Compositions and methods for regulating dec2 levels

Abstract

The present disclosure provides DEC2 targeting agents including peptides, polynucleotide targeting DEC2 mRNA, and small molecule inhibitors of DEC2. The present disclosure also provides peptides and fusion polypeptides comprising the disclosed peptides which function as DEC2 targeting agents. The present disclosure also provides methods of reducing pro-opiomelanocortin (POMC) expression in a cell or population thereof as well as treating obesity, promoting weight loss, restoring leptin sensitivity, reducing insulin resistance in a subject using the DEC2 targeting agents described herein.

Description

COMPOSITIONS AND METHODS FOR REGULATING DEC2 LEVELSFIELD OF THE DISCLOSUREThe present disclosure relates generally to compositions for regulating differentiated embryo chondrocyte 2 (DEC2) levels, and the methods of use of these compositions.BACKGROUND OF THE INVENTIONObesity has emerged as a significant global health burden that affects approximately 1 billion adults worldwide. It drives many metabolic perturbations, increasing the risk of a range of chronic and potentially life-threatening conditions, including type 2 diabetes, cardiovascular diseases, and certain types of cancer. Given that obesity imposes considerable economic burdens and medical challenges to society, it is imperative to deepen our understanding of the underlying molecular mechanisms and develop novel effective pharmacotherapeutic targets for managing obesity and its metabolic co-morbidities.The very popular glucagon-like peptide-1 (GLP-1) -based therapies for obesity are attracting considerable attention recently. However, numerous concerns have been raised regarding the introduction of these agents into clinical practice, including the rapid and substantial loss of lean muscle mass, severe and / or intolerable side effects, weight regain after discontinuation, as well as the necessity for long-term use and the unknown risks that may arise from it. Beyond incretin-based therapies, endogenous leptin is recognized as a central driving force for weight loss, exerting a profound influence on appetite regulation and energy balance -core principles essential for effective obesity treatment. Nonetheless, clinical trials of leptin-based therapies have largely failed, primarily due to the prevalence of leptin resistance among the obese population. As the primary central target sensing endogenous leptin, pro-opiomelanocortin (POMC) -expressing neurons in the hypothalamic arcuate nucleus (ARC) predominantly regulate energy balance by controlling feeding behavior, energy metabolism, and adiposity. Previous large genome-wide association studies (GWASs) have unraveled large amounts of genetic variants involved in a defective central leptin-melanocortin circuitry. However, only a limited number of genes, such as Pomc, Mc4r, and Sh2b1, have been validated. Mechanistically, the understanding of the leptin resistance that occur in POMC neurons is still lacking.There is a need in the art for identifying novel therapeutic targets and approaches aimed at restoring leptin sensitivity, which has been reported to occur during the early stages of obesity and greatly influences the metabolism of glucose and insulin sensitivity.SUMMARY OF THE DISCLSOUREThe present disclosure provides compositions and methods for regulating DEC2. In one embodiment, the present disclosure provides an isolated polypeptides. In one aspect, the polypeptide includes an amino acid sequence with at least 80%identity to QHLQDVRKRVQDLEQK (SEQ ID NO: 1) . In one aspect, the amino acid sequence of the polypeptide is QHLQDVRKRVQDLEQK (SEQ ID NO: 1) . In one aspect, the polypeptide is a fusion polypeptide. In one aspect, the polypeptide, further includes a TAT peptide. In one aspect, the TAT peptide includes the sequence of YGRKKRRQRRR (SEQ ID NO: 2) . In one aspect, the polypeptide further includes a chaperone-mediated autophagy (CMA) targeted motif having the sequence of KFERQKILDQRFFE (SEQ ID NO: 3) . In one aspect, the polypeptide binds to or interact with DEC2 protein. In one aspect, the polypeptide promotes DEC2 protein degradation. In one embodiment, the present disclosure provides a pharmaceutical composition of the fusion polypeptide described herein.The present disclosure provides methods of promoting DEC2 degradation in a cell or a population thereof. In one aspect, the method includes contacting or incubating the cell or the population thereof with the polypeptide or the pharmaceutical composition described herein. In one aspect, the polypeptide promotes DEC2 degradation. In one aspect, the cell is a neuron. In one aspect, the neuron is an arcuate nucleus pro-opiomelanocortin (ARCPOMC) -expressing neuron.In one embodiment, the present disclosure provides a method of reducing pro-opiomelanocortin (POMC) expression in a subject. In one aspect, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical compositions described herein. In one aspect, the polypeptide reduces POMC expression.In one embodiment, the present disclosure provides a method of treating obesity in a subject. In one aspect, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical compositions described herein, thereby reducing obesity in the subject.In one embodiment, the present disclosure provides a method of promoting weight loss in a subject. In one aspect, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical composition described herein thereby promoting weight loss in the subject.In one embodiment, the present disclosure provides a method of restoring leptin sensitivity in a subject. In one aspect, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical composition described herein, thereby promoting leptin sensitivity in the subject.In one embodiment, the present disclosure provides a method of reducing insulin resistance in a subject. In one aspect, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical composition described herein, thereby reducing insulin resistance in the subject.The present disclosure provides methods of promoting DEC2 degradation in a cell or a population thereof. In one aspect, the method includes contacting or incubating the cell or the population thereof with the DEC2 targeting agent described herein. In one aspect, the DEC2 targeting agent promotes DEC2 degradation. In one aspect, the cell is a neuron. In one aspect, the neuron is an arcuate nucleus pro-opiomelanocortin (ARCPOMC) -expressing neuron.In one embodiment, the present disclosure provides a method of reducing pro-opiomelanocortin (POMC) expression in a subject. In one aspect, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein. In one aspect, the polypeptide reduces POMC expression.In one embodiment, the present disclosure provides a method of treating obesity in a subject. In one aspect, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein, thereby reducing obesity in the subject.In one embodiment, the present disclosure provides a method of promoting weight loss in a subject. In one aspect, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein thereby promoting weight loss in the subject.In one embodiment, the present disclosure provides a method of restoring leptin sensitivity in a subject. In one aspect, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein, thereby promoting leptin sensitivity in the subject.In one embodiment, the present disclosure provides a method of reducing insulin resistance in a subject. In one aspect, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein, thereby reducing insulin resistance in the subject. In one aspect, the DEC2 targeting agent is a polynucleotide targeting DEC2 mRNA. In one aspect, the polynucleotide targeting DEC2 is a guide RNA, a tRNA, a suppressor tRNA, a siRNA, a miRNA, an mRNA, a shRNA, a circular RNA, or an antisense oligonucleotide (ASO) , a ribozyme, a DNAzyme, an aptamer, or any combination thereof. In one aspect, the DEC2 targeting agent is a polypeptide that includes a region or a portion of STAT3, wherein the STAT3 peptide reduces DEC2 levels and / or activity. In one aspect, DEC2 targeting agent includes an amino acid sequence with at least 80%identity to QHLQDVRKRVQDLEQK (SEQ ID NO: 1) . In one aspect, the DEC2 targeting agent includes the amino acid sequence of QHLQDVRKRVQDLEQK (SEQ ID NO: 1) . In one aspect, the DEC2 targeting agent is a fusion polypeptide. In one aspect, the fusion polypeptide includes a TAT peptide. In one aspect, the TAT peptide includes the sequence of YGRKKRRQRRR (SEQ ID NO: 2) . In one aspect, the fusion polypeptide further includes a chaperone-mediated autophagy (CMA) targeted motif including the sequence of KFERQKILDQRFFE (SEQ ID NO: 3) . In one aspect, the DEC2 targeting agent is a small molecule inhibitor of DEC2.BRIEF DESCRIPTION OF THE DRAWINGS

[0001] The foregoing and other objects, features and advantages will be apparent from the following description of particular embodiments of the disclosure, as illustrated in the accompanying drawings. The drawings are not necessarily to scale; emphasis instead being placed upon illustrating the principles of various embodiments of the disclosure.Figure 1A is a schematic timeline illustrating the Bhlhe41 (DEC2) over expression (OE) in the ARC induces obesity in mice fed with chow diet experiment. Figure 1B includes a schematic and representative images of stereotactic injection in the ARC (Scale bar = 100 μm) . Figure 1C, includes a representative image (left panel) and a graph detailing cumulative body weight gain (right panel) of control and Bhlhe41 OE mice. Figure 1D is a graph that illuminates cumulative food intake of control or Bhlhe41 OE mice. Figure 1E is a set of graphs depicting the daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake (right panel) of control of Bhlhe41 OE mice. Figure 1F is a schematic that displays food intake monitoring (top panel) and the food intake monitoring apparatus (bottom panel) . Figure 1G, is a graph that describes the cumulative bouts (left panel) and the daily time dependent and total (light, dark, and total phase) (right panel) cumulative food intake bouts of control or Bhlhe41 OE mice. Figure 1H, are a set of graphs that illustrates the daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake bout duration (right panel) of control or Bhlhe41 OE mice.Figure 2A, are a set of graphs showing daily time dependent (left panel) and total (light, dark, and total phase) energy expenditure (right panel) of control or Bhlhe41 OE mice. Figure 2B, is a set of graphs showing a daily time dependent (left panel) and total (light, dark, and total phase) respiratory exchange ratio (right panel) of control or Bhlhe41 OE mice. Figure 2C, is a graph of daily light, dark, and total cumulative movements of control or Bhlhe41 OE mice. Figure 2D, includes images of representative magnetic resonance imaging of control (left most panel) or Bhlhe41 OE mice (second panel to the left) . Furthermore, a set of graphs show visceral PDFF (second panel to the right) and subcutaneous PDFF (right most panel) of control or Bhlhe41 OE mice. Figure 2E, includes representative images of HE staining (scale bar = 50 μm) (left panel) , a graph showing weight (middle panel) , and a graph showing area of white adipose tissue (right panel) of control or Bhlhe41 OE mice.Figure 3A, illustrates a schematic of the experiment where ARCPOMC Bhlhe41 OE induces obesity in mice fed with chow diet. Figure 3B, is a representative image of control and ARCPOMC Bhlhe41 OE mice. Figure 3C, is a graph that shows cumulative body weight gain (g) of control and ARCPOMC Bhlhe41 OE mice. Figure 3D is a graph illustrating cumulative food intake (g) of control or ARCPOMC Bhlhe41 OE mice. Figure 3E, is a pair of graphs showing daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake (right panel) of control or ARCPOMC Bhlhe41 OE mice. Figure 3F, is a set of graphs displaying daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake bouts (right panel) of control or ARCPOMC Bhlhe41 OE mice. The figure compares the control and ARCPOMC Bhlhe41 OE between the two groups, with n = 8 mice per group. Figure 3G, is a set of two graphs displaying daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake bout duration (right panel) of control or ARCPOMC Bhlhe41 OE mice. Figure 3H, is a pair of graphs showing daily time dependent (left panel) and total (light, dark, and total phase) energy expenditure (right panel) of control or ARCPOMC Bhlhe41 OE mice.Figure 4A, is a pair of graphs illustrating daily time dependent (left panel) and total (light, dark, and total phase) respiratory exchange ratio (right panel) of control or ARCPOMC Bhlhe41 OE mice. Figure 4B, is a graph that shows daily light, dark, and total cumulative movements of control or ARCPOMC Bhlhe41 OE mice. Figure 4C, is an image showing representative magnetic resonance imaging (left images) and HE staining of white adipose tissue (scale bar = 50 μm) (right images) of control or ARCPOMC Bhlhe41 OE mice. Figure 4D, is a pair of two graphs showing visceral PDFF (%) (left panel) and subcutaneous PDFF (%) (right panel) of control or ARCPOMC Bhlhe41 OE mice. Figure 4E, is a pair of graphs showing weight (left panel) and area of white adipose tissue of control or ARCPOMC Bhlhe41 OE mice.Figure 5A, is a graph showing random blood glucose of control or ARCPOMC Bhlhe41 OE mice. Figure 5B, is a graph showing fasting blood glucose of control or ARCPOMC Bhlhe41 OE mice. Figure 5C, is a graph showing blood insulin of control or ARCPOMC Bhlhe41 OE mice. Figure 5D, is a graph showing time dependent blood glucose in insulin tolerance test of control or ARCPOMC Bhlhe41 OE mice. Figure 5E, is a graph showing time dependent blood glucose in glucose tolerance test of control or ARCPOMC Bhlhe41 OE mice. Figure 5F, is a graph showing blood leptin of control or ARCPOMC Bhlhe41 OE mice. Figure 5G, is a graph showing relative expression of Lepr mRNA of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 6 mice per group. Figure 5H, is a graph showing daily food intake change in leptin response test of control or ARCPOMC Bhlhe41 OE mice.Figure 6A, is a graph showing daily body weight change in leptin response test of control or ARCPOMC Bhlhe41 OE mice (Scale bar = 100) . Figure 6B, contains representative confocal images (scale bar = 100 μm) of p-STAT3 (top row of images, left panel) , POMC-tdTomato (bottom row of images, left panel) , and a graph showing percentage of p-STAT3 in POMC-TdTomato neurons (right panel) of control or ARCPOMC Bhlhe41 OE mice. Figure 6C, includes diagrams that illustrate the firing mode of POMC neurons in the ARC including Silent (left panel) , Tonic (middle) , and Burst (right panel) . Figure 6D, includes representative traces of leptin-induced firing of control (top panel) or ARCPOMC Bhlhe41 OE mice (bottom panel) . Figure 6E, is a pair of charts that show percentage of tonic, burst, and silent firing mode of control (left panel) or ARCPOMC Bhlhe41 OE mice (right panel) . Figure 6F, is graph that shows AP frequency of POMC neurons of control or ARCPOMC Bhlhe41 OE mice. Figure 6G, is a graph that shows AP amplitude of POMC neurons of control or ARCPOMC Bhlhe41 OE mice resistance to leptin. Figure 6H, is a graph illustrating depolarization of POMC neurons of control or ARCPOMC Bhlhe41 OE mice. Figure 6I, is a graph showing the reaction ratio of POMC neurons of control or ARCPOMC Bhlhe41 OE mice.Figure 7A, is a western blot (top panel) and a pair of graphs (bottom panel) that compare the relative expression of DEC2 (top of the top panel and left of the bottom panel) and POMC (middle of the top panel and right of the bottom panel) in the ARC between the two groups of control or high-fat diet mice, with n = 6 mice per group. Figure 7B, includes a western blot analysis (top panel) and a pair of graphs (bottom panel) that compare the relative expression of DEC2 (top of the top panel and left of the bottom panel) and POMC (middle of the top panel and right of the bottom panel) in the ARC of control or ARCPOMC Bhlhe41 OE mice, with n = 6 mice per group. Figure 7C, includes a western blot analysis (upper panel) and a pair of graphs (bottom panels) to show the relative expression of DEC2 and POMC in the ARC of control or Bhlhe41 OE GT1-7 cell. Figure 7D, is a motif of DEC2 and STAT3. Figure 7E, is a graph showing the putative binding score of DEC2. Figure 7F, is a putative illustration of p-STAT3 binding sites in POMC promoter (upper panel) and regulatory potential score of POMC (bottom panel) . Figure 7G, shows a graph comparing Pomc-luciferase activity between control or Bhlhe41 OE GT1-7 cell under vehicle and leptin treatment conditions. Figure 7H, shows a graph comparing fold enrichment for p-STAT3 binding between control or Bhlhe41 OE GT1-7 cell under vehicle and leptin treatment conditions. The data represents measurements from n = 6 sample per group.Figure 8A, shows a western blot analysis (left panel) and a bar graph (right panel) comparing the relative expression of leptin-induced phosphorylated STAT3 (p-STAT3) in the ARC between