A novel treatment for lysin metabolism disorders

Abstract

The invention relates to the fields of medicine and immunology. In particular, it relates to novel antisense oligonucleotide moieties that may be used in the treatment, prevention and / or delay of lysine metabolism disorders.

Description

[0001] A novel treatment for lysin metabolism disorders

[0002] Field of the invention

[0003] The invention relates to the fields of medicine and immunology. In particular, it relates to novel antisense oligonucleotide moieties that may be used in the treatment, prevention and / or delay of lysine metabolism disorders.

[0004] Background of the invention

[0005] Several inherited metabolic disorders affect the saccharopine pathway of lysine degradation. These disorders arise when an individual has a mutation in one of the genes which encode the enzymes involved in this pathway. The mutation results in a block in the pathway and causes an accumulation of metabolites upstream of the step catalyzed by the affected enzyme. In many cases, the metabolites are thought to be neurotoxic.

[0006] In more detail, mutations in ALDH7A1 (Aldehyde Dehydrogenase 7 Family Member Al) may result in a form of pyridoxine-dependent epilepsy. This pyridoxine dependent epilepsy has an incidence of 1 :64,000, and is characterized by intractable neonatal seizures caused by a lack of vitamin B6. Current treatments involve administration of pyridoxine (a form of vitamin B6), dietary restriction of lysine, and / or arginine supplementation. While pyridoxine administration may control the seizures, it may also cause a peripheral neuropathy. In addition, dietary restriction may be burdensome for the patient and their families, and lead to a deficiency in the essential amino acid lysine. Furthermore, 75% of patients have developmental delay that is believed to be caused by accumulation of the ALDH7A1 substrate AASA and other metabolites.

[0007] Mutations in glutaryl-CoA dehydrogenase may result in glutaric aciduria Type I. Glutaric aciduria Type I has an incidence of 1 :100,000 in children worldwide with up to 1 :300 newborns affected in the Amish community and the Ojibwa population of Canada. If left untreated, glutaric aciduria Type I results in irreversible striatal damage and a movement disorder, and many affected individuals do not survive to adulthood. Current treatments include a lysine- and tryptophan- restricted diet, and supplementation of arginine, carnitine and riboflavin. However, even if treatment is implemented early, affected individuals may develop kidney disease and / or experience white matter changes.

[0008] There is therefore a need for alternative treatments for disorders of the saccharopine pathway of lysine degradation.

[0009] Description of the invention

[0010] The invention relates to an antisense oligonucleotide moiety for the degradation of an AASS transcript, wherein the antisense oligonucleotide moiety binds to or is complementary to a polynucleotide part within the nucleotide sequence as shown in SEQ ID NO: 1 , and wherein the antisense oligonucleotide moiety preferably does not bind to and is not complementary to a nucleotide part with the nucleotide sequence as shown in SEQ ID NO: 7.The invention further relates to an antisense oligonucleotide moiety for the degradation of an A4SS transcript, wherein the antisense oligonucleotide moiety binds to or is complementary to a polynucleotide part within the nucleotide sequence as shown in SEQ ID NO: 2, and wherein the antisense oligonucleotide moiety preferably does not bind to and is not complementary to a nucleotide part with the nucleotide sequence as shown in SEQ ID NO: 7.

[0011] In the embodiments herein, the antisense oligonucleotide moiety is referred to as “the antisense oligonucleotide moiety for the degradation of an A4SS transcript according to the invention" and interchangeably as “the antisense oligonucleotide moiety for the degradation of an A4SS transcript”, or plainly “the antisense oligonucleotide moiety”.

[0012] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part within the nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, wherein the antisense oligonucleotide moiety preferably does not bind to and is not complementary to a nucleotide part with the nucleotide sequence as shown in SEQ ID NO: 7..

[0013] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part within the nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, said polynucleotide part having a nucleotide sequence selected from the group consisting of the nucleotide sequences as shown in SEQ ID NO: 3 to SEQ ID NO: 6, and SEQ ID NO: 11 to SEQ ID NO: 34.

[0014] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part having a nucleotide sequence as shown in SEQ ID NO: 3, preferably SEQ ID NO: 4, more preferably SEQ ID NO: 5, and more preferably SEQ ID NO: 6, or a part thereof.

[0015] In an embodiment, the antisense oligonucleotide moiety preferably does not bind to and may not be complementary to a polynucleotide part having a nucleotide sequence as shown in SEQ ID NO: 7, preferably SEQ ID NO: 8, more preferably SEQ ID NO: 9, and more preferably SEQ ID NO: 10, or a part thereof.

[0016] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part having a nucleotide sequence as shown in SEQ ID NO: 11 , preferably SEQ ID NO: 12, more preferably SEQ ID NO: 13, and more preferably SEQ ID NO: 14, or a part thereof.

[0017] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part having a nucleotide sequence as shown in SEQ ID NO: 15, preferably SEQ ID NO: 16, more preferably SEQ ID NO: 17, and more preferably SEQ ID NO: 18, or a part thereof.

