Use of TMEM151a and upregulator thereof in treatment of epilepsy

Abstract

Use of TMEM151A and an upregulator thereof in the treatment of epilepsy. Tmem151a gene is a key regulatory factor for susceptibility to epilepsy. Overexpression of TMEM151A can enhance the resistance to epilepsy and inhibit the progression of epilepsy. Thus, provided is use of TMEM151A or an upregulator thereof for reducing susceptibility to epilepsy and preventing and treating epilepsy, thereby providing new target and idea for the control and treatment of epilepsy. Disclosed are a pharmaceutical composition for treating epilepsy and use of a Tmem151a-knocked out animal in the preparation of an epilepsy animal model.

Description

Application of TMEM151A and its upregulators in the treatment of epilepsy Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application of TMEM151A and its upregulators in the treatment of epilepsy. Background Technology

[0002] Epilepsy is a central nervous system disorder characterized by abnormal diffuse electrical activity in localized or widespread areas of the brain. It typically manifests as recurrent and uncontrollable seizures, causing severe cognitive, social, and psychological impacts on patients. Epilepsy is one of the most prevalent and serious brain disorders worldwide, affecting an estimated 65 million people. The incidence and prevalence of epilepsy are higher in children and the elderly, particularly infants under one year old and people over 50 years of age. Pathophysiologically, epilepsy results from an imbalance of excitatory and inhibitory neural activity in neural circuits, usually stemming from overexcitation or weakened inhibition. Epilepsy can be caused by a variety of brain pathologies, including developmental malformations, brain trauma, tumors, and bacterial and parasitic infections. The cause is unknown in approximately 60% of epilepsy cases.

[0003] To better develop drugs for treating epilepsy, in-depth research into the molecular mechanisms associated with epilepsy is necessary. Transmembrane proteins play crucial roles in cellular function and homeostasis, participating in signal transduction, molecular transport, and intercellular communication. Currently, many transmembrane proteins and their relevance to disease remain under-examined.

[0004] TMEM151A has been identified as a gene associated with paroxysmal motor-induced dyskinesia (PKD). Although it is widely expressed in the central nervous system, its role in neural networks remains unclear.

[0005] Therefore, there is an urgent need in this field to identify new target molecules associated with epilepsy in order to develop novel methods for the prevention and treatment of epilepsy. Summary of the Invention

[0006] The purpose of this invention is to provide a novel target TMEM151A associated with epilepsy, and its application in the prevention and treatment of epilepsy and in the construction of animal models of epilepsy.

[0007] In a first aspect of the invention, there is provided the use of TMEM151A or an upregulator thereof for the preparation of a pharmaceutical composition for the prevention and / or treatment of epilepsy.

[0008] In another preferred embodiment, the TMEM151A or its upregulator acts on excitatory neurons, such as glutamatergic neurons.

[0009] In another preferred embodiment, the TMEM151A or its upregulator selectively acts on excitatory neurons in the forebrain.

[0010] In another preferred embodiment, the upregulator includes: a substance that increases the expression level of the Tmem151a gene or TMEM151A protein, a substance that increases the transcriptional activity of the Tmem151a gene, or a substance that increases the activity of the TMEM151A protein.

[0011] In another preferred embodiment, the upregulator can increase the level or activity of TMEM151A protein by at least 10%, preferably at least 30%, and more preferably at least 50%.

[0012] In another preferred embodiment, the upregulator includes: a small molecule compound, a nucleic acid, a protein, or a combination thereof.

[0013] In another preferred embodiment, the upregulator comprises an expression vector of TMEM151A.

[0014] In another preferred embodiment, the expression vector includes: a viral expression vector and a non-viral expression vector (such as a plasmid).

[0015] In another preferred embodiment, the viral expression vector is selected from the group consisting of adeno-associated virus vectors (AAV), lentiviral vectors, adenovirus vectors, or combinations thereof.

[0016] In another preferred embodiment, the vector is an AAV vector, preferably a PHP.eB serological AAV vector.

[0017] In another preferred embodiment, the expression vector comprises: a promoter, a nucleotide sequence encoding the TMEM151A protein, and optional expression regulatory elements.

[0018] In another preferred embodiment, the promoter is a neuron-specific promoter selected from the group consisting of: hSyn1 promoter, NSE promoter, Thy1 promoter, pCALM1 promoter, MiniLAP2 promoter, Nestin promoter, or combinations thereof.

[0019] In another preferred embodiment, the promoter is an excitatory neuron-specific promoter selected from the group consisting of: CaMKIIa promoter, Emx1 promoter, vGlut1 promoter, vGlut2 promoter, or a combination thereof.

[0020] In another preferred embodiment, the species of the TMEM151A protein is not limited, including, for example, human TMEM151A protein, mouse TMEM151A protein and zebrafish TMEM151A protein.

[0021] In another preferred embodiment, the TMEM151A protein includes wild-type, mutant, and derivative types.

[0022] In another preferred embodiment, the amino acid sequence of the TMEM151A protein is selected from the group consisting of:

[0023] (a1) The amino acid sequence is as shown in SEQ ID NO:2 or 4; and

[0024] (a2) The amino acid sequence has ≥95% sequence identity with the amino acid sequence shown in SEQ ID NO:2 or 4, preferably ≥98%, more preferably ≥99%.

[0025] In another preferred embodiment, the nucleotide sequence encoding the TMEM151A protein is a naturally occurring sequence or a codon-optimized sequence.

[0026] In another preferred embodiment, the nucleotide sequence encoding the TMEM151A protein is the same as the nucleotide sequence encoding the wild-type TMEM151A protein.

[0027] In another preferred embodiment, the nucleotide sequence encoding the TMEM151A protein is selected from the group consisting of:

[0028] (b1) The nucleotide sequence is as shown in SEQ ID NO: 1 or 3; and

[0029] (b2) The nucleotide sequence has ≥95% sequence identity with the nucleotide sequence shown in SEQ ID NO:1 or 3, preferably ≥98%, more preferably ≥99%;

[0030] (b3) A nucleotide sequence complementary to the nucleotide sequence described in (b1) or (b2).

[0031] In another preferred embodiment, the pharmaceutical composition is administered to a subject with the following subtype characteristics: the expression level of TMEM151A protein in excitatory neurons is comparable to or lower than that of normal controls.

[0032] In another preferred embodiment, the ratio H1 / H0 of the TMEM151A protein expression level H1 in the excitatory neurons of the subject to the TMEM151A protein expression level H0 in the excitatory neurons of the normal control is ≤0.9, preferably ≤0.8, and more preferably ≤0.5.

[0033] In another preferred embodiment, the prevention and / or treatment of epilepsy includes: reducing the subject's susceptibility to epilepsy, reducing the level of epileptic seizures, delaying the time of epileptic seizures, and / or reducing the frequency of epileptic seizures.

[0034] In another preferred embodiment, the subjects include mammals, such as humans, non-human primates, rodents (such as mice, rats), etc.

[0035] In a second aspect of the invention, a pharmaceutical composition is provided, the pharmaceutical composition comprising:

[0036] (i) A therapeutically effective amount of TMEM151A or an upregulator thereof;

[0037] (ii) Pharmaceutically acceptable carriers.

[0038] In another preferred embodiment, the pharmaceutical composition includes: injection, tablet, powder, granule, capsule, lyophilized preparation, solution, and syrup.

[0039] In another preferred embodiment, the upregulator is an expression vector of TMEM151A.

[0040] In another preferred embodiment, the vector is an AAV vector, preferably a PHP.eB serological AAV vector.

[0041] In another preferred embodiment, the expression vector comprises: a promoter, a nucleotide sequence encoding the TMEM151A protein, and optional expression regulatory elements.

[0042] In another preferred embodiment, the promoter of the expression vector is a neuron-specific promoter and / or an excitatory neuron-specific promoter.

[0043] In another preferred embodiment, the promoter is a neuron-specific promoter selected from the group consisting of: hSyn1 promoter, NSE promoter, Thy1 promoter, pCALM1 promoter, MiniLAP2 promoter, Nestin promoter, or combinations thereof.

[0044] In another preferred embodiment, the promoter is an excitatory neuron-specific promoter selected from the group consisting of: CaMKIIa promoter, Emx1 promoter, vGlut1 promoter, vGlut2 promoter, or a combination thereof.

[0045] In another preferred embodiment, the dosage form of the pharmaceutical composition is an injection.

[0046] In another preferred embodiment, the pharmaceutically acceptable carrier includes, but is not limited to: solvents, dispersion media, coatings, antibacterial or antifungal agents, isotonic agents and absorption delay agents, buffered saline, physiological saline, phosphate buffer, citrate buffer, acetate buffer, bicarbonate buffer, sucrose solution, salt solution, polysorbate solution, or combinations thereof.

[0047] In another preferred embodiment, the pharmaceutically acceptable carrier is a delivery carrier, including but not limited to liposomes, nanoparticles, etc.