control or ARCPOMC Bhlhe41 OE mice with and without leptin stimulation. Figure 8B shows a western blot analysis (left panel) and a bar graph (right panel) comparing the relative expression of leptin-induced p-STAT3 of control or Bhlhe41 OE GT1-7 cell with and without leptin stimulation. Figure 8C shows representative images of coimmunoprecipitation experiments demonstrating the in vitro binding of endogenous DEC2 to STAT3 in GT1-7 cells. Figure 8D shows representative images of coimmunoprecipitation experiments demonstrating the in vitro binding of endogenous STAT3 to DEC2 in GT1-7 cells. Figure 8E shows representative images of coimmunoprecipitation experiments demonstrating the in vitro binding of exogenous DEC2 to STAT3 in GT1-7 cells. Figure 8F shows representative images of coimmunoprecipitation experiments of DEC2 with STAT3 in the ARC of control or ARCPOMC Bhlhe41 OE mice. Figure 8G. shows representative images of GST-pull down experiments of in vitro binding of exogenous DEC2 to STAT3. Figure 8H, is a diagram that illustrates the molecular docking interaction between specific domains of DEC2 with STAT3 (left panel) . DEC2351-358 binds to STAT3146-161 and DEC2293-326 interacts with STAT3278-293 (left panel) .Figure 9A, is a schematic of GT1-7 cell synchronization and TAT-DEC2 treatment. The TAT-DEC2 interrupts the interaction of DEC2 and STAT3 in vitro. Figure 9B illustrates the structural composition of two peptide sequences: TAT-DEC2-CTM and TAT-DEC2. Figure 9C, includes a western blot analysis (upper panel) and a pair of graphs (bottom panel) that illustrate the relative expression of DEC2 and POMC of control, TAT-Seq1 or TAT-Seq2 treatment in GT1-7 cell. Figure 9D, includes a western blot analysis (upper panel) and a graph (bottom panel) that demonstrate the relative expression of p-STAT3 of control or TAT-DEC2 treatment with or without leptin incubation in GT1-7 cell. Figure 9E is a schematic of GT1-7 cell synchronization and time-dependent TAT-DEC2 treatment. Figure 9F, includes a western blot analysis (upper panel) and a graph (bottom panel) that illustrate the relative expression of DEC2 of 0-8 h TAT-DEC2 treatment in GT1-7 cell. Figure 9G is a schematic of GT1-7 cell synchronization and concentration-dependent TAT-DEC2 treatment. Figure 9H, includes a western blot analysis (upper panel) and a graph (bottom panel) that show the relative expression of DEC2 of 0-500 nM TAT-DEC2 treatment in GT1-7 cell.Figure 10A, is a schematic of TAT-DEC2 i.c.v experiment for a long-term treatment. Figure 10B, is a graph showing cumulative body weight gain of DIO or DIO+TAT-DEC2 mice. The data represents measurements from n = 8 mice per group. Figure 10C, is a graph that shows the cumulative food intake of DIO or DIO+TAT-DEC2 mice. Figure 10D, is a schematic of TAT-DEC2 i.c.v experiment for a short-term treatment. Figure 10E, is a graph showing daily body weight change in leptin response test of DIO or DIO+TAT-DEC2 mice. Figure 10F, is a graph showing daily food intake change in leptin response test of DIO or DIO+TAT-DEC2 mice. Figure 10G, include images of representative magnetic resonance imaging (left panels) and images of HE staining of white adipose tissue (right panels) of DIO or DIO+TAT-DEC2 mice (scale bar = 50 μm) . Figure 10H, includes a pair of graphs showing visceral PDFF (left panel) and subcutaneous PDFF (right panel) of DIO or DIO+TAT-DEC2 mice. Figure 10I, includes a pair of graphs showing weight (left panel) and area (right panel) of white adipose tissue of DIO or DIO+TAT-DEC2 mice.Figure 11A, contains confocal images (left-middle panels) comparing p-STAT3 and POMC-tdTomato in POMC-tdTomato neurons of DIO (left panels) or DIO+TAT-DEC2 (middle panels) mice with or without leptin stimulation (scale bar =100 μm) . In Figure 11A, the right side is a graph that illustrates the percentage of p-STAT3 in POMC-tdTomato neurons of DIO (shown in grey) or DIO+TAT+DEC2 (shown in pink) mice with or without leptin stimulation. Figure 11B, is a representative trace of leptin-induced firing of DIO (upper panel) or DIO+TAT-DEC2 (bottom panel) mice. Figure 11C, is a pie chart showing the percentage of tonic, burst, and silent firing modes of DIO (left panel) or DIO+TAT-DEC2 (right panel) mice. Figure 11D, is a graph showing the action potential frequency of POMC neurons of DIO (shown in grey) or DIO+TAT-DEC2 (shown in pink) mice with or without leptin stimulation. Figure 11E, is a graph that shows the action potential amplitude of POMC neurons of DIO (shown in grey) or DIO+TAT-DEC2 (shown in pink) mice with or without leptin stimulation. Figure 11F, is a graph showing depolarization of POMC neurons of DIO (shown in grey) or DIO+TAT-DEC2 (shown in pink) mice. Figure 11G, is a graph that shows the reaction ratio of POMC neurons of DIO (show in grey) or DIO+TAT-DEC2 (shown in pink) mice.Figure 12A, includes a schematic (left panel) and representative images (scale bar = 100 μm) (right panel) of stereotactic injection in DMH. Figure 12B, is a graph showing the cumulative body weight gain of control or Bhlhe41 OE mice. Figure 12C, is a graph showing cumulative food intake of control or Bhlhe41 OE mice. Figure 12D, shows a schematic (left panel) and representative images (scale bar = 100 μm) (right panel) of stereotactic injection in the VMH. Figure 12E, is a graph illustrating the cumulative body weight gain of control and Bhlhe41 OE mice. Figure 12F, is a graph showing the cumulative food intake of control or Bhlhe41 OE mice. Figure 12G, includes a schematic (left panel) and representative images (scale bar = 100 μm) (right panel) of stereotactic injection in the PVN. Figure 12H, is a graph showing the cumulative body weight gain of control and Bhlhe41 OE mice. Figure 12I, is a graph showing the cumulative food intake of control or Bhlhe41 OE mice.Figure 13A, includes a schematic (left panel) and representative images (scale bar = 100 μm) (right panel) of stereotactic injection in the ARC of female mice. Figure 13B, is a graph showing the cumulative body weight gain of control and Bhlhe41 OE mice. The data represent a measurement from n = 8 mice per group. Figure 13C, is a graph showing the cumulative food intake of control or Bhlhe41 OE mice.Figure 14A, is a schematic of the Bhlhe41 OE experiment. Figure 14B, is an image of control (left) or Bhlhe41 OE (right) mice-fed with high-fat diet. Figure 14C, is a graph showing the cumulative body weight gain of control and Bhlhe41 OE mice. Figure 14D, is a graph showing the cumulative food intake of control or Bhlhe41 OE mice. Figure 14E, includes a pair of graphs showing the daily time dependent (left panel) and the total (light, dark, and total phase) (right panel) cumulative food intake of control or Bhlhe41 OE mice. Figure 14F, is a pair of graphs showing the Daily time dependent (left panel) and total (light, dark, and total phase) (right panel) cumulative food intake bouts of control or Bhlhe41 OE mice. Figure 14G, include a pair of graphs showing the daily time dependent (left panel) and total (light, dark, and total phase) (right panel) cumulative food intake bout duration of control or Bhlhe41 OE mice. Figure 14H, include a pair of graphs showing the daily time dependent (left panel) and total cumulative (light, dark, and total phase) (right panel) energy expenditure of control or Bhlhe41 OE mice.Figure 15A, is a pair of graphs showing the daily time dependent (left panel) and average (light, dark, and total phase) (right panel) respiratory exchange ratio of control or Bhlhe41 OE mice. Figure 15B, is a graph showing the daily light, dark, and total cumulative movements of control or Bhlhe41 OE mice. Figure 15C, are images including representative magnetic resonance imaging (left panels) and HE staining of white adipose tissue (right panels) (scale bar = 50 μm) of control (upper panels) or Bhlhe41 OE (bottom panels) mice. Figure 15D, is a pair of graphs showing the visceral PDFF (left panel) and subcutaneous PDFF (right panel) of control or Bhlhe41 OE mice. Figure 15E, is a pair of graphs illustrating the weight (left panel) and area (right panel) of white adipose tissue of control or ARCPOMC Bhlhe41 OE mice.Figure 16A, is a representative genotyping image for Pomc-Cre mice. Figure 16B, is a representative genotyping image for Agrp-Cre mice. Figure 16C, is a representative genotyping image for Aldh1l1-Cre-ERT2 mice. Figure 16D, is a representative genotyping image for Cx3cr1-Cre-ERT2 mice. Figure 16E, is a representative genotyping image for Bhlhe41fl / fl mice. Figure 16F, is a representative genotyping image for Rosa-LSL-tdTomato mice.Figure 17A, shows a schematic of Bhlhe41 OE in the ARC of Agrp-Cre mice. Figure 17B, is a representative image of control (left) or Bhlhe41 OE (right) in the ARC of Agrp-Cre mice. Figure 17C, is a graph showing the cumulative body weight gain of control or Bhlhe41 OE in the ARC of Agrp-Cre mice. Figure 17D, is a graph showing the cumulative food intake of control or Bhlhe41 OE in the ARC of Agrp-Cre mice. Figure 17E, is a schematic of Bhlhe41 OE in the ARC of Cx3cr1-Cre-ERT2 mice. Figure 17F, is a representative image of control (left) or Bhlhe41 OE (right) in the ARC of Cx3cr1-Cre-ERT2 mice. Figure 17G, is a graph that shows cumulative body weight gain of control or Bhlhe41 OE in the ARC of Cx3cr1-Cre-ERT2 mice. Figure 17H, is a graph showing the cumulative food intake of control or Bhlhe41 OE in the ARC of Cx3cr1-Cre-ERT2 mice.Figure 18A, shows a schematic of Bhlhe41 OE in the ARC of Cx3cr1-Cre-ERT2 mice. Figure 18B, is a representative image of control (left) or Bhlhe41 OE (right) in the ARC of Aldh1l1-Cre-ERT2 mice. Figure 18C, is a graph that shows the cumulative body weight gain of control or Bhlhe41 OE in the ARC of Aldh1l1-Cre-ERT2 mice. Figure 18D, is a graph that shows the cumulative food intake of control or Bhlhe41 OE in the ARC of Aldh1l1-Cre-ERT2 mice.Figure 19A, is a schematic of the ARCPOMC Bhlhe41 cKO experiment. Figure 19B, is a graph showing the cumulative body weight gain of control or Bhlhe41 cKO in mice-fed with high-fat diet. Figure 19C, is a graph showing the cumulative food intake of control or Bhlhe41 cKO in mice-fed with high-fat diet. Figure 19D, is a schematic of the ARCPOMC Bhlhe41 cKO (AAV-Cre) experiment. Figure 19E, is a cumulative body weight gain of control or Bhlhe41 cKO (AAV-Cre) in DIO mice. Figure 19F, is a graph showing the cumulative food intake of control or Bhlhe41 cKO (AAV-Cre) in DIO mice. Figure 19G, is a schematic of Bhlhe41 knocking down in the ARC experiment. Figure 19H, is a graph that shows the cumulative body weight gain of control (shown as empty circles) or Bhlhe41 knocking down in db / db (shown as filled circles) mice. Figure 19I, is a graph showing the cumulative food intake of control (shown as empty circles) or Bhlhe41 knocking down in db / db (shown as filled circles) mice.Figure 20A, is a schematic of activating ARCPOMC synaptic function experiment in Bhlhe41 OE mice. Figure 20B, is a graph showing the cumulative body weight gain of control or tettoxic in Bhlhe41 OE mice. Figure 20C is a graph showing the cumulative food intake of control or tettoxic in Bhlhe41 OE mice. Figure 20D is a schematic of activating ARCPOMC synaptic function experiment in mice-fed with high-fat diet. Figure 20E is a graph showing the cumulative body weight gain of control or tettoxic in mice-fed with high-fat diet. The data represents measurements from n = 8 mice per group. Figure 20F, is a graph showing cumulative food intake of control or tettoxic in mice-fed with high-fat diet. Figure 20G, shows a schematic of activating ARCPOMC synaptic function experiment in DIO mice. Figure 20H, is a graph showing the cumulative body weight gain of control or tettoxic in DIO mice. Figure 20I, is a graph showing the cumulative food intake of control or tettoxic in DIO mice.Figure 21A, are representative confocal images of TAT-DEC2-FITC (left panel) and POMC-tdTomato (middle panel) in DIO mice following i.c.v. administration of TAT-DEC2-FITC. The right panel of Figure 21A shows a merged confocal image of TAT-DEC2-FITC and POMC-TdTomato. Figure 21B, is a schematic of short-term i.c.v. administration of TAT-DEC2 experiment. Figure 21C, is a graph showing the daily body weight change of DIO or DIO+TAT-DEC2 mice. Figure 21D, is a graph showing daily food intake of DIO or DIO+TAT-DEC2 mice.Figure 22A, Figure 22 B, Figure 22C, Figure 22D, Figure 22E, Figure 22F, Figure 22G, and Figure 22H are uncropped western blot images.Figure 23A, Figure 23B, Figure 23C, Figure 23D, Figure 23E, Figure 23F, Figure 23G, Figure 23H, Figure 23I, Figure 23J, Figure 23K, and Figure 23L are uncropped blots of western blot images.Figure 24 is the graphical abstract summarizing the proposed mechanism of TAT-DEC2 in improving leptin sensitivity and metabolic outcomes in obesity.DETAILED DESCRIPTION OF THE INVENTIONImpaired leptin sensitivity in the arcuate nucleus pro-opiomelanocortin (ARCPOMC) -expressing neurons drives obesity. However, the underlying molecular mechanisms remain unclear. The present disclosure is based on the novel observation that differentiated embryo chondrocyte 2 (DEC2) in ARCPOMC neurons plays a pivotal role in leptin resistance. DEC2 negatively regulates the leptin-STAT3-POMC signaling pathway, which in turn increases food intake, metabolic dysfunction, and adiposity, consequently leading to obesity. Conversely, mice with conditional knockout of DEC2 in ARCPOMC neurons exhibit resistance to a high-fat diet (HFD) -induced obesity. DEC2 drives leptin resistance by interacting with the signal transducer and activator of transcription-3 (STAT3) , thereby inhibiting its phosphorylation and POMC expression. The inventors further identified the specific sequences involved in DEC2-STAT3 interactions and develops a novel peptide TAT-DEC2 disrupting the DEC2-STAT3 interaction and augmenting central leptin signaling. Accordingly, TAT-DEC2 treatment restores leptin sensitivity and achieves dose-dependent weight loss in HFD-induced obese mice. The present disclosure provides a mechanistically validated and pharmaceutically tractable therapeutic target to restore central leptin sensitivity and energy homeostasis in ARCPOMC neurons. Specifically, the inventors identify DEC2 in ARCPOMC neurons as a therapeutic target for central leptin resistance and obesity. Accordingly, the present disclosure provides compositions comprising DEC2 targeting agents and methods of use thereof.DEC2 Targeting AgentsIn some aspects, the present disclosure provides DEC2 targeting agents. As used herein a DEC targeting agent refers to a polypeptide, nucleic acid or a small molecule that binds to DEC2, interferes with DEC2 expression, and / or DEC2 activity in a cell. In some aspects, the DEC2 targeting agent promotes DEC2 degradation in a cell or a subject.In some aspects, the DEC2 targeting agent is a polypeptide. In some aspects, the DEC2 targeting agent includes a region or a portion of a STAT3 peptide that binds to and / or interacts with DEC2. In some aspects, DEC2 directly binds to STAT3 and inhibits STAT3 phosphorylation, thus silences POMC expression and impairs leptin sensitivity. In some aspects, the DEC2 targeting agent binds to DEC2 and interferes with the DEC2-STAT3 interaction. In some aspects, the DEC2 targeting agent includes a region or a portion of STAT3. In some aspects, the DEC2 targeting agent includes amino acids 146-161 of STAT3 (UniProt ID: P40763) . In some aspects, the DEC2 targeting agent includes amino acids 278-293 of STAT3 (UniProt ID: P40763) . In some aspects, the DEC2 targeting agent is a synthetic peptide that mimics amino acids 146-161 of STAT3 (UniProt ID: P40763) and / or amino acids 278-293 of STAT3 (UniProt ID: P40763) .In some aspects, the DEC2 targeting agent includes a peptide having at least 80%identity to the amino acid sequence of QHLQDVRKRVQDLEQK (SEQ ID NO: 1) . In some aspects, the DEC2 targeting agent includes a peptide having at least, 81%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%or 100%identity to the sequence of QHLQDVRKRVQDLEQK (SEQ ID NO: 1) .In some aspects, the DEC2 targeting agent is a fusion polypeptide. In some aspects, the fusion polypeptide includes the QHLQDVRKRVQDLEQK (SEQ ID NO: 1) . In some aspects, the DEC2 targeting agent includes a peptide that promotes cellular entry of the fusion polypeptide. In some aspects, the DEC2 targeting agent includes a transcriptional transactivator (TAT) transmembrane functional domain peptide YGRKKRRQRRR (SEQ ID NO: 2) . In some aspects, the TAT peptide is at the N terminus of the fusion polypeptide. In some aspects, the TAT peptide is at the C-terminus of the fusion polypeptide.In some aspects, the DEC2 targeting agent includes a peptide having at least 80%identity to the amino acid sequence of YGRKKRRQRRR (SEQ ID NO: 2) . In some aspects, the DEC2 targeting agent includes a peptide having at least, 81%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%or 100%identity to the sequence of YGRKKRRQRRR (SEQ ID NO: 2) .In some aspects, the fusion polypeptide further includes a peptide that promotes