[0018] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part having a nucleotide sequence as shown in SEQ ID NO: 19, preferably SEQ ID NO: 20, more preferably SEQ ID NO: 21 , and more preferably SEQ ID NO: 22, or a part thereof.

[0019] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part having a nucleotide sequence as shown in SEQ ID NO: 23,preferably SEQ ID NO: 24, more preferably SEQ ID NO: 25, and more preferably SEQ ID NO: 26, or a part thereof.

[0020] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part having a nucleotide sequence as shown in SEQ ID NO: 27, preferably SEQ ID NO: 28, more preferably SEQ ID NO: 29, and more preferably SEQ ID NO: 30, or a part thereof.

[0021] In the embodiments herein, the antisense oligonucleotide moiety may bind to or may be complementary to a polynucleotide part having a nucleotide sequence as shown in SEQ ID NO: 31 , preferably SEQ ID NO: 32, more preferably SEQ ID NO: 33, and more preferably SEQ ID NO: 34, or a part thereof.

[0022] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an A4SS transcript may comprise or consist of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 35, 37, 38, 39, 40, 41 or 42.

[0023] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an A4SS transcript may comprise or consist of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 35.

[0024] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an A4SS transcript may comprise or consist of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 37.

[0025] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an A4SS transcript may comprise or consist of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 38.

[0026] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an A4SS transcript may comprise or consist of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 39.

[0027] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an A4SS transcript may comprise or consist of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 40.In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an A4SS transcript may comprise or consist of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 41.

[0028] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an A4SS transcript may comprise or consist of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 42.

[0029] In the embodiments herein, the antisense oligonucleotide moiety as defined above may comprise an RNA residue, a DNA residue, and / or a nucleotide analogue or equivalent. In the embodiments herein, the antisense oligonucleotide moiety may comprise both RNA and DNA residues. In the embodiments herein, the antisense nucleotide moiety may be a gapmer. The term “gapmer” is understood to refer to short DNA antisense oligonucleotide structures with RNA-like segments on both sides of the sequence (RNA mimics). In the embodiments herein, the antisense oligonucleotide moiety as defined above may be conjugated, for example, with GalNAc (N-acetylgalactosamine) or cell penetrating peptides (CPPs).

[0030] The term “moiety” is understood to refer to a part of the antisense oligonucleotide that could include a substructure, such as, for example a functional group. The terms "antisense oligonucleotide", “ASO” and “AON” are used interchangeably herein and are understood to refer to an oligonucleotide molecule comprising a nucleotide sequence which is substantially complementary to a target nucleotide sequence in a pre-mRNA molecule, hnRNA (heterogenous nuclear RNA) or mRNA molecule. The degree of complementarity (or substantial complementarity) of the antisense sequence is preferably such that a molecule comprising the antisense sequence can form a stable hybrid with the target nucleotide sequence in the RNA molecule under physiological conditions. Binding of an ASO to its target can easily be assessed by the person skilled in the art using techniques that are known in the field such as the gel mobility shift assay as described in EP1619249.

[0031] The term "complementary" used in the context of the invention indicates that some mismatches in the antisense sequence are allowed as long as the functionality is achieved. Preferably, the complementarity is from 90% to 100%. In general this allows for 1 or 2 mismatches in an antisense oligonucleotide moiety of 20 nucleotides or 1 , 2, 3 or 4 mismatches in an antisense oligonucleotide moiety of 40 nucleotides, or 1 , 2, 3, 4, 5 or 6 mismatches in an ASO of 60 nucleotides, etc. The complementary regions are preferably designed such that, when combined, they are specific for the intron or exon in the pre-mRNA or mRNA. Such specificity may be created with various lengths of complementary regions, as this depends on the actual sequences in other (pre-)mRNA molecules in the system. The risk that the antisense oligonucleotide moiety will also be able to hybridize to one or more other (pre-)mRNA molecules decreases with increasing size of the antisense oligonucleotide moiety. It is clear that antisense oligonucleotide moieties comprisingmismatches in the region of complementarity butthat retain the capacity to hybridize and / or bind to the targeted region(s) in the (pre-)mRNA, can be used in the invention. However, preferably at least the complementary parts do not comprise such mismatches as antisense oligonucleotide moieties lacking mismatches in the complementary part typically have a higher efficiency and a higher specificity than antisense oligonucleotide moieties having such mismatches in one or more complementary regions. It is thought, that higher hybridization strengths, (i.e. increasing number of interactions with the opposing strand) are favorable in increasing the efficiency of the process of interfering with the splicing or mRNA degradation machinery of the system.

[0032] The antisense oligonucleotide moiety according to the invention furthermore preferably has acceptable RNA binding kinetics and / or thermodynamic properties. The RNA binding kinetics and / or thermodynamic properties are at least in part determined by the melting temperature of an oligonucleotide (Tm; calculated with the oligonucleotide properties calculator (www.unc.edu / -cail / biotool / oligo / index) for single stranded RNA using the basic Tm and the nearest neighbor model), and / orthe free energy of the ASO-target intron / exon complex (using RNA structure version 4.5). If a Tm is too high, the ASO is expected to be less specific. An acceptable Tm and free energy depend on the sequence of the ASO. Therefore, it is difficult to give preferred ranges for each of these parameters. An acceptable Tm may be ranged between 35 and 70 °C and an acceptable free energy may be ranged between 15 and 45 kcal / mol.

