a fiber ORF.

[0430] In some aspects, the CAV E4 plasmid module(s) includes the right ITR and any combination of an E4-ORF1, an E4-ORF2, an E4-ORF3, an E4-ORF4, and an E3-ORF5.

[0431] In some aspects, the CAV El plasmid module(s), the CAV core plasmid module(s) and / or the CAV E3 plasmid module(s) further include one or more heterologous open reading frames (ORFs) and / or a heterologous expression cassette.

[0432] In some aspects, at least one CAV ORF of the CAV El plasmid module(s), the CAV core plasmid module(s), the CAV E3 plasmid module(s) and / or the CAV E4 plasmid module(s), or one or more non-coding sequences of the CAV El plasmid module(s), the CAV core plasmid module(s), the CAV E3 plasmid module(s) and / or the CAV E4 plasmid module(s), includes a mutation relative to a wild-type CAV ORF or non-coding sequence. In some examples, the mutation includes a deletion, an insertion, a substitution, or a combination thereof.

[0433] In some aspects, the CAV ORFs of the CAV El plasmid module(s), the CAV core plasmid module(s), the CAV E3 plasmid module(s) and / or the CAV E4 plasmid module(s) have wild-type CAV sequences.

[0434] In some aspects, tire library further includes one or more plasmid modules from a human adenovirus, a bat adenovirus, and / or a skunk adenovirus.7158-101791-02

[0435] EXAMPLES

[0436] The following non-limiting examples are provided to illustrate particular features of certain aspects of the disclosure, but the scope of the claims should not be limited to those features exemplified.

[0437] Example 1: Template for developing CAV assembly modules

[0438] The CAV assembly platforms disclosed herein, CAVSLIC and CAVsembly, were developed using the Toronto A 26 / 61 strain of CAV2 as a template, obtained from ATCC (VR-800™). However, CAV1 is substantially homologous to CAV2 (FIG. 5), and the genomic modules and breakpoints are highly homologous. Thus, the CAVSLIC and CAVsembly systems can be extended to CAV1 genomes using the information provided herein.

[0439] The complete genome of CAV2 VR-800 was sequenced and die following differences were identified between VR-800 and the GenBank reference sequence U77082:

[0440] Location Mutation (A26 / 61-to VR-800) Consequence

[0441] 293bp C-to-G Unknown. Possibly located in El A promoter 10,509 C-to-T Silent mutation in 52 / 55kDa protein 11189-11192 TGTG-to-GTGT CA-to-VS mutation in pllla precursor 14018 C-to-T A-to-V mutation in pen ton base

[0442] 18408 G-to-A Silent mutation in Hexon

[0443] 19599 T-to-G Silent mutation in Hexon

[0444] 19610 G-to-T G-to-V mutation in Hexon

[0445] 22562 C-to-T R-to-C mutation in lOOkDa protein 24058 C-to-A P-to-H mutation in 33kDa protein

[0446] 28627 A-to-T V-to-E mutation in E4-ORF5 on bottom strand

[0447] CAV2 VR-800 was grown in MDCK cells. Virus was harvested and purified using two-stage CsCl purification. CAV-2 DNA was extracted and cloned into a plasmid backbone via SLIC, producing PCMN-1312 (SEQ ID NO: 1) (FIG. 27). PCMN-1312 was used as the template for creating CAVsembly and CAVSLIC El, core, E3 and E4 modules.

[0448] Example 2: Generation of CAVsembly / CAVSLIC plasmid modules

[0449] The CAV genomes were engineered and cloned into plasmid modules using SLIC. The El module spans from the left-hand ITR t lirough ElB-55k; core spans from protein IX through L4-33k; E3 spans from pVIII through Fiber; and E4 spans from non-coding sequences after fiber through the E4 genes to the right-hand ITR (FIGS. 7-11). The four plasmid modules can be assembled by several methods, including SLIC / Gibson scarless assembly and / or gateway recombination (FIG. 35).7158-101791-02

[0450] Ligation-independent cloning techniques, such as Gibson assembly and one-step sequence- and ligation-independent cloning (SLIC), utilize a combination of enzymes (exonuclease, polymerase and ligase) to allow for seamless cloning without junction scars. Modular assembly can be simultaneously completed with all modules, or performed sequentially with a subset of the modules. As complete modular assembly decreases with the number of modules in tire reaction, micromodule plasmids of intermediate assemblages lacking one or more modules can be created. Macromodule plasmids are then combined with tire missing module(s) to create plasmids containing the full virus genome. This approach is advantageous for generating multiple viruses with a host of genome variations common to a defined module.

[0451] To facilitate tire introduction of genome modifications, tire El, E3 and E4 module sizes were designed such that they would be amenable to amplification (generally <10,000bp). El, E3 and E4 modules are compatible with both CAVSLIC and CAVsembly cloning systems. Core modules are specific to either CAVSLIC or CAVsembly. The CAVSLIC core module contains restriction enzymes at the module junctions, while the CAVsembly core module contains Gateway recombination sites at the module junctions.

[0452] Core, El, E3 and E4 modules were constructed as depicted in FIG. 28. Primers used for module construction and genome assembly are shown in Table 1. The CAV core genome plasmid module was constructed via Gibson assembly by combining (1) a 571 bp gBlock™ gene fragment (Integrated DNA Technologies), (2) CAV2 VR-800 (ATCC) DNA digested with BstZ17I / PshAI, and (3) a plasmid backbone with a pl5A origin of replication and ampicillin resistance, amplified by PCR using primers nl and n2. The El, E3 and E4 plasmid modules were constructed using PCR amplification of pCAV2 ATCC VR-800 DNA reference genome as the template using primers ml and m2 (El module), ol and o2 (E3 module), and pl, p2, p3, p4, p5 and p6 (E4 module), and each module was Gibson assembled with a plasmid backbone having a pMBl origin of replication and kanamycin resistance, amplified with PCR primers m3 and m4 (El module), o3 and o4 (E3 module), and p7 and p8 (E4 module). The E4 module was engineered with two silent nucleotide mutations (shown in bold underline below) to eliminate Bglll and Pact restriction sites, while maintaining amino acid sequence. This facilitates linearization of the plasmid module by restriction enzyme digestion and assembly of El, E3, E4 plasmids with core virus genome modules by scarless Gibson and SLIC based assembly methods.