[0048] In another preferred embodiment, the pharmaceutical composition further comprises:

[0049] (iii) Other active substances for treating epilepsy.

[0050] In another preferred embodiment, the other active substances for treating epilepsy include: phenytoin, carbamazepine, lamotrigine, oxcarbazepine, lacosamide, eslicarbazepine, rufinamide, gabapentin, levetiracetam, pregabalin, ethosuximide, phenobarbital, diazepam, tiagabine, topiramate, stiripentol, brivaracetam, zonisamide, perampanel, and valproic acid. Acid, cannabidiol, and retigabine.

[0051] In a third aspect of the invention, a medicine box is provided, the medicine box comprising:

[0052] (a) a first pharmaceutical composition, wherein the first pharmaceutical composition comprises (a1) TMEM151A or an upregulator thereof; and (a2) a pharmaceutically acceptable carrier; and

[0053] (b) A second pharmaceutical composition, wherein the second pharmaceutical composition comprises (b1) another drug for treating epilepsy; and (a2) a pharmaceutically acceptable carrier.

[0054] In another preferred embodiment, the first drug and the second drug are independent of each other.

[0055] In another preferred embodiment, other medications for treating epilepsy include: phenytoin, carbamazepine, lamotrigine, oxcarbazepine, lacosamide, eslicarbazepine, rufinamide, gabapentin, levetiracetam, pregabalin, ethosuximide, phenobarbital, diazepam, tiagabine, topiramate, stiripentol, brivaracetam, zonisamide, perampanel, valproic acid, cannabidiol, and retigabine.

[0056] In a fourth aspect of the present invention, a method for establishing an animal model of epilepsy is provided, the method comprising the steps of:

[0057] (S1) Provide animal cells, inactivate the Tmem151a gene in the cells, and obtain cells with inactivated Tmem151a gene;

[0058] (S2) Using the Tmem151a gene-inactivated cells obtained in step (S1), an animal model of Tmem151a gene inactivation was obtained.

[0059] (S3) Apply a stimulus that can induce epilepsy to the animal model with inactivated Tmem151a gene obtained in step (S2) to obtain an animal model of epilepsy.

[0060] In another preferred embodiment, the cells include fertilized eggs and embryonic stem cells; preferably, they are fertilized eggs.

[0061] In another preferred embodiment, the inactivation of the Tmem151a gene includes gene knockout, gene interruption, or gene insertion.

[0062] In another preferred embodiment, the Tmem151a gene inactivation is either systemic Tmem151a gene inactivation or conditional Tmem151a gene inactivation.

[0063] In another preferred embodiment, the gene inactivation includes knockout of the Tmem151a gene using a CRISPR / Cas9 system.

[0064] In another preferred embodiment, the sgRNA sequence in the CRISPR / Cas9 system is shown in SEQ ID NO:7 and 8: GGAGGTGCCCGCGCTCGTTC (SEQ ID NO:7), AGCCAGGACACCATGCCGGA (SEQ ID NO:8).

[0065] In another preferred embodiment, the animal model is heterozygous or homozygous; preferably, the animal model is homozygous, i.e., Tmem151a. - / - Animal models.

[0066] In another preferred embodiment, the animals include both non-mammals and mammals.

[0067] In another preferred embodiment, the non-mammal includes fish, such as zebrafish.

[0068] In another preferred embodiment, the mammal is a non-human mammal, such as rodents or primates, preferably including mice, rats, rabbits, and monkeys.

[0069] In another preferred embodiment, the non-human mammal is a mouse.

[0070] In another preferred embodiment, the epilepsy-inducing stimulus includes: electrical stimulation, chemical stimulation; the stimulus includes one or more / repeated stimulations.

[0071] In another preferred embodiment, the chemical stimulus comprises pentylenetetrazol (PTZ) treatment.

[0072] In another preferred embodiment, the epilepsy model is a complex partial epilepsy model, including an ignition model.

[0073] In another preferred embodiment, the animal with conditionally inactivated Tmem151a gene is a mouse, and the preparation method includes the step of providing Tmem151a. flox / flox Mice are crossed with tool mice CaMKIIa-iCre or Emx1-Cre to obtain mouse models with specific Tmem151a knockout in excitatory neurons of the forebrain, referred to as CaMKIIa-cKO mice or Emx1-cKO mice.

[0074] In a fifth aspect of the invention, the use of a Tmem151a-deficient animal for preparing an animal model of epilepsy is provided.

[0075] In another preferred embodiment, the Tmem151a-deficient animal is homozygous, i.e., Tmem151a... - / - animal.

[0076] In another preferred embodiment, the Tmem151a - / - Compared with normal animals of the same species, Tmem151a - / - Animals have a higher susceptibility to epilepsy.

[0077] In another preferred embodiment, the susceptibility to epilepsy is manifested as follows:

[0078] Compared to the stimulus intensity that induces epilepsy in normal homologous animals, the stimulation of Tmem151a... - / - The intensity of stimuli that trigger epilepsy in animals is reduced, for example, by 10%, 30%, 50%, 70%, 80%, or 90%.

[0079] Compared to the number of stimuli required for epilepsy to occur in normal animals of the same species, Tmem151a - / - The number of stimuli required to induce epilepsy in animals is reduced, for example, by 10%, 30%, 50%, 70%, 80%, or 90%; and / or

[0080] Under the same stimulus conditions, compared with the rate of epilepsy onset in normal animals of the same species, Tmem151a - / - Animal epilepsy occurs more rapidly;

[0081] Under the same stimulus conditions, compared with the level of epilepsy occurrence in normal animals of the same species, Tmem151a - / - Animal epilepsy occurs at a higher level.

[0082] In a sixth aspect of the invention, a method is provided for screening or identifying potential therapeutic agents for treating or alleviating epilepsy, the method comprising the steps of:

[0083] a. Applying the candidate substance to an epileptic animal model prepared using the method described in the fourth aspect of the present invention; and

[0084] b. Assess the level of epilepsy in the animal model and compare it with the control group;

[0085] In this study, if the level of epilepsy is lower in animal models that have been given the candidate substance compared to the control group, it indicates that the candidate substance is a potential therapeutic agent for epilepsy.

[0086] In another preferred embodiment, the method further includes: c. further conducting activity testing or functional testing on the potential therapeutic agents selected in step b.

[0087] In a seventh aspect of the invention, there is provided the use of a detection reagent for the TMEM151A gene or protein for preparing a kit for: assessing a subject's susceptibility to epilepsy; and / or predicting a subject's risk of developing epilepsy.

[0088] In another preferred embodiment, the detection reagent is used to detect the expression level of TMEM151A protein in the excitatory neurons of the subject.

[0089] In another preferred embodiment, when the test results show that the ratio H1 / H0 of the TMEM151A protein expression level H1 in the excitatory neurons of the subject to the TMEM151A protein expression level H0 in the excitatory neurons of the normal control is ≤0.9, preferably ≤0.8, and more preferably ≤0.5, the subject has a high susceptibility to epilepsy, and / or the subject has a high risk of developing epilepsy.

[0090] In an eighth aspect of the invention, a kit is provided, the kit comprising:

[0091] (Y1) Detection reagent, wherein the detection reagent is a detection reagent for the TMEM151A gene or protein; and

[0092] (Y2)TMEM151A or its upregulator.

[0093] In another preferred embodiment, the detection reagent is used to detect the expression level of the TMEM151A gene or protein in the test subject.

[0094] In another preferred embodiment, the kit further includes a label and / or instructions.

[0095] In another preferred embodiment, the label and / or instructions describe the method of administration of the kit: using the (Y1) detection reagent to detect whether the expression level of the TMEM151A gene or protein in the subject is lower than that in the normal control; if so, administering (Y2) TMEM151A or its upregulator to the subject.

[0096] In a ninth aspect of the invention, a method for preventing and / or treating epilepsy is provided, comprising administering to a subject in need a therapeutically effective amount of a pharmaceutical composition containing TMEM151A or an upregulator thereof, a pharmaceutical composition as described in a second aspect of the invention, or a cassette as described in a third aspect of the invention.

[0097] In another preferred embodiment, the desired subjects include humans and non-human mammals, such as mice.

[0098] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0099] Figure 1 shows that Tmem151a is mainly expressed in glutamatergic neurons and oligodendrocytes. (A) Representative RNAscope in situ hybridization (ISH) image showing the expression of Tmem151a mRNA (red) in mouse sagittal brain sections. Scale bar: 2 mm. (B) Quantitative analysis of the fluorescence intensity of Tmem151a mRNA in different brain regions in (A), n = 2 mice. The fluorescence intensity of each brain region is normalized to the mean intensity of the striatum. (C) Co-labeling. Shows the co-labeling of Tmem151a mRNA with neuronal markers Vglut1 (glutamatergic neuron marker, top), Vglut2 (glutamatergic neuron marker, middle), and Vgat (GABAergic inhibitory neuron marker, bottom) mRNA in mouse brain tissue sections in RNAscope multiplex fluorescence experiments. (D) Top: Co-labeling of Tmem151a and Olig2 mRNA (CC, corpus callosum). Middle image: RNAscope and immunohistochemistry (IHC) double labeling experiment, showing co-labeling of Tmem151a mRNA (RNAscope) and IBA1 (immunohistochemistry, labeling microglia). Bottom image: RNAscope detects Tmem151a mRNA combined with IHC labeling of GFAP (astrocytocyte marker). In (C) and (D), the last column shows magnified views. Scale bar: Tmem151a image: 200 μm. Magnified view: 50 μm. This experiment was independently replicated in two mice to obtain similar results.