[0033] In the embodiments herein, the antisense oligonucleotide moiety may have a length of from about 8 to about 40 nucleotides, preferably from about 10 to about 40 nucleotides, more preferably from about 14 to about 30 nucleotides, more preferably from about 16 to about 24 nucleotides, such as 16, 17, 18, 19, 20, 21 , 22, 23 or 24 nucleotides.

[0034] It is preferred that each antisense oligonucleotide moiety of the invention comprises one or more residues that are modified to increase nuclease resistance, and / or to increase the affinity of the antisense oligonucleotide moiety for the target sequence. Therefore, in the embodiments herein, the antisense nucleotide sequence comprises at least one nucleotide analogue or equivalent, wherein a nucleotide analogue or equivalent is defined as a residue having a modified base, and / or a modified backbone, and / or a non-natural internucleoside linkage, or a combination of these modifications.

[0035] In the embodiments herein, the nucleotide analogue or equivalent may comprise a modified backbone. Examples of such backbones are provided by morpholino backbones, carbamate backbones, siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl backbones, riboacetyl backbones, alkene containing backbones, sulfamate, sulfonate and sulfonamide backbones, methyleneimino and methylenehydrazino backbones, and amide backbones. Phosphorodiamidate morpholino oligomers are modified backbone oligonucleotides that have previously been investigated as antisense agents.

[0036] Morpholino oligonucleotides have an uncharged backbone in which the deoxyribose sugar of DNA is replaced by a six membered ring and the phosphodiester linkage is replaced by a phosphorodiamidate linkage. Morpholino oligonucleotides are resistant to enzymatic degradationand appear to function as antisense agents by arresting translation or interfering with pre-mRNA splicing rather than by activating RNase H. Morpholino oligonucleotides have been successfully delivered to tissue culture cells by methods that physically disrupt the cell membrane, and one study comparing several of these methods found that scrape loading was the most efficient method of delivery; however, because the morpholino backbone is uncharged, cationic lipids are not effective mediators of morpholino oligonucleotide uptake in cells. A recent report demonstrated triplex formation by a morpholino oligonucleotide and, because of the non-ionic backbone, these studies showed that the morpholino oligonucleotide was capable of triplex formation in the absence of magnesium.

[0037] In the embodiments herein, it is preferred that the linkage between the residues in a backbone do not include a phosphorus atom, such as a linkage that is formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.

[0038] Examples of nucleotide analogue or equivalent comprises a Peptide Nucleic Acid (PNA), having a modified polyamide backbone (Nielsen, et al. (1991) Science 254, 1497-1500). PNA-based molecules are true mimics of DNA molecules in terms of base-pair recognition. The backbone of the PNA is composed of N-(2-aminoethyl)-glycine units linked by peptide bonds, wherein the nucleobases are linked to the backbone by methylene carbonyl bonds. An alternative backbone comprises a one-carbon extended pyrrolidine PNA monomer (Govindaraju and Kumar (2005) Chem. Commun, 495 — 497). Since the backbone of a PNA molecule contains no charged phosphate groups, PNA-RNA hybrids are usually more stable than RNA-RNA or RNA-DNA hybrids, respectively (Egholm et al (1993) Nature 365, 566-568). In the embodiments herein the backbone comprises a morpholino nucleotide analog or equivalent, in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring. In the embodiments herein the nucleotide analog or equivalent comprises a phosphorodiamidate morpholino oligomer (PMO), in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring, and the anionic phosphodiester linkage between adjacent morpholino rings is replaced by a non-ionic phosphorodiamidate linkage. In the embodiments herein, a nucleotide analogue or equivalent of the invention comprises a substitution of one of the non-bridging oxygens in the phosphodiester linkage. This modification slightly destabilizes base-pairing but adds significant resistance to nuclease degradation. A preferred nucleotide analogue or equivalent comprises phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, H-phosphonate, methyl and other alkyl phosphonate including 3'-alkylene phosphonate, 5'-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3'-amino phosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate or boranophosphate.

[0039] In the embodiments herein, the nucleotide analogue or equivalent of the invention may comprise one or more sugar moieties that are mono- or disubstituted at the 2', 3' and / or 5' position such as a -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alky nyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-or N-alkynyl; O-, S-, or N- allyl; O-alkyl-O-alkyl, -methoxy, -aminopropoxy; methoxyethoxy; dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy. The sugar moiety can be a pyranose or derivative thereof, or a deoxypyranose or derivative thereof, preferably ribose or derivative thereof, or deoxyribose or derivative of. A preferred derivatized sugar moiety comprises a Locked Nucleic Acid (LNA), in which the 2'-carbon atom is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. A preferred LNA comprises 2'-O, 4'-C-ethylene-bridged nucleic acid (Morita et al. 2001. Nucleic Acid Res Supplement No. 1 : 241 -242). These substitutions render the nucleotide analogue or equivalent RNase H and nuclease resistant and increase the affinity for the target RNA.