[0453] E4 region 1 (SEQ ID NO: 22)

[0454] agcacccgctctattacagacctcacccacacagcacagtt

[0455] E4 region 2 (SEQ ID NO: 23)

[0456] acgtcagaaatttctttaatcaaagtgcctttaaaatgtgc7158-101791-02

[0457] Table 1. PCR primers for CAV genome assembly*

[0458] Primer Sequence SEQ ID NO: ml gcagattaccctgttatccctaCATCATCAATAATATACAGGACAAAGAGGTGTG 24 G

[0459] m2 agttgggctgtaaatacacagcCACGTACCGCGCCCCTTTTATAC 25 m3 GCTGTGTATTTACAGCCCAAC 26 m4 TAGGGATAACAGGGTAATCTGC 27 nl cacgtaccgcgccccttttaATTAAGTAATCTTACAGACAAGCTGTGAC 28 i)2 caacaaatactgtcaaggactcgagtccggcacagactgagcagatcTATAAACGCAGAAAGG 29 CCCAC

[0460] ol ATGTCTAAAGAAATACCAACCCC 30 o2 CCGCTCGCGTGTATGAAAAATAAAG 31 o3 gggttggtatttctttagacatCACAACTTTTGTATACAAAGTTGGC 32 o4 tttttcatacacgcgagcggTACAACTTTGTATAATAAAGTTGAACGAG 33 Pl ccaactttgtataataaagttgTAAGGCTGCCGCCTTCAG 34 p2 tgtgggtgaggTCTGTAATAGAGCGGGTGC 35 p3 ctattacagacCTCACCCACACAGCACAG 36 p4 aaaggcactttgATTAAAGAAATTTCTGACGTTGTTAATAATCAC 37 p5 tttctttaatcAAAGTGCCTTTAAAATGTGCAAGAG 38 p6 gctgattaccctgttatccctaC ATC ATC A AT AAT AT AC AGGAC AA AGAGG 39 P7 CTTTTTTATAATGCCAACTTTGTATAATAAAGTTG 40P8 TAGGGATAACAGGGTAATCAGC 41

[0461]

[0462] *Upper case letters indicate overlap with template DNA, lower case letters indicate overlap with neighboring regions for Gibson assembly.

[0463] El and E4 genome plasmid modules were designed, and cloned, such that the left and right ITRs of the CAV genome were flanked by att sites followed by an I-Scel restriction enzyme recognition site (FIG. 29). I-Scel digestion of assembled CAV genome plasmids, in vitro, or upon expression of an I- Scel cassette in mammalian cells, linearizes CAV genomes at tire ITRs so they can undergo DNA replication and releases the CAV genome from att and plasmid backbone sequences. This design ensures that only three of five att SSR sequences used to assemble El, core, E3 and E4 modules are introduced in fully assembled CAV genome sequences upon restriction enzyme digestion with I-Scel. As shown in FIG. 29, attLl sites flank the left ITR in the CAV El module entry plasmid and attL2 sites in the E4 module entry plasmid. These generate attbl and attb2 sites when recombined with attRl and attR2 sites in a core module destination plasmid.7158-101791-02

[0464] El entry module plasmids (e.g., El-269, FIG. 30; SEQ ID NO: 10) have bacterial origins of replication and kanamycin resistance cassettes for selection and propagation in bacteria. In this example, attLl and attL4 sequences were incorporated at left and right ends of CAV El genomic sequences for recombination with Core modules that were engineered to have complementary attRl and attR4 SSRs flanking a negative selection cassette, comprising a ccdB gene as an example, and positive selection cassette, such as chloramphenicol resistance, as one example. In addition, rrnBl and rrnB2 bacterial terminator sequences were included to overcome potential toxicities of CAV El module sequences in bacteria. An I-Scel restriction site was engineered in between att sequences and tire ITR.

[0465] E3 entry module plasmids (FIG. 31) have bacterial origins of replication and kanamycin resistance cassettes for selection and propagation in bacteria. In this example, attL5 and attR3 sequences were incorporated for recombination in a LR reaction with Core and E4 modules with complementary att sites at the junctions.

[0466] E4 entry module plasmids (e.g., E4-099, FIG. 32; SEQ ID NO: 19) have bacterial origins of replication and kanamycin resistance cassettes for selection and propagation in bacteria. In this example, attL3 sequences were incorporated at tire E4 junction with tire E3 module and attL2 flanking an engineered I-Scel site at the E4 module CAV genome right ITR. In addition, and 1-Scel site was engineered in between the ITR and att sequences. When tested, the E4 entry plasmid modules exhibited toxicity in bacteria, as evidenced by low DNA yields. Therefore, to overcome this toxicity, E4 plasmid modules were modified to include additional bacterial terminator sequences flaking the right ITR, as indicated in the plasmid map of FIG. 32.

[0467] CAV core modules provide the starting point for CAVsembly and CAVSLIC design. CAVSLIC core modules were designed with unique restriction enzyme sites on each end to facilitate scarless assembly or their conversion to a dual-DEST core vector for CAVsembly.

[0468] CAV core module genomic sequences were fragmented and designed as described above (see also FIGS.

[0469] 7, 9 and 18-20). CAV modules for scarless assembly have Pad and Bglll sites engineered at the left-hand and right-hand side of core module sequences, respectively. These sites enable linearization of the large core module genome sequences for scarless assembly with El modules and E3 / E4 modules in one to three steps, as desired and determined by engineering and screening library goals.

[0470] The core plasmid module (Core-059, FIG. 33; SEQ ID NO: 12) has a low copy bacterial origin of replication (pl5A) and an ampicillin resistance selection cassette for propagation in bacteria. In addition, it has a mammalian RSV LTR / promoter for driving the expression of tire I-Scel restriction enzyme upon transfection into mammalian cells. Fully assembled CAV genomes have I-Scel restriction sites flanking the left and right ITRs, which are cleaved upon expression of I-Scel, linearizing CAV genomes and releasing plasmid sequences from CAV viral genomes. This feature of tire CAVsembly / CAVSLIC platform enables assembled CAV genome plasmids to be transfected directly into mammalian cells, without laborious purification of linearized CAV genome fragments, which results in low yields and is not amenable to high-throughput screening of variant libraries.7158-101791-02

[0471] CAV core modules (e.g., Core-74D; SEQ ID NO: 13) for multisite Gateway recombination with El and E3 / E4 entry plasmids have compatible pairs of attRl and attR4 sites placed at the left and attR5 and attR2 sites on the right of the core module sequences. The attRl / R4 and attR5 / attR2 SSR sites flank positive and negative selection cassettes, in die example chloramphenicol resistance and ccdB, respectively, which enable positive and negative selection of correctly recombined plasmids in an LR reaction, togedier witii the distinct ampicillin versus kanamycin resistance cassettes encoded by core destination versus entry plasmids.

[0472] Example 3: SLIC Assembly of Wild-Type CAV2 (PCMN-1313)

[0473] To determine whether the design of die El, core, E3, and E4 module plasmids resulted in scarless assembly and wild-type virus genome replication upon transfection into canine cells, El, core, E3, and E4 modules were assembled as shown in FIGS. 36 and 37. CAV-SLIC was used to construct the PCMN-1313 whole viral genome. The core module plasmid, Core-059 (SEQ ID NO: 12), was digested with Pad and Gibson assembled widi the linear product of the El-269 plasmid (SEQ ID NO: 10) amplified with primers rl and r2. This resulting macromodule plasmid is designated ASMM-149 (SEQ ID NO: 20), with the features illustrated in FIG. 38.

[0474] The ASMM-149 macromodule plasmid (SEQ ID NO: 20) was digested with Bglll and Gibson assembled with the linear products of the E4-099 plasmid module (SEQ ID NO: 19) amplified with primers t3 and t2, to create ASMM-150 (FIG. 39; SEQ ID NO: 21). The ASMM-150 macromodule plasmid was then digested with Bglll and assembled with the E3-522 plasmid module (SEQ ID NO: 14) amplified with primers si and s2. See Table 2 for primer sequences. Final constructs were selected using ampicillin resistance.