[0100] Figure 2 shows the localization of TMEM151A on the plasma membrane of primary cultured neurons to the axon. (A) Schematic diagram of the strategy for detecting TMEM151A on the plasma membrane of cultured neurons. Top: Schematic diagram of TMEM151A structure, where the HA tag is inserted into an extracellular loop between two transmembrane domains (Tmem151a-HA(81)). EGFP is co-expressed via the IRES (Internal Ribosome Entry Site) sequence as a reporter gene for successful transfection. Bottom: Schematic diagram of permeabilized and non-permeabilized immunofluorescence staining conditions. Anti-HA antibody was used to detect HA-tagged TMEM151A protein. (B) Representative immunofluorescence images of cultured neurons transfected with the Tmem151a-HA(81) plasmid. Top: Under permeabilized conditions, the HA tag and EGFP signal are visible throughout the neuron. Bottom: Under non-permeabilized conditions, the HA tag signal is mainly distributed along the axon (white arrow). Scale bar: 50 μm. (C) Immunofluorescence images of DIV3 and DIV5 neurons. DIV3 (day 3 of in vitro culture): TMEM151A-HA is enriched in the growth cone, indicated by white arrows. Scale bar: 20 μm. DIV5 (day 5 of in vitro culture): TMEM151A-HA is mainly distributed in the axon. Scale bar: 50 μm. Right side: Quantitative analysis of HA fluorescence signal in DIV3 neurons. Fluorescence intensity analysis was performed by tracking dendrites, cell bodies, and axons using NeuronJ. (D) Representative immunofluorescence images of DIV14 neurons. Scale bar: 50 μm. (BD) Immunofluorescence staining experiments were repeated in at least two independent batches, and the results were consistent.

[0101] Figure 3 shows Tmem151a - / - Increased susceptibility to epilepsy in mice. (A, B) represent WT and Tmem151a. - / - Epilepsy behavior (A) and Racine score (B) in mice after treatment with a moderate dose of PTZ (40 mg / kg, intraperitoneal injection). WT group: n = 6 mice; Tmem151a - / - Group: n = 5 mice. (C) WT and Tmem151a - / - The percentage of mice exhibiting grade 3 or higher (Racine score ≥3) epileptic behaviors (including myoclonus, clonic, or tonic seizures) at different PTZ doses. WT group: n = 6 mice; Tmem151a - / - Group: n = 5 mice. (D) WT and Tmem151a - / -Representative electrocorticograph (ECoG) recordings of mice before and after PTZ (30 mg / kg) injection. Baseline ECoG signal is shown for each group 500 seconds before PTZ injection. ECoG recordings were performed for 30 minutes after PTZ treatment. A representative 25-second ECoG segment is marked with a red rectangle and magnified below. Scale bar: full waveform 1 mV / 100 s; magnified waveform 1 mV / 2 s. (E) Schematic diagram of electrode implantation sites in the sensory cortex of mice. Bipolar electrodes implanted in the sensory cortex (S1BF), WT, and Tmem151a. - / - Mice received a single electrical stimulation (60 Hz, pulse width 1 ms, stimulation duration 2 s, current 200 μA). (F) represents WT and Tmem151a. - / - Representative behavioral responses of mice after localized cortical stimulation. gr represents the epilepsy score grade. (G) represents WT and Tmem151a. - / - Racine scores of mice after cortical stimulation. n = 5 mice per group. (H) represents WT and Tmem151a. - / - Representative ECoG recordings of mice before and after cortical stimulation. Scale bar: 0.2 mV / 3 s.

[0102] Figure 4 shows Tmem151a - / - Mice exhibited accelerated epileptic progression during hippocampal ignition. (A) is a schematic diagram of the experimental timeline and electrode implantation locations. (B) is a representative ECoG recording (5 minutes) showing brain activity during ignition stimulation. Stimulation induced subsequent discharges, or after-discharges (AD), accompanied by post-ictal inhibition of neuronal activity. The ECoG segment marked by the red rectangle is magnified below. The area below the red line indicates the 2-second stimulation period. Scale bar: Full waveform 0.25mV / 25s; magnified waveform 0.5mV / 2s. (C) shows WT and Tmem151a. - / - Comparison of after-firing (AD) thresholds in mice. WT group: n = 7 mice; Tmem151a - / - Group: n = 8 mice. (D) WT and Tmem151a - / - Ignition process in mice. WT group: n = 7 mice; Tmem151a - / - Group: n = 8 mice. (E) represents WT and Tmem151a mice. - / - The number of stimuli required for mice to reach epilepsy scores of grade 2 (gr-2), 5 (gr-5), and fully lit state was statistically analyzed. WT group: n = 7 mice; Tmem151a - / - Group: n = 8 mice. (F) represents WT and Tmem151a mice. - / -The cumulative afterfiring (AD) duration required for mice to reach a fully ignited state. WT group: n = 4 mice; Tmem151a - / - Group: n = 6 mice.

[0103] Figure 5 shows the excitatory neurons (CaMKIIa) in the forebrain. + Conditional knockout of Tmem151a in neurons accelerates the progression of epilepsy in mice. (A) shows a control mouse (Tmem151a). flox / flox ) and conditional knockout mice of excitatory neurons in the forebrain (CaMKIIa-cKO, CaMKIIa-iCre / Tmem151a) flox / flox Representative RNAscope image of Tmem151a mRNA (red). Scale bar: 1 mm. The region indicated by the yellow dashed rectangle (cerebral cortex and hippocampus) is magnified. In the magnified image, the corpus callosum between the cortex and hippocampus is outlined with a white dashed line. Scale bar: 500 μm. Ctx, cerebral cortex; CC, corpus callosum; CA1, Cornu Ammonis1 region of the hippocampus. (B) Ignition process in control and CaMKIIa-cKO mice. n = 7 mice / group. (C) Afterfiring (AD) threshold in control and CaMKIIa-cKO mice. n = 7 mice / group. (D) Number of stimulations required to reach epilepsy score 2 (gr-2), 5 (gr-5), and complete ignition in control and CaMKIIa-cKO mice. n = 7 mice / group. (E) Control (Tmem151a) flox / flox ) and oligodendrocyte conditional knockout mice (Olig2-cKO, Olig2-Cre / Tmem151a) flox / flox Representative RNAscope image of Tmem151a mRNA (red). Scale bar: 1 mm. The area indicated by the yellow dashed rectangle (corpus callosum, cerebral cortex, hippocampus) is magnified; the corpus callosum is outlined with a white dashed line in the magnified image. CC, corpus callosum. Scale bar: 500 μm. (F) Ignition process in control and Olig2-cKO mice. n = 4 mice / group. (G) Afterfiring (AD) threshold in control and Olig2-cKO mice. n = 4 mice / group. (H) Number of stimulations required for control and Olig2-cKO mice to reach epilepsy score 2 (gr-2), 5 (gr-5), and complete ignition. n = 4 mice / group.

[0104] Figure 6 shows the reduction in seizure severity induced by chemotherapeutic agent (PTZ)-induced epilepsy due to TMEM151A overexpression in forebrain excitatory neurons. (A) Experimental flowchart. TMEM151A overexpression was induced in Emx1-Cre mice using AAV-PHP.eB-CAG-DIO-Tmem151a-HA (TMEM151A-OE); AAV-PHP.eB-CAG-DIO-mCherry served as a control. Two weeks after tail vein injection of the virus, both groups of mice were induced with 55 mg / kg PTZ (intraperitoneal injection). (B) Immunofluorescence images showing TMEM151A-HA (magenta) expression in excitatory neurons of the forebrain in the TMEM151A-OE group. Cerebellum and brainstem regions are marked with white dashed lines. Scale bar: 1 mm. (C) Racine grading scores of mice in the control and TMEM151A-OE groups after 55 mg / kg PTZ (intraperitoneal injection). Control group: n = 5 mice; TMEM151A-OE group: n = 5 mice. (D, E) Typical behavioral responses (D) and electrocorticography (E) of mice in the control group and TMEM151A-OE group after PTZ (55 mg / kg) injection. Control mice exhibited grade 5 seizures with multiple sharp waves and post-inhibition; while TMEM151A-OE mice exhibited grade 3 seizures with a single sharp wave. Scale bar: 1 mV / 2s for the control group and 0.2 mV / 2s for the TMEM151A-OE group.