[0040] In the embodiments herein, a nucleotide analogue or equivalent of the invention may comprises one or more base modifications or substitutions. Modified bases comprise synthetic and natural bases such as inosine, xanthine, hypoxanthine and other -aza, deaza, -hydroxy, -halo, -thio, thiol, -alkyl, -alkenyl, -alky nyl, thioalkyl derivatives of pyrimidine and purine bases that are or will be known in the art.

[0041] It is understood by a skilled person that it is not necessary for all positions in an antisense oligonucleotide moiety to be modified uniformly. In addition, more than one of the aforementioned analogues or equivalents may be incorporated in a single antisense oligonucleotide moiety or even at a single position within an antisense oligonucleotide moiety. In the embodiments herein, an antisense oligonucleotide moiety of the invention has at least two different types of analogues or equivalents.

[0042] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an AASS transcript may comprise a phosphorothioate modification in its phosphate backbone.

[0043] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an AASS transcript may comprise a 2'-0 alkyl modified nucleotide, such as a 2'-O-methyl modified ribose, a 2'-O-ethyl modified ribose, a 2'-O-propyl modified ribose, 2-O’-methoxy ethyl ribose and / or substituted derivatives of these modifications such as halogenated derivatives,

[0044] In the embodiments herein, the antisense oligonucleotide moiety may comprise an 8-oxo-Guanine (8-oxoG) modification.

[0045] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an AASS transcript according to the invention may be delivered as such. However, the antisense oligonucleotide moiety for the degradation of an AASS transcript may also be encoded by a viral vector. Typically, this is in the form of an RNA transcript that comprises the sequence of an antisense oligonucleotide moiety according to the invention in a part of the transcript. Accordingly, the invention further provides for a viral vector expressing at least one antisense oligonucleotide moiety for the degradation of an AASS transcript as defined herein when placed under conditions conducive to expression of the molecule.

[0046] Viral vectors as used herein include but are not limited to lentiviral vector systems and adenoviral vector systems.

[0047] A preferred expression system for an antisense oligonucleotide moiety for the degradation of an AASS transcript according to the invention is an adenovirus associated virus (AAV)-basedvector. Single chain and double chain AAV-based vectors have been developed that can be used for prolonged expression of antisense nucleotide sequences for highly efficient degradation of transcripts. A preferred AAV-based vector, for instance, comprises an expression cassette that is driven by an RNA polymerase Ill-promoter (Pol III) or an RNA polymerase II promoter (Pol II). A preferred RNA promoter is, for example, a Pol III U6 RNA promoter, or a Pol II U7 RNA promoter.

[0048] The invention accordingly provides for a viral-based vector, comprising a Pol II or a Pol III promoter driven expression cassette for expression of an antisense oligonucleotide moiety for the degradation of an AASS transcript.

[0049] An AAV vector according to the invention is a recombinant AAV vector and refers to an AAV vector comprising part of an AAV genome comprising an encoded ASO for the degradation of an AASS transcript according to the invention encapsidated in a protein shell of capsid protein derived from an AAV serotype as depicted elsewhere herein. Part of an AAV genome may contain the inverted terminal repeats (ITR) derived from an adeno-associated virus serotype, such as AAV1 , AAV2, AAV3, AAV4, AAV5, AAV8, AAV9 and others. A protein shell comprised of capsid protein may be derived from an AAV serotype such as AAV1 , 2, 3, 4, 5, 8, 9 and others. A protein shell may also be named a capsid protein shell. AAV vector may have one or preferably all wild type AAV genes deleted, but may still comprise functional ITR nucleic acid sequences. Functional ITR sequences are necessary for the replication, rescue and packaging of AAV virions. The ITR sequences may be wild type sequences or may have at least 80%, 85%, 90%, 95, or 100% sequence identity with wild type sequences or may be altered by for example in insertion, mutation, deletion or substitution of nucleotides, as long as they remain functional. In this context, functionality refers to the ability to direct packaging of the genome into the capsid shell and then allow for expression in the host cell to be infected or target cell. In the context of the invention a capsid protein shell may be of a different serotype than the AAV vector genome ITR. An AAV vector according to present the invention may thus be composed of a capsid protein shell, i.e. the icosahedral capsid, which comprises capsid proteins (VP1 , VP2, and / or VP3) of one AAV serotype, e.g. AAV serotype 2, whereas the ITRs sequences contained in that AAV5 vector may be any of the AAV serotypes described above, including an AAV2 vector. An “AAV 2 vector” thus comprises a capsid protein shell of AAV serotype 2, while e.g. an “AAV5 vector” comprises a capsid protein shell of AAV serotype 5, whereby either may encapsidate any AAV vector genome ITR according to the invention.

