Conjugate formulation of oncolytic virus and proteolysis targeting chimera prodrug, preparation method therefor, and use thereof

Abstract

Disclosed in the present invention are a conjugate formulation of an oncolytic virus and a proteolysis targeting chimera prodrug, a preparation method therefor, and use thereof. The conjugate formulation provided in the present invention is obtained by linking a proteolysis targeting chimera (PROTAC) prodrug to the surface of an oncolytic virus, wherein the efficient and highly specific infection of tumor cells by the oncolytic virus can enhance the cellular uptake and targeted delivery of the prodrug to the tumor, thereby enhancing the targeted therapeutic effect; moreover, after the prodrug is linked to the surface of the oncolytic virus, the infection performance of the oncolytic virus can be significantly improved; after infection, the prodrug is released from the surface of the oncolytic virus, and is converted from the prodrug into PROTAC to degrade the target protein, and the two can synergistically exert an anti-tumor effect.

Description

A conjugate formulation of an oncolytic virus and a protein degradation-targeting chimeric prodrug, its preparation method and application. Technical Field

[0001] This invention belongs to the field of nanomedicine technology, specifically relating to a conjugate formulation of oncolytic virus (OVs) and a protein degradation targeting chimera (PROTAC) prodrug, its preparation method, and its application. In particular, it relates to a conjugate formulation of oncolytic adenovirus (AD) and a PROTAC prodrug that targets the degradation of bromodomain and extra terminal domain 4 (BRD4), its preparation method, and its application. Background Technology

[0002] Globally, cancer incidence and mortality rates continue to rise rapidly. In current clinical practice, early-stage tumors are treated surgically, while late-stage tumors are treated with radiotherapy, chemotherapy, and immunotherapy. However, all treatments, including intensity-modulated radiotherapy (IMRT), small-molecule chemotherapy drugs, and immune-related checkpoint inhibitors, suffer from significant side effects, low specificity, and multidrug resistance. OV (October Vaccine) immunotherapy is a novel approach to cancer treatment that selectively destroys tumor tissue without excessively harming normal, non-cancerous cells. Several OV drugs have already been approved for marketing. In 2003, a p53-gene-modified adenovirus (Gendicine, China) was the first OV product approved for marketing. Talimogene laherparepvec (T-VEC) is a transgenic herpes simplex virus type 1 (HSV-1) that replicates in tumor cells and expresses the immune-activating protein granulocyte-macrophage colony-stimulating factor (GM-CSF). In 2015, the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) approved T-VEC for the treatment of advanced melanoma. Additionally, RIGVIR (an oncolytic virus-based anticancer drug derived from a non-pathogenic ECHO-7 enterovirus, first approved in Latvia in 2004 for melanoma treatment) is also marketed in Latvia, Georgia, and Armenia. All these oncolytic viruses (OVs) are administered intratumorally and are targeted at patients with refractory malignancies resistant to second- or third-line treatments. In recent years, given the good safety profile of OVs in clinical practice, numerous clinical trials have been conducted. From 2000 to 2020, 97 clinical trials using OVs have been performed, but results indicate that OVs are not significantly effective against solid tumors.

[0003] The antitumor activity of oral vesicles (OVs) is typically mediated by two mechanisms: first, OVs induce tumor cell lysis; second, after lysing tumor cells, OVs release specific tumor-associated antigens, promoting T cell recognition of tumor antigens and thus establishing tumor-specific T cell immunity. Most OVs that have entered clinical trials or are currently undergoing clinical trials have been genetically modified to locally release co-stimulatory molecules, chemokines, cytokines, and immune checkpoint inhibitors to enhance their therapeutic effects. OVs have the potential to induce immunogenic cell death, leading to the release of tumor antigens, risk-related molecular patterns, and type I interferon. These immunogenic substances, especially tumor antigens, can activate a systemic tumor-specific immune response, resulting in the regression of distant or uninfected tumors. However, the activated immune response is often limited and insufficient to effectively attack the tumor, possibly due to low activation levels of antigen-presenting cells, failing to effectively and sustainably activate an adaptive immune response. Therefore, improving the efficacy of OVs is an urgent clinical need.

[0004] PROTACs are a new class of small molecule drugs that have the ability to selectively degrade disease-associated proteins (such as tumors) through endogenous cellular pathways, showing potential in the treatment of various cancers. For example, CN119661657A discloses a PROTAC drug targeting BRCA2 that could provide a new treatment strategy for prostate cancer; CN119504710A discloses a series of PROTAC-degrading compounds targeting PRMT5, which can effectively induce PRMT5 degradation and significantly inhibit tumor cell proliferation, growth, migration, invasion, colony formation and metastasis, promote cancer cell apoptosis, promote tumor cell autophagy, prevent or overcome BTK inhibitor resistance, and / or prolong the survival of cancer patients; CN115894439A discloses a PROTAC chimera targeting GPX4 degradation, which can bind to GPX4 protein and induce effective degradation, effectively downregulating GPX4 protein levels and causing ferroptosis; CN119119002A discloses a PROTAC compound targeting ALK protein degradation, which can effectively solve the problem that existing small molecule inhibitors cannot degrade ALK protein, and this compound can inhibit the proliferation of ALK-resistant mutant cell lines. However, the clinical translation of PROTACs into effective cancer treatments still faces some challenges. A major challenge in PROTAC development lies in insufficient target cell uptake and its potential off-target effects. Achieving good therapeutic efficacy largely depends on the efficient delivery of these molecules to target cells while minimizing off-target effects on healthy tissues. Another key consideration is the impact of PROTACs on anti-tumor immune responses. Recent evidence suggests that PROTAC-induced protein degradation may affect the presentation of tumor-associated antigens and impair the generation of effective immune responses against tumors, raising concerns about the potential immunosuppressive effects of PROTACs.

[0005] Therefore, there is an urgent need in this field for more effective cancer treatment strategies. Summary of the Invention

[0006] To address the limitations of PROTAC drugs themselves and the often limited immune responses activated by oncolytic viruses (OVs), which are insufficient to effectively attack tumors, this invention provides a conjugate formulation of oncolytic viruses (especially oncolytic adenoviruses) and PROTAC prodrugs, along with its preparation method and applications. This invention can link PROTAC prodrugs to the surface groups of oncolytic viruses without affecting or even enhancing their infectivity, thereby achieving a synergistic effect between oncolytic viruses and PROTACs and significantly enhancing their anti-tumor activity. This invention effectively solves three major challenges encountered in the clinical translation of PROTACs: limited cellular uptake efficiency, off-target effects, and insufficient immune responses. It paves the way for the design of biomolecule-conjugated PROTACs and provides a new method for combining oncolytic viruses and PROTACs. Furthermore, this invention features good biocompatibility, strong stability, high safety, and high bioavailability.

[0007] This invention is mainly achieved through the following technical solutions.

[0008] In a first aspect, the present invention provides a conjugation formulation comprising an oncolytic virus and a protein degradation-targeting chimeric prodrug attached to the surface of the oncolytic virus.

[0009] In some embodiments, the protein degradation targeting chimeric prodrug is a prodrug of a protein degradation targeting chimeric that targets the degradation of BRD4 (a protein that plays a key role in epigenetic regulation and is involved in tumorigenesis, metastasis, and drug resistance, such as hematologic malignancies (e.g., acute myeloid leukemia, multiple myeloma, etc.) and solid tumors (e.g., melanoma, breast cancer, liver cancer, neuroblastoma, etc.)), which is attached to the surface of the oncolytic virus.

[0010] In some embodiments, the prodrug of the protein degradation targeting chimera that targets BRD4 has the structure shown in formula (I):

[0011] In formula (I):

[0012] R 1 -R 7 Each is independently selected from -H, C l-5 alkyl;

[0013] R 8 Selected from F, Cl, Br and I;

[0014] L is selected from -(CH2CH2O) mCH2-, -CH2CH2OCH2CH2CH2OCH2- and -CH2(CH2OCH2) m CH2-, where m = integers from 1 to 10;

[0015] n = integers from 1 to 10.