[0105] Figure 7 shows the inhibition of hippocampal electrical stimulation-induced epilepsy development by TMEM151A overexpression in forebrain excitatory neurons. (A) Experimental flowchart. TMEM151A overexpression was induced in Emx1-Cre mice by injection of AAV-PHP.eB-CAG-DIO-Tmem151a-HA (TMEM151A-OE); AAV-PHP.eB-CAG-DIO-mCherry served as a control. One week after tail vein injection of the virus, bipolar electrodes were implanted in the CA3 region of the hippocampus. After an additional 7-day recovery period, hippocampal ignition experiments were performed on both groups of mice. (B) Afterfire (AD) thresholds in the control and TMEM151A-OE groups. Control group: n = 4 mice; TMEM151A-OE group: n = 5 mice. (C) Ignition process in the control and TMEM151A-OE groups. Control group: n = 4 mice; TMEM151A-OE group: n = 5 mice. Detailed Implementation

[0106] Through extensive and in-depth research, the inventors unexpectedly discovered for the first time that mice lacking the Tmem151a gene exhibited significantly enhanced susceptibility to epilepsy, and that overexpression of TMEM151A could enhance resistance to epilepsy and inhibit epileptic development, indicating that TMEM151A plays a bidirectional regulatory role in the occurrence of epilepsy. Based on this, the inventors provide a method for using TMEM151A or its upregulators to reduce susceptibility to epilepsy, prevent and treat epilepsy, providing a new target and approach for epilepsy control and treatment. Furthermore, the inventors also provide a Tmem151a knockout animal model, which reduces the stimulation conditions required to generate an epilepsy animal model and significantly shortens the modeling time. The Tmem151a knockout epilepsy animal model provided by this invention can be used for screening and testing epilepsy drugs. This invention was completed based on these findings.

[0107] definition

[0108] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0109] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0110] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “composed of”.

[0111] As used in this article, the abbreviation DIV indicates the number of days of culture, especially the number of days of in vitro culture. For example, day 3 of culture and day 5 of culture are DIV 3 and DIV 5, respectively.

[0112] As used herein, the data analysis and processing methods are readily mastered by those skilled in the art. When the number of experimental replicates is greater than 2, the data results in this specification are expressed as mean ± standard error (sem), **P<0.01, ****P<0.0001, and ns indicates no significant difference (P>0.05).

[0113] TMEM superfamily and TMEM151A

[0114] The TMEM (transmembrane protein) superfamily is a class of membrane proteins widely distributed in eukaryotes. Members typically contain multiple transmembrane domains and participate in the functional regulation of the cell membrane or organelle membranes. TMEM proteins are diverse in type and function; most TMEM proteins contain 2–12 transmembrane α-helices, and the transmembrane regions are generally highly conserved. The TMEM superfamily has broad functions, including involvement in ion channels and transporters, membrane stability and organelle function, signal transduction, and disease associations. Currently, the functions of more than 50% of TMEM proteins remain unclear.

[0115] Transmembrane protein 151A (TMEM151A) is a membrane-associated protein belonging to the transmembrane protein 151 family. TMEM151A contains four α-helical domains, with both the N-terminus and C-terminus located on the cytoplasmic side. TMEM151A is highly conserved in mammals (e.g., the amino acid sequence similarity between human and mouse TMEM151A is >90%).

[0116] TMEM151A has been identified as being associated with paroxysmal motor-evoked dyskinesia (PKD), and is the second gene, after PRRT2, to be identified as being associated with PKD. However, aside from its clinical relevance, TMEM151A has not been extensively studied, and its function in the nervous system remains unclear.

[0117] This invention reveals that TMEM151A is primarily expressed in glutamatergic neurons and oligodendrocytes in the mouse brain, and that the TMEM151A protein is mainly distributed on the axons of cultured neurons. Furthermore, this invention identifies a bidirectional role of TMEM151A in regulating epilepsy susceptibility: its deficiency accelerates the onset of epilepsy, while its overexpression inhibits it.

[0118] It should be understood that the term "TMEM151A" also includes various naturally occurring variants of the TMEM151A gene. Representative examples include: nucleotide sequences encoding the same TMEM151A protein as the wild type due to codon degeneracy, and nucleotide sequences of conserved variant polypeptides encoding the wild-type TMEM151A protein. Furthermore, for mammals other than mice, or non-mammals, the term refers to the homologue of the TMEM151A gene in that animal. For example, for humans, the term refers to human TMEM151A; for zebrafish, the term refers to zebrafish TMEM151A.

[0119] The amino acid sequence of the mouse TMEM151A wild-type protein is shown in SEQ ID NO:2; the amino acid sequence of the human TMEM151A wild-type protein is shown in SEQ ID NO:4; the nucleotide sequence encoding the mouse TMEM151A protein is shown in SEQ ID NO:1; and the nucleotide sequence encoding the human TMEM151A protein is shown in SEQ ID NO:3.

[0120] Epilepsy and its animal models

[0121] As used herein, the term "epilepsy" can refer to a brain disorder characterized by recurrent (e.g., ≥2) epileptic seizures. The clinical presentation of epileptic seizures is diverse and may be accompanied by symptoms of consciousness, motor function, sensory sensation, mental state, or autonomic nervous system involvement. Those skilled in the art will recognize that epileptic seizures can be classified into different levels, including but not limited to: tonic-clonic, tonic, clonic, myoclonic, absence, or atonic seizures.

[0122] The term "epilepsy occurrence" refers to the pathological process by which a subject's brain gradually transforms from a normal state to a state capable of producing spontaneous, recurrent epileptic seizures. This involves a series of complex neurobiological changes that ultimately lead to abnormal synchronous discharge of neurons and epileptic seizures.

[0123] Animal models of epilepsy are created in laboratory animals by inducing a pathological state similar to human epileptic seizures through various methods such as chemical, electrical stimulation, genetic, or physical approaches. These models are used to study the pathogenesis of epilepsy, drug screening, and treatment methods. Commonly used models include chemically induced models (such as the γ-aminobutyric acid (GABA) A receptor antagonist pentylenetetrazol, PTZ) and electrically induced models.

[0124] Animal models involving electrical stimulation include the kindling model. As used herein, the terms "kindling model" and "electro-kindling model" are used interchangeably to refer to an animal model of complex partial epilepsy in which repeated after-discharges (ADs) induced by local electrical stimulation lead to a gradual increase in the severity of behavioral epilepsy, ultimately resulting in neural circuit sensitization and long-term epileptic remodeling.

[0125] In this document, "animal model" generally includes "non-human mammalian model," such as rodent and non-human primate models. In a preferred embodiment, the animal model is a rodent model, including mouse models, rat models, etc. In a preferred embodiment, the animal model is a mouse model.

[0126] As is well known to those skilled in the art, the Racine scoring system can be used to assess the severity of epileptic seizures in rodent models. The Racine scoring system classifies the severity of epileptic seizures into six levels: Level 0 is no seizures, characterized by the complete absence of abnormal behavior; Level 1 is facial twitching, with focal facial movements such as blinking and whisker twitching; Level 2 is head nodding, with rhythmic head movements or chewing motions; Level 3 is unilateral forelimb clonus, characterized by the raising and twitching of one forelimb; Level 4 is bilateral forelimb clonus with orthostatic posture, progressing to bilateral forelimb twitching accompanied by a standing posture; Level 5 is generalized tonic-clonic seizures, characterized by generalized convulsions, falls, and loss of consciousness, marking widespread epilepsy; Level 6 is a lethal seizure.

[0127] This invention provides the use of Tmem151a-deficient animals in establishing an animal model of epilepsy. This invention is the first to reveal the use of Tmem151a-deficient animals (e.g., Tmem151a...) in establishing an animal model of epilepsy. - / - Animals exhibiting these traits have a higher susceptibility to epilepsy. As used herein, the term "epilepsy susceptibility" refers to an intrinsic tendency in a subject or test animal to have a lower threshold for epileptiform stimuli, thus making them more susceptible to seizures. For example, epilepsy susceptibility can manifest as:

[0128] Compared to the stimulus intensity that induces epilepsy in normal homologous animals, the stimulation of Tmem151a... - / - The intensity of stimuli that trigger epilepsy in animals is reduced, for example, by 10%, 30%, 50%, 70%, 80%, or 90%.

[0129] Compared to the number of stimuli required for epilepsy to occur in normal animals of the same species, Tmem151a - / - The number of stimuli required to induce epilepsy in animals is reduced, for example, by 10%, 30%, 50%, 70%, 80%, or 90%.

[0130] Under the same stimulus conditions, compared with the rate of epilepsy onset in normal animals of the same species, Tmem151a - / - Animal epilepsy occurs more rapidly; and / or

[0131] Under the same stimulus conditions, compared with the level of epilepsy occurrence in normal animals of the same species, Tmem151a - / - Animal epilepsy occurs at a higher level.