[0050] Preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2, 5, 8 or AAV serotype 9 wherein the AAV genome or ITRs present in said AAV vector are derived from AAV serotype 2, 5, 8 or AAV serotype 9; such AAV vector is referred to as an AAV2 / 2, AAV 2 / 5, AAV2 / 8, AAV2 / 9, AAV5 / 2, AAV5 / 5, AAV5 / 8, AAV 5 / 9, AAV8 / 2, AAV 8 / 5, AAV8 / 8, AAV8 / 9, AAV9 / 2, AAV9 / 5, AAV9 / 8, or an AAV9 / 9 vector.

[0051] More preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2 and the AAV genome or ITRs present in said vector are derived from AAV serotype 5; such vector is referred to as an AAV 2 / 5 vector.More preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2 and the AAV genome or ITRs present in said vector are derived from AAV serotype 8; such vector is referred to as an AAV 2 / 8 vector.

[0052] More preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2 and the AAV genome or ITRs present in said vector are derived from AAV serotype 9; such vector is referred to as an AAV 2 / 9 vector.

[0053] More preferably, a recombinant AAV vector according to the invention comprises a capsid protein shell of AAV serotype 2 and the AAV genome or ITRs present in said vector are derived from AAV serotype 2; such vector is referred to as an AAV 2 / 2 vector.

[0054] A nucleic acid molecule encoding an ASO according to the invention represented by a nucleic acid sequence of choice is preferably inserted between the AAV genome or ITR sequences as identified above, for example an expression construct comprising an expression regulatory element operably linked to a coding sequence and a 3’ termination sequence.

[0055] “AAV helper functions” generally refers to the corresponding AAV functions required for AAV replication and packaging supplied to the AAV vector in trans. AAV helper functions complement the AAV functions which are missing in the AAV vector, but they lack AAV ITRs (which are provided by the AAV vector genome). AAV helper functions include the two major ORFs of AAV, namely the rep coding region and the cap coding region or functional substantially identical sequences thereof. Rep and Cap regions are well known in the art, see e.g. (Chiorini et al., 1999) or US 5,139,941 , incorporated herein by reference. The AAV helper functions can be supplied on an AAV helper construct, which may be a plasmid. Introduction of the helper construct into the host cell can occur e.g. by transformation, transfection, or transduction prior to or concurrently with the introduction of the AAV genome present in the AAV vector as identified herein. The AAV helper constructs according to the invention may thus be chosen such that they produce the desired combination of serotypes for the AAV vector’s capsid protein shell on the one hand and for the AAV genome present in said AAV vector replication and packaging on the other hand.

[0056] “AAV helper virus” provides additional functions required for AAV replication and packaging. Suitable AAV helper viruses include adenoviruses, herpes simplex viruses (such as HSV types 1 and 2) and vaccinia viruses. The additional functions provided by the helper virus can also be introduced into the host cell via vectors, as described in US 6,531 ,456 incorporated herein by reference.

[0057] Preferably, an AAV genome as present in a recombinant AAV vector according to the invention does not comprise any nucleotide sequences encoding viral proteins, such as the rep (replication) or cap (capsid) genes of AAV. An AAV genome may further comprise a marker or reporter gene, such as a gene for example encoding an antibiotic resistance gene, a fluorescent protein (e.g. gfp) or a gene encoding a chemically, enzymatically or otherwise detectable and / or selectable product (e.g. lacZ, aph, etc.) known in the art.

[0058] Improvements in means for providing an individual or a cell, tissue, organ of said individual with an antisense oligonucleotide moiety for the degradation of an AASS transcript according to the invention, are anticipated considering the progress that has already thus far been achieved. Suchfuture improvements may of course be incorporated to achieve the mentioned effect on restructuring of mRNA using a method according to the invention.

[0059] In the embodiments herein, the antisense oligonucleotide moiety may be delivered naked to the brain. In the embodiments herein, the antisense oligonucleotide moiety may be intrathecally delivered naked to the brain. Alternatively, a preferred delivery method for an antisense oligonucleotide moiety or a plasmid for antisense oligonucleotide moiety expression is a viral vector, nanoparticles or virus-like particles. Preferably, viral vectors, nanoparticles or virus-like particles are delivered to the brain or the liver. In the embodiments herein, the antisense oligonucleotide moiety may be conjugated to GalNAc for delivery to the liver.

[0060] In the embodiments herein, the antisense oligonucleotide moiety, viral vectors or nanoparticles may be administered systemically to the liver. In the embodiments herein, the antisense oligonucleotide moiety, viral vectors or nanoparticles as described herein may be delivered intrathecally and / or intraventricularly.