[0016] In some embodiments, the prodrug of the protein degradation targeting chimera that targets BRD4 has the structure shown in formulas (I-1), (I-2), (I-3), or (I-4):

[0017] In some embodiments, the oncolytic virus is an oncolytic adenovirus Ad5.

[0018] In some embodiments, the coupling agent has a particle size of 106-108 nm, a dispersion index (PDI) of 0.11-0.13, and a potential of -25 mV to -29 mV.

[0019] Secondly, the present invention provides a method for preparing a coupling agent, comprising the following steps:

[0020] 1) Mix the oncolytic virus with a solution of the protein degradation targeting chimeric prodrug to obtain a first mixture;

[0021] 2) The first mixture was subjected to ultrasonic treatment in an ice bath to obtain a second mixture;

[0022] 3) Remove excess prodrug from the second mixture to obtain the coupling formulation.

[0023] In some implementations, in step 1), according to 0.8 × 10 -9 nmol / VP or higher, preferably 1.0 × 10⁻⁶ -9 The protein degradation-targeting chimeric prodrug is mixed with the oncolytic virus at a ratio of nmol / VP or higher, for example, at 0.8-1.33 × 10⁻⁶. -9 The nmol / VP ratio is used to mix the protein degradation-targeting chimeric prodrug with the oncolytic virus.

[0024] In some implementations, the temperature of the ice bath in step 2) can be 2-5°C.

[0025] In some embodiments, in step 2), the power of the ultrasound may be 200-300W.

[0026] In some embodiments, the duration of the ultrasonic treatment in step 2) may be 20-40 minutes.

[0027] In some embodiments, in step 3), excess prodrug in the second mixture can be removed by a HiTrap desalting column.

[0028] Thirdly, the present invention provides a composition comprising the conjugate formulation provided in the first aspect of the present invention and an immune checkpoint inhibitor, wherein, optionally, the immune checkpoint inhibitor is αPD-1.

[0029] Fourthly, the present invention provides the use of the conjugation formulation provided in the first aspect of the present invention or the composition provided in the third aspect of the present invention in the preparation of a medicament for targeted antitumor treatment. The tumor may be a BRD4 protein-related tumor, such as hematologic malignancies (e.g., acute myeloid leukemia, multiple myeloma, etc.) and solid tumors (e.g., melanoma, breast cancer, liver cancer, neuroblastoma, etc.).

[0030] Fifthly, the present invention provides the use of the coupling agent provided in the first aspect of the present invention or the composition provided in the third aspect of the present invention in the preparation of a medicament for activating the cGAS-STING pathway of tumor cells in vitro and / or in vivo.

[0031] In a sixth aspect, the present invention provides the use of the coupling agent provided in the first aspect of the present invention or the composition provided in the third aspect of the present invention in the preparation of a medicament for enhancing dendritic cell maturation.

[0032] In a seventh aspect, the present invention provides the use of the coupling agent provided in the first aspect of the present invention or the composition provided in the third aspect of the present invention in the preparation of a medicament that activates antitumor immunity in vivo.

[0033] Compared to existing technologies, this invention offers the following advantages: While oral viral viruses (OVs) represent novel immunotherapies, their mediated in situ killing and anti-tumor immunity typically fail to produce durable effects against solid tumors. In preclinical and clinical trials, two methods are generally employed to enhance the anti-tumor efficacy of OVs. First, non-essential viral genes are deleted to enhance viral replication within tumor cells and reduce viral pathogenicity. Second, OVs are equipped with co-stimulatory molecules, chemokines, cytokines, and immune checkpoint inhibitors to release the immunosuppressive microenvironment surrounding the tumor. This invention provides a conjugate formulation of OVs and a PROTAC prodrug, which conjugates a PROTAC prodrug (pmMZ1) targeting and degrading BRD4 to the surface of an oncolytic adenovirus (Ad5). The conjugation of pmMZ1 does not affect, and may even significantly enhance, the infectivity of the oncolytic adenovirus itself. The highly efficient and specific infection of tumor cells by Ad5 enhances tumor cellular uptake and targeted delivery of PROTAC, thereby enhancing the targeted therapeutic effect. Following infection, the prodrug pmMZ1 is released from the Ad5 surface and converted to mMZ1 to degrade BRD4 protein. Furthermore, the selective replication of Ad5 in tumor cells synergistically with BRD4 degradation significantly promotes the secretion of type I interferon, thereby promoting dendritic cell maturation and enhancing the anti-tumor immune response. Moreover, the conjugate provided by this invention can also be used in combination with the immune checkpoint inhibitor αPD-1 for tumor treatment, further enhancing its anti-tumor effect. Attached Figure Description

[0034] Figure 1: a shows the in vitro release curve of pmMZ1 converted to mMZ1 in Example 1; b shows the in vitro release detection results of pmMZ1 converted to mMZ1 in Example 1.

[0035] Figure 2 shows the Western blot results of the degradation effect of mMZ1 on BRD4 in Example 2.

[0036] Figure 3: a shows the transmission electron microscopy and particle size characterization results of Ad5 in Example 1, with scale bars of 100 nm (low magnification) and 50 nm (high magnification); b shows the transmission electron microscopy and particle size characterization results of BPAD in Example 1, with scale bars of 100 nm (low magnification) and 50 nm (high magnification).

[0037] Figure 4: a shows the average particle size results of Ad5 and BPAD in Example 1; b shows the zeta potential detection results of Ad5 and BPAD in Example 1.

[0038] Figure 5: a shows the Western blot results of the degradation effect of BPAD prepared with different pmMZ1 / Ad5 ratios on BRD4 in Example 4; b shows the killing effect of BPAD prepared with different pmMZ1 / Ad5 ratios on B16F10-mCAR cells in Example 4.

[0039] Figure 6 shows the average amount of prodrug on virus particles in conjugate formulations prepared with different pCy5.5 / Ad5 ratios in Example 5.

[0040] Figure 7: a shows the Western blot results of the degradation effect of different concentrations of drugs on BRD4 in the BPAD group and PROTACs group in Example 6; b shows the statistical results of the degradation effect of different concentrations of drugs on BRD4 in the BPAD group and PROTACs group in Example 6.

[0041] Figure 8: a shows the Western blot results of the degradation effect of different formulations on BRD4 under in vitro conditions in Example 7; b shows the Western blot results of the degradation effect of different formulations on BRD4 under in vivo conditions in Example 8.

[0042] Figure 9: a shows representative flow cytometry analysis results of BRD4 expression in B16F10-mCAR cells after in vitro treatment with different agents in Example 7; b shows the BRD4 expression in B16F10-mCAR cells after in vitro treatment with different agents in Example 7. - The proportion of (BRD4 negative) cells; c represents the representative flow cytometry analysis results of B16F10-mCAR cells after in vivo treatment with different agents in Example 8; d represents the BRD4 expression of B16F10-mCAR cells after in vivo treatment with different agents in Example 8. - The proportion of cells.

[0043] Figure 10: Results of the detection of the effect of Ad5 and pmMZ1 on the infectivity of the virus.

[0044] Figure 11: a shows the proportion of B16F10-mCAR and B16F10-GFP cells after treatment with different agents in Example 10; b shows the representative flow cytometry analysis results of the proportion of B16F10-mCAR and B16F10-GFP cells after treatment with different agents in Example 10.

[0045] Figure 12: ab shows the proportion of BRD4-negative cells and BRD4 expression in B16F10-GFP cells after in vitro treatment with different formulations in Example 10, as detected by flow cytometry; cd shows the proportion of BRD4-negative cells and BRD4 expression in B16F10-mCAR cells after in vitro treatment with different formulations in Example 10, as detected by flow cytometry; ef shows the expression of CD45 in B16F10-mCAR cells after in vivo treatment with different formulations in Example 11. + The proportion of BRD4-positive cells and the expression of BRD4 in the cells.