[0132] In this invention, a method for establishing an animal model of epilepsy is also provided, including establishing an epilepsy model in animals with inactivated / deleted Tmem151a gene.

[0133] In a preferred embodiment, the animal model with Tmem151a gene deletion is a systemic Tmem151a gene deletion animal model. The systemic gene deletion animal model can be prepared by the following method: providing cells from a non-human mammal (fertilized eggs or embryonic stem cells, preferably fertilized eggs), inactivating the Tmem151a gene in the cells to obtain Tmem151a gene-inactivated cells; and obtaining an animal model with Tmem151a gene inactivation, preferably a Tmem151a gene deletion animal model, through culturing, hybridization, and other steps. - / - Homozygous animal models. Gene inactivation can be achieved using any method known in the art, such as knockout of the Tmem151a gene using gene editing systems, including the CRISPR / Cas9 system.

[0134] In a preferred embodiment, the Tmem151a gene deletion animal model is a conditional Tmem151a gene deletion animal model, such as a specific Tmem151a knockout animal model in excitatory neurons of the forebrain. Taking mice as an example, the conditional gene deletion mouse model can be prepared by the following method: First, Tmem151a is prepared using CRISPR / Cas9 technology. flox / flox Gene knock-in mice were created by inserting loxP sequences flanking the mouse Tmem151a gene. The upstream loxP was located between the first and second introns of Tmem151a, while the downstream loxP was located approximately 300 bp downstream of the 3'UTR of Tmem151a. The sgRNA sequences used were: 5'-CGGAAGAGGCTGTTAAGTCGGGG-3' (SEQ ID NO:5) and 5'-GGGTCTGTCATAGGCGTCACGGG-3' (SEQ ID NO:6). Tmem151a was obtained. flox / flox After mice, using Tmem151a flox / flox Mice are crossed with tool mice CaMKIIa-iCre or Emx1-Cre to obtain mouse models with specific Tmem151a knockout in excitatory neurons of the forebrain, referred to as CaMKIIa-cKO mice or Emx1-cKO mice.

[0135] The steps for establishing an animal model of epilepsy also include: applying a stimulus capable of inducing epilepsy to the obtained animal model with inactivated Tmem151a gene to obtain an animal model of epilepsy. The stimulus capable of inducing epilepsy includes, but is not limited to, electrical stimulation and chemical stimulation; the stimulus can be a single stimulus or multiple stimuli, such as multiple electrical stimulations in the ignition model.

[0136] Pharmaceutical Composition

[0137] In this invention, we provide the use of TMEM151A or an upregulator thereof for the preparation of a pharmaceutical composition for the prevention and / or treatment of epilepsy.

[0138] As used herein, the terms "upregulator," "agonist," and "promoter" are used interchangeably to refer to any substance that can increase the expression level or activity of the TMEM151A protein or its corresponding encoding nucleic acid molecule. For example, the upregulator includes substances that increase the level of the Tmem151a gene or TMEM151A protein, substances that increase the transcriptional activity of the Tmem151a gene, or substances that increase the activity of the TMEM151A protein. The upregulator includes small molecules or biomacromolecules. In a preferred embodiment, the upregulator can increase the TMEM151A protein level or activity by at least 10%, preferably at least 30%, and more preferably at least 50%.

[0139] In a preferred embodiment, the upregulator comprises an overexpression vector of TMEM151A. The type of expression vector is not limited and may include any expression vector known in the art. In a preferred embodiment, the overexpression vector comprises a non-viral expression vector, such as naked DNA, plasmids, etc. In a preferred embodiment, the overexpression vector comprises a viral expression vector, such as adeno-associated virus (AAV) vectors, lentiviral vectors, adenovirus vectors, or combinations thereof.

[0140] In a preferred embodiment, the vector is an AAV vector. AAV can infect a variety of cells and has characteristics such as small size, non-pathogenicity, and the ability to transfect both dividing and non-dividing cells. In this invention, the AAV serotype is not limited. Preferably, it is a PHP.eB serotype AAV vector.

[0141] In this invention, the expression vector is preferably a vector that can cross the blood-brain barrier (BBB) ​​and achieve brain delivery. For example, the PHP.eB serotype AAV vector can effectively cross the blood-brain barrier and achieve broad brain gene delivery without being limited by cell type.

[0142] In this invention, the expression vector is delivered via intraorbital injection, intraventricular injection, intrathecal injection, local brain tissue injection, intravenous injection, intraperitoneal injection, subcutaneous injection, gavage administration, nasal administration, and intraocular injection.

[0143] In this invention, the structure of the expression vector is well known to those skilled in the art, and includes, for example, a promoter, a target gene coding sequence, and expression regulatory elements, all of which are conventionally selectable by those skilled in the art.

[0144] In a preferred embodiment, the expression vector of the present invention may include a constitutive promoter, an inducible promoter, a systemic promoter, or a specific promoter. In a preferred embodiment, the promoter is a specific promoter. In a preferred embodiment, the promoter is an excitatory neuron-specific promoter, including: the CaMKIIa promoter, the Emx1 promoter, etc., which can achieve specific expression of TMEM151A in excitatory neurons of the forebrain.

[0145] The pharmaceutical compositions of the present invention may also include other active ingredients for treating and / or alleviating epilepsy, such as drugs for treating epilepsy, including phenytoin, carbamazepine, lamotrigine, oxcarbazepine, lacosamide, eslicarbazepine, rufinamide, gabapentin, levetiracetam, pregabalin, ethosuximide, phenobarbital, diazepam, tiagabine, topiramate, stiripentol, brivaracetam, zonisamide, perampanel, and valproic acid. Acid, cannabidiol, and retigabine.

[0146] The pharmaceutical compositions of the present invention can be in any form or dosage form, including but not limited to: injections, tablets, powders, granules, capsules, lyophilized preparations, solutions, and syrups. In a preferred embodiment, the dosage form of the pharmaceutical composition is preferably an injection.

[0147] As used herein, pharmaceutically acceptable carriers include, but are not limited to: solvents, dispersion media, coatings, antibacterial or antifungal agents, isotonic agents and absorption delay agents, buffered saline, physiological saline, phosphate buffer, citrate buffer, acetate buffer, bicarbonate buffer, sucrose solution, salt solution, polysorbate solution, or combinations thereof. In a preferred embodiment, the pharmaceutically acceptable carrier is a delivery carrier, including but not limited to liposomes, nanoparticles, etc.

[0148] In this invention, the drug combination is delivered via intraorbital injection, intraventricular injection, intrathecal injection, local brain tissue injection, intravenous injection, intraperitoneal injection, subcutaneous injection, gavage, nasal administration, and intraocular injection.

[0149] In this invention, the use of the pharmaceutical composition of the invention is also provided, administered to a subject in need, for the treatment, prevention and / or relief of epilepsy.

[0150] As used in this article, the term "treatment" refers to both therapeutic and preventative measures. Those requiring treatment may include individuals who already have a skin condition and those who may eventually develop it.

[0151] As used herein, the terms “subject” and “object” are used interchangeably and include any human or non-human mammal, such as non-human primates, sheep, dogs, cats, horses, cattle, chickens, rats, mice, etc.

[0152] As used herein, the term "effective amount" or "effective dose" refers to an amount that is functional or active in humans and / or animals and is acceptable to them. It refers to the amount of a therapeutic agent that treats, alleviates, or prevents a target disease or condition, or that exhibits a detectable therapeutic or preventative effect. Therapeutic effects also include a reduction in physiological symptoms. The precise effective amount for a given subject depends on the subject's body size and health status, the nature and severity of the condition, and the choice of the therapeutic agent and / or combination of therapeutic agents administered. For a given condition, the effective amount can be determined using routine laboratory methods.

[0153] The effective amount of a pharmaceutical composition can vary depending on the mode of administration and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: pharmacokinetic parameters of the drug, such as tissue distribution, bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.

[0154] The beneficial effects of this invention include:

[0155] 1. This invention reveals for the first time that Tmem151a is a key regulatory factor in epilepsy susceptibility and has a bidirectional regulatory effect in epilepsy susceptibility.

[0156] 2. This invention provides Tmem151a - / - Mice and Tmem151a flox / flox The use of mice for the rapid establishment of animal models of epilepsy is of great value in the screening of antiepileptic drugs and in epilepsy research.

[0157] 3. This invention provides the use of Tmem151a as a target for the prevention and / or treatment of epilepsy. Overexpression of Tmem151a in excitatory neurons can inhibit the occurrence of epilepsy, providing a new method for the control of epilepsy.

[0158] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and fractions are weight percentages and weight fractions.