[0061] Alternatively, a plasmid can be delivered by transfection using known transfection agents. For intrathecal and / or intraventricular administration it is preferred that the solution comprising the antisense oligonucleotide moiety is a physiological salt solution. Particularly preferred in the invention is the use of an excipient or transfection agents that will aid in delivery of each of the constituents as defined herein to a cell and / or into a cell, preferably a brain cell. Preferred are excipients or transfection agents capable of forming complexes, nanoparticles, micelles, vesicles and / or liposomes that deliver each constituent as defined herein, complexed or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art. Suitable excipients or transfection agents comprise polyethylenimine (PEI; ExGen500 (MBI Fermentas)), LipofectAMINE™ 2000 (Invitrogen) or derivatives thereof, or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, synthetic amphiphils (SAINT-18), lipofectinTM, DOTAP and / or viral capsid proteins that are capable of self-assembly into particles that can deliver each constituent as defined herein to a cell, preferably a brain cell. Such excipients have been shown to efficiently deliver an antisense oligonucleotide moiety such as antisense nucleic acids to a wide variety of cultured cells. Their high transfection potential is combined with an excepted low to moderate toxicity in terms of overall cell survival. The ease of structural modification can be used to allow further modifications and the analysis of their further ( / n vivo) nucleic acid transfer characteristics and toxicity.

[0062] Lipofectin represents an example of a liposomal transfection agent. It consists of two lipid components, a cationic lipid N-[1-(2,3 dioleoyloxy)propyl]-N, N, N- trimethylammonium chloride (DOTMA) (cp. DOTAP which is the methylsulfate salt) and a neutral lipid dioleoylphosphatidylethanolamine (DOPE). The neutral component mediates the intracellular release. Another group of delivery systems are polymeric nanoparticles.

[0063] Polycations such as diethylaminoethylaminoethyl (DEAE)-dextran, which are well known as DNA transfection reagent can be combined with butylcyanoacrylate (PBCA) and hexylcyanoacrylate (PHCA) to formulate cationic nanoparticles that can deliver each constituent as defined herein, preferably an antisense oligonucleotide moiety, across cell membranes into cells.In addition to these common nanoparticle materials, the cationic peptide protamine offers an alternative approach to formulate an antisense oligonucleotide moiety with colloids. This colloidal nanoparticle system can form so-called proticles, which can be prepared by a simple self-assembly process to package and mediate intracellular release of an antisense oligonucleotide moiety. The skilled person may select and adapt any of the above or other commercially available alternative excipients and delivery systems to package and deliver a molecule for use in the current invention to deliver it for treatment, prevention and / or delay of a lysine metabolism disorder or a condition requiring the degradation of an AASS (pre)mRNA.

[0064] "Treatment, prevention and / or delay of a lysine metabolism disorder or a condition" is herein preferably defined as preventing, halting, ceasing the progression of neurological problems that include epilepsy, dystonia, movement disorders and other neurological abnormalities, caused by mutations in the ALDH7A1 gene (for Pyridoxine dependent epilepsy (PDE)), and by mutations in the GCDH gene (for Glutaric Aciduria type I (GA1)).

[0065] An antisense oligonucleotide moiety can be linked to a moiety that enhances uptake of the antisense oligonucleotide moiety in cells, preferably brain cells and liver cells. Examples of such moieties are cholesterols, carbohydrates, vitamins, biotin, lipids, phospholipids, cell-penetrating peptides including but not limited to antennapedia, TAT, transportan and positively charged amino acids such as oligoarginine, poly-arginine, oligolysine or polylysine, antigen-binding domains such as provided by an antibody, a Fab fragment of an antibody, or a single chain antigen binding domain such as a cameloid single domain antigen-binding domain.

[0066] In addition, the antisense oligonucleotide moiety according to the invention could be covalently or non-covalently linked to a targeting ligand specifically designed to facilitate the uptake into the cell, cytoplasm and / or its nucleus. Such ligand could comprise (i) a compound (including but not limited to peptide(-like) structures) recognizing cell, tissue or organ specific elements facilitating cellular uptake and / or (ii) a chemical compound able to facilitate the uptake in to cells and / or the intracellular release of an antisense oligonucleotide moiety from vesicles, e.g. endosomes or lysosomes.

[0067] Therefore, in the embodiments herein, the antisense oligonucleotide moieties for the degradation of an AASS transcript according to the invention is formulated in a composition or a medicament, which is provided with at least an excipient and / or a targeting ligand for delivery and / or a delivery device thereof to a cell and / or enhancing its intracellular delivery.

[0068] It is to be understood that if a composition comprises an additional constituent such as an adjunct compound as later defined herein, each constituent of the composition may not be formulated in one single combination or composition or preparation. Depending on their identity, the skilled person will know which type of formulation is the most appropriate for each constituent as defined herein. In the embodiments herein, the invention provides a composition or a preparation which is in the form of a kit of parts comprising the molecule for the degradation of an AASS transcript according to the invention and a further adjunct compound as later defined herein.If required, the antisense oligonucleotide moieties for the degradation of an AASS transcript according to the invention or the vector, preferably viral vector of the invention, can be incorporated into a pharmaceutically active mixture by adding a pharmaceutically acceptable carrier.