chaperone-mediated autophagy (CMA) . In some aspects, the fusion polypeptide includes a CMA motif having the sequence of KFERQKILDQRFFE (SEQ ID NO: 3) .In some aspects, the DEC2 targeting agent includes a peptide having at least 80%identity to the amino acid sequence of KFERQKILDQRFFE (SEQ ID NO: 3) . In some aspects, the DEC2 targeting agent includes a peptide having at least, 81%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%or 100%identity to the sequence of KFERQKILDQRFFE (SEQ ID NO: 3) .In some aspects, the DEC2 targeting agent is a polynucleotide targeting DEC2 mRNA. In some aspects, the polynucleotide targeting DEC2 is a guide RNA, a tRNA, a suppressor tRNA, a siRNA, a miRNA, an mRNA, a shRNA, a circular RNA, or an antisense oligonucleotide (ASO) , a ribozyme, a DNAzyme, an aptamer, or any combination thereof. In some aspects, the polynucleotide targeting DEC2 includes a guide RNA sequence, a tracrRNA, an siRNA, an shRNA, or an miRNA, an antisense oligonucleotide (e.g., for expression knockdown) , a structural element (e.g., an RNA hairpin) , or combinations thereof. In some aspects, the guide RNA may include a targeting sequence having sufficient complementarity to a DEC2 RNA to allow for hybridization of the targeting sequence to the DEC2 RNA. In some aspects, the targeting sequence has a minimum antisense complementarity of about 50, 60, 70, 80, 90, 100 0r more nucleotides or more to the DEC2 RNA. In some aspects, the guide RNA is 20 to 400 nucleotide residues long. In some aspects, the guide RNA sequence is 50-200 nucleotide residues long. In some embodiments, the guide RNA sequence is 80-150 nucleotide residues long.In some aspects, the DEC2 targeting agent is a DEC2 targeting antibody. In some aspects, the DEC2 targeting agent is a small molecule inhibitor of DEC2.Pharmaceutical CompositionsIn some aspects, the DEC2 targeting agents can be formulated in pharmaceutical compositions. In some aspects, these compositions include, in addition to the DEC2 targeting agents, a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the DEC2 targeting agents. In some aspects, the precise nature of the carrier or other material can depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.In some aspects, pharmaceutical compositions for oral administration are in tablet, capsule, powder, or liquid form. In some aspects, a tablet includes a solid carrier such as gelatin or an adjuvant. In some aspects, liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil. In some aspects, physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol are included.For intravenous, cutaneous, or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection. Preservatives, stabilizers, buffers, antioxidants and / or other additives can be included, as required.MethodsThe present disclosure provides methods of promoting DEC2 degradation in a cell or a population thereof. In some aspects, the method includes contacting or incubating the cell or the population thereof with the polypeptide or the pharmaceutical composition described herein. In some aspects, the polypeptide promotes DEC2 degradation. In some aspects, the cell is a neuron. In some aspects, the neuron is an arcuate nucleus pro-opiomelanocortin (ARCPOMC) -expressing neuron.In some aspects, the present disclosure provides a method of reducing pro-opiomelanocortin (POMC) expression in a subject. In some aspects, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical compositions described herein. In some aspects, the polypeptide reduces POMC expression.In some aspects, the present disclosure provides a method of treating obesity in a subject. In some aspects, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical compositions described herein, thereby reducing obesity in the subject.In some aspects, the present disclosure provides a method of promoting weight loss in a subject. In some aspects, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical composition described herein thereby promoting weight loss in the subject.In some aspects, the present disclosure provides a method of restoring leptin sensitivity in a subject. In some aspects, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical composition described herein, thereby promoting leptin sensitivity in the subject.In some aspects, the present disclosure provides a method of reducing insulin resistance in a subject. In some aspects, the method includes administering to a subject in need thereof, the polypeptide or the pharmaceutical composition described herein, thereby reducing insulin resistance in the subject.The present disclosure provides methods of promoting DEC2 degradation in a cell or a population thereof. In some aspects, the method includes contacting or incubating the cell or the population thereof with the DEC2 targeting agent described herein. In some aspects, the DEC2 targeting agent promotes DEC2 degradation. In some aspects, the cell is a neuron. In some aspects, the neuron is an arcuate nucleus pro-opiomelanocortin (ARCPOMC) -expressing neuron.In some aspects, the present disclosure provides a method of reducing pro-opiomelanocortin (POMC) expression in a subject. In some aspects, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein. In some aspects, the polypeptide reduces POMC expression.In some aspects, the present disclosure provides a method of treating obesity in a subject. In some aspects, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein, thereby reducing obesity in the subject.In some aspects, the present disclosure provides a method of promoting weight loss in a subject. In some aspects, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein thereby promoting weight loss in the subject.In some aspects, the present disclosure provides a method of restoring leptin sensitivity in a subject. In some aspects, the method includes administering to a subject in need thereof, the DEC2 targeting agent described herein, thereby promoting leptin sensitivity in the subject.EXAMPLESExample 1. MethodsExample 1 provides the materials and methods for the results described in Example 2.Mice and DietsMale and female C57BL / 6 J wild-type (WT) mice at 6 weeks of age were acquired from Shanghai Model Organisms Center, Inc. (Shanghai, China) . Pomc-Cre mice (C001017) , Agrp-Cre mice (C001249) , tamoxifen-inducible Cx3cr1-Cre (Cx3cr1-CreER) mice (C001247) , Aldh1l1-CreER mice (C001288) , Rosa-LSL-tdtomato reporter mice (C001181) , and Bhlhe41fl / fl mice (S-CKO-16917) were obtained from Cyagen Biotechnology Co., Ltd. (Shenzhen, China) . All transgenic mice and their WT littermates were generated on a C57BL / 6 background. Pomc-Cre mice were crossed with tdTomato reporter mice to generate mice with tdTomato-labeled POMC neurons (Pomc-Cre-tdTomato mice) . Bhlhe41fl / fl mice were crossed with Pomc-Cre mice or Pomc-Cre-tdTomato mice to produce POMC-Bhlhe41 KO (POMCΔBhlhe41) mice and POMCΔBhlhe41 mice expressing tdTomato, respectively. For the DIO mice model, age-matched mice were randomly assigned to either a standard chow diet (10 kcal%fat, Research Diets, D12450J) or a high-fat diet (HFD; 60 kcal%fat, Research Diets, D12492) after weaning. HFD feeding was initiated at 8 weeks of age and sustained for 12 weeks. Twice-weekly body weight and once-daily food intake of the mice were monitored.All mice were housed in a specific pathogen-free (SPF) facility with controlled temperature of 23 ± 2℃, humidity (50 ± 10%) , 12-hour light / dark cycle, and food and water ad libitum unless otherwise indicated. All experimental protocols involving mice were reviewed and approved by the Animal Care and Use Committee, Tongji University, and complied with the ARRIVE guidelines.Food intake and feeding behavior monitoringMice were individually caged for 1 week before transferring to the food intake and feeding behavior monitoring system (BioMed Easy Technologies Co., Ltd, Shenzhen, China) . Food intake and feeding number were automatically measured by every hour for 3 consecutive days.Adipose tissue quantificationMice were anesthetized with isoflurane (5%for induction and 1-2%for maintenance) and placed on a Siemens MEGNETOM skyra 7.0 T scanner (Zhangjiang Brain Imaging Centre) . Adipose tissue, excluding head, limbs, and tail, were quantified by using magnetic resonance Dixon technique.Body mass composition measurementsLive mice body mass composition was measured with a magnetic resonance imaging technique (EchoMRI 130, Echo Medical Systems) . Fat mass and lean mass were analyzed by using Echo MRI 14 software.Metabolic cage measurementsMice energy expenditure (EE) and spontaneous activity were monitored in real-time for 72 hours by using the Comprehensive Lab Animal Monitoring System (CLAMS, Columbus Instruments) with food and water ad libitum in a 12-h light / dark cycle (7 am to 7 pm) after 1-week individual housing for weaning. Oxygen consumption (VO2) and carbon dioxide production (VCO2) rates of individual mice were recorded. Respiratory-exchange-ratio (RER) was calculated by dividing VCO2 of VO2. EE values were calculated using indirect calorimetry as: EE = 3.815 × VO2 + 1.232 ×VCO2, and correlated to the body weight by using co-variance (ANCOVA) analysis. Spontaneous activities including movement in horizontal and vertical directions were measured by beam break counts, which were recorded by infrared light sources and optical sensors.Blood glucose, plasma insulin and leptinBlood samples were collected from tail veins. Mice were fasted for 6 hours and tail glucose levels were measured by using a Yuwell blood glucose meter (Yuwell Medical Equipment &Supply Co., Ltd., Jiangsu, China) . Plasma was isolated after centrifugation (5000 × g for 10 minutes) at 4℃ and stored at -80℃ until testing. Plasma insulin and leptin were measured by using insulin and leptin ELISA kits (Cloud-Clone Corp., formerly Uscn Life Science Inc., Wuhan, China) under the manufacturer’s instructions, respectively.Glucose tolerance test (GTT) , insulin tolerance test (ITT) , and leptin sensitivity assayGTT, ITT, and leptin sensitivity assays were performed according to previous study for investigating the insulin and leptin sensitivity, respectively. For the GTT, mice were fasted overnight and received intraperitoneal (i. p. ) injection of 20%glucose (2 g / kg, Sigma-Aldrich, St. Louis, MO) . For the ITT, mice were fasted and received insulin (0.75 U / kg, i. p., Sigma-Aldrich) . Tail glucose levels were measured at the indicated times points (0, 15, 30, 60, 90 and 120 minutes) after glucose or insulin injection. For the leptin sensitivity assay, mice were individually housed and acclimatized for 1 week prior to the test. Both groups were received vehicle (saline) twice daily (at 6 pm and 10 am) for 3 days, followed by 3 days of recombinant mouse leptin (1 mg / kg, i. p., CYT-351, Prospec-Tany Technogene Ltd., NJ, USA) treatment. Daily body weight and food intake were measured. For the leptin signaling study, mice were received leptin stimulation (1 mg / kg, i. p. ) 45 minutes before euthanasia.Stereotaxic microinjection and cannula implantationMice were anesthetized with isoflurane (5%for induction and 1-2%for maintenance) and placed on an automated stereotaxic system (RWD Life Science Co., LTD, Shenzhen, China) . Body temperature was maintained within a normal range during the entire procedures using a temperature maintenance device. The skull was exposed to identify the bregma and lambda, and a small opening in the skull was made using a microdrill at coordinates of ARC (AP: -1.7 mm, ML: ±0.2 mm, and -5.8 mm) , VMH (AP: -1.22 mm, ML: ±0.3 mm, and -5.5 mm) , DMH (AP: -1.94 mm, ML: ±0.3 mm, and -5.25 mm) , or PVN (AP: -0.82 mm, ML: ±0.1 mm, and -4.75 mm) . AAV vectors (200 nl) were injected into the ARC in 10 minutes using micro-syringe pump (RWD Life Science Co., LTD) . AAV-CMV-Bhlhe41-eGFP, AAV-hSyn-DIO-Bhlhe41, AAV-hSyn-DIO-Bhlhe41-eGFP, AAV-SFFV-DIO-Bhlhe41-eGFP, AAV-GfaABC1D-DIO-Bhlhe41-eGFP, AAV-hSyn-Cre, AAV-EF1α-DIO-tettoxlc-P2A-mCherry, and their control vehicles were purchased from BrainVTA Co., Ltd. (Wuhan, China) . For inducing adult-onset DEC2 overexpression in microglia and astrocytes, 8-week-old male Cx3cr1-CreER or Aldh1l1-CreER mice were received tamoxifen (0.15 g / kg, i. p., Sigma Aldrich) dissolved in corn oil for 3 consecutive days after stereotaxic microinjection of AAV-SFFV-DIO-Bhlhe41 and AAV-GfaABC1D-DIO-Bhlhe41, respectively. For i.c.v. cannula implantation, single cannula (26 G for O.D., 30 G for I.D., 6.8 mm length, RWD Life Science Co., LTD) was implanted into the 3rd brain ventricle at coordinates of AP: -1.7 mm, ML: 0.0 mm, and -5.8 mm. Mice were allowed to recover for 7 days after stereotaxic microinjection or cannula implantation.TAT-DEC2 administrationCannula-implanted DIO mice were randomly assigned to either TAT at a concentration of 200 μM in artificial cerebrospinal fluid (aCSF, ddH2O with 125 mM NaCl, 2.5 mM KCl, 1.0 mM MgCl2, 2.0 mM CaCl2, 1.25 mM NaH2PO4·2H2O, 2.6 mM NaHCO3 and 25 mM D-glucose monohydrate, 10 μl) or concentration-dependent TAT-DEC2 (10, 20, 50, 100, or 200 μM dissolved in aCSF, 10 μl) at a rate of 1 μl / minute once daily for 4 weeks, 90 minutes before the dark cycle.Hematoxylin and eosin (H&E) stainingWhite adipose tissue was dissected and stored in 4%paraformaldehyde solution. Paraffin-embedding, sectioning and H&E staining were performed by using corresponding kit (C0105S, Beyotime Biotechnology, Shanghai, China) under the manufacturer’s instructions.Immunohistochemistry and image analysisImmunohistochemistry was performed as previously described. In brief, mice were transcranially perfused with ice-cold 4%paraformaldehyde (P0099, Beyotime Biotechnology) , and the brains were post-fixed overnight at 4℃, and cryoprotected by immersion in 30%sucrose for 2 days until tissue sank, thereafter. Brains were then embedded and frozen in Tissue-Tek O. C. T. Compound (Sakura, Tokyo, Japan) . Coronal sections (40 mm) were prepared with the Leica microtome (CM1860, Leica Biosystems, IL, USA) and stored in freezing medium containing 50 v / v%PBS, 30 v / v%ethylene glycol, and 20 v / v%glycerol at -20℃ until staining. Brain sections were washed 3 times with PBS for 10 minutes per each at room temperature and then sequentially incubated with 1%NaOH for 30 minutes and blocking buffer (3%normal goat serum, 0.3%Triton X-100 in PBS) for 2 hours at room temperature. After blocking, the brain slices were incubated with primary antibody rabbit anti-phospho-STAT3 (9145, Cell Signaling Technology, Inc., 1: 500) in PBS containing 1%BSA and 0.3%Triton X-100 overnight at 4℃. After washing for 5 minutes with PBST (0.05%Tween 20 in PBS) 3 times, secondary antibody Alexa Fluor 488-goat anti-rabbit IgG (ab150077, Abcam, 1: 1000) were added and incubated for 1 hour at room temperature. Then the brain sections were washed 3 times (5 minutes per each) in PBST before mounting onto microscopy glasses and covering with cover glasses.A confocal laser scanning microscope (FV3000, Olympus, Ishikawa, Japan) was used for imaging. For quantifying the percentage of phospho-STAT3+ cells among POMC-TdTomato-expressing neurons under saline and leptin stimulation, all brain sections in the ARC (from bregma -1.22 to -2.70) were collected for immunostaining and analysis. The phospho-STAT3+ or POMC-TdTomato-expressing cell numbers were automatically counted in CellSens software (Olympus) . The percentage of phospho-STAT3+ cells among POMC-TdTomato-expressing neurons in the ARC was calculated by dividing the number of phospho-STAT3+ cell by the total number of POMC-TdTomato-expressing neurons.Cell culture and transfectionMouse hypothalamic GnRH neuronal cell line (GT1-7, EDC00037, EDITGENE Co., Ltd., Guangzhou, China) was cultured in DMEM (11965092, Gibco, Grand Island, NY, USA) with 10%fetal bovine serum (FBS) (A5256701, Gibco) and 1%penicillin-streptomycin (15140122, Gibco) . GT1-7 cells with DEC2 overexpression were generated by using LV expressing Bhlhe41 (GENECHEM CO., LTD., Shanghai, China) . For synchronization, prepared GT1-7 cells were treated with 100 nM of dexamethasone (265005, Sigma-Aldrich) for 15 minutes. Then cells were washed 3 times with DPBS and incubated in fresh media under dark / dark cycle. For leptin stimulation, GT1-7 cells were incubated with 100 nM recombinant mouse leptin (CYT-351, Prospec-Tany Technogene Ltd. ) for 30 minutes and then kept cultured in fresh media for 6 hours.Luciferase transcription activation assaysTo measure STAT3 activity on the POMC promoter, DEC2-scramble and DEC2-OE GT1-7 cells were seeded into a 24-well plate overnight and then transfected with 500 ng of the Pomc-luciferase reporter plasmid, combined with 200 ng of pRL-SV40 (BrainVTA Inc. ) , 500 ng of pRc / CMV-STAT3 or the control empty plasmids, according to the Lipofectamine 3000 protocol (L3000001, Invitrogen) . After 48 hours post-transfection, the cells were lysed and the luciferase activity was measured using the Dual Luciferase Reporter Gene Assay Kit (RG029S, Beyotime Biotechnology) according to the manufacturer’s instruction.Total protein extraction from cells and