[0475] The left column of Table 2 shows the logic for assembly with what is a universal set of primers for assembly of CAVSLIC El, E3 and E4 modules to core and with each other in exemplary two or three step assembly schemes, and not particular to only this example of PCMN-1313. In this example, there is a three-step assembly used, where the E4 module is added to the El-core to create a second macromodule plasmid, followed by assembly with the E3 module.

[0476] In other schemas and examples, for example, in FIG. 57 and FIG. 58, an El-core macromodule is assembled with E3 and E4 modules in a 3-fragment Gibson and single step. In this example, the E4 module is amplified with primers tl and t2 (not the t3 forward primer, which assembled E4 with core).

[0477] The PCMN-1313 genome sequence is set forth as SEQ ID NO: 2, with the corresponding virus genome plasmid map illustrated in FIG. 40.

[0478] Table 2. Primer sequences for assembly of CAVSLIC modules in different orders

[0479] El to core Dest AgcttgtctgtaagattacttaCTTTTTT AT A AT GCC A ACTTT GT AC A A A El_For (rl) AA

[0480] plasmid AAAGCAG (SEQ ID NO: 42)

[0481] El to pIX-core El Rev (r2) AB Cacgtaccgcgccccttttatac (SEQ ID NO: 43)

[0482]

[0483] 7158-101791-02

[0484] E3 to core 33k CgagtccggcacagactgagcaATGTCTAAAGAAATACCAACCCCTT E3 For (si) AE

[0485] assembly ATATGTGGAG (SEQ ID NO: 44)

[0486] E3 to E4 TttcctgaaggcggcagccttaCCGCTCGCGTGTATGAAAAATAAAG E3 Rev (s2) AF

[0487] no Bglll (SEQ ID NO: 45)

[0488] AgctttatttttcatacacgcgagcgGTAAGGCTGCCGCCTTCAG (SEQ ID E4 to E3 E4 For (tl) AF

[0489] NO: 46)

[0490] E4 to core Dest GgtgggcctttctgcgtttataaCTTATAATGCCAACTTTGTACAAGAA E4 Rev (t2) AD

[0491] plasmid AGCTG (SEQ ID NO: 47)

[0492] E4 to core 33k E4 to core For TCCGGCACAGACTGAGCAGATCTAAGGCTGCCGCCTTCAG with Bglll (t3) AC (SEQ ID NO: 48)

[0493] E4 to core Dest GgtgggcctttctgcgtttataaCTTATAATGCCAACTTTGTACAAGAA E4 Rev (t2) AD

[0494] plasmid AGCTG (SEQ ID NO: 47)

[0495]

[0496] Transformation and transfection

[0497] E. coli DHIOb cells were used to transform and amplify the assembled virus genome plasmids. Correct virus genome assemblies were selected by virtue of ampicillin resistance and confirmed by sequencing. MDCK cells or DK cells (such as those from ATCC) were used for viral genome plasmid transfection and virus propagation. Transfection was performed in 6-well plates using Lipofectamine 3000 (Thermo Fisher), with 2-2.5 pg DNA and 7.5 pl Lipofectamine 3000 diluted and incubated as per standard manufacturer optimized protocols. Upon transfection into mammalian cells, the RSV promoter drives expression of the I-Scel enzyme, which releases and linearizes the CAV genome at the left and right ITRs, allowing viral genome replication. There was no need to cut, isolate, and purify the CAV genome prior to transfection, facilitating efficient viral production.

[0498] Virus successfully propagated in MDCK cells using MEM10 with 2-10% FBS media was transferred to freshly plated MDCK cells for further viral amplification. Parental plasmids specified in FIG. 37 were used to assemble intermediate macromodule plasmids ASMM-149 (FIG. 38), ASMM-150 (FIG. 39), and the complete whole-genome plasmid PCMN-1313 (FIG. 40).

[0499] Verification of scarless assembly

[0500] Successful scarless assembly was confirmed by sequencing and alignment of the PCMN-1313 plasmid against the wild-type CAV2 reference genome, ensuring no residual Pad sites or additional sequences were introduced at module junctions (FIG. 41).

[0501] PCMN-1313 SLIC-assembled whole genome plasmids were transfected into canine cells and compared with PCMN-1312 genome plasmids derived from the ATCC reference virus. Viral replication efficiency was assessed by log virus replication, plaque formation and cytopathic effects. PCMN-1313 exhibited replication characteristics identical to PCMN-1312, demonstrating wild-type virus genome sequences and functional replication properties.7158-101791-02

[0502] Example 4: Scarless assembly of recombinant CAV genome PCMN-1324

[0503] This example shows that individual CAVsembly / SLIC modules can be genetically engineered, modified to express heterologous ORFs, and then scarlessly assembled with CAV genome modules into a recombinant CAV genome and virus. This example specifically describes the generation of PCMN-1324 (FIG. 42; SEQ ID NO: 3), which contains a modified El module that expresses a heterologous ORF as a P2A fusion with El A. The assembly method, number of steps and primers used are similar to those described in Example 3.

[0504] A modified El plasmid module (El-271) was engineered to encode a YPet-P2A-fusion with the E1A gene. The El-271 plasmid map is shown in FIG. 43 and has a sequence set forth as SEQ ID NO: 11. Parental plasmids El-271, Core-059, E3-522 and E4-099 were used to assemble the complete wholegenome plasmid PCMN-1324 (SEQ ID NO: 3).

[0505] MDCK cells were transfected with PCMN-1324 whole genome plasmids. The average life cycle of CAV2 is between 48-72 hours in MDCK cells. At 3 days post infection (dpi), isolated fluorescent plaques were apparent in the MDCK monolayer, indicating successful transfection, and productive replication of the transfected recombinant CAV genome, as well as YPet fluorescent payload expression from engineered CAV genome El module. PCMN-1324 and YPet fluorescence spread to infect the entire monolayer, indicating productive log replication by day 10 (FIG. 45). As such, the increase in virally infected fluorescent cells over time demonstrates productive viral replication and secondary infection and spread from initially transfected cells. Viral supernatants were harvested and used to infect MDCK cells in secondary and tertiary rounds of infection. Productive replication and payload expression was demonstrated by an increase in the number of YPet-positive cells infected over time.