[0159] Example 1: Major cell types expressing Tmem151a

[0160] TMEM151A is a transmembrane protein composed of 468 amino acids and containing two transmembrane domains. To investigate its expression in the mouse brain, a rabbit polyclonal antibody targeting the C-terminal region (positions 362-468) of mouse TMEM151A was prepared. Western blot analysis detected an approximately 55 kDa band of endogenous TMEM151A in wild-type mouse brain samples, while this band was absent in samples from Tmem151a knockout mice, validating the antibody's specificity. Furthermore, Western blot analysis of multiple brain regions (including the forebrain, brainstem, and cerebellum) showed that TMEM151A was expressed in all examined brain regions, with the highest expression level in the cerebral cortex and lower expression in the striatum and cerebellum.

[0161] To further analyze the cellular distribution of Tmem151a, its expression in the adult mouse brain was detected using multiplex mRNA in situ hybridization. Specifically, Tmem151a mRNA and cell type-specific markers were detected using RNAscope multiplex fluorescence detection (Advanced Cell Diagnostics, 323100) according to the manufacturer's instructions. The results showed that Tmem151a was highly expressed in the pyramidal neuron layer of the cerebral cortex and hippocampus, while its expression was lower in the striatum and cerebellar molecular layers (Figures 1A and 1B), which was consistent with the results of Western blot analysis.

[0162] To further clarify the expression of Tmem151a in specific cell types, co-labeling experiments with known neuronal and glial cell markers were performed (Figs. 1C and 1D). In the cerebral cortex and hippocampus, Tmem151a mRNA was co-labeled with Vglut1 (a marker of glutamatergic excitatory neurons) (Fig. 1C, top panel). In the thalamus, Tmem151a was co-labeled with Vglut2 (another marker of glutamatergic neurons) (Fig. 1C, middle panel).

[0163] The results showed that Tmem151a was expressed very little in GABAergic neurons. Co-labeling of Tmem151a with Vgat (a marker of GABAergic neurons) was minimal in the cerebral cortex, hippocampus, and cerebellum (Figure 1C, bottom). These results indicate that Tmem151a is primarily expressed in glutamatergic neurons, with less expression in GABAergic neurons.

[0164] Besides neuronal populations, glial cells such as astrocytes, microglia, and oligodendrocytes are widely distributed in the brain. Further investigation was conducted into whether Tmem151a is expressed in glial cells. First, co-labeling experiments using Olig2 (a marker for mature oligodendrocytes) revealed that Tmem151a mRNA is expressed in most oligodendrocytes, primarily distributed in white matter regions such as the corpus callosum and cerebellar white matter (Figure 1D, top). These findings are consistent with human single-cell RNA sequencing data.

[0165] Subsequently, the expression of Tmem151a in microglia was examined. Tmem151a mRNA was labeled using RNAscope technology (according to the manufacturer's instructions), and immunohistochemical detection of the microglia marker IBA1 was performed. The results showed that Tmem151a was not detected in microglia of the cerebral cortex (Figure 1D, middle panel). The same strategy was used to detect the expression of Tmem151a in GFAP (glial fibrillary acidic protein)-positive astrocytes, and the results also showed that Tmem151a was not expressed in astrocytes (Figure 1D, bottom panel).

[0166] In summary, these results indicate that Tmem151a is mainly expressed in glutamatergic neurons and oligodendrocytes, while its expression is extremely low in GABAergic neurons, astrocytes, and microglia.

[0167] Example 2: Localization study of TMEM151A on neurons

[0168] TMEM151A has two transmembrane domains connected by an extracellular loop. Since Tmem151a is highly expressed in neurons, which are cells with intrinsic polarity, this study further investigated its subcellular localization to gain a deeper understanding of its biological function.

[0169] To specifically visualize the membrane-associated TMEM151A, a Tmem151a expression vector was constructed. A hemagglutinin (HA) tag was inserted into the extracellular loop (after the Gly81 site) between its two transmembrane domains, and an EGFP reporter gene was linked downstream of the intron ribosome entry site (IRES) (Figure 2A). Under non-membrane conditions, the antibody could not enter the cell and therefore could only label TMEM151A-HA located on the plasma membrane (Figure 2A).

[0170] The expression vector was transfected on the day primary cultured neurons were plated, and the HA tag was immunofluorescence stained under both perforated and non-perforated membrane conditions on day 5 of in vitro culture (DIV 5). At this developmental stage, neuronal axons had formed and could be identified by morphological features (Figure 2B). Under non-perforated membrane conditions, TMEM151A-HA was observed to be mainly localized in axons, but almost undetectable in dendrites and the cell body (Figure 2B). Conversely, under perforated membrane conditions (where the antibody could enter the cytoplasm), TMEM151A-HA was observed to be distributed throughout the neuron, but not in the nucleus (Figure 2B). These results suggest that a specific transport mechanism may regulate the subcellular localization of membrane-associated TMEM151A within neurons.

[0171] At different neuronal developmental stages (DIV3, DIV5, and DIV14), membrane-associated TMEM151A exhibited distinct polarization axonal distribution patterns (Fig. 2C and 2D). In DIV3, membrane-associated TMEM151A gradually increased along the axon from proximal to distal, with the strongest signal at the growth cone and filopodia (Fig. 2C). In DIV5, TMEM151A formed punctate aggregates along the axon, but was almost entirely absent in the proximal segment near the cell body (Fig. 2C). By DIV14, co-staining of membrane-associated TMEM151A and Ankyrin-G (AnkG, an AIS marker for the initial axonal segment) confirmed the near-absence of TMEM151A in AIS (Fig. 2D).

[0172] In summary, the results indicate that TMEM151A on the membrane is mainly located in axons, but is less distributed in the cell body, dendrites, axonopods, and AIS.

[0173] Example 3: The relationship between Tmem151a and behavioral phenotypes and epilepsy susceptibility in mice

[0174] (I) Relationship between Tmem151a and mouse behavioral phenotypes

[0175] To investigate the functional role of TMEM151A, a Tmem151a knockout (Tmem151a) was constructed in this embodiment. - / - Mice were screened for behavioral phenotypes.

[0176] Tmem151a - / - Mice were constructed using the CRISPR / Cas9 method. The sgRNA sequences were 5'-GGAGGTGCCCGCGCTCGTTC-3' (SEQ ID NO:7) and 5'-AGCCAGGACACCATGCCGGA-3' (SEQ ID NO:8). The sgRNA target sequence was located in the Exon1 exon region of the Tmem151a gene. Tmem151a gene knockout mice were obtained through routine gene targeting and breeding of fertilized eggs. These mice had a 37bp deletion in the Tmem151a gene after the start codon, preventing normal transcription and ultimately resulting in the loss of the TMEM151A protein.

[0177] The behavioral phenotype of mice was evaluated using the following tests:

[0178] Open field test: Mice were placed individually in a clean open field box (40×40×40 cm, length×width×height) and allowed to explore freely for 30 minutes. The entire test was video-recorded, and movement activities (including total distance traveled and average speed) were automatically measured and analyzed using Ethovision XT software.

[0179] Rotarod test: Mice were first trained on a rotarod apparatus (Ugo Basile, Italy) at a constant speed of 4 revolutions per minute (rpm) for 5 minutes to familiarize themselves with the device. After a 30-minute rest period, the mice entered the accelerated phase test, where the rotarod speed was gradually increased from 4 rpm to 60 rpm over 5 minutes. Each mouse underwent three trials, with each trial spaced 30 minutes apart. The fall latency was recorded for each trial, and the average latency was used as an indicator of motor ability.

[0180] Social interaction test: The test was conducted in a rectangular box (40×60×40 cm, length×width×height) divided into three equal sections. A small cage was placed at each end. During the acclimatization phase, each mouse was placed in the center of the box and allowed to freely explore all three sections for 10 minutes. Afterward, an unfamiliar mouse was randomly placed in one of the cages, leaving the other cage empty. The test mice then explored freely for another 10 minutes. The time spent by the test mice around each cage was recorded and analyzed.

[0181] The results showed that Tmem151a - / - The mice showed no significant differences in motor ability, motor coordination, and social behavior compared to wild-type (WT) mice.

[0182] (II) The relationship between Tmem151a and susceptibility to epilepsy in mice

[0183] Since TMEM151A-related diseases are classified as paroxysmal neurological disorders in humans, further research on Tmem151a is needed. - / - Whether mice are more sensitive to epileptic stimuli that induce increased excitability of the nervous system. Intraperitoneal injection (ip) of the γ-aminobutyric acid (GABA) A receptor antagonist pentylenetetrazol (PTZ) 40 mg / kg (this moderate dose is sufficient to induce mild epileptic behavior in WT mice), and the severity of epilepsy was assessed using the Racine scoring system. Tmem151a - / - The mice experienced more severe seizures, and their Racine scores were significantly higher than those of the WT control group (Figures 3A and 3B).