[0046] Figure 13 shows the GO enrichment analysis of relevant gene pathways in B16F10-mCAR cells treated with BPAD and PBS in Example 12.

[0047] Figure 14: a shows the mRNA expression level of IFN-α in B16F10-mCAR after treatment with different formulations in vitro in Example 12; b shows the mRNA expression level of IFN-β in B16F10-mCAR after treatment with different formulations in vitro in Example 12.

[0048] Figure 15: a shows the expression of cGAS-STING signaling pathway-related proteins in B16F10-mCAR cells after in vitro treatment with different formulations in Example 12; b shows the expression of cGAS-STING signaling pathway-related proteins in B16F10-mCAR tumor tissue after in vivo treatment with different formulations in Example 12.

[0049] Figure 16: ab represents the amount of IFN-α and IFN-β secreted in vitro after B16F10-mCAR was treated with different formulations in Example 12; cd represents the amount of IFN-α and IFN-β secreted in tumor tissue after in vivo treatment with different formulations in Example 13.

[0050] Figure 17: a is a schematic diagram of evaluating the effect of BPAD on DC activation in the co-culture model of B16F10-mCAR and DCs in Example 14; b is the flow cytometry analysis of the proportion of mature DCs in different in vitro treatment groups and its quantitative results in Example 14.

[0051] Figure 18: a) Flow cytometry analysis of the level and quantitative results of mature DCs in tumor tissues of tumor-bearing mice treated with different formulations in vivo, as shown in Example 15; b) Flow cytometry analysis of the level and quantitative results of mature DCs in lymph nodes of tumor-bearing mice treated with different formulations in vivo, as shown in Example 15; c) Flow cytometry analysis of the level and quantitative results of type I macrophages in tumor tissues of tumor-bearing mice treated with different formulations in vivo, as shown in Example 15; d) Flow cytometry analysis of cytotoxic CD8+ in tumor tissues of tumor-bearing mice treated with different formulations in vivo, as shown in Example 15.+ T cell levels and their quantitative results.

[0052] Figure 19: a) Photographs of ex vivo tumors from mice receiving intratumoral injection of different formulations at the endpoint of the efficacy experiment of mice bearing B16F10-mCAR subcutaneous tumors in Example 16 (scale bar: 2cm); b) Tumor growth curves after receiving intratumoral injection of different formulations in Example 16. Figure 20: a) Photographs of ex vivo tumors from mice receiving intratumoral injection of different formulations at the endpoint of the efficacy experiment of mice bearing B16F10-mCAR subcutaneous tumors combined with H151 in Example 16 (scale bar: 2cm); b) Tumor growth curves after receiving intratumoral injection of different formulations in Example 16.

[0053] Figure 21: a shows an ex vivo photograph of mouse tumors treated with intratumoral injection of different formulations at the endpoint of the efficacy experiment of mice with subcutaneous tumors carrying B16F10-mCAR, B16F10-cGAS-KO and B16F10-STING-KO in Example 16, scale bar: 2cm; b shows the tumor growth curves after intratumoral injection of different formulations in Example 16.

[0054] Figure 22: a shows an ex vivo tumor photograph of mice with B16F10-mCAR subcutaneous tumors treated with different formulations at the endpoint of the efficacy experiment of combined αPD-1 with mice in Example 16. Scale bar: 2cm; b shows the tumor growth curves after treatment with different formulations in Example 16.

[0055] Figure 23: a) Photographs of ex vivo tumors from mice treated with tail vein injection of different formulations at the endpoint of the efficacy experiment of mice carrying B16F10-mCAR subcutaneous tumors in Example 16, scale bar: 2cm; b) Tumor growth curves after tail vein injection of different formulations in Example 16. Detailed Implementation

[0056] This invention aims to provide a conjugate of oncolytic virus and PROTAC prodrug to overcome the shortcomings of PROTAC drugs themselves and the often limited immune response activated by oncolytic viruses (OVs), which is insufficient to effectively attack tumors. Specifically, this invention utilizes abundant groups (e.g., amino groups) on the surface of oncolytic viruses to attach PROTAC prodrugs to their surface to obtain the conjugate.

[0057] In this invention, the PROTAC prodrug that can be linked to the surface of an oncolytic virus can be selected as a prodrug of a protein degradation-targeting chimera that targets the degradation of BRD4, and its structure can be as shown in the following formula (I):

[0058] In formula (I):

[0059] R1 -R 7 Each is independently selected from -H and C. l-5 Alkyl groups, for example, may be selected from: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, and neopentyl;

[0060] R 8 Selected from F, Cl, Br and I;

[0061] L is selected from -(CH2CH2O) m CH2-, -CH2CH2OCH2CH2CH2OCH2- and -CH2(CH2OCH2) m CH2-, where m = an integer from 1 to 10, for example, m = an integer from 1 to 6, an integer from 1 to 5, an integer from 1 to 4, an integer from 1 to 3, or an integer from 1 to 2, specifically 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;

[0062] n = 1-10 integers, for example, n = 1-6 integers, 1-5 integers, 1-4 integers, 1-3 integers or 1-2 integers, specifically 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0063] In a preferred embodiment, the structure of the prodrug of the protein degradation targeting chimera that targets BRD4 degradation can be as shown in formulas (I-1), (I-2), (I-3), or (I-4):

[0064] In equations (I-1) to (I-4), n is an integer from 1 to 10, for example, an integer from 1 to 6, an integer from 1 to 5, an integer from 1 to 4, an integer from 1 to 3, or an integer from 1 to 2, specifically 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0065] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.

[0066] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).

[0067] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials used in this invention. In fact, the sources of biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted and used according to the suggestions in the embodiments.

[0068] In the following examples, the oncolytic adenovirus Ad5 used was provided by Zhengzhou University. The PROTAC prodrug is a prodrug of a protein degradation-targeting chimeric compound (mMZ1) that targets and degrades BRD4, named pmMZ1. The NHS group (succinimide carbonate) on pmMZ1 can react with the abundant amino groups on the surface of Ad5, allowing pmMZ1 to be attached to the surface of Ad5. The pmMZ1 used in the following examples (whose molecular structure is shown in formula (I-1) above, where n=3) was provided by Shandong University.

[0069] In the following examples, the melanoma cell line B16F10-mCAR, which expresses the mouse Coxsackievirus receptor (mCAR, a key receptor for adenovirus infection) and was constructed based on the wild-type melanoma cell line (B16F10, which expresses the BRD4 protein), was donated by Zhengzhou University. Based on the B16F10-mCAR cell line, two melanoma cell lines were constructed using the pLentiCRISPRv2 vector (purchased from Addgene, #196625): B16F10-mCAR-cGAS KO, ​​which knocks out the cGAS protein and expresses the murine coxsackievirus receptor (mCAR), and B16F10-mCAR-STING KO, which knocks out the STING protein and expresses the murine coxsackievirus receptor (mCAR). The cGAS sgRNA was GGCUGGAUGCAGGUUGGAGUA (SEQ ID NO:1); the STING sgRNA was AGGACCAGAACACCUUGUAG (SEQ ID NO:2). Based on the wild-type B16F10 cell line, the green fluorescent protein (GFP) gene was transfected using lentivirus (purchased from Addgene), constructing the B16F10-GFP melanoma cell line expressing GFP.

[0070] In the following examples, pCy5.5 (Cy5.5-PEG-NHS) was purchased from Ruixi Biotechnology.

[0071] In the following examples, the CCK8 reagent was purchased from Yisheng Biotechnology.

[0072] In the following examples, male C57BL / 6 mice were purchased from Vital River (Beijing).