[0506] Furthermore, FIG. 46 shows cesium chloride (CsCl) density gradients of viral supernatants harvested from large scale preps of PCMN-1324 infected DK cells, which were benchmarked against an Ad5 virus (PCMN-1346) produced in human 293 cells. CsCl density gradient ultracentrifugation, provide a means of separating these populations based on buoyant density differences. Using CsCl gradients, an infectious virus band will appear lower in the gradient due to the higher density of genome-filled virions and contains fully infectious viral particles, whereas a defective virus band is found higher in the gradient, representing empty capsids or incomplete virions, indicating they may lack functional genomes, or have packaging defects that render them non-infectious. Productive recombinant CAV virus genome assembly and infectious particle production was demonstrated by the visible and strong lower white band of concentrated recombinant CAV virus particles and tire absence of upper unfilled defective virus particles. These results validated tire systematic and scalable modular assembly approach for assembling recombinant CAV genomes without replication defects as a result of engineered modular plasmid genome assembly sequences incorporated in design.7158-101791-02

[0507] Example 5: Fluorescent Based Viral Kinetics (FBVK) Assay of PCMN-1324 replication

[0508] FIG. 47 shows an FBVK assay of PCMN-1324. FBVK assays enable the florescence based viral kinetics and replication of recombinant CAV genomes with engineered fluorescent reporter proteins to be quantitatively measured and log exponential growth (slope) calculated (see U.S. Patent No. 11,130,968). Fluorescence intensity on the Y axis is a measure of payload expression over time (X axis). PCMN-1324 had a log slope of 2, which indicated robust wildtype level virus replication kinetics. Furthermore, CAV genomes with El A-P2A-fusion compare favorably to Ad5 constructs with YPet fusions in analogous placements. YPet fluorescence expression levels were higher in recombinant CAVs than Ad5 El A-P2A-YPet (PCMN-950) fusions (FIG. 48).

[0509] Example 6: Scarless assembly of recombinant CAV genome PCMN-1326

[0510] This example describes the assembly of PCMN-1326, which contains a modified El module that encodes a fluorescent reporter and an E3 module plasmid (E3-0527; SEQ ID NO: 15) that has deletions of E3 ORF1 (FIG. 50). As such, it provides an example of combinatorial assembly wherein more than on3 CAV module is modified and is assembled together, with a method similar to that delineated in Example 3.

[0511] FIG. 49 is a schematic example of scarless assembly of a recombinant CAV genome that has combined modifications in El and E3 genome modules. The El module has the El A-P2A-YPet reporter, which provides a method to quantify and compare the replication of recombinant CAV genomes across all stages of the viral life cycle and the impact of genome module modifications and deletions of E3-ORF1, in this example, on viral replication kinetics and competency. The assembly of an El module reporter is combined with the deletions of E3 gene ORFs to determine if E3 gene expression is required for CAV virus replication in cell culture.

[0512] The PCMN-1326 recombinant CAV genome (SEQ ID NO: 4) was assembled as depicted in FIG.

[0513] 49 with an E3 module plasmid (E3-527; SEQ ID NO: 15) in which the E3-ORF1 coding sequences were deleted (FIG. 50).

[0514] Example 7: Scarless assembly of recombinant CAV genome PCMN-1327

[0515] This example describes the assembly of PCMN-1327, which has a modified El module that encodes a fluorescent reporter of viral replication with an E3 module that has de lotions of E3 ORF2.

[0516] Similar to the methods described in Example 3, the PCMN-1327 recombinant CAV genome (SEQ ID NO: 5) was assembled as depicted in FIG. 51 with an E3 module plasmid (E3-528; SEQ ID NO: 16) in which the E3-ORF2 coding sequences were deleted (FIG. 52).7158-101791-02

[0517] Example 8: Scarless assembly of recombinant CAV genome PCMN-1328

[0518] This example describes assembly of PCMN-1328, which has a modified El module that encodes a fluorescent reporter of viral replication with an E3 module that has deletions of E3-ORF1 and E3- ORF2.

[0519] Similar to the methods described in Example 3, the PCMN-1328 recombinant CAV genome (SEQ ID NO: 6) was assembled as depicted in FIG. 53 with an E3 module plasmid (E3-529; SEQ ID NO: 17) in which the E3-ORF1 and E3-ORF-2 coding sequences were deleted (FIG. 54).

[0520] Example 9: Replication kinetics of recombinant CAVs with E3 module deletions

[0521] PCMN-1324, PCMN-1326, PCMN-1327 and PCMN-1328 viral replication kinetics were quantitatively analyzed and determined in an FBVK assay in MDCK cells infected with serial dilutions of the different recombinant CAV viruses (FIG. 55). This is enabled by the placement of an El A-P2A- YPet fusion and fluorescent reporter placement in the El module. Log slopes are shown in graphs of FIG. 55 and in the table below.

[0522] These data demonstrate that the replication kinetics of viruses with E3-ORF1 deletions have wildtype virus kinetics. In contrast, viruses with deletions in E3-ORF2 coding sequences have delayed viral replication kinetics, which appears to be associated with reduced CAV lysis and spread. However, deletions of both E3-ORF2 and E3-ORF1 restore wildtype virus kinetics.

[0523] Table 3. Replication kinetics of recombinant CAVs

[0524] Virus Virus genotype Log-slope

[0525] PCMN-1324 ElA-P2A-YPet 2.00

[0526] PCMN-1326 ElA-P2A-YPet, AE3-ORF1 1.94

[0527] PCMN-1327 ElA-P2A-YPet, AE3-ORF2 0.97

[0528] PCMN-1328 ElA-P2A-YPet, AE3-ORF1, AE3-ORF2 1.93

[0529]

[0530] CsCl density gradients of viral supernatants harvested from large scale preps of PCMN-1324 infected DK cells and PCMN-1327 or PCMN-1328 infected MDCK cells are shown in FIG. 56.

[0531] Productive recombinant CAV virus genome assembly and infectious particle production was demonstrated by the visible and strong lower white band of concentrated recombinant CAV virus particles and the absence of upper unfilled defective virus particles.

[0532] Taken together, these data demonstrate the utility of being able to assemble and screen, in a scalable and systematic way, recombinant CAVs from different functional genomic plasmid module parts libraries, which enable fluorescent reporter genes to be encoded in one module and mutations or deletions in another, to reveal CAV gene functions and engineer CAVs for therapeutic applications.7158-101791-02

[0533] Example 10: Two-step scarless assembly of recombinant CAV genomes where one of the modules also has a fluorescent reporter incorporated in the core module, PCMN1466: YPET-P2A-E2B-DNA polymerase fusions

[0534] An example of CAVSLIC assembly of replication competent CAV genomes in which scarless assembly was performed in two steps as opposed to three steps is shown in FIG. 57 (generic) and FIG. 58 for PCMN-1466. The example in FIG. 58, PCMN-1466 (SEQ ID NO: 62), also shows assembly of a CAV genome that has engineered modifications and a heterologous ORF operably linked to the expression of CAV genes in the core genome module.

[0535] E2B DNA polymerase is expressed from the E2 promoter and is essential for CAV genome replication and virus production. The Core-065 plasmid (FIG. 59; SEQ ID NO: 70) was engineered to have a P2A-YPet fusion with E2B polymerase and then assembled via CAVSLIC with an El plasmid to generate the ASMM-176 macromodule plasmid (SEQ ID NO: 65). The ASMM-176 plasmid (FIG. 59) was then cut with Bglll and assembled with E3-522 (SEQ ID NO: 14) amplified with primers si and s2 and E4-099 plasmid (SEQ ID NO: 19) amplified with primers tl and t2 (Table 2, Example 3) using a 3-fragment SL1C assembly.