tissuesPrepared cell samples or hypothalamic tissues were homogenized with lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.1%SDS, 1%NP-40, 0.5%sodium deoxycholate and 1 mM Na3VO4; supplemented with protease and phosphatase inhibitor cocktail) . After homogenization, lysates were rotated at 4℃ for 1 hour and centrifuged at 14,000 × g for 10 minutes at 4℃. The supernatant was then collected. Protein concentration of the supernatant was quantified using a BCA Protein Assay Kit (23225, Thermo Fisher Scientific) . Protein samples were mixed with 5 × Laemmli buffer and boiled at 100℃ for 5 minutes. After cooling to room temperature, the protein samples were stored at -20℃ until testing.Western BlottingCells or tissues lysate were loaded on sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) . Separated proteins were transferred onto a polyvinylidene fluoride (PVDF) membranes (IPVH00010, Millipore) at 4℃ and 100 V for 2 hours. The membrane was blocked with 5%nonfat milk in Tris-buffered saline with 0.05%Tween 20 (TBST) at room temperature for 1 hour and then immunoblotted with primary antibodies overnight at 4℃. After incubation, the membrane was washed 3 times in TBST (10 minutes per each) and then incubated with a secondary antibody for 2 hours at room temperature. After washing 3 times in TBST (10 minutes per each) , the membranes were developed using the ECL plus Detection Kit (SQ201, Epizyme Biotech, Shanghai, China) and visualized using Bio-Rad gel-imaging analysis system (Bio-Rad) . The protein expressions were further quantified using Image J. Primary antibodies used in the current study and their dilutions were: DEC2 (NBP1-19613, Novus Biologicals, LLC., 1: 1000) , STAT3 (9139, Cell Signaling Technology, Inc., 1:1000) , phospho-STAT3 (9145, Cell Signaling Technology, Inc., 1: 1000) , POMC (ab254257, abcam, 1: 1000) , and β-actin (81115-1-RR, Proteintech, 1: 5000) .Co-immunoprecipitationFor in vitro DEC2-STAT3 co-immunoprecipitation, GT1-7 cells were transfected with indicated plasmids and leptin stimulation. Then cells were lysed with co-immunoprecipitation buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 1%Lubrol, and a mixture of proteinase and protease inhibitors) . After rotation at 4℃ for 30 minutes, cell lysates were centrifuged at 14,000 × g for 10 minutes at 4℃ and supernatants were collected. Then supernatants were incubated with specific antibodies overnight at 4℃, which were pre-cleaned by incubating with protein A / G Sepharose beads, followed by incubation with protein A / G Sepharose beads for 4 hours at 4℃. Immunoprecipitates were centrifuged and washed three times with 1 × wash buffer (10 minutes per each) . Then the immunoprecipitates were mixed with 1 × Laemmli buffer, and boiled at 100℃ for 5 minutes. Protein samples were separated onto 10%SDS-PAGE gels to conduct immunoblotting tests.GST pull downThe plasmids for GST-DEC2, combined with His-STAT31-750, His-STAT31-137, His-STAT3138-319, His-STAT3320-493, or His-STAT3494-750 were transfected into E. coli. The fusion proteins were prepared as described previously. Approximately 100 μg of GST and GST-DEC2 fusion protein was immobilized in 50 μL of glutathione agarose and equilibrated before being incubated together at 4℃ for 60 minutes with gentle rocking motion. Approximately 100 μg of His-STAT31-750, His-STAT31-137, His-STAT3138-319, His-STAT3320-493, or His-STAT3494-750 fusion protein was added to the immobilized GST-DEC2 and GST after 3 times of wash with PBST. The two fusion proteins were incubated overnight at 4℃ under gentle rotation. The bound proteins were eluted with elution buffer (10 mM glutathione in PBS, pH 8.0) and analyzed by immunoblotting.Molecular dockingMolecular docking was performed as previously described. The anticipated three-dimensional conformations of the underlying proteins DEC2 and STAT3 were acquired from the AlphaFold protein database and the Protein Data Bank (PDB) database, respectively. Additionally, AutoDockTools-1.5.7 was used to visualize and optimize the amino acid residues involved in interprotein interactions, while Docking Web Server (GRAMM) was used for protein-protein docking. Finally, the protein-protein interactions were predicted and the protein-protein interaction figure was generated by PyMOL software (version 4.3.0) .Chromatin immunoprecipitation assay (ChIP) and qPCR analysisPrepared cells were homogenized and cross-linked in 1%formaldehyde. Then, the cross-linked protein-DNA complexes were sonicated to a length between 200 and 500 bp. The total chromatin (1%) was saved as an “input” for later quantification. Complexes were pre-cleared and incubated with the Pierce Protein A / G Magnetic Beads (Thermo Scientific) and antibodies against STAT3 (9139, Cell Signaling Technology, Inc. ) overnight at 4 ℃. Subsequently, cross-linking was reversed by overnight incubation at 65 ℃. DNAs were purified by phenol / chloroform extraction, ethanol precipitation and the enriched promoter fragments were measured by qPCR. The following primers for detecting STAT3-POMC promoter occupancy were used as previously described:POMC-promotor site 1 (forward primer: GTTTGGGAGCTTGGTGTGTT (SEQ ID NO: 4) ; reverse primer: GGTGCCTGCCTAATCTACCA (SEQ ID NO: 5) ) ;POMC-promotor site 2 (forward primer: TTCCCATCATTGGGGAAATC (SEQ ID NO: 6) ; reverse primer: TCTTGCAGATCGGAGTGGAA (SEQ ID NO: 7) ) ;POMC-promotor site 3 (forward primer: GAGACAGAGGCCCAGACATTTT (SEQ ID NO: 8) ; reverse primer: CCGAGAATGAAAGTTGTGGTGAA (SEQ ID NO: 9) .Relative STAT3-POMC promoter occupancy was adjusted to the background content of the negative control, and the initial chromatin input by using the 2-ΔΔCt method.In situ proximity ligation assay (PLA)In situ DEC2-STAT3 PLA assays were performed as described previously, using the Duolink in situ kit (DUO92121, Sigma) according to the manufacturer’s instructions. In brief, brain slices were deposited on glass slides, covering adequate solution for keeping humidity. Then slices were pre-treated with respect to fixation and retrieval before staining. Samples were blocked with Duolink blocking solution and incubated in a heated humidity chamber for 1 hour at 37 ℃. After tapping off the blocking solution, samples were incubated with primary antibody DEC2 (1: 200) in Duolink antibody diluent and incubated for 2 hours at 37℃, then overnight at 4℃. After 2 times of wash with 1 × wash buffer A (5 minutes per each) at room temperature, samples were incubated with diluted PLUS and MINUS PLA probes in the Duolink antibody diluent (1: 5) for 1 hour at 37℃. After 2 times of wash with 1 × wash buffer A (5 minutes per each) at room temperature, samples were incubated with ligase in the 1 × Duolink ligation buffer (1: 40) for 30 minutes at 37℃. After 2 times of wash with 1 × wash buffer A (5 minutes per each) at room temperature, samples were incubated with Polymerase in the 1 × Duolink amplification buffer (1: 80) for 100 minutes at 37℃. Finally, after 2 times of wash with 1 × wash buffer B (10 minutes per each) and 0.01 ×wash buffer B for further 1 minute at room temperature, samples were mounted with coverslips using Duolink PLA mounting medium with DAPI for imaging.Statistical analysisAll data were presented as Mean ± SEM. P values were determined by student’s t test for two independent groups comparison, and one-or two-way ANOVA with Bonferroni’s multiple-comparisons test for curve and multiple factors involved analysis. *P < 0.05, **P < 0.01, ***P < 0.001, ****P <0.0001. Sample size was determined based on previous experiments, our previous experience, and the literature.The baseline variance was similar in the groups being compared.Data and software availabilityImageJ and Fiji software (https:  / / imagej. nih. gov / ij / ) were used for immunostaining analysis. GraphPad Prism 9 software (https:  / / www. graphpad. com / ) was used for student’s t test, one-or two-way ANOVA with Bonferroni multiple-comparison analysis.Any additional information required to re-analyze the data reported in this paper is available from the lead contact upon request.Example 2. Inhibition of hypothalamic DEC2 in pro-opiomelanocortin neurons restores leptin sensitivity during obesity and promotes weight lossHigh expression of DEC2 in the hypothalamic ARC promotes susceptibility to develop obesity.To determine the role of hypothalamic DEC2 in obesity, we firstly investigated whether it was changed during obesity. The results showed a significantly increased expression of hypothalamic DEC2 in HFD-induced obese mice. To further identify the specific region of hypothalamic DEC2 that contributed to this obesity-prone phenotype, we compared body weight and cumulative food intake in cases of DEC2-overexpression (OE) in the ARC, ventromedial hypothalamic nucleus (VMH) , dorsomedial hypothalamic nucleus (DMH) , and paraventricular hypothalamic nucleus (PVN) . We found that DEC2-OE in the VMH and DMH resulted in relatively normal the body weight and cumulative food intake, while mild weight gain and increased food intake were observed in the PVN. Previous studies have demonstrated that the PVN is downstream brain region of the ARC, which is involved in the melanocortin system. On the contrary, DEC2-OE specifically in the hypothalamic ARC exhibited a significant susceptibility to develop obesity, as indicated by body weight gains more than twice that of the scramble controls when fed a standard chow diet in both male and female. Feeding pattern analysis showed that mice with DEC2-OE in the hypothalamic ARC displayed significantly increased bouts and longer bout duration, especially in the dark cycle. Metabolic pattern analysis showed that mice with DEC2-OE in the hypothalamic ARC displayed significantly lower energy expenditure (EE) that normalized to body weight both in light and dark cycle, as well as dramatically decreased spontaneous activities in the dark cycle. The respiratory exchange ratios (RER) were relatively similar between two groups. Fat content analysis showed that the enhanced adiposity, together with increased weight and area of white adipose tissue (WAT) depots, were dramatically higher in mice with DEC2-OE in the hypothalamic ARC, compared with their scramble controls. Strikingly, all these changes of feeding behaviors and metabolic patterns were exacerbated when fed a HFD, indicating by gaining more than triple as much body weight as the control littermates. These data suggest that DEC2 in the hypothalamic ARC plays a potential role on obesity.High expression of DEC2 specifically in ARCPOMC neurons contributes to obesity.For further investigating which types of cells-specifically contributed to this obese phenotype, AAV-hSyn-DIO-Bhlhe41, AAV-SFFV-DIO-Bhlhe41, or AAV-GfaABC1D-DIO-Bhlhe41 was stereotaxic microinjected bilaterally in the hypothalamic ARC of Pomc-Cre mice, Agrp-Cre mice, Cx3cr1-CreER mice, and Aldh1l1-CreER mice, respectively. Surprisingly, only DEC2-OE specifically in ARCPOMC neurons promoted dramatically increased energy intake, metabolic dysfunction, adiposity, and obesity when fed a standard chow diet. No significant change on body weight and cumulative food intake among DEC2-OE in Agrp-Cre mice, Cx3cr1-CreER mice, or Aldh1l1-CreER mice were observed compared with their scramble controls. For further confirming the role of DEC2 in ARCPOMC neurons promoted HFD-induced obesity, we crossed Bhlhe41fl / fl mice with Pomc-Cre mice to generate mice lacking DEC2 selectively in POMC neurons (POMCΔBhlhe41) . When fed a HFD, POMCΔBhlhe41 mice showed significantly less weight gain, compared with their control littermates. Importantly, POMCΔBhlhe41 mice showed significant weight loss compared with their HFD-induced obese controls. Collectively, these results strongly suggest that DEC2 in ARCPOMC neurons is specifically involved in the process of obesity.High expression of DEC2 in ARCPOMC neurons impairs leptin sensitivity.Leptin and insulin resistance are closely implicated in the metabolic dysfunction during obesity. Previous studies have indicated that leptin resistance occurred during the early stages of obesity and greatly influenced the metabolism of glucose and insulin sensitivity. Here we further investigated whether DEC2 in ARCPOMC neurons plays a functionally significant role in leptin and insulin resistance during obesity. On a standard chow diet, the circulating leptin was significantly increased in mice with DEC2-OE in ARCPOMC neurons compared with their scramble controls, while both fasting and random plasma glucose, as well as circulating insulin level were comparable to control littermates. Notably, we further found that intraperitoneal (i. p. ) administration of exogenous leptin significantly reduced food intake and body weight, accompanied by a significant activation of phospho-STAT3 in the ARCPOMC neurons of scramble controls but not in mice with DEC2-OE. However, both in glucose (GTT) or insulin (ITT) tolerance tests, blood glucose levels in mice with DEC2-OE in ARCPOMC neurons were comparable to their control littermates. Moreover, we also observed relatively comparable body weight and cumulative food intake upon knocking down Bhlhe41 in the hypothalamic ARC of db / db mice and their control littermates, which carry a spontaneous mutation in the Lepr gene, resulting in a loss of ability to sense endogenous leptin. Collectively, these data suggest that high expression of DEC2 in ARCPOMC neurons primarily impairs leptin sensitivity, instead of insulin signaling. Thus, we hypothesized that DEC2 is downstream of leptin action and gain of DEC2 in ARCPOMC neurons impairs leptin signaling pathway.DEC2 silences POMC expression by inhibiting STAT3 phosphorylation during obesity.We then investigated the mechanism by which DEC2-OE in ARCPOMC neurons promotes leptin resistance. Supporting this hypothesis, single-cell RNA sequencing of hypothalamic ARC revealed that DEC2-OE dramatically inhibited Pomc expression in ARCPOMC neurons, and these findings also confirmed by qPCR assays. We further verified that increased DEC2 expression led to a decreased POMC level in mice with DEC2-OE in ARCPOMC neurons compared with their scramble controls. When fed a HFD, mice displayed increased weight gain and adiposity, associated with less phospho-STAT3 and POMC expression compared to standard chow diet littermates, which recapitulated the phenotypes observed in mice with DEC2-OE in ARCPOMC neurons. Moreover, results from single-cell RNA sequencing indicted that obviously silenced POMC / MC4R signaling and its related synaptic transmission were enriched. Then we also confirmed that rescuing the POMC / MC4R signaling by enhancing synaptic transmission in ARCPOMC neurons significantly prevented weight gain and food intake induced by DEC2-OE in ARCPOMC neurons in vivo. Similarly, rescuing the POMC / MC4R signaling and its synaptic transmission in ARCPOMC neurons also effectively prevented HFD-induced obesity in mice.As previously reported, DEC2 is a transcription factor that recognizes the E-box sequence in the promoter region of target genes and subsequently regulates the transcription of downstream genes. Thus, we investigated whether DEC2 directly binds to the POMC E-box sequence and transcriptionally repressed its mRNA transcription. However, the results showed that there was little interaction between DEC2 and POMC or STAT3 promotor according the database of transcriptional factor binding profiles by using JASPAR (https:  / / jaspar. elixir. no / ) . Thus, we investigated the role of DEC2-OE on leptin-induced phospho-STAT3 and POMC promotor occupancy by using ChIP and qPCR. Our results suggested that DEC2-OE significantly decreased leptin-induced phospho-STAT3 and POMC promotor occupancy with a comparable baseline. Considering STAT3 signaling is a mediator of leptin’s effects that directly regulates POMC expression, we then verified that impaired STAT3 signaling contributed to DEC2-induced POMC reduction in mice with DEC2-OE in ARCPOMC neurons compared with their scramble controls. In vitro, we further confirmed that the leptin-induced STAT3 phosphorylation was significantly suppressed by DEC2-OE compared with scramble in the pre-synchronized GT1-7 cells which endogenously express POMC. We further used a POMC-luciferase reporter assay to examine the effects of DEC2-OE on leptin-induced Pomc expression. We found that significantly decreased baseline and leptin-induced Pomc-luciferase reporter activity were observed in DEC2-OE cells compared with scramble controls, while cells with STAT3-OE rescued the inhibitory Pomc transcription activity induced by DEC-OE. Together, these data support that DEC2 plays a crucial role on impairing leptin-activated STAT3 signaling and subsequently silencing POMC expression during obesity.DEC2 directly binds to STAT3 and subsequently inhibits STAT3 phosphorylation.Given that DEC2 does not affect STAT3 and POMC expression through direct transcriptional regulation, we next explored the possibility of an interaction between DEC2 and STAT3 that could disrupt leptin-induced STAT3 phosphorylation. In vivo and in vitro co-immunoprecipitation