[0073] In the following examples, the HiTrap desalination columns used were purchased from Cytiva (Sweden).

[0074] The primers used in this example were purchased from Sangon Biotech, and their sequences are as follows:

[0075] Mouse genome gActin-F: GTGACGTTGACATCCGTAAAGA (SEQ ID NO:3);

[0076] Mouse genome gActin-R: GCCGGACTCATCGTACTCC (SEQ ID NO:4);

[0077] AD5-E1A-F: TGATCGATCCACCCAGTGAC (SEQ ID NO: 5);

[0078] AD5-E1A-R: ATGACAAGACCTGCAACCGT (SEQ ID NO: 6);

[0079] mGAPDH-F:CATCACTGCCACCCAGAAGACTG (SEQ ID NO:7);

[0080] mGAPDH-R:ATGCCAGTGAGCTTCCCGTTCAG (SEQ ID NO: 8);

[0081] IFNα1-F: GGATGTGACCTTCCTCAGACTC (SEQ ID NO: 9);

[0082] IFNα1-R: ACTTCTCCTGCGGGAATCCAA (SEQ ID NO: 10);

[0083] IFNβ1-F: AGCTCCAAGAAAGGACGAACA (SEQ ID NO: 11);

[0084] IFNβ1-R: GCCCTGTAGGTGAGGTTGAT (SEQ ID NO: 12).

[0085] In the following examples, the combination therapy drug is the immune checkpoint inhibitor αPD-1, which was purchased from BioXcell, Inc., USA.

[0086] Example 1

[0087] The purpose of this embodiment is to verify the conversion of pmMZ1 to mMZ1 (i.e., drug release).

[0088] (1) pmMZ1 (50μM) was treated with 10mM DTT (MeOH:H2O=1:1, v / v) at 37℃ for 0, 20, 40, 60, 80 and 100 minutes to convert pmMZ1 into mMZ1 (i.e. release mMZ1 from pmMZ1).

[0089] (2) The concentration of released mMZ1 in the solution in (1) was detected by HPLC (mobile phase: B: CH3CN, A: H2O, containing 0.1% TFA; flow rate: 0.6 mL / min; column temperature: 30℃; UV: 254 nm; elution gradient: 0-20 min, from 10% B to 100% B). As shown in Figure 1 (where mMZ1-SH is the intermediate product during the conversion of pmMZ1 to mMZ1), almost all of the mMZ1 was released within 2 hours (i.e., all of the pmMZ1 was converted to mMZ1).

[0090] Example 2

[0091] The purpose of this embodiment is to verify the ability of mMZ1 to degrade BRD4 protein in vitro.

[0092] (1) Take B16F10-mCAR cells in the logarithmic growth phase from the incubator and add RPMI-1640 complete medium (Gibco, hereinafter also referred to as 1640 complete medium) to adjust the cell suspension concentration to about 3×10⁻⁶. 6 Cells / ml: 100 μl of cell suspension was spread evenly in each well of a 6-well cell culture plate. At this point, the cell density in each well of the plate was approximately 3 × 10⁻⁶ cells / ml. 5 Cells / well, add RPMI-1640 complete culture medium to 2 mL, for a total of 40 experimental wells.

[0093] (2) Add DMSO to mMZ1 powder (gifted by Shandong University) to prepare a stock solution at a concentration of 1mM. Take 10μL of the stock solution and add it to 990μL of PBS as a stock solution (10μM). After sterilization by filtering through a 0.22μm filter membrane, store it in a -80 degree refrigerator for later use.

[0094] (3) Culture the cells for 14-16 hours, when the cells are completely attached to the plate but have not yet proliferated, and then remove the culture plate.

[0095] (4) For cells in a 6-well plate, the 40 experimental wells were divided into 4 time gradients. After adding mMZ1, the cells were cultured for 2, 4, 8 and 16 hours respectively. Five concentration gradients were set for each gradient time: 0, 10, 20, 50 and 100 nM. Two replicates were set.

[0096] (5) Collect the forward RIPA lysis buffer (Merck, Germany) and add protease inhibitor, phosphatase inhibitor and PMSF (Wuhan, Bosch) at a ratio of 100:1 to prepare the cell lysis buffer.

[0097] (6) After administering the drug and culturing the cells for a specific time as in step (4), discard the culture medium, wash the cells three times with PBS, add 100 μL of the cell lysis buffer prepared in step (5) to each well, collect the cells with a cell scraper and place them in a 1.5 mL EP tube, lyse them on ice for 30 minutes, and then centrifuge at 10000g for 30 minutes to collect the supernatant into a new 1.5 mL EP tube.

[0098] (7) The concentration of the protein collected in (6) was determined by BCA protein assay kit (Wuhan, Bosch).

[0099] (8) Mix the protein sample from (7) with 5×SDS sample buffer (Wuhan, Bosideng) and PBS, set the final protein concentration at 1 mg / mL, and denature at 95°C for 10 minutes.

[0100] (9) The protein sample from (8) was then separated using a 7.5% SDS-PAGE gel. The gel was then transferred to a PVDF membrane (Merck, Germany) and blocked at room temperature with TBS buffer containing 5% BSA for 2 hours.

[0101] (10) Subsequently, the PVDF membrane was cut and incubated overnight at 4°C with primary antibodies against BRD4 (Boster Biological, A00123-3) and GAPDH (Boster Biological, A00227-1), respectively. The membrane was then washed three times with TBST and incubated for 1 hour at room temperature with HRP-conjugated secondary antibody. After washing three times with TBST, the signal was detected using a Clarity Western ECL (US Everbrigh, USA), and the blot was scanned using a Tanon imaging system. The results are shown in Figure 2, demonstrating that mMZ1 significantly degrades BRD4 protein in tumor cells.

[0102] The results of Examples 1 and 2 above show that the PROTAC prodrug pmMZ1 can be completely converted into mMZ1, that is, mMZ1 can be completely released from pmMZ1, and confirms that mMZ1 can indeed significantly degrade the BRD4 protein of tumor cells.

[0103] Example 3

[0104] In this embodiment, a conjugate formulation of oncolytic virus (Ad5) and PROTAC prodrug (pmMZ1) was constructed and named BPAD using the following method, and its particle size and potential were detected. The specific operation method is as follows:

[0105] (1) Add 400 μL of Ad5 (5 × 10⁻⁶) 11 Mix 10 μL of pmMZ1 solution (20 μmol / mL) with VP / mL, sonicate (200 W) in an ice bath (4 degrees Celsius) for 30 min, and then use a HiTrap desalting column to remove excess pmMZ1. The filtered liquid is the BPAD preparation and should be stored at 4 degrees Celsius for later use.

[0106] (2) The BPAD formulation is obtained by reacting pmMZ1 with the abundant amino groups on the surface of Ad5 through the NHS group on pmMZ1, thereby attaching pmMZ1 to the surface of Ad5. The results were obtained using transmission electron microscopy (FEI, Tecnai G2 20S-TWIN, 200kV) and laser particle size analyzer (Malvern, Zetasizer Nano). The Pro study characterized Ad5 and the BPAD-coupled formulation, and the results are shown in Figures 3 and 4. Figure 3a shows the transmission electron microscopy (TEM) image of bare Ad5, with an average particle size of approximately 103.42 nm (as shown in Figure 4a, approximately in the range of 101 nm to 104 nm), a dispersion index (PDI) of approximately 0.08, and a potential of approximately -23 mV (as shown in Figure 4b, approximately in the range of -22 mV to -24 mV). Figure 3b shows the prepared BPAD-coupled formulation, which is spherical with less defined edges than Ad5, and has a more uniform particle size, with an average particle size of approximately 107.12 nm (as shown in Figure 4a, approximately in the range of 106 nm to 108 nm), a dispersion index (PDI) of approximately 0.12, and a potential of approximately -27 mV (as shown in Figure 4b, approximately in the range of -25 mV to -29 mV). Compared with bare Ad5, the particle size increased by approximately 4 nm.