[0069] Accordingly, the invention also provides for a composition, preferably a pharmaceutical composition, comprising the antisense oligonucleotide moiety for the degradation of an AASS transcript according to the invention, and a pharmaceutically acceptable excipient. Such a pharmaceutical composition may comprise any pharmaceutically acceptable excipient, including a carrier, filler, preservative, adjuvant, solubilizer and / or diluent. Such pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer and / or diluent may for instance be found in Remington, 2000. Each feature of said composition has earlier been defined herein.

[0070] In the embodiments herein, the pharmaceutical composition may be administered to the brain. In the embodiments herein, the pharmaceutical composition as described herein may be administered intrathecally and / or intraventricularly. A preferred delivery method for the pharmaceutical composition as described herein is a viral vector or nanoparticles.

[0071] Concentration or dose defined herein may refer to the total concentration or dose of all antisense oligonucleotide moieties used or the concentration or dose of each molecule for the degradation of an AASS transcript used or added. Therefore, there is provided a composition wherein each or the total amount of antisense oligonucleotide moieties according to the invention used is dosed in an amount ranged from 0.01 to 50 mg / kg, preferably from 0.05 to 50 mg / kg. A suitable intrathecal and / or intraventricular dose would be between 0.05 mg / kg and 30 mg / kg. In the embodiments herein, the total amount of antisense oligonucleotide moieties according to the invention may range from 5 to 150 mg per dose, preferably from 10 to 120 mg per dose.

[0072] Preferably, the antisense oligonucleotide moieties for the degradation of an AASS transcript according to the invention, the vector as described herein and the pharmaceutical composition as described herein is for use in the treatment, prevention and / or delay of a lysine metabolism disorder or a condition of an individual. In the embodiments herein, the term "treatment" is understood to include the prevention and / or delay of a lysine metabolism disorder or a condition. An individual, which may be treated using an antisense oligonucleotide moieties for the degradation of an AASS transcript according to the invention, the vector as described herein and the pharmaceutical composition as described herein may already have been diagnosed as having a lysine metabolism disorder or a condition.

[0073] Alternatively, an individual which may be treated using the set of antisense oligonucleotide moieties for the degradation of an AASS transcript according to the invention may not have yet been diagnosed as having a lysine metabolism disorder or a condition but may be an individual having an increased risk of developing a lysine metabolism disorder or a condition in the future given his or her genetic background. A preferred individual is a human being. In the embodiments herein the lysine metabolism disorder or a condition preferably is Pyridoxine dependent epilepsy (PDE) and / or Glutaric Aciduria type I (GA1).

[0074] In the embodiments herein, the antisense oligonucleotide moiety for the degradation of an AASS transcript or the pharmaceutical composition may be for use as a medicament. In theembodiments herein, the antisense oligonucleotide moiety for the degradation of an AASS transcript or the pharmaceutical composition may be for use as a medicament for the treatment, prevention and / or delay of a lysine metabolism disorder or a condition requiring the degradation of an AASS (pre)mRNA.

[0075] The invention further provides for a use of the antisense oligonucleotide moiety for the degradation of an AASS transcript or the pharmaceutical composition, for the treatment, prevention and / or delay of a lysine metabolism disorder or a condition requiring the degradation of an AASS (pre)mRNA.

[0076] The invention further provides for the use of the antisense oligonucleotide moiety for the degradation of an AASS transcript or the pharmaceutical composition according to the invention, for the preparation of a medicament.

[0077] In the embodiments herein, the invention further provides for the use of the antisense oligonucleotide moiety for the degradation of an AASS transcript or the pharmaceutical composition according to the invention, for the preparation of a medicament for treatment, prevention and / or delay of a lysine metabolism disorder or a condition.

[0078] The invention further provides for a method of treatment of a lysine metabolism disorder or condition requiring the degradation of an AASS (pre)mRNA in a subject in need thereof, comprising administration of an antisense oligonucleotide moiety for the degradation of an AASS transcript as defined above or administration of the pharmaceutical composition as defined herein.

[0079] The invention further provides for a method for the degradation of an AASS transcript in a cell, the method comprising contacting the cell with an antisense oligonucleotide moiety for the degradation of an AASS transcript as defined above or the pharmaceutical composition as defined above. The features of this embodiment are preferably those defined earlier herein. Contacting the cell, preferably a brain cell with the oligonucleotide moiety according to the invention, or a composition according to the invention may be performed by any method known by the person skilled in the art. Use of the methods for delivery of molecules, viral vectors and compositions described herein is included. Contacting may be directly or indirectly and may be in vivo, ex vivo or in vitro.