[0536] MDCK cells were transfected with PCMN-1466 whole genome plasmid. Between 3-10 days post infection (dpi), fluorescent plaques appeared in the MDCK monolayer, indicating successful transfection, and YPet fluorescent payload expression from the P2A fusion with E2B-DNA pol. PCMN-1466 and YPet fluorescence spread to infect the entire monolayer, indicating productive log replication, by day 13 (FIG. 60). As such, the increase in virally infected fluorescent cells over time demonstrated productive viral replication and secondary infection and spread from initially transfected cells.

[0537] Example 11: CMBT-1426 assembly using CAVsembly

[0538] The El, E3 and E4 modules are compatible with both CAVSLIC and CAVsembly systems. Unlike the CAVSLIC core, the CAVsembly core module contains two ccdB cassettes flanked by unique att recombination sites. The first ccdB cassette is flanked by Gateway sites attRl and attR4. The second ccdB cassette is flanked by Gateway® sites attR5 and attR2. Gateway recombination results in the exchange of the attRl / attR4 flanked ccdB cassette with the El region module between attLl and attL4 sites. The attR5 / attR2 ccdB cassette is exchanged with the E3 region module between attL5 and attR3, and the E4 region module between attL3 and attL2 (FIG. 61).

[0539] For assembly of CMBT-1426 (FIG. 63), Core-74D (SEQ ID NO: 13), El-269 (SEQ ID NO: 10), E3-541 (SEQ ID NO: 18; FIG. 62) and E4-099 (SEQ ID NO: 19) module plasmids were combined into a single tube. Gateway LR Clonase II plus enzyme mix (Thermo Fisher) was added and the reaction was incubated at room temperature for 8-16 hours. Clonase enzyme was inactivated with proteinase K at 37°C for 10 minutes. The reaction can then be transformed into bacteria for genome screening or directly7158-101791-02

[0540] transfected into mammalian cells to reconstitute virus. In this example, the reaction and DNA was transformed into E. coli DHIOb cells and selected using ampicillin resistance.

[0541] CMBT-1426 plasmid (FIG .63) was purified, sequence verified and transfected into MDCK cells for virus production. Transfection was done using Lipofectamine 3000 (Thermo Fisher) using 2 pg DNA per 6-well, as in previous examples. Virus successfully grown in MDCK cells with MEM10 media was transferred to freshly plated MDCK cells for virus propagation. The nucleic acid sequence of CMBT-1426 is set forth herein as SEQ ID NO: 7.

[0542] Sequencing of CMBT-1426 showed that the recombination of core and El plasmids resulted in correct attB site sequences and placement at the pIX Kozak site in the El -core genome module breakpoint (FIG. 64). Similarly, recombination of E3 and E4 modules resulted in attB sequences at the fiber-E4 junction in the assembled CMBT-1426 viral genome (FIG. 65).

[0543] Example 12: Hybrid assembly using both CAVSLIC and CAVsembly methods

[0544] This example describes a hybrid assembly schema whereby an El module is assembled with a core module by scarless assembly, and E3 and E4 modules are assembled with the core module in an LR reaction.

[0545] The example schema shown in FIG. 66 highlights a hybrid method wherein CAV genomes can be assembled by a combination of scarless assembly and multi-site recombination of CAV genome modules. An example of a recombinant CAV genome assembled using a hybrid SLIC and Gateway schema shown in FIG. 66, to produce CMBT-1424 (SEQ ID NO: 8). In this example, an El module is assembled with a Core-073 E3 / E4 Dest plasmid module (FIG. 67; SEQ ID NO: 67) that lacks the attR4 site before pIX but has the Pad site and overlap with El for assembly with an El module linearized by PCR (as in previously described scarless assembly of El and core modules). The E3-541 module (where E3-ORF1 is deleted and replaced by mCherry and has an additional deletion in E3-ORF2), and wild type E4-099 module, were assembled with the El-core module in an LR reaction (FIG. 66) to create a whole CAV genome, CMBT-1424. The genome map of the resulting viral genome CMBT-1424 is shown in FIG. 68.

[0546] Example 13: Recombinant assembled CAV genomes that have one, two or three attB insertions as a result of the assembly method used are all replication competent

[0547] In this example, it is shown that CAV genomes assembled with one, two or three attB insertions as a result of the assembly method used are all replication competent (Table 4). To test this, CAV genomes were assembled using CAVsembly (FIG. 61) or a hybrid schema wherein only E3 and E4 modules were assembled via an LR reaction (FIG. 66), or only the El module was assembled in an LR reaction (CMBT-1437; SEQ ID NO: 63). It is shown that viruses which have all three attB sites in the CAV genome (CMBT-1426; SEQ ID NO: 7), attB sites at core-E3 and E3-E4 junctions and CMBT-1437 that has an attB site only at El pIX-core junction are all replication competent. Assembled viruses with7158-101791-02

[0548] one or more of the different attB site CAV module placements are replication competent, and do not significantly impair productive replication, infection and screening of CAV viruses using high throughput recombination based assembly methods, suitable for generation and screening of large libraries of CAV variants.

[0549] Table 4. Recombinant CAVs with one, two or three attB sites

[0550] Replication

[0551] Virus Number and attB Recombination Insertions

[0552] competence

[0553] Two attB insertions: attB5 at core-E3 pVIII, attB3 at

[0554] CMBT-1424 Yes

[0555] E3 Fiber- E4 junctions

[0556] Three attB insertions:El-core attB4 at pIX, attB5 at

[0557] CMBT-1426 Yes

[0558] core-E3 pVIII, attB3 at E3 Fiber-E4 junctions

[0559] CMBT-1437 One attB insertion: El -core attB4 at pIX Yes

[0560]

[0561] Example 14: Assembly and screening of recombinant CAV genomes that express heterologous and therapeutic ORFs in one or more CAV genome modules

[0562] This example shows CMBT-1460 (SEQ ID NO: 64) as an example, which was assembled in an LR reaction from a Core-74D plasmid (FIG. 62B; SEQ ID NO: 13), El-285 (SEQ ID NO: 66) and E3- 574 module (FIG. 69; SEQ ID NO: 68) and wildtype E4 plasmid (SEQ ID NO: 19) in an LR reaction to create the whole genome plasmid. The El-285 plasmid is a modified El module with an ElB-55k-P2A- YPet fluorescent reporter placement. The E3-574 plasmid is a modified E3 module that expresses a heterologous therapeutic ORF, an immunogenic antigen from canine distemper virus (CDV H), instead of E3-ORF1 and also has an additional deletion of E3-ORF2 coding sequences. The El and E3 modified plasmids were assembled with a Core-74D plasmid (FIG. 62B) and wildtype E4 plasmid in an LR reaction to create the whole genome plasmid CMBT-1460 (FIG. 70).

[0563] MDCK cells were transfected with CMBT-1460 and YPet fluorescence visualized and quantified at 6 and 12 days post-transfection (FIG. 71). The increase in the number of YPet expressing and infected cells between day 6 and 12, demonstrated productive virus replication and secondary infection spread. These data demonstrate that expression of a heterologous therapeutic ORF, in this case a vaccine antigen from a different canine pathogen, in a CAV modified E3 module can be assembled to create a replication competent virus using multi-site gateway recombination. This assembly scheme is useful to rapidly screen and enable the development of therapeutic recombinant CAVs, such as, in this example, live virus vaccine candidate placements and genome compositions. Once an optimal composition has been7158-101791-02

[0564] identified, the same genomic modules can be scarlessly assembled to generate CAV genomes for screening and production as clinical candidate development leads.