[0184] Furthermore, to verify that Tmem151a deficiency lowers the threshold for epilepsy onset, a PTZ dose-escalation strategy (increased every two days) was used to assess the dose threshold for inducing epilepsy. Results showed that at a low dose of 30 mg / kg PTZ, <30% of WT mice exhibited forelimb clonus, while >85% of Tmem151a deficiency... - / - Mice developed myoclonus, some of which progressed to clonic seizures. At a medium dose of 45 mg / kg PTZ, approximately 70% of WT mice and all Tmem151a mice showed [the following effect / effect]. - / - Mice developed grade 3 or higher (Racine score ≥3) epilepsy. At a high dose of 55 mg / kg PTZ, both groups experienced clonic or tonic-clonic seizures (Figure 3C). Notably, at low to medium doses (30 and 45 mg / kg, ip), epilepsy-induced death occurred only in Tmem151a. - / - Mice, and all WT mice survived.

[0185] The above results indicate that Tmem151a deficiency significantly increases susceptibility to PTZ-induced epilepsy.

[0186] To further confirm whether these epileptiform behaviors were related to epileptic discharges, electrocorticography (ECoG) was performed after PTZ treatment. Results showed that baseline ECoG recordings (without PTZ injection) showed that WT and Tmem151a... - / -No epileptiform discharges were observed in any of the mice (Figure 3D). Minutes after PTZ (30 mg / kg, ip) injection, Tmem151a... - / - Mice exhibited repetitive polyspikes and spike-wave discharges, corresponding to behavioral clonic and / or tonic epilepsy. WT mice did not show similar ECoG abnormalities at this subthreshold dose (Figure 3D). High-dose PTZ (55 mg / kg, ip): Spike discharges and behavioral epilepsy occurred in both groups, but Tmem151a... - / - The mortality rate induced by epilepsy in mice was higher, manifested as respiratory arrest after rigid extension.

[0187] In addition, an electrical stimulation-induced epilepsy model was investigated, with bipolar electrodes implanted in the sensory cortex for local electrical stimulation (Figure 3E). WT mice did not develop epilepsy under these stimulation parameters: 200 μA, 60 Hz, 1 ms pulse width, and 2 s pulse duration. Tmem151a - / - Mice developed grade 5 epilepsy under the same stimulus (Figures 3F and G).

[0188] In summary, Tmem151a deficiency significantly reduces the epilepsy threshold, leading to increased sensitivity to chemically and electrically induced epilepsy.

[0189] Example 4: Tmem151a - / - Epilepsy progression in a mouse hippocampal electric ignition model

[0190] To determine Tmem151a - / - To investigate whether mice are susceptible to ignition-induced epilepsy, a hippocampal ignition model was used to study the process of epilepsy development.

[0191] Bipolar stimulation and recording electrodes were implanted in the CA3 region of the hippocampus: Bipolar electrodes (brown spirals) were implanted in the CA3 region of the hippocampus. Seven days after surgery, the after-discharge (AD) threshold was measured in each mouse. Subsequently, burn-in stimulation (60 Hz, 2 s, pulse width 1 ms) was performed twice daily (Figure 4A). After the 7-day recovery period, the AD threshold for each mouse was measured, defined as the minimum current intensity required to induce rhythmic hippocampal discharges (≥5 seconds) (Figure 4B). Results showed that Tmem151a... - / - The AD threshold of mice (16.88±1.619μA) was lower than that of the WT littermate control group (24.29±3.689μA), but the difference was not statistically significant (Figure 4C).

[0192] To induce kindling, electrical stimulation was performed twice daily at 125% of the AD threshold intensity, with ECoG signals and behavioral epilepsy grading recorded during each stimulation session. Results showed that, compared to the WT control group, Tmem151a... - / - Mice exhibited a significantly accelerated epileptic progression (Figure 4D). Notably, Tmem151a - / - Mice were induced to develop grade 5 seizures with only ≤4 consecutive electrical stimulations, with some individuals requiring only 2 stimulations. In contrast, WT mice typically required approximately 20-30 electrical stimulations to progressively develop grade 5 seizures (Figures 4D and E). Tmem151a - / - The number of electrical stimulations required for mice to reach levels 2, 5, and complete ignition were significantly fewer than those required for WT mice (Figure 4E). Furthermore, Tmem151a... - / - The cumulative AD duration required for mice to reach the ignition state was also significantly shorter than that for WT mice (Figure 4F).

[0193] In summary, these results confirm that Tmem151a deficiency can accelerate the occurrence of epilepsy in the hippocampal electric ignition model, further supporting the key role of Tmem151a in epilepsy susceptibility.

[0194] Example 5: In CaMKIIa + Conditional knockout of Tmem151a in neurons accelerates the onset of epilepsy.

[0195] Given that Tmem151a is primarily expressed in glutamatergic neurons and oligodendrocyte lineages within the central nervous system (CNS), a Tmem151a construct was developed in this embodiment. flox / flox Mice were used, and two conditional knockout (cKO) mouse models were further established—CaMKIIa-iCre / Tmem151a. flox / flox (CaMKIIa-cKO) and Olig2-Cre / Tmem151a flox / flox (Olig2-cKO) was used to investigate in which cell population Tmem151a deficiency promotes accelerated epilepsy. In the experiment, the control group consisted of Tmem151a cells. flox / flox Mice.

[0196] In this study, the mouse model was established using the following method: Tmem151a flox / flox The mouse strain was generated using a CRISPR / Cas9 strategy, with an upstream loxP site inserted between introns 1 and 2, and a downstream loxP site inserted approximately 300 bp downstream of the 3'UTR. The sgRNA sequence used was:

[0197] 5'-CGGAAGAGGCTGTTAAGTCGGGG-3' (SEQ ID NO:5); 5'-GGGTCTGTCATAGGCGTCACGGG-3' (SEQ ID NO:6). A mixture of sgRNAs, Cas9 mRNAs, and a targeting vector (containing homologous arm sequences) was microinjected into fertilized eggs of C57BL / 6J mice. The injected fertilized eggs were then implanted into pseudopregnant female mice, and PCR and Sanger sequencing were used to screen for loxP site integration at the target site. Positive F0 generation mice were mated with C57BL / 6J mice to establish stable Tmem151a. flox / flox Mouse population. Tmem151a flox / flox Mice were mated with CaMKIIa-iCre or Olig2-Cre (JAX-025567) mice to obtain conditional knockout (cKO) mice.

[0198] In CaMKIIa-cKO mice, Tmem151a is specifically lost in excitatory neurons of the forebrain. The knockout efficiency of Tmem151a was validated in the cerebral cortex and hippocampus using in situ hybridization (RNAscope) (Figure 5A). The results showed that Tmem151a mRNA was not detected in the pyramidal cell layer of the CA1 region, but its expression was still detected in oligodendrocytes in the corpus callosum and other regions, indicating that Tmem151a is specifically lost in neurons (Figure 5A).

[0199] To assess the impact of Tmem151a knockout in forebrain excitatory neurons on epilepsy, bipolar electrodes were implanted in the CA3 region of the hippocampus. The AD threshold induced by electrical stimulation was measured, and the electrical ignition process was monitored. Compared to the control group, CaMKIIa-cKO mice exhibited a significantly accelerated epilepsy progression, while the AD threshold showed no significant difference (Figs. 5B and 5C). Furthermore, CaMKIIa-cKO mice required fewer electrical stimulations to reach grades 2, 5, and complete ignition compared to the control group (Fig. 5D). These results indicate that knockout of Tmem151a in forebrain excitatory neurons is sufficient to accelerate epilepsy in a hippocampal ignition model.

[0200] Next, we investigated the effect of Tmem151a knockout in oligodendrocytes on epilepsy. In Olig2-cKO mice, Tmem151a mRNA was not detected in the corpus callosum (Fig. 5E), indicating that Tmem151a was effectively knocked out in oligodendrocytes. However, compared with the control group, there were no significant differences in the ignition process and AD threshold in Olig2-cKO mice (Figs. 5F and 5G). Furthermore, the number of electrical stimulations required for Olig2-cKO mice to reach grade 2, grade 5, and complete ignition states was comparable to that in the control group (Fig. 5H).

[0201] In summary, these results indicate that the loss of Tmem151a in CaMKIIa-positive excitatory neurons can accelerate the onset of epilepsy, while the loss in Olig2-positive oligodendrocytes does not affect the epilepsy process.

[0202] Example 6: Inhibitory effect of TMEM151A overexpression on epilepsy

[0203] The observation that Tmem151a deficiency increases susceptibility to epilepsy prompted further investigation into whether its overexpression could alleviate or even suppress epilepsy. To test this hypothesis, the adeno-associated virus (AAV) vector PHP.eB-CAG-DIO-Tmem151a-HA was designed and constructed. To ensure specific overexpression of Tmem151a in excitatory neurons of the forebrain (these neurons endogenously express Tmem151a and are closely associated with epilepsy susceptibility), Emx1-Cre mice were used. In Emx1-Cre mice, the Cre recombinase driven by the Emx1 promoter mediates the expression of this AAV in excitatory neurons of the forebrain. Therefore, TMEM151A (TMEM151A-OE) was overexpressed in excitatory neurons of the forebrain in Emx1-Cre mice. PHP.eB-CAG-DIO-mCherry was used as a control. AAV viral particles were delivered via tail vein injection in mice.