results showed that the immunocomplex from cell and tissue lysates could be pulled down by an anti-STAT3 antibody, followed by immunoblotting with an anti-DEC2 antibody. Reciprocally, the immunocomplex also could be pulled down by an anti-DEC2 antibody, followed by immunoblotting with an anti-STAT3 antibody. Then GST-pull down assays verified that DEC2 interacted with STAT3 in a direct manner. To explore the specific region contributed to DEC-STAT3 interaction, we delineated the domains of STAT3 with a series of deletion mutants, including STAT31-137, STAT3138-319, STAT3320-493, and STAT3494-750. We found that the DNA binding domains and the N-terminal domains of STAT3 interacted with DEC2. For further identified the possible structural and functional sequences that contributes to DEC2-STAT3 interaction, their binding effects were predicted by molecular docking and deep-learning-based protein-protein interaction analysis. Our results showed that the binding effect might be contributed to two potential interaction regions (DEC2 351 to 358 amino acids / STAT3 146 to 161 amino acids; DEC2 293 to 326 amino acids / STAT3 278 to 293 amino acids) between DEC2 and STAT3. Together, these data suggest that the sequences of STAT3 served as a primary structure for directly targeting DEC2, thus suppressing leptin-induced STAT3 phosphorylation and its nuclear translocalization that regulates POMC expression.A novel peptide TAT-DEC2 disrupts DEC2-STAT3 interaction and dose-dependently ameliorates obesity in HFD-fed miceBased on our novel findings of the DEC2 and STAT3 binding sequences, we designed a novel peptide that modified with transcriptional transactivator (TAT) transmembrane functional domain (YGRKKRRQRRR, TAT-DEC2) . This peptide could mimic the STAT3 146 to 161-amino acid sequences (QHLQDVRKRVQDLEQK) to competitively bind with DEC2 and restore leptin-activated STAT3-POMC signaling. In GT1-7 cells, TAT-DEC2 with a chaperone-mediated autophagy (CMA) targeted motif (KFERQKILDQRFFE) treatment significantly induced DEC2 degradation in a concentration-dependent manner in the pre-synchronized GT1-7 cells with DEC2-OE. In addition, both TAT-DEC2-CMA and TAT-DEC2 treatment significantly rescued DEC2-OE-induced inhibition of phosphor-STAT3 and POMC expression in a concentration-dependent and time-dependent manner through degrading DEC2 and competitively interrupting DEC2-STAT3 interaction, respectively. We further found that incubating 100 μM of TAT-DEC2 for 4 hours reached the peak inhibition of DEC2 and STAT3 binding in vitro. For investigating the permeability of TAT-DEC2, we labelled florescence FITC to the peptide. Wide distribution of intracellular FITC-labeled TAT-DEC2 peptides could be observed in both incubated GT1-7 cells and the ARCPOMC of mice following i.c.v. administration. We further examined that a 200 μM i.c.v. administration of TAT-DEC2 for 1 week significantly restored leptin sensitivity, as indicated by rescued leptin-activated STAT3-POMC signaling during obesity. In HFD-induced obese mice, daily i.c.v. administration of TAT-DEC2 90 minutes before the dark cycle for 4 weeks showed significant weight loss in a dose-dependent manner. These weight loss effect could be synergized with energy restriction. Together, these results suggested that the novel peptide could effectively interrupt the abnormal interaction between DEC2 and STAT3 and thereby restore leptin sensitivity in HFD-induced obese mice. The 302 to 313-amino acid sequences of STAT3 protein sequences is of high homology in rodents and human, which provides a potential for obesity treatment with TAT-DEC2 in the future.DiscussionIn summary, we present novel findings that DEC2 in ARCPOMC neurons plays a crucial role in inducing leptin resistance and promoting obesity. Specifically, DEC2 silences the leptin-STAT3-POMC signaling pathway in ARCPOMC neurons, which in turn increases food intake, metabolic dysfunction, and adiposity, consequently leading to obesity. This scenario recapitulates the phenotypes observed in HFD-induced obese mice. Mechanistically, DEC2 inhibits leptin-activated POMC expression primarily by directly binding to the domains of STAT3 (QHLQDVRKRVQDLEQK) , thereby suppressing leptin-induced STAT3 phosphorylation and its subsequent nuclear translocalization, rather than through transcriptional repression. Besides, we propose a novel synthetic peptide modified with TAT and verify it re-sensitizes leptin-STAT3-POMC signaling pathway by competitively disrupting DEC2-STAT3 binding in vivo and in vitro. Importantly, the novel antagonistic peptide that targets hypothalamic DEC2 show its ability to restore leptin sensitivity and exhibit anti-obesity effects in a mouse model, which position TAT-DEC2 as a novel promising therapeutic agent for the treatment of obesity.Basically, exercise together with dietary and behavioral changes are the cornerstone of a comprehensive strategy for the treatment of obesity, as they have proven to be effective in reduction of body fat and improvement of metabolic dysfunction. However, in many cases, these approaches alone often yield an average weight loss less than 5%-10%. Nowadays, incretin-based pharmacotherapies, such as GLP-1 receptor agonists, glucose-dependent insulinotropic polypeptide (GIP) agonists, dual GLP-1 and GIP agonists, GLP-1 and glucagon co-agonists, as well as triple agonists with GLP-1, GIP and glucagon, have gained significant popularity worldwide. Clinical evidence has shown that these emerging obesity pharmacotherapies have sparked a revolution in the management of obesity and its metabolic co-morbidities. Together with dietary changes, exercise and counselling, these new emerging pharmacotherapies approximately achieving an average weight loss of 10%to 20%. However, many issues have addressed when these medicines translate to the treatment of obesity in clinical practice. The most significant concerns relate to the rapid and substantial loss of lean muscle mass, comparable to a decade or more of aging, potentially leading to sarcopenia and frailty. Besides, a large proportion are reported to be associated with gastrointestinal adverse events, erectile dysfunction, suicidal ideation, as well as even acute pancreatitis and pancreatic cancer. The severe and / or unendurable gastrointestinal side effects, including nausea, vomiting, diarrhea, constipation or otherwise, are the most common reasons patients are compelled to discontinue treatment. These data are particularly striking, as more than 80%of the participants in clinical trial reported experiencing gastrointestinal distress while taking semaglutide and liraglutide, although most instances were considered mild to moderate. Besides, weight regain after stopping taking these medications has also attracted a lot of attention. Previous studies have reported that a portion of patients who stop taking either medication experience weight regain, with 18.7%of liraglutide users and 17.7%of semaglutide users regaining all the weight they had lost or more. Consequently, all of these safety concerns drive the development of new drugs and therapeutic targets. Notably, the latest study reports a novel bimodal molecule that integrates GLP-1 receptor agonism with N-methyl-D-aspartate (NMDA) receptor antagonism. This compound exhibits an effective anti-obesity profile with a pronounced weight loss of 23.2%and fat mass loss of 45%in a HFD-induced obesity rodent model. Comparatively, our findings suggest that daily administration of the novel peptide targeting hypothalamic DEC2, especially in the ARCPOMC neurons, for 4 weeks showed significant weight loss of 22.8%and fat mass loss of 50%. Moreover, this weight loss effect can be synergistically enhanced when combined with energy restriction, potentially leading to more than a 30%reduction in body weight and 60%in fat mass.Beyond incretin-based therapies, the endogenous leptin is considered to be a driving force for weight loss. Nonetheless, clinical trials of leptin-based treatments, such as recombinant human leptin and its mutants, fragments, and antibodies, have failed to effectively treat obesity, predominately owing to leptin resistance in most obese population. Notably, different from all of these incretin-based pharmacotherapies that target reversing insulin resistance, our study focuses on uncovering therapeutic targets and novel approaches aimed at restoring leptin sensitivity, which has been reported to occur during the early stages of obesity and greatly influences the metabolism of glucose and insulin sensitivity. Our findings suggest that DEC2 in ARCPOMC neurons plays a crucial role in promoting leptin resistance by silencing STAT3-POMC signaling pathway, which is the first study reporting hypothalamic DEC2 that participates in central control of leptin sensitivity. Previous studies have primarily focused on the mechanism through which DEC2 transcriptionally represses its downstream target genes containing E-box elements, recognized by the basic helix-loop-helix motif, thereby maintaining physiological homeostasis and contributing to disease states. Several groundbreaking studies indicate that DEC2 can repress Clock / Bmal1-induced transactivation of Per1 promoter to maintain the circadian rhythm and sleep homeostasis, while a mutation in a human DEC2-P385R is associated with a short sleep phenotype. Other study has reported that DEC2 can directly repress the expression of lineage-inappropriate genes in alveolar macrophages, participating in their self-renewal and the maintenance of immune homeostasis in the lung alveoli. Moreover, DEC2 also plays a determined role in the pathological process of certain type of cancer, including triple-negative breast cancer, colorectal cancer, renal cell carcinoma, and acute myeloid leukemia. It is worth noting that loss or reduction of Bhlhe41 and its homologue Bhlhe40 in central microglia and peripheral macrophages leads to an increased expression of their downstream genes involved in cholesterol clearance and lysosomal processing, as well as cholesterol efflux and storage, strongly suggesting the potential role of DEC2 in modulating cholesterol hemostasis in lipid-rich tissues. In addition, alterations of Bhlhe41 and its close homolog Bhlhe40 during food deprivation and metabolic challenges in the hypothalamic ARC have been identified by cell type-specific transcriptomics approach. These lines of evidence strongly indicated the possibility that DEC2 is involved in maintaining the hemostasis of whole-body metabolism. In the present study, we have confirmed that DEC2-OE significantly induce leptin resistance and silence leptin-STAT3-POMC signaling pathway, which recapitulated the phenotypes observed in HFD-induced obese mice. Moreover, POMCΔBhlhe41 mice exhibit a decreased susceptibility to obesity when fed a HFD, whereas POMCΔBhlhe41 (AAV-Cre) in HFD-induced obese mice show spontaneous weight loss of 20%. Mechanistically, we have further demonstrated a novel inhibitory effect that DEC2 represses leptin-induced POMC expression through direct interaction with STAT3, which extends beyond the classic transcriptional repression function. Together, these findings highlight that hypothalamic DEC2 in POMC neurons could be a potent therapeutic target for the treatment of obesity.Unlike gene editing therapy, which has not yet matured for application in clinical treatment, peptide-mediated targeted delivery system has showed significant potential for clinical translation. Previous studies have indicated that the targeting peptide approach is specific to its intended target proteins with no off-target effects, which surpasses that achievable by DNA or mRNA targeting methods. In our case, the specificity and effectiveness of TAT-DEC2 in disrupting the DEC2-STAT3 interaction primarily depend on the specificity and affinity of the interaction between the protein-binding domain and its target protein. Therefore, we have constructed a peptide that simulates the 146 to 161-amino acid domain of STAT3 protein (QHLQDVRKRVQDLEQK) according to molecular docking and deep-learning-based protein-protein interaction analysis. Given that the amino acid sequence 150 to 162 (DVRKRQDLEQKM (SEQ ID NO: 10) ) , which is located within the first helix of the coiled-coil domain in the STAT3 crystal structure, is indispensable for STAT3 nuclear import, their interaction with DEC2 may inhibit process of nuclear import of phospho-STAT3. We further confirmed that this novel peptide could specifically target the DEC2-STAT3 interaction domain and competitively interrupt their binding, enabling STAT3 phosphorylation and its subsequent nuclear translocalization to rescue its transcription of POMC both in vivo and in vitro.Given the advantages of targeting peptide containing a cell membrane penetrating domain (YGRKKRRQRRR) that facilitates the bypassing of the blood-brain barrier (BBB) and plasma membrane, our previous study and others have highlighted this targeting peptide-based approach for the treatment of neurological disorders, including cerebral stroke, subarachnoid hemorrhage, and Alzheimer's disease. These studies show that varying the duration and concentration of the applied targeting peptides can easily regulate the extent and duration of protein degradation, which enables for precise control over the expression levels of the endogenous protein implicated in these diseases processes. Similarly, TAT-DEC2-CTM also exhibits a short-term action in vitro, as evidenced by previous study and ours that a single dose leading to a time-dependent and reversible reduction in DEC2 levels, which became significant by 2 hours, peaked at 4 hours, and then gradually returned to baseline levels within 8 hours. These time-dependent and reversible DEC2 degradation strongly indicate that the therapeutic effect is not due to toxicity-induced cell death, but is a result of TAT-mediated protein degradation. Likewise, our previous studies and others have demonstrated that TAT-mediated peptides exhibit a short-term profile, with persistence up to 4 hours, by i. p., subcutaneous (s.c. ) or intravenous (i.v. ) administration in vivo. Although some studies showed that administrating a second dose of TAT-mediated peptide could significantly prolong the therapeutic effect, this duration is still too short to cover the daily therapeutic requirement necessary for the long-term management of chronic diseases, including obesity. Therefore, we administrated via the i.c.v. route, which has been observed to have a duration of action more than twice as long as when administered via the bloodstream. However, more efforts are encouraged to achieve sustained release by modifying the formulation or delivery method.Taken together, our findings represent the first report detailing a mechanistically validated and pharmaceutically tractable therapeutic target to restore central leptin sensitivity and energy homeostasis in ARCPOMC neurons. We uncover a pathophysiological mechanism that underlies the development of leptin resistance during obesity and identify a novel therapeutic peptide with potential for clinical translation for the treatment of obesity.Figure 1A is a schematic timeline illustrating the Bhlhe41 (DEC2) over expression (OE) in the ARC induces obesity in mice fed with chow diet experiment. Figure 1B includes a schematic and representative images of stereotactic injection in the ARC (Scale bar = 100 μm) . Figure 1C, includes a representative image (left panel) and a graph detailing cumulative body weight gain (right panel) of control and Bhlhe41 OE mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results indicate that Bhlhe41 over expression in the ARC induced obesity in mice fed with chow diet. Figure 1D is a graph that illuminates cumulative food intake of control or Bhlhe41 OE mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet. Figure 1E is a set of graphs depicting the daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake (right panel) of control of Bhlhe41 OE mice. The figure compares control and Bhlhe41 OE between the two groups, with n =8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating ****P < 0.0001. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet. Figure 1F is a schematic that displays food intake monitoring (top panel) and the food intake monitoring apparatus (bottom panel) . Figure 1G, is a graph that describes the cumulative bouts (left panel) and the daily time dependent and total (light, dark, and total phase) (right panel) cumulative food intake bouts of control or Bhlhe41 OE mice. The figure compares control and Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating*P < 0.05 and **P < 0.01. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet. Figure 1H, are a set of graphs that illustrates the daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake bout duration (right panel) of control or Bhlhe41 OE mice. The figure compares control and Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating ***P < 0.001. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet.Figure 2A, are a set of graphs showing daily time dependent (left panel) and total (light, dark, and total phase) energy expenditure (right panel) of control or Bhlhe41 OE mice. The figure compares control and Bhlhe41 OE between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating ***P < 0.001, ****P <0.0001. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet. Figure 2B, is a set of graphs showing a daily time dependent (left panel) and total (light, dark, and total phase) respiratory exchange ratio (right panel) of control or Bhlhe41 OE mice. The data represents measurements from n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet. Figure 2C, is a graph of daily light, dark, and total cumulative movements of control or Bhlhe41 OE mice. The figure compares control and Bhlhe41 OE between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating ****P < 0.0001. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet. Figure 2D, includes images of representative magnetic resonance imaging of control (left most panel) or Bhlhe41 OE mice (second panel to the left) . Furthermore, a set of graphs show visceral PDFF (second panel to the right) and subcutaneous PDFF (right most panel) of control or Bhlhe41 OE mice. The figure compares control and Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ****P < 0.0001. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet. Figure 2E, includes representative images of HE staining (scale bar = 50 μm) (left panel) , a graph showing weight (middle panel) , and a graph showing area of white adipose tissue (right panel) of control or Bhlhe41 OE mice. The figure compares control and Bhlhe41 OE between the two groups, with n = 8 mice per group and 80-100 adipocytes from 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ****P < 0.0001. The results indicate that Bhlhe41 over expression in the ARC induces obesity in mice fed with chow diet.Figure 3A, illustrates a schematic of the experiment where ARCPOMC Bhlhe41 OE induces obesity in mice fed with chow diet. Figure 3B, is a representative image of control and ARCPOMC Bhlhe41 OE mice. Figure 3C, is a graph that shows cumulative body weight gain (g) of control and ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet. Figure 3D is a graph illustrating cumulative food intake (g) of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet. Figure 3E, is a pair of graphs showing daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake (right panel) of control or ARCPOMC Bhlhe41 OE mice. The figure compares the control and ARCPOMC Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ****P < 0.0001. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet. Figure 3F, is a set of graphs displaying daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake bouts (right panel) of control or ARCPOMC Bhlhe41 OE mice. The figure compares the control and ARCPOMC Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that *P < 0.05 and **P < 0.01. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet. Figure 3G, is a set of two graphs displaying daily time dependent (left panel) and total (light, dark, and total phase) cumulative food intake bout duration (right panel) of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ***P < 0.001. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet. Figure 3H, is a pair of graphs showing daily time dependent (left panel) and total (light, dark, and total phase) energy expenditure (right panel) of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that***P < 0.001 and ****P < 0.0001. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet.Figure 4A, is a pair of graphs illustrating daily time dependent (left panel) and total (light, dark, and total phase) respiratory exchange ratio (right panel) of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet. Figure 4B, is a graph that shows daily light, dark, and total cumulative movements of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ****P < 0.0001. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet. Figure 4C, is an image showing representative magnetic resonance imaging (left images) and HE staining of white adipose tissue (scale bar = 50 μm) (right images) of control or ARCPOMC Bhlhe41 OE mice. Figure 4D, is a pair of two graphs showing visceral PDFF (%) (left panel) and subcutaneous PDFF (%) (right panel) of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ****P <0.0001. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet. Figure 4E, is a pair of graphs showing weight (left panel) and area of white adipose tissue of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE between the two groups, with n = 8 mice per group and 80-100 adipocytes from 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ****P < 0.0001. The results demonstrate Bhlhe41 over expression in the ARCPOMC induces obesity in mice fed with chow diet.Figure 5A, is a graph showing random blood glucose of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 10 mice per group. Statistical analysis is performed using a two-tailed Student’s t test. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 5B, is a graph showing fasting blood glucose of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 10 mice per group. Statistical analysis is performed using a two-tailed Student’s t test. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 5C, is a graph showing blood insulin of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 5D, is a graph showing time dependent blood glucose in insulin tolerance test of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 5E, is a graph showing time dependent blood glucose in glucose tolerance test of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 5F, is a graph showing blood leptin of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 8 mice per group. Statistical analysis is performed using a Two-tailed Student’s t test, with results indicating that ***P < 0.001. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 5G, is a graph showing relative expression of Lepr mRNA of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ****P <0.0001. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 5H, is a graph showing daily food intake change in leptin response test of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that **P < 0.01. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance.Figure 6A, is a graph showing daily body weight change in leptin response test of control or ARCPOMC Bhlhe41 OE mice (Scale bar = 100) . The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that *P < 0.05 and **P < 0.01. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 6B, contains representative confocal images (scale bar = 100 μm) of p-STAT3 (top row of images, left panel) , POMC-tdTomato (bottom row of images, left panel) , and a graph showing percentage of p-STAT3 in POMC-TdTomato neurons (right panel) of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 18 brain slices from 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that *P < 0.05 and ****P < 0.0001. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 6C, includes diagrams that illustrate the firing mode of POMC neurons in the ARC including Silent (left panel) , Tonic (middle) , and Burst (right panel) . Figure 6D, includes representative traces of leptin-induced firing of control (top panel) or ARCPOMC Bhlhe41 OE mice (bottom panel) . Figure 6E, is a pair of charts that show percentage of tonic, burst, and silent firing mode of control (left panel) or ARCPOMC Bhlhe41 OE mice (right panel) . The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 45-54 POMC neurons from 6 mice per group. Figure 6F, is graph that shows AP frequency of POMC neurons of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 16-18 POMC neurons from 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that **P <0.01. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 6G, is a graph that shows AP amplitude of POMC neurons of control or ARCPOMC Bhlhe41 OE mice resistance to leptin. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 16-18 POMC neurons from 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 6H, is a graph illustrating depolarization of POMC neurons of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 16-18 POMC neurons from 6 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ***P < 0.001. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance. Figure 6I, is a graph showing the reaction ratio of POMC neurons of control or ARCPOMC Bhlhe41 OE mice. The figure compares control and ARCPOMC Bhlhe41 OE promotion of leptin resistance between the two groups, with n = 16-18 POMC neurons from 6 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ***P < 0.001. The results demonstrate Bhlhe41 over expression in the ARCPOMC promotes leptin resistance.Figure 7A, is a western blot (top panel) and a pair of graphs (bottom panel) that compare the relative expression of DEC2 (top of the top panel and left of the bottom panel) and POMC (middle of the top panel and right of the bottom panel) in the ARC between the two groups of control or high-fat diet mice, with n = 6 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating **P < 0.01 and ***P < 0.001. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 7B, includes a western blot analysis (top panel) and a pair of graphs (bottom panel) that compare the relative expression of DEC2 (top of the top panel and left of the bottom panel) and POMC (middle of the top panel and right of the bottom panel) in the ARC of control or ARCPOMC Bhlhe41 OE mice, with n = 6 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ***P < 0.001 and ****P < 0.0001. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 7C, includes a western blot analysis (upper panel) and a pair of graphs (bottom panels) to show the relative expression of DEC2 and POMC in the ARC of control or Bhlhe41 OE GT1-7 cell. The figure compares the control and Bhlhe41 OE mice, with n = 6 sample per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ***P < 0.001. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 7D, is a motif of DEC2 and STAT3. Figure 7E, is a graph showing the putative binding score of DEC2. Figure 7F, is a putative illustration of p-STAT3 binding sites in POMC promoter (upper panel) and regulatory potential score of POMC (bottom panel) . Figure 7G, shows a graph comparing Pomc-luciferase activity between control or Bhlhe41 OE GT1-7 cell under vehicle and leptin treatment conditions. The data represents measurements from n = 6 sample per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that *P < 0.05 and ****P <0.0001. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 7H, shows a graph comparing fold enrichment for p-STAT3 binding between control or Bhlhe41 OE GT1-7 cell under vehicle and leptin treatment conditions. The data represents measurements from n = 6 sample per group. This figure demonstrates how DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that **P < 0.01 and ****P < 0.0001. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression.Figure 8A, shows a western blot analysis (left panel) and a bar graph (right panel) comparing the relative expression of leptin-induced phosphorylated STAT3 (p-STAT3) in the ARC between control or ARCPOMC Bhlhe41 OE mice with and without leptin stimulation. The data represents measurements from n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that **P < 0.01 and ***P < 0.001. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 8B shows a western blot analysis (left panel) and a bar graph (right panel) comparing the relative expression of leptin-induced p-STAT3 of control or Bhlhe41 OE GT1-7 cell with and without leptin stimulation. The data represents measurements from n = 6 sample per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that **P < 0.01. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 8C shows representative images of coimmunoprecipitation experiments demonstrating the in vitro binding of endogenous DEC2 to STAT3 in GT1-7 cells. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 8D shows representative images of coimmunoprecipitation experiments demonstrating the in vitro binding of endogenous STAT3 to DEC2 in GT1-7 cells. The results illustrate that DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 8E shows representative images of coimmunoprecipitation experiments demonstrating the in vitro binding of exogenous DEC2 to STAT3 in GT1-7 cells. This figure demonstrates how DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 8F shows representative images of coimmunoprecipitation experiments of DEC2 with STAT3 in the ARC of control or ARCPOMC Bhlhe41 OE mice. This figure demonstrates how DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 8G. shows representative images of GST-pull down experiments of in vitro binding of exogenous DEC2 to STAT3. This figure demonstrates how DEC2 interacts with STAT3, thereby inhibiting leptin-induced POMC expression. Figure 8H, is a diagram that illustrates the molecular docking interaction between specific domains of DEC2 with STAT3 (left panel) . DEC2351-358 binds to STAT3146-161 and DEC2293-326 interacts with STAT3278-293 (left panel) . Key amino acid residues in DEC2 interacting with STAT3 are labeled (right panel) . The figure also highlights hydrogen bonds between two proteins (right panel) .Figure 9A, is a schematic of GT1-7 cell synchronization and TAT-DEC2 treatment. The TAT-DEC2 interrupts the interaction of DEC2 and STAT3 in vitro. Figure 9B illustrates the structural composition of two peptide sequences: TAT-DEC2-CTM and TAT-DEC2. Both peptides contain a cell membrane penetrating domain (TAT47-57) with the sequence “YGRKKRRQRRR” , and a protein binding domain labeled as “Targeting sequence. ” The TAT-DEC2-CTM peptide includes an additional CMA targeting motif (CTM) with the sequence “KFERQKILDQRRFFE. ” The diagram highlights the key functional domains of these peptides designed to interrupt the interaction between DEC2 and STAT3 in vitro. Figure 9C, includes a western blot analysis (upper panel) and a pair of graphs (bottom panel) that illustrate the relative expression of DEC2 and POMC of control, TAT-Seq1 or TAT-Seq2 treatment in GT1-7 cell. The data represents measurements from n = 6 sample per group. Statistical analysis is performed using a one-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ***P < 0.001. These results support the hypothesis that TAT-DEC2 interrupts the interaction of DEC2 and STAT3 in vitro. Figure 9D, includes a western blot analysis (upper panel) and a graph (bottom panel) that demonstrate the relative expression of p-STAT3 of control or TAT-DEC2 treatment with or without leptin incubation in GT1-7 cell. The data represents measurements from n = 6 sample per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that**P < 0.01 and ****P < 0.0001. These results support the hypothesis that TAT-DEC2 interrupts the interaction of DEC2 and STAT3 in vitro. Figure 9E is a schematic of GT1-7 cell synchronization and time-dependent TAT-DEC2 treatment. Figure 9F, includes a western blot analysis (upper panel) and a graph (bottom panel) that illustrate the relative expression of DEC2 of 0-8 h TAT-DEC2 treatment in GT1-7 cell. The data represents measurements from n = 3 sample per group. Statistical analysis is performed using a one-way ANOVA, with Bonferroni multiple comparisons, with results indicating that *P < 0.05 and **P < 0.01. These results support the hypothesis that TAT-DEC2 interrupts the interaction of DEC2 and STAT3 in vitro. Figure 9G is a schematic of GT1-7 cell synchronization and concentration-dependent TAT-DEC2 treatment. Figure 9H, includes a western blot analysis (upper panel) and a graph (bottom panel) that show the relative expression of DEC2 of 0-500 nM TAT-DEC2 treatment in GT1-7 cell. The data represent measurements from n = 3 sample per group. Statistical analysis is performed using a one-way ANOVA, with Bonferroni multiple comparisons with results indicating that **P < 0.01 and ***P < 0.001.Figure 10A, is a schematic of TAT-DEC2 i.c.v experiment for a long-term treatment. Figure 10B, is a graph showing cumulative body weight gain of DIO or DIO+TAT-DEC2 mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating ****P < 0.0001. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 10C, is a graph that shows the cumulative food intake of DIO or DIO+TAT-DEC2 mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ****P < 0.0001. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 10D, is a schematic of TAT-DEC2 i.c.v experiment for a short-term treatment. Figure 10E, is a graph showing daily body weight change in leptin response test of DIO or DIO+TAT-DEC2 mice. The data represents measurements from n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that *P < 0.05. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 10F, is a graph showing daily food intake change in leptin response test of DIO or DIO+TAT-DEC2 mice. The data represent measurements from n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating *P < 0.05. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 10G, include images of representative magnetic resonance imaging (left panels) and images of HE staining of white adipose tissue (right panels) of DIO or DIO+TAT-DEC2 mice (scale bar = 50 μm) . The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 10H, includes a pair of graphs showing visceral PDFF (left panel) and subcutaneous PDFF (right panel) of DIO or DIO+TAT-DEC2 mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that **P < 0.01 and ****P < 0.0001. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 10I, includes a pair of graphs showing weight (left panel) and area (right panel) of white adipose tissue of DIO or DIO+TAT-DEC2 mice. The data represent measurements from n = 8 mice per group and 80-100 adipocytes from 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that **P < 0.01. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice.Figure 11A, contains confocal images (left-middle panels) comparing p-STAT3 and POMC-tdTomato in POMC-tdTomato neurons of DIO (left panels) or DIO+TAT-DEC2 (middle panels) mice with or without leptin stimulation (scale bar =100 μm) . In Figure 11A, the right side is a graph that illustrates the percentage of p-STAT3 in POMC-tdTomato neurons of DIO (shown in grey) or DIO+TAT+DEC2 (shown in pink) mice with or without leptin stimulation. The data represent measurements from n = 18 brain slices from 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ***P < 0.001 and ****P < 0.0001. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 11B, is a representative trace of leptin-induced firing of DIO (upper panel) or DIO+TAT-DEC2 (bottom panel) mice. Figure 11C, is a pie chart showing the percentage of tonic, burst, and silent firing modes of DIO (left panel) or DIO+TAT-DEC2 (right panel) mice. The data represents measurements from n = 41-48 POMC neurons from 6 mice per group. Figure 11D, is a graph showing the action potential frequency of POMC neurons of DIO (shown in grey) or DIO+TAT-DEC2 (shown in pink) mice with or without leptin stimulation. The data represent measurements from n = 14-16 POMC neurons from 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that *P < 0.05 and **P < 0.01. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 11E, is a graph that shows the action potential amplitude of POMC neurons of DIO (shown in grey) or DIO+TAT-DEC2 (shown in pink) mice with or without leptin stimulation. The data represents measurements from n = 14-16 POMC neurons from 6 mice per group. Statistical data analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 11F, is a graph showing depolarization of POMC neurons of DIO (shown in grey) or DIO+TAT-DEC2 (shown in pink) mice. The data represents measurements from n = 14-16 POMC neurons from 6 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ***P < 0.001. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. Figure 11G, is a graph that shows the reaction ratio of POMC neurons of DIO (show in grey) or DIO+TAT-DEC2 (shown in pink) mice. The data represent measurements from n = 14-16 POMC neurons from 6 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ****P < 0.0001. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice. The results support the hypothesis that TAT-DEC2 improves leptin sensitivity and reduces body weight in DIO mice.Figure 12A, includes a schematic (left panel) and representative images (scale bar = 100 μm) (right panel) of stereotactic injection in DMH. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 12B, is a graph showing the cumulative body weight gain of control or Bhlhe41 OE mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 12C, is a graph showing cumulative food intake of control or Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 12D, shows a schematic (left panel) and representative images (scale bar = 100 μm) (right panel) of stereotactic injection in the VMH. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 12E, is a graph illustrating the cumulative body weight gain of control and Bhlhe41 OE mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 12F, is a graph showing the cumulative food intake of control or Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 12G, includes a schematic (left panel) and representative images (scale bar = 100 μm) (right panel) of stereotactic injection in the PVN. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 12H, is a graph showing the cumulative body weight gain of control and Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 12I, is a graph showing the cumulative food intake of control or Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC.Figure 13A, includes a schematic (left panel) and representative images (scale bar = 100 μm) (right panel) of stereotactic injection in the ARC of female mice. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 13B, is a graph showing the cumulative body weight gain of control and Bhlhe41 OE mice. The data represent a measurement from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC. Figure 13C, is a graph showing the cumulative food intake of control or Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effects of Bhlhe41 over expression in the different areas of the ARC.Figure 14A, is a schematic of the Bhlhe41 OE experiment. Figure 14B, is an image of control (left) or Bhlhe41 OE (right) mice-fed with high-fat diet. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 14C, is a graph showing the cumulative body weight gain of control and Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 14D, is a graph showing the cumulative food intake of control or Bhlhe41 OE mice. The data represent the measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 14E, includes a pair of graphs showing the daily time dependent (left panel) and the total (light, dark, and total phase) (right panel) cumulative food intake of control or Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ***P < 0.001 and ****P < 0.0001. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 14F, is a pair of graphs showing the Daily time dependent (left panel) and total (light, dark, and total phase) (right panel) cumulative food intake bouts of control or Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that **P < 0.01 and ***P < 0.001. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 14G, include a pair of graphs showing the daily time dependent (left panel) and total (light, dark, and total phase) (right panel) cumulative food intake bout duration of control or Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ***P < 0.001 and ****P < 0.0001. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 14H, include a pair of graphs showing the daily time dependent (left panel) and total cumulative (light, dark, and total phase) (right panel) energy expenditure of control or Bhlhe41 OE mice. The data represent measurements from n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons with results indicating that *P <0.05 and ****P < 0.0001. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet.Figure 15A, is a pair of graphs showing the daily time dependent (left panel) and average (light, dark, and total phase) (right panel) respiratory exchange ratio of control or Bhlhe41 OE mice. The data represent measurements from n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that *P < 0.05 and **P < 0.01 and ***P < 0.001. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 15B, is a graph showing the daily light, dark, and total cumulative movements of control or Bhlhe41 OE mice. The data represent measurements from n = 6 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that ****P < 0.0001. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 15C, are images including representative magnetic resonance imaging (left panels) and HE staining of white adipose tissue (right panels) (scale bar = 50 μm) of control (upper panels) or Bhlhe41 OE (bottom panels) mice. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 15D, is a pair of graphs showing the visceral PDFF (left panel) and subcutaneous PDFF (right panel) of control or Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating that ****P < 0.0001. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet. Figure 15E, is a pair of graphs illustrating the weight (left panel) and area (right panel) of white adipose tissue of control or ARCPOMC Bhlhe41 OE mice. The data represent measurements from n = 8 mice per group and 80-100 adipocytes from 8 mice per group. Statistical analysis is performed using a two-tailed Student’s t test, with results indicating **P < 0.01 and ****P < 0.0001. The results support the hypothesis that Bhlbhe41 over expression in the ARC boosts obesity in mice fed with the high-fat diet.Figure 16A, is a representative genotyping image for Pomc-Cre mice. Figure 16B, is a representative genotyping image for Agrp-Cre mice. Figure 16C, is a representative genotyping image for Aldh1l1-Cre-ERT2 mice. Figure 16D, is a representative genotyping image for Cx3cr1-Cre-ERT2 mice. Figure 16E, is a representative genotyping image for Bhlhe41fl / fl mice. Figure 16F, is a representative genotyping image for Rosa-LSL-tdTomato mice.Figure 17A, shows a schematic of Bhlhe41 OE in the ARC of Agrp-Cre mice. Figure 17B, is a representative image of control (left) or Bhlhe41 OE (right) in the ARC of Agrp-Cre mice. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet. Figure 17C, is a graph showing the cumulative body weight gain of control or Bhlhe41 OE in the ARC of Agrp-Cre mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet. Figure 17D, is a graph showing the cumulative food intake of control or Bhlhe41 OE in the ARC of Agrp-Cre mice. The data represent measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet. Figure 17E, is a schematic of Bhlhe41 OE in the ARC of Cx3cr1-Cre-ERT2 mice. Figure 17F, is a representative image of control (left) or Bhlhe41 OE (right) in the ARC of Cx3cr1-Cre-ERT2 mice. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet. Figure 17G, is a graph that shows cumulative body weight gain of control or Bhlhe41 OE in the ARC of Cx3cr1-Cre-ERT2 mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet. Figure 17H, is a graph showing the cumulative food intake of control or Bhlhe41 OE in the ARC of Cx3cr1-Cre-ERT2 mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet.Figure 18A, shows a schematic of Bhlhe41 OE in the ARC of Cx3cr1-Cre-ERT2 mice. Figure 18B, is a representative image of control (left) or Bhlhe41 OE (right) in the ARC of Aldh1l1-Cre-ERT2 mice. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet. Figure 18C, is a graph that shows the cumulative body weight gain of control or Bhlhe41 OE in the ARC of Aldh1l1-Cre-ERT2 mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet. Figure 18D, is a graph that shows the cumulative food intake of control or Bhlhe41 OE in the ARC of Aldh1l1-Cre-ERT2 mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 over expression in different cell type of the ARC in mice fed with chow diet.Figure 19A, is a schematic of the ARCPOMC Bhlhe41 cKO experiment. Figure 19B, is a graph showing the cumulative body weight gain of control or Bhlhe41 cKO in mice-fed with high-fat diet. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 cKO in DIO mice. Figure 19C, is a graph showing the cumulative food intake of control or Bhlhe41 cKO in mice-fed with high-fat diet. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 cKO in DIO mice. Figure 19D, is a schematic of the ARCPOMC Bhlhe41 cKO (AAV-Cre) experiment. Figure 19E, is a cumulative body weight gain of control or Bhlhe41 cKO (AAV-Cre) in DIO mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 cKO in DIO mice. Figure 19F, is a graph showing the cumulative food intake of control or Bhlhe41 cKO (AAV-Cre) in DIO mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 cKO in DIO mice. Figure 19G, is a schematic of Bhlhe41 knocking down in the ARC experiment. Figure 19H, is a graph that shows the cumulative body weight gain of control (shown as empty circles) or Bhlhe41 knocking down in db / db (shown as filled circles) mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 cKO in DIO mice. Figure 19I, is a graph showing the cumulative food intake of control (shown as empty circles) or Bhlhe41 knocking down in db / db (shown as filled circles) mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of Bhlhe41 cKO in DIO mice.Figure 20A, is a schematic of activating ARCPOMC synaptic function experiment in Bhlhe41 OE mice. Figure 20B, is a graph showing the cumulative body weight gain of control or tettoxic in Bhlhe41 OE mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of activating ARCPOMC synaptic function in Bhlhe41 over expression and DIO mice. Figure 20C is a graph showing the cumulative food intake of control or tettoxic in Bhlhe41 OE mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of activating ARCPOMC synaptic function in Bhlhe41 over expression and DIO mice. Figure 20D is a schematic of activating ARCPOMC synaptic function experiment in mice-fed with high-fat diet. Figure 20E is a graph showing the cumulative body weight gain of control or tettoxic in mice-fed with high-fat diet. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of activating ARCPOMC synaptic function in Bhlhe41 over expression and DIO mice. Figure 20F, is a graph showing cumulative food intake of control or tettoxic in mice-fed with high-fat diet. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of activating ARCPOMC synaptic function in Bhlhe41 over expression and DIO mice. Figure 20G, shows a schematic of activating ARCPOMC synaptic function experiment in DIO mice. Figure 20H, is a graph showing the cumulative body weight gain of control or tettoxic in DIO mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of activating ARCPOMC synaptic function in Bhlhe41 over expression and DIO mice. Figure 20I, is a graph showing the cumulative food intake of control or tettoxic in DIO mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons. The results illustrate the effect of activating ARCPOMC synaptic function in Bhlhe41 over expression and DIO mice.Figure 21A, are representative confocal images of TAT-DEC2-FITC (left panel) and POMC-tdTomato (middle panel) in DIO mice following i.c.v. administration of TAT-DEC2-FITC. The right panel of Figure 21A shows a merged confocal image of TAT-DEC2-FITC and POMC-TdTomato. The scale bars of the upper panel photos are 100 μm and the scale bars of the bottom panel photos are 25 μm. The results show the short-term effects of i.c.v. administration of TAT-DEC2 in DIO mice. Figure 21B, is a schematic of short-term i.c.v. administration of TAT-DEC2 experiment. Figure 21C, is a graph showing the daily body weight change of DIO or DIO+TAT-DEC2 mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that **P < 0.01 and ***P < 0.001. The results show the short-term effects of i.c.v. administration of TAT-DEC2 in DIO mice. Figure 21D, is a graph showing daily food intake of DIO or DIO+TAT-DEC2 mice. The data represents measurements from n = 8 mice per group. Statistical analysis is performed using a two-way ANOVA, with Bonferroni multiple comparisons, with results indicating that **P < 0.01 and ***P < 0.001 and ****P < 0.0001. The results show the short-term effects of i.c.v. administration of TAT-DEC2 in DIO mice.Figure 22 and Figures 23 are uncropped blots of western blot images.Figure 24 is the graphical abstract that illustrates the effects of DEC2 on melanocortin output and leptin sensitivity of diet-induced obesity (DIO) mic, and the effects of TAT-DEC2 treatment in pro-opiomelanocortin (POMC) neurons around the third ventricle in the arcuate nucleus. The diagram divides into two main sections: DIO mice (left side) and the TAT-DEC2 treatment (right side) . The left side shows reduced leptin sensitivity, increased food intake, and decreased energy expenditure. Furthermore, the left side shows DEC2 inhibits STAT3 phosphorylation and translocation to the nucleus, and it shows that POMC expression inactivates. The right side shows the TAT-DEC2 treatment that demonstrates restored leptin sensitivity decreased food intake, and increased energy expenditure. Moreover, the right side shows TAT-DEC2 disrupts the DEC2-STAT3 interaction, allowing STAT3 phosphorylation and nuclear translocation. Additionally, POMC expression activates. The contrasting outcomes between obesity and treatment conditions visually represent through changes in signaling intensity, STAT3 phosphorylation, and POMC expression levels. Figure 24 summarizes the proposed mechanism of TAT-DEC2 in improving leptin sensitivity and metabolic outcomes in obesity.1. Collaborators, G.B.D.R.F. Global burden and strength of evidence for 88 risk factors in 204 countries and 811 subnational locations, 1990-2021: a systematic analysis for the Global Burden of Disease Study 2021. Lancet 403, 2162-2203 (2024) .2. Wharton, S., et al. Obesity in adults: a clinical practice guideline. CMAJ 192, E875-E891 (2020) .3. Collaboration, N.C.D.R.F. Trends in adult body-mass index in 200 countries from 1975 to 2014: a pooled analysis of 1698 population-based measurement studies with 19.2 million participants. Lancet 387, 1377-1396 (2016) .4. Collaboration, N.C.D.R.F. Worldwide trends in underweight and obesity from 1990 to 2022: a pooled analysis of 3663 population-representative studies with 222 million children, adolescents, and adults. Lancet 403, 1027-1050 (2024) .5. Boer, G.A., Hay, D.L. &Tups, A. Obesity pharmacotherapy: incretin action in the central nervous system. Trends Pharmacol Sci 44, 50-63 (2023) .6. Bessesen, D.H. &Van Gaal, L.F. Progress and challenges in anti-obesity pharmacotherapy. The lancet. Diabetes &endocrinology 6, 237-248 (2018) .7. Jais, A. &Brüning, J.C. Arcuate Nucleus-Dependent Regulation of Metabolism-Pathways to Obesity and Diabetes Mellitus. Endocrine reviews 43, 314-328 (2022) .8. Heymsfield, S.B., et al. Recombinant leptin for weight loss in obese and lean adults: a randomized, controlled, dose-escalation trial. Jama 282, 1568-1575 (1999) .9. Westerterp-Plantenga, M.S., Saris, W.H., Hukshorn, C.J. &Campfield, L.A. Effects of weekly administration of pegylated recombinant human OB protein on appetite profile and energy metabolism in obese men. The American journal of clinical nutrition 74, 426-434 (2001) .10. Chan, J.L., et al. Differential regulation of metabolic, neuroendocrine, and immune function by leptin in humans. Proceedings of the National Academy of Sciences of the United States of America 103, 8481-8486 (2006) .11. Lee, J., et al. Withaferin A is a leptin sensitizer with strong antidiabetic properties in mice. Nature medicine 22, 1023-1032 (2016) .12. Cowley, M.A., et al. Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature 411, 480-484 (2001) .13. Yaswen, L., Diehl, N., Brennan, M.B. &Hochgeschwender, U. Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nature medicine 5, 1066-1070 (1999) .14. Lotta, L.A., et al. Human Gain-of-Function MC4R Variants Show Signaling Bias and Protect against Obesity. Cell 177, 597-607. e599 (2019) .15. Speliotes, E.K., et al. Association analyses of 249, 796 individuals reveal 18 new loci associated with body mass index. Nature genetics 42, 937-948 (2010) .16. Bochukova, E.G., et al. Large, rare chromosomal deletions associated with severe early-onset obesity. Nature 463, 666-670 (2010) .17. Kato, Y., Kawamoto, T., Fujimoto, K. &Noshiro, M. DEC1 / STRA13 / SHARP2 and DEC2 / SHARP1 coordinate physiological processes, including circadian rhythms in response to environmental stimuli. Current topics in developmental biology 110, 339-372 (2014) .18. Honma, S., et al. Dec1 and Dec2 are regulators of the mammalian molecular clock. Nature 419, 841-844 (2002) .19. He, Y., et al. The transcriptional repressor DEC2 regulates sleep length in mammals. Science (New York, N.Y. ) 325, 866-870 (2009) .20. Hirano, A., et al. DEC2 modulates orexin expression and regulates sleep. Proceedings of the National Academy of Sciences of the United States of America 115, 3434-3439 (2018) .21. -Drabiniok, A., et al. BHLHE40 / 41 regulate microglia and peripheral macrophage responses associated with Alzheimer's disease and other disorders of lipid-rich tissues. Nature communications 15, 2058 (2024) .22. Henry, F.E., Sugino, K., Tozer, A., Branco, T. &Sternson, S.M. Cell type-specific transcriptomics of hypothalamic energy-sensing neuron responses to weight-loss. eLife 4 (2015) .23. Brüning, J.C. &Fenselau, H. Integrative neurocircuits that control metabolism and food intake. Science (New York, N.Y. ) 381, eabl7398 (2023) .24. A.C. &Brüning, J.C. Selective insulin and leptin resistance in metabolic disorders. Cell metabolism 16, 144-152 (2012) .25. Amitani, M., Asakawa, A., Amitani, H. &Inui, A. The role of leptin in the control of insulin-glucose axis. Frontiers in neuroscience 7, 51 (2013) .26. Wang, G., et al. Deep-learning-enabled protein-protein interaction analysis for prediction of SARS-CoV-2 infectivity and variant evolution. Nature medicine 29, 2007-2018 (2023) .27. Lean, M.E.J., et al. Durability of a primary care-led weight-management intervention for remission of type 2 diabetes: 2-year results of the DiRECT open-label, cluster-randomised trial. The lancet. Diabetes &endocrinology 7, 344-355 (2019) .28. Rosenkilde, M.M. Advances in incretin-based therapeutics for obesity. Nature reviews. Endocrinology 20, 67-68 (2024) .29. Aroda, V.R., et al. Efficacy and safety of once-daily oral semaglutide 25 mg and 50 mg compared with 14 mg in adults with type 2 diabetes (PIONEER PLUS) : a multicentre, randomised, phase 3b trial. Lancet 402, 693-704 (2023) .30. Frias, J.P., et al. Efficacy and safety of LY3298176, a novel dual GIP and GLP-1 receptor agonist, in patients with type 2 diabetes: a randomised, placebo-controlled and active comparator-controlled phase 2 trial. Lancet 392, 2180-2193 (2018) .31. Ji, L., et al. IBI362 (LY3305677) , a weekly-dose GLP-1 and glucagon receptor dual agonist, in Chinese adults with overweight or obesity: A randomised, placebo-controlled, multiple ascending dose phase 1b study. EClinicalMedicine 39, 101088 (2021) .32. Rosenstock, J., et al. Retatrutide, a GIP, GLP-1 and glucagon receptor agonist, for people with type 2 diabetes: a randomised, double-blind, placebo and active-controlled, parallel-group, phase 2 trial conducted in the USA. Lancet 402, 529-544 (2023) .33. Aronne, L.J., et al. Continued Treatment With Tirzepatide for Maintenance of Weight Reduction in Adults With Obesity: The SURMOUNT-4 Randomized Clinical Trial. JAMA 331, 38-48 (2024) .34. Zhao, L., et al. Tirzepatide for Weight Reduction in Chinese Adults With Obesity: The SURMOUNT-CN Randomized Clinical Trial. Jama (2024) .35. Locatelli, J.C., et al. Incretin-Based Weight Loss Pharmacotherapy: Can Resistance Exercise Optimize Changes in Body Composition? Diabetes Care (2024) .36. Sodhi, M., Rezaeianzadeh, R., Kezouh, A. &Etminan, M. Risk of Gastrointestinal Adverse Events Associated With Glucagon-Like Peptide-1 Receptor Agonists for Weight Loss. Jama 330, 1795-1797 (2023) .37. Bajaj, H.S., et al. Erectile function in men with type 2 diabetes treated with dulaglutide: an exploratory analysis of the REWIND placebo-controlled randomised trial. The lancet. Diabetes &endocrinology 9, 484-490 (2021) .38. Wang, W., et al. Association of semaglutide with risk of suicidal ideation in a real-world cohort. Nature medicine 30, 168-176 (2024) .39. Butler, P.C., Elashoff, M., Elashoff, R. &Gale, E.A.A critical analysis of the clinical use of incretin-based therapies: Are the GLP-1 therapies safe? Diabetes Care 36, 2118-2125 (2013) .40. Prillaman, M. Obesity drugs aren't always forever. What happens when you quit? Nature 628, 488-490 (2024) .41. Wilding, J.P.H., et al. Once-Weekly Semaglutide in Adults with Overweight or Obesity. The New England journal of medicine 384, 989-1002 (2021) .42. Rubino, D.M., et al. Effect of Weekly Subcutaneous Semaglutide vs Daily Liraglutide on Body Weight in Adults With Overweight or Obesity Without Diabetes: The STEP 8 Randomized Clinical Trial. Jama 327, 138-150 (2022) .43. Wadden, T.A., et al. Effect of Subcutaneous Semaglutide vs Placebo as an Adjunct to Intensive Behavioral Therapy on Body Weight in Adults With Overweight or Obesity: The STEP 3 Randomized Clinical Trial. Jama 325, 1403-1413 (2021) .44. Davies, M., et al. Semaglutide 2·4 mg once a week in adults with overweight or obesity, and type 2 diabetes (STEP 2) : a randomised, double-blind, double-dummy, placebo-controlled, phase 3 trial. Lancet (London, England) 397, 971-984 (2021) .45. Petersen, J., et al. GLP-1-directed NMDA receptor antagonism for obesity treatment. Nature 629, 1133-1141 (2024) .46. Rauschmeier, R., et al. Bhlhe40 and Bhlhe41 transcription factors regulate alveolar macrophage self-renewal and identity. The EMBO journal 38, e101233 (2019) .47. Chen, H., et al. METTL3 Inhibits Antitumor Immunity by Targeting m (6) A-BHLHE41-CXCL1 / CXCR2 Axis to Promote Colorectal Cancer. Gastroenterology 163, 891-907 (2022) .48. Nassar, A.H., et al. Epigenomic charting and functional annotation of risk loci in renal cell carcinoma. Nature communications 14, 346 (2023) .49. Numata, A., et al. The basic helix-loop-helix transcription factor SHARP1 is an oncogenic driver in MLL-AF6 acute myelogenous leukemia. Nature communications 9, 1622 (2018) .50. Majumdar, S. &Siahaan, T.J. Peptide-mediated targeted drug delivery. Medicinal research reviews 32, 637-658 (2012) .51. Liu, L., McBride, K.M. &Reich, N.C. STAT3 nuclear import is independent of tyrosine phosphorylation and mediated by importin-alpha3. Proceedings of the National Academy of Sciences of the United States of America 102, 8150-8155 (2005) .52. Brooks, H., Lebleu, B. &Vivès, E. Tat peptide-mediated cellular delivery: back to basics. Advanced drug delivery reviews 57, 559-577 (2005) .53. Fang, Z., et al. An MD2-perturbing peptide has therapeutic effects in rodent and rhesus monkey models of stroke. Science translational medicine 13 (2021) .54. Feng, D., et al. Astrocytic NDRG2-PPM1A interaction exacerbates blood-brain barrier disruption after subarachnoid hemorrhage. Science advances 8, eabq2423 (2022) .55. Fan, X., Jin, W.Y., Lu, J., Wang, J. &Wang, Y.T. Rapid and reversible knockdown of endogenous proteins by peptide-directed lysosomal degradation. Nature neuroscience 17, 471-480 (2014) .56. Mori, H., et al. Critical role for hypothalamic mTOR activity in energy balance. Cell metabolism 9, 362-374 (2009) .57. Hill, J.W., et al. Direct insulin and leptin action on pro-opiomelanocortin neurons is required for normal glucose homeostasis and fertility. Cell metabolism 11, 286-297 (2010) .58. Jiang, L., et al. Leptin receptor-expressing neuron Sh2b1 supports sympathetic nervous system and protects against obesity and metabolic disease. Nature communications 11, 1517 (2020) .59. Balthasar, N., et al. Leptin receptor signaling in POMC neurons is required for normal body weight homeostasis. Neuron 42, 983-991 (2004) .60. Padilla, S.L., Carmody, J.S. &Zeltser, L.M. Pomc-expressing progenitors give rise to antagonistic neuronal populations in hypothalamic feeding circuits. Nature medicine 16, 403-405 (2010) .61. Yang, Y., et al. Steroid receptor coactivator-1 modulates the function of Pomc neurons and energy homeostasis. Nature communications 10, 1718 (2019) .62. Torchilin, V.P. Fluorescence microscopy to follow the targeting of liposomes and micelles to cells and their intracellular fate. Advanced drug delivery reviews 57, 95-109 (2005) .63. Liu, H., et al. Hypothalamic Grb10 enhances leptin signalling and promotes weight loss. Nature metabolism 5, 147-164 (2023) .64. Madisen, L., et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nature neuroscience 13, 133-140 (2010) .65. Huang, Y., et al. Dual extra-retinal origins of microglia in the model of retinal microglia repopulation. Cell discovery 4, 9 (2018) .66. Tanaka, T., et al. PDLIM2 inhibits T helper 17 cell development and granulomatous inflammation through degradation of STAT3. Science signaling 4, ra85 (2011) .67. Katchalski-Katzir, E., et al. Molecular surface recognition: determination of geometric fit between proteins and their ligands by correlation techniques. Proceedings of the National Academy of Sciences of the United States of America 89, 2195-2199 (1992) .68. Vakser, I.A. Long-distance potentials: an approach to the multiple-minima problem in ligand-receptor interaction. Protein engineering 9, 37-41 (1996) .69. Hegazy, M., et al. Proximity Ligation Assay for Detecting Protein-Protein Interactions and Protein Modifications in Cells and Tissues in Situ. Current protocols in cell biology 89, e115 (2020) .Although the invention has been described with reference to the presently preferred embodiments, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.

Claims

1.An isolated polypeptide comprising an amino acid sequence with at least 80%identity to QHLQDVRKRVQDLEQK (SEQ ID NO: 1) .2.The polypeptide of claim 1, comprising the amino acid sequence of QHLQDVRKRVQDLEQK (SEQ ID NO: 1) .3.The polypeptide of claim 1, wherein the polypeptide is a fusion polypeptide.4.The polypeptide of any one of claims 1-3, further comprising a TAT peptide.5.The polypeptide of claim 4, wherein the TAT peptide comprises the sequence of YGRKKRRQRRR (SEQ ID NO: 2) .6.The polypeptide of any one of claims 1-5, further comprising a chaperone-mediated autophagy (CMA) targeted motif comprising the sequence of KFERQKILDQRFFE (SEQ ID NO: 3) .7.The polypeptide of any one of claims 1-6, wherein the polypeptide binds to or interact with DEC2 protein.8.The polypeptide of any one of claims 1-7, wherein the polypeptide promotes DEC2 protein degradation.9.A pharmaceutical composition comprising the fusion polypeptide of any one of claims 1-8.10.A method of promoting DEC2 degradation in a cell or a population thereof, comprising contacting or incubating the cell or the population thereof with the polypeptide of any one of claims 1-8 or the pharmaceutical composition of claim 9,wherein the polypeptide promotes DEC2 degradation.11.The method of claim 10, wherein the cell is a neuron.12.The method of claim 11, wherein the neuron is an arcuate nucleus pro-opiomelanocortin (ARCPOMC) -expressing neuron.13.A method of reducing pro-opiomelanocortin (POMC) expression in a subject, comprising administering to a subject in need thereof, the polypeptide of any one of claims 1-8 or the pharmaceutical composition of claim 9,wherein the polypeptide reduces POMC expression.14.A method of treating obesity in a subject, comprising administering to a subject in need thereof, the polypeptide of any one of claims 1-8 or the pharmaceutical composition of claim 9,thereby reducing obesity in the subject.15.A method of promoting weight loss in a subject, comprising administering to a subject in need thereof, the polypeptide of any one of claims 1-8 or the pharmaceutical composition of claim 9,thereby promoting weight loss in the subject.16.A method of restoring leptin sensitivity in a subject, comprising administering to a subject in need thereof, the polypeptide of any one of claims 1-8 or the pharmaceutical composition of claim 9,thereby promoting leptin sensitivity in the subject.17.A method of reducing insulin resistance in a subject, comprising administering to a subject in need thereof, the polypeptide of any one of claims 1-8 or the pharmaceutical composition of claim 9,thereby reducing insulin resistance in the subject.18.A method of reducing pro-opiomelanocortin (POMC) expression in a subject, comprising administering to a subject in need thereof, a DEC2 targeting agent,wherein the DEC2 targeting agent reduces POMC expression by reducing DEC2 levels and / or DEC2 activity.19.A method of treating obesity in a subject, comprising administering to a subject in need thereof, a DEC2 targeting agent, wherein the DEC2 targeting agent reduces DEC2 levels and / or DEC2 activity,thereby reducing obesity in the subject.20.A method of promoting weight loss in a subject, comprising administering to a subject in need thereof, a DEC2 targeting agent, wherein the DEC2 targeting agent reduces DEC2 levels and / or DEC2 activity,thereby promoting weight loss in the subject.21.A method of restoring leptin sensitivity in a subject, comprising administering to a subject in need thereof, a DEC2 targeting agent, wherein the DEC2 targeting agent reduces DEC2 levels and / or DEC2 activity,thereby promoting leptin sensitivity in the subject.22.A method of reducing insulin resistance in a subject, comprising administering to a subject in need thereof, a DEC2 targeting agent, wherein the DEC2 targeting agent reduces DEC2 levels and / or DEC2 activity,thereby reducing insulin resistance in the subject.23.The method of any one of claims 18-22, wherein the DEC2 targeting agent is a polynucleotide targeting DEC2 mRNA.24.The method of claim 23, wherein the polynucleotide targeting DEC2 is a guide RNA, a tRNA, a suppressor tRNA, a siRNA, a miRNA, an mRNA, a shRNA, a circular RNA, or an antisense oligonucleotide (ASO) , a ribozyme, a DNAzyme, an aptamer, or any combination thereof.25.The method of any one of claims 18-22, wherein the DEC2 targeting agent is a polypeptide comprising a region or a portion of STAT3, wherein the STAT3 peptide reduces DEC2 levels and / or activity.26.The method of claim 25, wherein DEC2 targeting agent comprises an amino acid sequence with at least 80%identity to QHLQDVRKRVQDLEQK (SEQ ID NO: 1) .27.The method of claim 26, wherein the DEC2 targeting agent comprises the amino acid sequence of QHLQDVRKRVQDLEQK (SEQ ID NO: 1) .28.The method of any one of claims 26-27, wherein the DEC2 targeting agent is a fusion polypeptide.29.The method of claim 28, wherein the fusion polypeptide comprises a TAT peptide.30.The method of claim 29, wherein the TAT peptide comprises the sequence of YGRKKRRQRRR (SEQ ID NO: 2) .31.The method of any one of claims 28-30, wherein the fusion polypeptide further comprises a chaperone-mediated autophagy (CMA) targeted motif comprising the sequence of KFERQKILDQRFFE (SEQ ID NO: 3) .32.The method of any one of claims 18-22, wherein the DEC2 targeting agent is a small molecule inhibitor of DEC2.

Images