[0107] Example 4

[0108] The purpose of this embodiment is to explore the optimal ratio when Ad5 and pmMZ1 are coupled.

[0109] (1) 300, 400, 500, and 600 μL of Ad5 (5×10⁻⁶) were added respectively. 11 Mix 10 μL of pmMZ1 solution (20 μmol / mL) with VP / mL, add PBS to 1 mL, sonicate at 4°C on ice for 30 min, then remove excess pmMZ1 using a HiTrap desalting column. The filtered liquid is the BPAD formulation, with corresponding pmMZ1:Ad5 ratios of 0.67, 0.80, 1.00, and 1.33 (1×10⁻⁶). -9 (nmol / VP), store at 4 degrees Celsius for later use.

[0110] (2) Take B16F10-mCAR cells in the logarithmic growth phase from the incubator and add RPMI-1640 complete medium to adjust the cell suspension concentration to 3×10⁻⁶. 6Cells / ml: 100 μl of cell suspension was evenly distributed into each well of a 6-well cell culture plate, resulting in a cell density of 3 × 10⁶ cells / ml in each well. 5 Cells / well, add RPMI-1640 complete culture medium to 2 mL, set up 10 experimental wells in total.

[0111] (3) Take B16F10-mCAR cells in the logarithmic growth phase from the incubator and add RPMI-1640 complete medium to adjust the cell suspension concentration to 3×10⁻⁶. 4 Cells / ml: 100 μl of cell suspension was spread evenly in each well of a 96-well cell culture plate. Only the middle 30 wells (5 columns × 6 rows) of each 96-well plate were spread. At this time, the cell density in each well of the plate to be tested was 3000 cells / well. A total of 5 96-well plates were spread.

[0112] (4) Culture the cells for 14-16 hours, when the cells are fully attached to the plate but have not yet proliferated, and then remove the culture plate.

[0113] (5) For the cells in the 6-well plate, the 10 experimental wells were divided into 5 groups: PBS, 0.67, 0.80, 1.00, 1.33 (1×10⁻⁶) -9 (nmol / VP), two replicates per group. Except for the PBS group, all other groups were added with 500 VP / cell (calculated as Ad5) of a conjugated preparation synthesized at different ratios. After culturing the cells for 4 h, all five groups were replaced with fresh culture medium and cultured for another 4 h. Subsequently, cell proteins were extracted and analyzed by Western blotting according to the method in Example 3. The results are shown in Figure 5a. It can be seen that at a ratio of 0.8-1.33×10 -9 At nmol / VP, intracellular BRD4 is almost completely degraded.

[0114] (6) For the cells in the 96-well plates, the two 96-well plates were divided into 5 groups: Ad5, 0.67, 0.80, 1.00, 1.33 (1×10⁻⁶) -9 The cells were divided into groups (nmmol / VP), with the Ad5 group receiving adenovirus Ad5 alone, and the other groups receiving conjugates in different ratios. The outermost ring of wells in each 96-well plate was left untreated. The remaining wells were divided into two groups of five, each with five concentration gradients: 0, 1000, 2000, 4000, and 8000 VP / cell. Conjugates (based on Ad5) were added to each well. After 48 hours of culture, cell viability was assessed using the CCK8 reagent (Yisheng Biotechnology, 40203ES). The results are shown in Figure 5b, where the ratio of prodrug to virus particles was 1.00 (1×10⁻⁶). -9 At a concentration of 1.0 × 10⁻⁶ nmol / VP, BRD4 degradation reaches saturation and cytotoxicity is maximized; further increases do not provide additional functional benefits. Therefore, subsequent examples will use 1.0 × 10⁻⁶ nmol / VP.-9 The coupling agent BPAD was synthesized using a ratio of nmol / VP.

[0115] Example 5

[0116] The purpose of this embodiment is to detect the average number of small molecules coupled to each Ad5 virus particle in the coupling formulation under different synthesis ratios.

[0117] (1) Since the maximum absorption peak of pmMZ1 at 260 nm closely overlaps with the maximum absorption peak of Ad5, we used pCy5.5 (Cy5.5-PEG-NHS) as a substitute for pmMZ1 for the synthesis of the coupling formulation. 300, 400, 500, and 600 μL of Ad5 (5 × 10⁻⁶) were added respectively. 11 Mix 10 μL of pCy5.5 solution (20 μmol / mL) with VP / mL, add PBS to 1 mL, sonicate at 4°C on ice for 30 min, then remove excess pCy5.5 using a HiTrap desalting column. The filtered liquid is the conjugated formulation sample, with pCy5.5:Ad5 ratios of 0.67, 0.80, 1.00, and 1.33 (1×10⁻⁶). -9 (nmol / VP), store at 4 degrees Celsius for later use.

[0118] (2) Take 500 μL of sample solution and measure the absorbance at 640 nm using a UV spectrophotometer (Agilent Cary 60, USA). Simultaneously, prepare pCy5.5 solutions with concentrations of 1, 2, 10, 20, and 40 nmol / mL using PBS as known concentrations of standards, and measure the absorbance at 640 nm using the same UV spectrophotometer to obtain a standard curve relating pCy5.5 concentration to absorbance. Based on this standard curve and the absorbance values ​​measured at 640 nm for each group of samples, the concentration of pCy5.5 in each sample solution can be determined.

[0119] (3) Take 100 μL of each sample group, and then add 100 μL of a solution containing 5 × 10⁻⁶ ppm. 5 The genomic DNA was extracted from the cell suspension of B16F10-mCAR cells according to the instructions of the DNA extraction kit (Novizan, DC112-01); simultaneously, Ad5 (5 × 10⁻⁶ cells with a known particle count) was taken. 11 Dilute 1 μL, 2 μL, 5 μL, 10 μL, and 20 μL of VP / mL solution, add PBS to a final volume of 100 μL, then add 100 μL of solution containing 5 × 10⁻⁶ ppm. 5 Cell suspensions of B16F10-mCAR cells were extracted, and DNA was then extracted from the samples using the same method as a standard for known Ad5 virus particle counts.

[0120] (4) qPCR (quantitative polymerase chain reaction) was performed to detect the relative content of Ad5 genome in the genome of each sample (primers AD5-E1A-F and AD5-E1A-R were used to quantify the adenovirus genome; primers gActin-F and gActin-R were used to quantify the B16F10-mCAR cell genome and serve as an internal reference gene). Based on the known number of Ad5 virus particles in the standard and the Ct value detected by qPCR, a standard curve regarding the number of Ad5 virus particles and the Ct value can be calculated. Based on this standard curve and the Ct value of each group of conjugate samples, the number of Ad5 virus particles in 100 μL of each group of conjugate samples can be obtained, and then the concentration of Ad5 virus particles in conjugate samples synthesized in different proportions can be calculated.

[0121] (5) Based on the concentrations (nmol / mL) of pCy5.5 and Ad5 virus particle concentrations (VP / mL) in the conjugated formulation samples synthesized with different ratios obtained in (2) and (4), the average number of small molecules conjugated on each Ad5 virus particle (nmol / VP) can be obtained by dividing the two. The results are shown in Figure 6. It can be seen that as the synthesis ratio of pCy5.5:Ad5 increases, the average number of prodrugs on the Ad5 virus particles also increases. At 1.00 (1×10 -9 Under the conditions of the pCy5.5:Ad5 synthesis ratio of nmol / VP, the average prodrug quantity on Ad5 virus particles is approximately 4 × 10⁻⁶. -11 nmol / VP, and this quantity represents 1.00 (1×10⁻⁶) / VP. -9 Under the conditions of a pmMZ1:Ad5 synthesis ratio of nmol / VP, the number of pmMZ1 on the Ad5 viral particle is approximately 4 × 10⁻⁶. -11 nmol / VP.