[0565] Example 15: Assembly and replication of CMBT-1501, which has deletions of genes in E3 and E4 modules

[0566] This example describes CMBT-1501 (SEQ ID NO: 9), which was assembled using multi-site LR reaction from E3-541 (SEQ ID NO: 18) that expresses mCherry instead of E3-ORF1 and has additional deletions of E3-ORF2 sequences. Furthermore, E4-ORF5 protein coding sequences were deleted in die E4 genome plasmid module, E4-114 (FIG. 72; SEQ ID NO: 69).

[0567] MDCK cells were transfected with CMBT-1501 (FIG. 73) and mCherry fluorescence expressing transfected and secondary infected cells were visualized and quantified at 3 and 15 days posttransfection. As shown in FIG. 74, mCherry fluorescence was observed at 3 days post-transfection and virus spread and infection to monolayer was observable by 15 days post-transfecdon. These results demonstrate that CAVsembly-mediated assembly of the virus genome modules does not lead to a discernable impact on viral replication. Furthermore, this data shows diat deletion of CAV E4-ORF5 sequences did not impair virus replication, which indicates that CAV E4 genes may have very different functional requirements in CAVs compared to human Ads.

[0568] Example 16. Transfection and propagation of recombinant CAV compositions in canine cells Viral genome plasmids described in the above examples were propagated in E. coli, plasmid DNA isolated and transfected into canine cells to propagate and produce recombinant CAV virus compositions. Upon transfection into mammalian cells, the RSV promoter in the destination plasmid backbone drives expression of the I-Scel enzyme which cuts and linearizes the CAV genome from the bacterial plasmid sequences at the engineered I-Scel restriction sites that were engineered at the left and right ITRs so the CAV genome is released and can then be replicated (FIGS. 27, 33 and 34). Thus, there is no need to cut, isolate and purify the CAV genome for transfection into canine cells and viral production. Virus successfully grown in MDCK cells with MEM10 media was transferred to freshly plated MDCK cells for virus propagation.

[0569] The following workflow and schema were used to produce and characterize the replication and production of recombinant CAV compositions from the examples above.

[0570] Transfection (per well of 6-well plate, using Lipofectamine3000)

[0571] 1. Plate 500,000 MDCK cells per well of 6-well plate in 2.5 mL MEM+10%FBS (heat inactivated).

[0572] Zero to 4 hours after plating, add DNA for transfection.

[0573] 2. Tube l:

[0574] a. Add 2000 ng plasmid DNA to 1.5 ml tube

[0575] b. Add 100 |1L Opti-MEM (or other media without serum)7158-101791-02

[0576] c. Add 8 (1L P3000 reagent (from Lipofectamine 3000 Transfection Reagent kit) 3. Tube 2:

[0577] a. Add 100 |1L Opti-MEM (or other media without serum)

[0578] b. Add 12 |1L Lipofectamine 3000 reagent (from Lipofectamine 3000 Transfection Reagent kit)

[0579] 4. Thoroughly vortex tubes #1 and #2. Briefly spin tubes in microfuge.

[0580] 5. Transfer 100 |iL from tube #2 to tube #1. Thoroughly vortex tube #1. Briefly spin tube #1 in microfuge. Let tube #1 sit for 10-20 minutes.

[0581] 6. To well of 6-well plate, dropwise add contents of tube #1 to the well.

[0582] 7. Return cells to incubator.

[0583] 8. Exchange ~1.5 mL media with -1.5 mL fresh MEM+10%FBS every 2-3 days.

[0584] 9. Plaques should be visible starting from day 3 to day 5. Cells are typically wiped out between days 7 to 14. Continue exchanging media every 2-3 days.

[0585] 10. Harvest 6-well, using small cell scraper, transferring media and cells into a 15 mL conical tube. Virus expansion (10 cm)

[0586] 1. Split MDCK cells to one 10 cm plate in lOmL DMEM+10%FBS.

[0587] 2. When cells are -90% confluent, change media to MEM+10%FBS.

[0588] 3. Freeze-thaw the 15 ml conical tube (containing the 6-well lysate) 3 times. Dry-ice / 95%ethanol bath and 37°C water bath work well for the freeze-thaw process. Freezing in a -80°C freezer also works for tire freeze step. Be careful to avoid ethanol / water near tire cap of the tube. Spin lysate 1000g for 5 minutes to pellet the cell debris.

[0589] 4. Transfer 1.25 ml lysate (half of 6-well lysate) to 10 cm plate of MDCK cells.

[0590] 5. If cells take longer than 3 days for full cytopathic effect, exchange half of media with fresh MEM+10%FBS every 2-3 days.

[0591] 6. Har vest 10 cm plate, using small cell scraper, transferring media and cells into a 50 mL conical tube.

[0592] Virus expansion (2x15 cm)

[0593] 1. Split MDCK cells to two 15 cm plates in 16 mL DMEM+10%FBS.

[0594] 2. When cells are -90% confluent, change media to MEM+10%FBS.

[0595] 3. Freeze-thaw the 50 ml conical tube (containing the 10 cm lysate) 3 times. Dry-ice / 95%ethanol bath and 37°C water bath work well for tire freeze-thaw process. Freezing in a -80°C freezer also works for the freeze step. Be careful to avoid ethanol / water near the cap of the tube. Spin lysate 1000g for 5 minutes to pellet tire cell debris.

[0596] 4. Transfer 2.5 mL lysate (of 10 cm lysate) to two 15 cm plates of MDCK cells.

[0597] 5. If cells take longer than 3 days for full cytopathic effect, exchange half of media with fresh MEM+10%FBS every 2-3 days.7158-101791-02

[0598] 6. Harvest 15 cm plates, using large cell scraper, transferring media and cells from both plates into a 50 mL conical tube.

[0599] Virus expansion (15x15 cm)

[0600] 1. Split MDCK cells to 15x15 cm plates in 16 mL DMEM+10%FBS.

[0601] 2. When cells are -90% confluent, change media to MEM+10%FBS.

[0602] 3. Freeze-thaw the 50 ml conical tube (containing the 2x15 cm lysate) 3 times. Dry-ice / 95%ethanol bath and 37°C water bath work well for the freeze-thaw process. Freezing in a -80°C freezer also works for the freeze step. Be careful to avoid ethanol / water near tire cap of the tube. Spin lysate 1000g for 5 minutes to pellet the cell debris.

[0603] 4. Transfer 2 mL lysate (of 2x15 cm lysate) to fifteen 15 cm plates of MDCK cells.

[0604] 5. If cells take longer than 3 days for full cytopathic effect, exchange half of media with fresh MEM+10%FBS every 2-3 days.

[0605] 6. Harvest 15 cm plates, using large cell scraper, transferring media and cells from 15 plates into a 250 mL conical tube. If cytopathic effect is sporadic across plate, harvest free cells, without the scraper, and replace media with fresh MEM+10%FBS, spinning down cells (200g for 5 minutes) to be combined with additional harvests at later timepoints.