[0204] (I) Effects of TMEM151A overexpression on a chemical drug (pentylenetetrazole)-induced epilepsy model

[0205] Two weeks after tail vein injection, mice in both groups were intraperitoneally injected with 55 mg / kg of the γ-aminobutyric acid (GABA) A receptor antagonist pentylenetetrazol (PTZ) (a dose sufficient to induce high Racine-grade epileptic behavior in WT mice) (Figure 6A). Immunohistochemistry was used to verify the overexpression of TMEM151A-HA in excitatory neurons of the forebrain of the TMEM151A-OE group mice (Figure 6B). After injection of 55 mg / kg PTZ, the severity of the epileptic phenotype was assessed using the Racine scoring system, and seizure frequency was recorded using electroencephalography (EEG). The number of seizures in the TMEM151A-OE group was significantly lower than that in the control group (Figure 6C). Specifically, the phenotype in the TMEM151A-OE group was around grade 3, while that in the control group was around grade 5 (Figure 6D). EEG in the TMEM151A-OE group showed single spikes, while the control group showed continuous waves (Figure 6E).

[0206] (II) Effects of TMEM151A overexpression on hippocampal ignition-induced epilepsy model

[0207] Electrodes were implanted in the CA3 region, and epilepsy experiments were conducted using a hippocampal ignition model (Figure 7A). One week after tail vein injection, electrodes were implanted in the CA3 region of both the control and TMEM151A overexpression groups, and epilepsy experiments were conducted using a hippocampal ignition model (Figure 7A). Compared with the control group, there was no significant difference in the after-emission (AD) threshold of the overexpression group (TMEM151A-OE) mice (Figure 7B). However, in the TMEM151A-OE group, even after 30 stimulations, Emx1-cKO mice did not reach the level of grade 3 epileptic seizures, which is extremely rare in hippocampal ignition models, where control mice typically exhibit grade 5 epileptic seizures within 30 stimulations (Figure 7C).

[0208] These results indicate that TMEM151A plays a bidirectional regulatory role in the development of epilepsy; its deficiency increases susceptibility to epilepsy, while its overexpression enhances resistance to epilepsy.

[0209] discuss

[0210] TMEM151A is a membrane-associated protein. Studies have reported that Tmem151a is a pathogenic gene for paroxysmal kinetic disorder (PKD), but its function in the central nervous system remains unclear.

[0211] This study reveals for the first time that TMEM151a is mainly expressed in glutamatergic neurons and oligodendrocytes in the mouse brain, and that TMEM151A protein is primarily distributed on the axons of cultured neurons. Furthermore, a bidirectional role of TMEM151A in regulating epilepsy susceptibility was identified, indicating that its deficiency accelerates the onset of epilepsy, while overexpression inhibits it.

[0212] In Tmem151a-deficient mice (C57BL / 6J background), no spontaneous seizures were observed during reproduction. However, these mice exhibited higher susceptibility to seizure-inducing stimuli such as chemically induced stimuli (PTZ) and electrical stimulation, and epilepsy onset was accelerated in a hippocampal electric ignition model. These results suggest that Tmem151a plays a role in modulating seizure susceptibility, rather than directly inducing severe seizures.

[0213] According to the excitation-inhibition balance theory, excessive excitability of glutamatergic neurons may disrupt network homeostasis, making the brain more susceptible to epileptic seizures. This invention discovers that membrane-associated TMEM151A preferentially localizes on the axons of glutamatergic neurons, providing insights into a potential mechanism of increased susceptibility to epilepsy.

[0214] First, during early neural development, TMEM151A is highly concentrated in growth cones and pseudopodia, suggesting a possible role in axonal extension and pathway selection. This function may influence neuronal projection patterns, network organization, and synaptic remodeling, all crucial for maintaining appropriate network excitability. Disruption of these processes may increase susceptibility to epilepsy.

[0215] Secondly, axons and axonal terminals are rich in membrane proteins, including ion channels and transporters, which are crucial for neuronal excitability. Genes encoding various ion channels (such as CACNA1A, KCNQ2, and SCN8A), receptors (such as GRIN1), and transporters (such as SLC2A1) have been shown to be associated with monogenic epilepsy. TMEM151A may function as a regulator or helper subunit of these epilepsy-related proteins. Loss of TMEM151A may alter the function of these axonal membrane proteins, thereby increasing neuronal excitability. Alternatively, TMEM151A itself may act as a signaling molecule at the axonal terminals, directly promoting neuronal excitability. Its loss may impair normal axonal signaling, leading to hyperexcitability of neuronal circuits and thus increasing susceptibility to epilepsy.

[0216] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of TMEM151A or its upregulator, characterized in that, This is used to prepare a pharmaceutical composition for the prevention and / or treatment of epilepsy.

2. The use as described in claim 1, characterized in that, The TMEM151A or its upregulators selectively act on excitatory neurons in the forebrain.

3. The use as described in claim 1, characterized in that, The upregulators include substances that increase the expression level of the Tmem151a gene or TMEM151A protein, substances that increase the transcriptional activity of the Tmem151a gene, or substances that increase the activity of the TMEM151A protein.

4. The use as described in claim 1, characterized in that, The upregulator includes the expression vector of TMEM151A; preferably, the vector is an AAV vector, and more preferably, a PHP.eB serotype AAV vector.

5. The use as described in claim 4, characterized in that, The expression vector comprises: a promoter, a nucleotide sequence encoding the TMEM151A protein, and optional expression regulatory elements; preferably, the promoter is an excitatory neuron-specific promoter; preferably, the excitatory neuron-specific promoter is selected from the group consisting of: CaMKIIa promoter, Emx1 promoter, vGlut1 promoter, vGlut2 promoter, or a combination thereof.

6. The use as described in claim 1, characterized in that, The drug composition was administered to subjects with the following subtypes: TMEM151A protein expression levels in excitatory neurons were comparable to or lower than those in normal controls.

7. The use as described in claim 1, characterized in that, The prevention and / or treatment of epilepsy include: reducing the subject's susceptibility to epilepsy, reducing the level of epileptic seizures, delaying the time of epileptic seizures, and / or reducing the frequency of epileptic seizures.

8. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises: (i) A therapeutically effective amount of TMEM151A or an upregulator thereof; (ii) Pharmaceutically acceptable carriers.

9. The pharmaceutical composition according to claim 8, characterized in that, The upregulator is an expression vector of TMEM151A, and the promoter of the expression vector is a neuron-specific promoter and / or an excitatory neuron-specific promoter.

10. A medicine box, characterized in that, The medicine box includes: (a) a first pharmaceutical composition, wherein the first pharmaceutical composition comprises (a1) TMEM151A or an upregulator thereof; and (a2) a pharmaceutically acceptable carrier; and (b) A second pharmaceutical composition, wherein the second pharmaceutical composition comprises (b1) another drug for treating epilepsy; and (a2) a pharmaceutically acceptable carrier.

11. A method for establishing an animal model of epilepsy, characterized in that, The method includes the following steps: (S1) Provide animal cells, inactivate the Tmem151a gene in the cells, and obtain cells with inactivated Tmem151a gene; (S2) Using the Tmem151a gene-inactivated cells obtained in step (S1), an animal model of Tmem151a gene inactivation was obtained. (S3) Apply a stimulus that can induce epilepsy to the animal model with inactivated Tmem151a gene obtained in step (S2) to obtain an animal model of epilepsy.

12. The use of an animal lacking Tmem151a, characterized in that, Used to prepare animal models of epilepsy.

13. A method for screening or identifying potential therapeutic agents for treating or alleviating epilepsy, characterized in that, The method includes the following steps: a. Applying the candidate substance to an epileptic animal model prepared using the method of claim 8; and b. Assess the level of epilepsy in the animal model and compare it with the control group; In this study, if the level of epilepsy is lower in animal models that have been given the candidate substance compared to the control group, it indicates that the candidate substance is a potential therapeutic agent for epilepsy.

14. The use of a detection reagent for the TMEM151A gene or protein, characterized in that, This kit is used to prepare a kit for: assessing a subject's susceptibility to epilepsy; and / or predicting a subject's risk of developing epilepsy.

15. A reagent kit, characterized in that, The kit includes: (Y1) Detection reagent, wherein the detection reagent is a detection reagent for the TMEM151A gene or protein; and (Y2)TMEM151A or its upregulator.

16. The kit according to claim 15, characterized in that, The kit also includes a label and / or instructions, which describe the method of administration of the kit: using the (Y1) detection reagent to detect whether the expression level of the TMEM151A gene or protein in the subject is lower than that in the normal control; if so, administer (Y2) TMEM151A or its upregulator to the subject.

17. A method for preventing and / or treating epilepsy, characterized in that, This includes administering a therapeutically effective amount of a pharmaceutical composition containing TMEM151A or an upregulator thereof to a subject in need, the pharmaceutical composition of claim 8, or the kit of claim 10.

Images