[0122] Example 6

[0123] The purpose of this embodiment is to detect the half-maximal degradation concentration (DC) of BRD4 in B16F10-mCAR cells in vitro using mMZ1 and the conjugate BPAD. 50 ) and maximum degradation level (D max ).

[0124] (1) Take B16F10-mCAR cells in the logarithmic growth phase from the incubator and add 1640 complete culture medium to adjust the cell suspension concentration to 3×10⁻⁶. 6 Cells / ml: 100 μl of cell suspension was evenly distributed into each well of a 6-well cell culture plate, resulting in a cell density of 3 × 10⁶ cells / ml in each well. 5Cells / well, add 1640 complete culture medium to 2 mL. Two groups were set up: BPAD group and PROTACs group (mMZ1 added separately, the same below), with 18 sample wells in each group.

[0125] (2) Culture the cells for 14-16 hours as usual, until the cells are completely attached to the plate but have not yet proliferated, then remove the culture plate.

[0126] (3) Add the corresponding drug to the cells in each well. For the PROTACs group, the concentration gradient was set to 0, 5, 10, 50, 100, 500, 1000, 5000, and 10000 nM. For the BPAD group, the concentration gradient was set to 0, 0.3, 0.6, 3, 6, 12, 18, 24, and 30 nM (calculated in pmMZ1). After culturing the cells for 4 h, both groups were replaced with fresh culture medium and cultured for another 4 h. Cell proteins were extracted from two wells of each concentration gradient using the aforementioned method, and the intracellular BRD4 protein content was detected by Western blotting. The results are shown in Figures 7a and 7b. It can be seen that the DCs in the PROTACs group... 50 The DC of the BPAD group is 128.5 nM. 50 The DC concentration of the conjugate BPAD is 0.2 nM. 50 Significantly lower than free PROTACs.

[0127] Example 7

[0128] The purpose of this embodiment is to verify in vitro that the conjugate BPAD can carry more small molecule drugs into cells, thereby achieving more efficient degradation of intracellular BRD4 protein.

[0129] (1) Take B16F10-mCAR cells in the logarithmic growth phase from the incubator and add 1640 complete culture medium to adjust the cell suspension concentration to 3×10⁻⁶. 6 Cells / ml: 100 μl of cell suspension was evenly distributed into each well of a 6-well cell culture plate, resulting in a cell density of 3 × 10⁶ cells / ml in each well. 5 Cells / well, add 1640 complete culture medium to 2 mL, a total of 5 groups were set up, namely PBS, Ad5, PROTACs, Ad5@BP (Ad5 and mMZ1 mixed addition), BPAD, 7 wells in each group, for a total of 35 experimental wells.

[0130] (2) Culture the cells for 14-16 hours as usual, until the cells are completely attached to the plate but have not yet proliferated, then remove the culture plate.

[0131] (3) Add the corresponding drug to the cells in each group of test wells. Add 500Vp / cell of Ad5 and BPAD (calculated as Ad5), and the final concentration of PROTACs is 50nM. Add Ad5@BP according to the amount of Ad5 and PROTACs respectively. After culturing the cells for 4 hours, all 5 groups were replaced with fresh culture medium and cultured for another 4 hours. Extract cell proteins from 2 test wells in each group for Western blot detection as described above. For the remaining test wells, use BRD4 antibody (Boster, A00123-3) for flow cytometry to detect the content of intracellular BRD4 protein. The results are shown in Figure 8a, Figure 9a and b. As can be seen from the Western blot results shown in Figure 8a, the content of BRD4 protein extracted from cells with added BPAD is significantly lower. As can be seen from the flow cytometry results shown in Figure 9a and b, the proportion of BRD4 negative cells in cells with added BPAD is significantly higher. These results prove that the preparation BPAD can carry more mMZ1 small molecules into the cells, thereby degrading intracellular BRD4 protein more efficiently.

[0132] Example 8

[0133] The purpose of this embodiment is to verify in vivo that the conjugate BPAD can carry more small molecule drugs into cells, thereby achieving more efficient degradation of BRD4 protein.

[0134] (1) On day 0, 2×10 6 B16F10-mCAR cells were injected subcutaneously into the right flank of 30 male C57BL / 6 mice (6-8 weeks old) and divided into 5 groups: PBS, Ad5, PROTACs, Ad5@BP, and BPAD, with 5 mice in each group.

[0135] (2) On day 8, the tumor had grown to a size of approximately 100 mm. 3 At the same time, different drugs were injected intratumorally, with Ad5 and BPAD at a concentration of 5 × 10⁻⁶. 9 VP / animal (based on Ad5), PROTACs 5 nmol / animal, Ad5@BP injected according to the amounts of Ad5 and PROTACs respectively. The formula for calculating tumor volume (V) is: V = ab 2 / 2, where a and b are the long axis and short axis of the tumor, respectively.

[0136] (3) Eight hours later, all mice were sacrificed, and tumors were collected for Western blot (WB) and flow cytometry (C / D) analysis. The results are shown in Figure 8b, Figure 9c and d. It can be seen that the two experiments, WB and flow cytometry, demonstrate that the formulation BPAD can carry more PROTAC small molecules into the cells in the tumor model, thereby degrading intracellular BRD4 protein more efficiently.

[0137] Example 9

[0138] The purpose of this embodiment is to detect the effect of Ad5 and pmMZ1 conjugation on the infectivity of the virus.

[0139] (1) Take B16F10-mCAR cells in the logarithmic growth phase from the incubator and add 1640 complete culture medium to adjust the cell suspension concentration to 1×10⁻⁶. 6 Cells / ml: 100 μl of cell suspension was spread evenly in each well of a 12-well cell culture plate, resulting in a cell density of 1 × 10⁻⁶ cells / ml in each well. 5 Cells / well, add 1640 complete culture medium to 1 mL, set up 2 groups: Ad5 group and BPAD group.

[0140] (2) Culture the cells for 14-16 hours, when the cells are completely attached to the plate but have not yet proliferated, and then remove the culture plate.

[0141] (3) Add the corresponding drug to each test well. Add 500 VP / cell (based on Ad5) for both Ad5 and BPAD. Culture cells for 4 hours;

[0142] (4) Discard the culture medium, wash 3 times with PBS, then digest the cells with 100 μL of trypsin for 3 minutes, add 300 μL of 1640 complete culture medium to stop the digestion, and collect all the cells into a 1.5 ml EP tube.

[0143] (5) Extract the genome from the sample according to the instructions of the DNA extraction kit (Novizan, DC112-01);

[0144] (6) Perform qPCR (quantitative polymerase chain reaction) to detect the relative content of Ad5 genome in the genome (among which primers AD5-E1A-F and AD5-E1A-R were used to quantify the adenovirus genome; primers gActin-F and gActin-R were used to quantify the B16F10-mCAR cell genome and used as internal reference genes).

[0145] As shown in Figure 10, the BPAD formulation conjugated with pmMZ1 was more readily taken up by cells compared to Ad5. This result indicates that conjugation of Ad5 with pmMZ1 not only did not affect Ad5's viral infectivity, but actually significantly enhanced it. This allows the BPAD formulation to carry more PROTAC molecules into the cell, thereby more efficiently degrading intracellular BRD4 protein.

[0146] Example 10

[0147] The purpose of this embodiment is to verify the targeted killing effect of the conjugate BPAD on tumor cells in vitro.

[0148] (1) Take equal amounts of B16F10-mCAR cells and B16F10-GFP cells in the logarithmic growth phase from the incubator, and add 1640 complete culture medium to adjust the cell suspension concentration to 3×10⁻⁶. 6 Cells / ml: 100 μl of cell suspension was evenly distributed into each well of a 6-well cell culture plate, resulting in a cell density of 3 × 10⁶ cells / ml in each well. 5 Cells / well, add 1640 complete culture medium to 2 mL, a total of 5 groups were set up, namely PBS, Ad5, PROTACs, Ad5@BP (Ad5 and mMZ1 mixed addition), BPAD, 9 wells in each group, for a total of 45 experimental wells.