[0606] 7. For non CSCL2 purified virus preparation, freeze the 15x15 cm harvest.

[0607] Materials:

[0608] Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific cat#L3000015)

[0609] Opti-MEM (Gibco cat#51985-034)

[0610] DMEM (Corning cat#10-013-CV)

[0611] MEM (Corning cat#10-010-CM)

[0612] NucleoBond XTra Midi (Macherey-Nagel cat#740410)

[0613] NEB lOBeta competent cells (NEB cat#C3019H)

[0614] It will be apparent that the precise details of the methods or compositions described may be varied or modified without departing from the spirit of the described aspects of the disclosure. We claim all such modifications and variations that fall within the scope and spirit of the claims below.

Claims

7158-101791-02CLAIMS1. A method of generating a recombinant canine adenovirus (CAV) genome, comprising assembling a nucleic acid molecule from four CAV plasmid modules, wherein each plasmid module corresponds to a portion of a CAV genome, and wherein the four CAV plasmid modules comprise: a CAV El plasmid module comprising CAV genome sequence from a left inverted terminal repeat (ITR) to non-coding sequence located between an E1B-55K open reading frame (ORF) and a pIX ORF;a CAV core plasmid module comprising CAV genome sequence from non-coding sequence prior to a pIX ORF to non-coding sequence immediately prior to a pVIII ORF;a CAV E3 plasmid module comprising CAV genome sequence from non-coding sequence prior to a pVIII ORF to non-coding sequence following a fiber ORF; anda CAV E4 plasmid module comprising CAV genome sequence from non-coding sequence following a fiber ORF to a right ITR.

2. The method of claim 1, wherein the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module, and / or the CAV E4 plasmid module comprise site-specific recombination (SSR) sequences flanking the CAV genome sequence.

3. The method of claim 2, wherein the El plasmid module further comprises a recognition site for a rare-cutting restriction endonuclease situated between the recombination site sequence and the left ITR.

4. The method of claim 2, wherein the E4 plasmid module further comprises a recognition site for a rare-cutting restriction endonuclease situated between the recombination site sequence and the right ITR.

5. The method of claim 3 or claim 4, wherein the rare-cutting restriction endonuclease is I-Scel.

6. The method of any one of claims 1-5, wherein the CAV El plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module further comprise an antibiotic resistance gene.

7. The method of claim 6, wherein tire antibiotic resistance gene is a kanamycin resistance gene.

8. The method of any one of claims 1-7, wherein tire CAV El plasmid module, the CAV E3 plasmid module and / or tire CAV E4 plasmid module further comprise an origin of replication.7158-101791-029. The method of claim 8, wherein the origin of replication is a pMBl origin of replication.

10. The method of any one of claims 1-9, wherein the CAV El plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module further comprise one or more terminator sequences.

11. The method of any one of claims 1-10, wherein the CAV core plasmid module comprises restriction site sequences flanking the CAV genome sequence.

12. The method of claim 11 , wherein tire restriction site sequences are not found in or are ablated in the CAV El plasmid module, the CAV E3 plasmid module, and the CAV E4 plasmid module.

13. The method of any one of claims 1-10, wherein the CAV core plasmid module comprises site-specific recombination sequences flanking the CAV genome sequence.

14. The method of claim 13, wherein the CAV core plasmid module comprises a first pair of site-specific recombination sequences and a second pair of site-specific recombination sequences flanking the CAV genome sequence, wherein each of the first pair and the second pair of site-specific recombination sequences flank a negative selection cassette and a positive selection cassette.

15. The method of claim 14, wherein the negative selection cassette is a ccdB negative selection cassette.

16. The method of claim 14 or claim 15, wherein the positive selection cassette is a chloramphenicol selection cassette.

17. The method of any one of claims 1-16, wherein the CAV core plasmid module further comprises an antibiotic resistance gene.

18. The method of claim 17, wherein the antibiotic resistance gene is an ampicillin resistance gene.

19. The method of any one of claims 1-18, wherein the CAV core module plasmid further comprises a low-copy origin of replication.

20. The method of claim 19, wherein tire low-copy origin of replication is pl5A.7158-101791-0221. The method of any one of claims 1-20, wherein the CAV core module plasmid or the recombinant CAV genome further comprises a coding sequence for a rare-cutting restriction endonuclease.

22. The method of claim 21, wherein the rare-cutting restriction endonuclease is I-Scel.

23. The method of claim 21 and claim 22, wherein expression of the rare-cutting restriction endonuclease is driven by a mammalian promoter.

24. The method of any one of claims 1-23, wherein the CAV El plasmid module comprises the left ITR, and any combination of an El A ORF, an E1B-19K ORF, and an E1B-55K ORF.

25. The method of any one of claims 1-23, wherein the CAV E l plasmid module comprises the left ITR and no CAV ORFs.

26. The method of claim 25, wherein the CAV El plasmid module further comprises a heterologous promoter and a heterologous ORF.

27. The method of any one of claims 1-26, wherein the CAV core plasmid module comprises any combination of a pIX ORF, an IVA2 ORF, an E2B DNA polymerase ORF, an E2B pTP ORF, a 52 / 55k ORF, a pllla ORF, a penton ORF, a pVII ORF, a pV ORF, a pX ORF, a pVI ORF, a hexon ORF, an endoproteinase ORF, an E2A DBP ORF, a 22k ORF and a 33K ORF.

28. The method of any one of claims 1-27, wherein the CAV E3 plasmid module comprises any combination of a pVIII ORF, an E3-ORF1, and E3-ORF2, a U exon ORF, and a fiber ORF.

29. The method of any one of claims 1-28, wherein the CAV E4 plasmid module comprises the right ITR and any combination of an E4-ORF1, an E4-ORF2, an E4-ORF3, an E4-ORF4, and an E3-ORF5.

30. The method of any one of claims 24-29, wherein the CAV El plasmid module, the CAV core plasmid module and / or the CAV E3 plasmid module further comprise one or more heterologous open reading frames (ORFs) and / or a heterologous expression cassette.

31. The method of any one of claims 24-30, wherein at least one CAV ORF of the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module and / or the CAV E47158-101791-02plasmid module, or one or more non-coding sequences of the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module, comprises a mutation relative to a wild-type CAV ORF or non-coding sequence.

32. The method of the claim 31, wherein the mutation comprises a deletion, an insertion, a substitution, or a combination thereof.

33. The method of any one of claims 24-30, wherein the CAV ORFs of the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module comprise wild-type CAV sequences.

34. The method of any one of claims 1-33, wherein the CAV El plasmid module is first assembled with the CAV core plasmid module to produce a CAV El -core macromodule.

35. The method of claim 34, further comprising assembling the CAV El -core macromodule with the CAV E3 plasmid module and the CAV E4 plasmid module simultaneously.

36. The method of claim 34, further comprising assembling the CAV El -core macromodule with the CAV E3 plasmid module followed by the CAV E4 plasmid module.

37. The method of claim 34, further comprising assembling the CAV El-core macromodule with the CAV E4 plasmid module followed by the CAV E3 plasmid module.

38. The method of any one of claims 1-33, wherein tire CAV core plasmid module is first assembled with tire CAV E3 plasmid module to produce a CAV core-E3 macromodule.

39. The method of claim 38, further comprising assembling the CAV core-E3 macromodule with the CAV E4 plasmid module followed by the CAV El plasmid module.

40. The method of any one of claims 1-33, wherein the CAV core plasmid module is assembled simultaneously with the CAV E3 plasmid module and the CAV E4 plasmid module, followed by assembly with the CAV El plasmid module.

41. The method of any one of claims 1-33, wherein the CAV core plasmid module is first assembled with the CAV E4 plasmid module to produce a CAV core-E4 macromodule.

42. The method of claim 41 , further comprising assembling the CAV core-E4 macromodule with the CAV E3 plasmid module followed by assembly with the CAV El plasmid module.7158-101791-0243. The method of claim 41, further comprising assembling the CAV core-E4 macromodule with the CAV El plasmid module followed by assembly with the CAV E3 plasmid module.

44. The method of any one of claims 34-43, wherein the CAV plasmid modules are assembled using a seamless cloning method.

45. The method of claim 44, wherein the seamless cloning method is sequence- and ligationindependent cloning (SLIC) or Gibson.

46. The method of any one of claims 1-33, wherein the CAV El plasmid module, the CAV core plasmid module, the CAV E3 plasmid module and the CAV E4 plasmid module are assembled simultaneously.

47. The method of any one of claims 34-46, wherein the CAV plasmid modules are assembled using site-specific recombination (SSR).

48. The method of claim 47, comprising incubating the CAV plasmid modules in the presence of a SSR enzyme system capable of catalyzing recombination between the SSR recognition sequences such that a CAV genome is assembled from left to right: El-core-E3-E4 modules flanked by the left and right ITRs.

49. The method of claim 48, wherein the SSR sites are att sites.

50. The method of claim 49, wherein:the El plasmid module is flanked by attLl and attL4 sites;the E3 plasmid module is flanked by attL5 and attR3 sites;the E4 plasmid module is flanked by attL3 and attL2 sites; andthe core plasmid module comprises attRl and attR4 sites flanking a first ccdB cassette at the left end and attR5 and attR2 sites flanking at second ccdB cassette at the right end.

51. The method of any one of claims 34-49, wherein the CAV plasmid modules are assembled using a combination of a seamless cloning method and SSR.

52. The method of claim 37, comprising:linearizing the CAV core module plasmid by restriction enzyme digestion;7158-101791-02assembling the linear CAV core module plasmid with a linear CAV El plasmid module to produce a CAV El-core macromodule;assembling the CAV El-core macromodule with a linear CAV E4 plasmid module to produce a CAV El-core-E4 macromodule; andassembling the CAV El-core-E4 macromodule with a linear CAV E3 plasmid module to produce a complete CAV genome.

53. The method of claim 36, comprising:linearizing the CAV core module plasmid by restriction enzyme digestion;assembling the linear' CAV core module plasmid with a linear CAV El plasmid module to produce a CAV El -core macromodule;assembling the CAV El-core macromodule with a linear CAV E3 plasmid module to produce a CAV El-core-E3 macromodule; andassembling the CAV El-core-E3 macromodule with a linear CAV E4 plasmid module to produce a complete CAV genome.54 The method of claim 35, comprising:linearizing the CAV core module plasmid by restriction enzyme digestion;assembling the linear CAV core module plasmid with a linear CAV El plasmid module to produce a CAV El-core macromodule; andassembling the CAV El-core macromodule with a linear CAV E3 plasmid module and a linear CAV E4 plasmid module to produce a complete CAV genome.

55. The method of claim 39, comprising:linearizing the CAV core module plasmid by restriction enzyme digestion;assembling the linear CAV core module plasmid with a linear CAV E3 plasmid module to produce a CAV core-E3 macromodule;assembling the CAV core-E3 macromodule with a linear CAV E4 plasmid module to produce a CAV core-E3-E4 macromodule; andassembling the CAV core-E3-E4 macromodule with a linear CAV El plasmid module to produce a complete CAV genome.

56. The method of claim 40, comprising:linearizing the CAV core module plasmid by restriction enzyme digestion;assembling the linear' CAV core module plasmid with a linear CAV E3 plasmid module and a linear' CAV E4 plasmid module to produce a CAV core-E3-E4 macromodule; and7158-101791-02assembling the CAV core-E3-E4 macromodule with a linear CAV El plasmid module to produce a complete CAV genome.

57. The method of claim 42, comprising:linearizing the CAV core module plasmid by restriction enzyme digestion;assembling the linear CAV core module plasmid with a linear CAV E4 plasmid module to produce a CAV core-E4 macromodule;assembling the CAV core-E4 macromodule with a linear CAV E3 plasmid module to produce a CAV core-E3-E4 macromodule; andassembling the CAV core-E3-E4 macromodule with a linear CAV El plasmid module to produce a complete CAV genome.

58. The method of claim 43, comprising:linearizing the CAV core module plasmid by restriction enzyme digestion;assembling the linear CAV core module plasmid with a linear CAV E4 plasmid module to produce a CAV core-E4 macromodule;assembling the CAV core-E4 macromodule with a linear CAV El plasmid module to produce a CAV El-core-E4 macromodule; andassembling the CAV El-core-E4 macromodule with a linear CAV E3 plasmid module to produce a complete CAV genome.

59. The method of any one of claims 52-58, wherein the CAV El plasmid module, the CAV E3 plasmid module and / or the CAV E4 plasmid module are linearized by PCR amplification.

60. The method of any one of claims 1-59, wherein at least 12%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of clones screened after CAV genome assembly are correctly assembled.

61. A recombinant CAV genome produced according to the method of any one of claims 1-60.

62. A recombinant CAV, comprising the recombinant CAV genome of claim 61.

63. The recombinant CAV of claim 62, wherein the recombinant CAV is replication competent.

64. The recombinant CAV of claim 62, wherein the recombinant CAV is replication incompetent.7158-101791-0265. A library, comprising at least one or a plurality of different canine adenovirus (CAV) El plasmid modules, at least one or a plurality of different CAV core plasmid modules, at least one or a plurality of different CAV E3 plasmid modules, at least one or a plurality of different CAV E4 plasmid modules, or any combination thereof, wherein:the CAV El plasmid modules comprise CAV genome sequence from a left inverted terminal repeat (ITR) to non-coding sequence located between an E1B-55K open reading frame (ORF) and a pIX ORF;the CAV core plasmid modules comprise CAV genome sequence from non-coding sequence prior to a pIX ORF to non-coding sequence immediately prior to a pVIII ORF;the CAV E3 plasmid modules comprise CAV genome sequence from non-coding sequence prior to a pVIII ORF to non-coding sequence following a fiber ORF; and / orthe CAV E4 plasmid modules comprise CAV genome sequence from non-coding sequence following a fiber ORF to a right ITR.

66. The library of claim 65, further comprising one or more plasmid modules from a human adenovirus, a bat adenovirus, and / or a skunk adenovirus.

Images