[0149] (2) Culture the cells for 14-16 hours, when the cells are completely attached to the plate but have not yet proliferated, and then remove the culture plate.

[0150] (3) To verify the targeted killing ability of BPAD, the corresponding drugs were added to each experimental well. 500 VP / cell of Ad5 and BPAD were added, and the final concentration of PROTACs was 50 nM. Ad5@BP was added according to the amounts of Ad5 and PROTACs, respectively. After culturing the cells for 12 h, the cells were collected for flow cytometry analysis to detect the proportion of the two cell types in each sample. The results are shown in Figures 11a and 11b. It can be seen that the proportion of B16F10-mCAR cells in the BPAD group was significantly reduced, indicating the targeted killing ability of BPAD on cells that highly express Coxsackievirus receptor mCAR.

[0151] (4) To verify the targeted degradation ability of BPAD, the corresponding drug was added to each experimental well. 500 VP / cell of Ad5 and BPAD were added, and the final concentration of PROTACs was 50 nM. Ad5@BP was added according to the amount of Ad5 and PROTACs, respectively. After culturing the cells for 4 h, the medium was replaced with fresh medium without the drug. After 4 h, the cells were collected and the content of intracellular BRD4 protein was detected by flow cytometry using BRD4 antibody (Boster, A00123-3). The results are shown in Figures 12a, b, c, and d. The experiment proved that the formulation BPAD can carry more PROTAC small molecules to target cells that highly express mCAR, thereby reducing the off-target effect of free PROTAC small molecules.

[0152] Example 11

[0153] The purpose of this embodiment is to verify in vivo the targeting ability of the conjugate BPAD to tumor cells that highly express mCAR.

[0154] (1) On day 0, 2×10 6B16F10-mCAR cells were injected subcutaneously into the right flank of 30 male C57BL / 6 mice (6-8 weeks old) and divided into 5 groups: PBS, Ad5, PROTACs, Ad5@BP (Ad5 and mMZ1 mixed addition), and BPAD, with 6 mice in each group.

[0155] (2) On day 8, the tumor had grown to a size of approximately 100 mm. 3 At the same time, different drugs were injected intratumorally, with Ad5 and BPAD at a concentration of 5 × 10⁻⁶. 9 VP / animal, PROTACs 5 nmol / animal, Ad5@BP injected according to the amounts of Ad5 and PROTACs respectively. The formula for calculating tumor volume (V) is: V = ab 2 / 2, where a and b are the long axis and short axis of the tumor, respectively.

[0156] (3) Eight hours later, all mice were sacrificed, and tumors were collected for flow cytometry analysis. The results are shown in Figures 12e and 12f. In the tumor model, the formulation BPAD showed an effect on CD45 in the tumor. + The BPAD formulation had no significant effect on the expression of BRD4 in immune cells, demonstrating in vivo that the conjugation of BPAD avoided the off-target effects of free PROTACs.

[0157] Example 12

[0158] The purpose of this embodiment is to explore the ability of the conjugate BPAD to activate the cGAS-STING pathway in tumor cells in vitro.

[0159] (1) Take B16F10-mCAR cells in the logarithmic growth phase from the incubator and add 1640 complete culture medium to adjust the cell suspension concentration to 3×10⁻⁶. 6 Cells / ml: 100 μl of cell suspension was evenly distributed into each well of a 6-well cell culture plate, resulting in a cell density of 3 × 10⁶ cells / ml in each well. 5 Cells / well, replenished with 1640 complete culture medium to 2 mL, a total of 6 groups were set up: PBS, Ad5, PROTACs, Ad5@BP (Ad5 and mMZ1 mixed addition), BPAD, BPnAD (replication-defective Ad5 coupled with pmMZ1 (using 1.0×10⁻⁶ cells / well). -9 The ratio of nmol / VP was determined, with 9 wells per group, for a total of 54 experimental wells.

[0160] (2) Culture the cells for 14-16 hours, when the cells are completely attached to the plate but have not yet proliferated, and then remove the culture plate.

[0161] (3) Add the corresponding drug to each experimental well. Add 500Vp / cell (based on Ad5) of Ad5, BPAD and BPnAD. The final concentration of PROTACs is 50nM. Add Ad5@BP according to the amount of Ad5 and PROTACs respectively. After culturing the cells for 4 hours, replace with fresh medium without drugs. After culturing for another 36 hours, collect the cells.

[0162] (4) RNA sequencing was performed (Figure 13 shows the GO enrichment analysis of relevant gene pathways). The mRNA expression of IFNα and IFNβ was detected by qPCR (the primer pairs used were: IFNα1-F and IFNα1-R, IFNβ1-F and IFNβ1-R, mGAPDH-F and mGAPDH-R, where the mGAPDH-F and mGAPDH-R primer pairs were used to detect the internal reference gene) (Figure 14a and b). The expression of cGAS, p-STING, p-TBK1, and IFNα was detected by Western blotting (Figure 15a and b). Cell supernatant was collected after 36 hours, and the levels of IFNα and IFNβ secreted by cells were detected by ELISA (Figure 16a and b). These results indicate that the conjugate BPAD significantly activated the cGAS-STING pathway in tumor cells, leading to the secretion of large amounts of type I interferons (e.g., IFN-α and IFN-β).

[0163] Example 13

[0164] The purpose of this embodiment is to explore the ability of the conjugate BPAD to activate the tumor cGAS-STING pathway at the in vivo level.

[0165] (1) On day 0, 2×10 6 B16F10-mCAR cells were injected subcutaneously into the right flank of 30 male C57BL / 6 mice (6-8 weeks old) and divided into 6 groups: PBS, Ad5, PROTACs, Ad5@BP (Ad5 and mMZ1 mixed addition), BPAD, and BPnAD, with 5 mice in each group.

[0166] (2) On days 8 and 10, different drugs were injected intratumorally: Ad5, BPAD, and BPnAD at doses of 5 × 10⁻⁶. 9 VP / animal, PROTACs 5 nmol / animal, Ad5@BP injected according to the amounts of Ad5 and PROTACs respectively.

[0167] (3) All mice were sacrificed on day 11, and tumors were collected for Western blotting to detect the expression of pSTING and IFNα. The levels of IFNα and IFNβ in the tumors were detected by ELISA. The results are shown in Figures 16c and 16d. It can be seen that the conjugate BPAD can activate the tumor cGAS-STING pathway, as evidenced by a significant increase in the levels of IFNα and IFNβ in the tumor.

[0168] Example 14

[0169] The purpose of this study is to explore the effect of BPAD agent-induced tumor cell infection and activation of the cGAS-STING pathway on dendritic cell maturation.

[0170] (1) Take B16F10-mCAR cells in the logarithmic growth phase from the incubator and add 1640 complete culture medium to adjust the cell suspension concentration to 1×10⁻⁶. 6 Cells / ml: 100 μl of cell suspension was spread evenly in the lower layer of a Transwell 24-well cell culture plate, resulting in a cell density of 1 × 10⁻⁶ cells / ml in each well. 5 Cells / well, replenished with 1640 complete culture medium to 0.5 mL, a total of 6 groups were set up, namely PBS, Ad5, PROTACs, Ad5@BP (Ad5 and mMZ1 mixed addition), BPAD, BPnAD (replication-defective Ad5 coupled with pmMZ1), 3 wells in each group, for a total of 18 experimental wells.

[0171] (2) Culture the cells for 14-16 hours, when the cells are completely attached to the plate but have not yet proliferated, and then remove the culture plate.

[0172] (3) Add the corresponding drug to each experimental well. Add 500V / cell (based on Ad5) of Ad5, BPAD and BPnAD, and the final concentration of PROTACs is 50nM. Add Ad5@BP according to the amount of Ad5 and PROTACs respectively. The final concentration of H151 (STING inhibitor) is 1μM. After culturing the cells for 4 hours, replace with fresh medium without drugs.

[0173] (4) Subsequently, bone marrow-derived dendritic cells (BMDCs) were arranged at a density of 1×10⁻⁶. 5 Cells were seeded onto the upper layer of Transwell 24-well plates (Figure 17a) and cultured for 36 h. The upper layer of BMDC cells was then harvested for flow cytometry analysis. Cell maturity was assessed using anti-mouse CD80 antibody (104707, clone number: 16-10A1, dilution: 1:40) and anti-mouse CD86 antibody (105014, clone number: GL-1, dilution: 1:20).

[0174] (5) As shown in Figure 17b, the BPAD group significantly activated dendritic cells, while the activation of dendritic cells was significantly weakened after the addition of H151, indicating that BPAD can enhance the function of dendritic cells by activating the cGAS-STING pathway of tumor cells.

[0175] Example 15

[0176] The purpose of this study is to explore the role of BPAD preparations in activating anti-tumor immunity in vivo.

[0177] (1) On day 0, 2×10 6 B16F10-mCAR cells were injected subcutaneously into the right flank of 30 male C57BL / 6 mice (6-8 weeks old) and divided into 6 groups: PBS, Ad5, PROTACs, Ad5@BP (Ad5 and mMZ1 mixed addition), BPAD, and BPnAD, with 5 mice in each group.

[0178] (2) On days 8 and 10, different drugs were injected intratumorally: Ad5, BPAD, and BPnAD at doses of 5 × 10⁻⁶. 9 VP / animal, PROTACs 5 nmol / animal.

[0179] (3) All mice were sacrificed on day 11, and tumors and tumor draining lymph nodes were collected for flow cytometry analysis.

[0180] (4) As shown in Figures 18a, c, and d (where G1-G6 represent PBS, PROTACs, Ad5, Ad5@BP, BPnAD, and BPAD, respectively), the proportions of DC cells highly expressing CD86, M1 macrophages, and cytotoxic T cells expressing IFN-γ were significantly increased in tumor cells. As shown in Figure 18b (where G1-G6 represent PBS, PROTACs, Ad5, Ad5@BP, BPnAD, and BPAD, respectively), the proportion of DC cells highly expressing CD86 in tumor-draining lymph nodes was also significantly increased.

[0181] Example 16

[0182] The purpose of this embodiment is to verify the antitumor efficacy and mechanism of the conjugate BPAD in tumor-bearing mice.

[0183] (1) On day -5, 2×10 6 One B16F10-mCAR cell, one B16F10-mCAR-cGAS KO cell, or one B16F10-mCAR-STING KO cell was subcutaneously injected into the right flank of male C57BL / 6 mice (6-8 weeks old).

[0184] (2) Different formulations (Ad5, BPAD, and BPnAD at doses of 5 × 10⁻⁶) were injected intratumorally on days 0, 2, 4, and 6. 9VP / 25μl / mouse, mMZ1 dose was 5nmol / 25μl / mouse (meaning each mouse was injected with 25μl of 5nmol mMZ1). For treatment requiring combination with H151 (MCE, HY-112693), H151 750nmol / 100μl / mouse was administered intraperitoneally daily from day 0 to day 6. For treatment in combination with αPD-1 (InVivoMAb, BE0273), 2.5μg / g / 100μl / mouse was administered intravenously on days 3 and 5 (meaning each mouse was injected with 2.5μg of αPD-1 per g of mouse, in a volume of 100μL). For experiments involving tail vein treatment, different formulations (Ad5, BPAD, and BPnAD at doses of 5×10) were injected into the tail vein on days 0, 2, 4, and 6. 9 VP / 100μl / mouse, mMZ1 dose of 5nmol / 100μl / mouse (meaning each mouse was injected with 100μl of 5nmol mMZ1). Tumor volume and body weight were measured every two days. The formula for calculating tumor volume (V) is: V = 1 / 2ab 2 , where a and b are the long axis and short axis of the tumor, respectively. Mice were sacrificed on day 8 to analyze tumor weight and volume.

[0185] Compared with other groups, BPAD significantly inhibited tumor growth (Figure 19a and b), suggesting a potent antitumor effect of BPAD. The antitumor effect of BPAD was suppressed after intraperitoneal injection of H151 inhibited systemic cGAS-STING pathway activation in mice (Figure 20a and b). In the B16F10 tumor model with cGAS or STING knocked out, the antitumor effect of BPAD was also weakened (Figure 21a, b, and c), suggesting that the antitumor effect of BPAD depends on cGAS-STING pathway activation.

[0186] In combination with αPD-1 therapy, tumor growth was further controlled after BPAD was combined with αPD-1 therapy (Figure 22a and b).

[0187] For tail vein injection therapy, BPAD significantly inhibited tumor growth (Figure 23a and b), suggesting that BPAD has a potent anti-tumor effect.

[0188] Industrial application

[0189] This invention provides a conjugate formulation of an oncolytic virus and a protein degradation-targeting chimeric prodrug, its preparation method, and its application. The conjugate formulation is obtained by attaching a protein degradation-targeting chimeric (PROTAC) prodrug to the surface of an oncolytic virus, which can enhance the targeted therapeutic effect and is suitable for industrial application.

Claims

1. A conjugate formulation, wherein the conjugate formulation comprises an oncolytic virus and a protein degradation-targeting chimeric prodrug attached to the surface of the oncolytic virus.

2. The conjugation formulation according to claim 1, wherein the protein degradation targeting chimeric prodrug is a protein degradation targeting chimeric prodrug that targets the degradation of BRD4.

3. The conjugate formulation according to claim 1, wherein the oncolytic virus is an oncolytic adenovirus Ad5.

4. The conjugate formulation of claim 2, wherein the prodrug of a protein degradation targeting chimera that targets degradation of BRD4 has the structure of Formula (I): In formula (I): R 1 -R 7 each independently selected from -H and C l-5 alkyl; R 8 selected from F, CI, Br, and I; L is selected from -(CH2CH20) m CH2-, -CH2CH2OCH2CH2CH2OCH2- and -CH2(CH2OCH2) m CH2-, wherein m = an integer from 1 to 10; n = integers from 1 to 10.

5. The conjugation formulation according to claim 4, wherein the prodrug of the protein degradation targeting chimera that targets BRD4 degradation has the structure shown in formula (I-1), (I-2), (I-3), or (I-4):

6. The coupling formulation according to claim 1, wherein the particle size of the coupling formulation is 106-108 nm, the dispersion index (PDI) is 0.11-0.13, and the potential is -25 mV to -29 mV.

7. The method for preparing the coupling agent according to claim 1, wherein the method comprises the following steps: 1) Mix the oncolytic virus with a solution of the protein degradation targeting chimeric prodrug to obtain a first mixture; 2) The first mixture was subjected to ultrasonic treatment in an ice bath to obtain a second mixture; 3) Remove excess prodrug from the second mixture to obtain the coupling formulation.

8. A composition comprising the conjugate of claim 1 and an immune checkpoint inhibitor.

9. The composition according to claim 8, wherein the immune checkpoint inhibitor is αPD-1.

10. Use of the coupling agent of claim 1 or the composition of claim 8 in the preparation of a medicament for targeted antitumor treatment.

11. The use of the conjugate of claim 1 or the composition of claim 8 in the preparation of a medicament for activating the cGAS-STING pathway in tumor cells in vitro and / or in vivo.

12. The use of the coupling agent of claim 1 or the composition of claim 8 in the preparation of a medicament for enhancing dendritic cell maturation.

13. The use of the conjugate of claim 1 or the composition of claim 8 in the preparation of a medicament that activates antitumor immunity in vivo.

Images