[0080] Treatment in a use or in a method according to the invention may be at least once, lasts one week, one month, several months, one year, 2, 3, 4, 5, 6 years or longer, such as lifelong. The antisense oligonucleotide moiety for the degradation of an AASS transcript or equivalent thereof as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and / or an organ in vivo of individuals already affected or at risk of developing a lysine metabolism disorder or a condition, and may be administered directly in vivo, ex vivo or in vitro. The frequency of administration of an oligonucleotide, composition, compound or adjunct compound of the invention may depend on several parameters such as the severity of the disease, the age of the patient, the mutation of the patient, the number of antisense oligonucleotides (i.e. dose), the formulation of antisense oligonucleotides, the route of administration and so forth. The frequency may vary between daily, weekly, at least once in two weeks, or three weeks or four weeks or five weeks or a longer time period.Dose ranges of an antisense oligonucleotide moiety according to the invention are preferably designed on the basis of rising dose studies in clinical trials ( / n vivo use) for which rigorous protocol requirements exist. An antisense oligonucleotide moiety as defined herein, may be used at a dose which is ranged from 0.01 to 150 mg, preferably from 0.5 and 50 mg. A suitable intrathecal or intraventricular dose would be between 5 mg and 50 mg, preferably between 5 mg and 20 mg. For systemic delivery, an antisense oligonucleotide moiety as defined herein, may be used at a dose which is ranged from 0.01 mg / kg and 150 mg / kg, preferably from 1 mg / kg and 50 mg / kg.

[0081] In the embodiments herein, the concentration used of an antisense oligonucleotide moiety as defined herein, may be ranged from 0.1 nM and 10 pM. More preferably, the concentration used is ranged from 0.01 pM and 1 pM. If several antisense oligonucleotide moieties are used, this concentration or dose may refer to the total concentration or dose of antisense oligonucleotide moieties or the concentration or dose of each antisense oligonucleotide moiety added.

[0082] In the embodiments herein, a viral vector, preferably an AAV vector as described earlier herein, as delivery vehicle for an antisense oligonucleotide moiety according to the invention, may be administered in a dose ranging from 1x108— 1x1017virus particles per injection, more preferably from 1x109— 1x1012virus particles per injection.

[0083] The ranges of concentration or dose of antisense oligonucleotide moiety (or moieties) as given above are preferred concentrations or doses for in vivo, in vitro or ex vivo uses. The skilled person will understand that depending on the antisense oligonucleotide moiety (or moieties) used, the target cell to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration or dose of antisense oligonucleotide moiety (or moieties) used may further vary and may need to be optimized any further.

[0084] "Sequence identity" is herein defined as a relationship between two or more amino acid (peptide, polypeptide, or protein) sequences or two or more nucleic acid (nucleotide, polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleotide sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one peptide or polypeptide to the sequence of a second peptide or polypeptide. In a preferred embodiment, identity or similarity is calculated over the whole SEQ ID NO as identified herein. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 ; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988).

[0085] Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly availablecomputer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the GCG program package (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Mol. Biol. 215:403-410 (1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, MD 20894; Altschul, S„ et al., J. Mol. Biol. 215:403-410 (1990). The well-known Smith Waterman algorithm may also be used to determine identity.

[0086] Preferred parameters for polypeptide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: BLOSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992); Gap Penalty: 12; and Gap Length Penalty: 4. A program useful with these parameters is publicly available as the "Ogap" program from Genetics Computer Group, located in Madison, WL The aforementioned parameters are the default parameters for amino acid comparisons (along with no penalty for end gaps).

[0087] Preferred parameters for nucleic acid comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: matches=+10, mismatch=0; Gap Penalty: 50; Gap Length Penalty: 3. Available as the Gap program from Genetics Computer Group, located in Madison, Wis. Given above are the default parameters for nucleic acid comparisons.

[0088] A “nucleic acid molecule” or “polynucleotide” (the terms are used interchangeably herein) is represented by a nucleotide sequence. A “polypeptide” is represented by an amino acid sequence. A “nucleic acid construct” is defined as a nucleic acid molecule which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acids which are combined or juxtaposed in a manner which would not otherwise exist in nature. A nucleic acid molecule is represented by a nucleotide sequence.

[0089] The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors.

[0090] In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, the verb “to consist” may be replaced by “to consist essentially of’ meaning that a product or a composition or a nucleic acid molecule or a peptide or polypeptide of a nucleic acid construct or vector or cell as defined herein may comprise additional component(s) than the ones specifically identified; said additional component(s) not altering the unique characteristic of the invention. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one". The word “about” or “approximately” when used in association with a numerical value (e.g. about 10) preferably means that the value may be the given value (of 10) more or less 10% of the value.All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

[0091] Unless otherwise indicated each embodiment as described herein may be combined with another embodiment as described herein.

[0092] The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

[0093] Description of the sequences

[0094] Table 1: Sequences

[0095] SEQ Description Sequence (5’to 3’)

[0096] ID NO:

[0097] 1 Genomic AASS sequence: 7 See sequence listing

[0098] dna:chromosome

[0099] chromoso me:GRCh38:7:1220

[0100] 73549:122144249:-1

[0101] 2 Exonic AASS sequence: See sequence listing

[0102] ENST00000417368.7 AASS- 203 cdna:protein_coding

[0103] 3 Target sequence for ssAONI GT AGT GGCAT T T GGACAGT GGGCT GGT GT GGCAGGT AAG + / - 20 nucleotides TAT GC CAGGGCT T ACAT GA

[0104] 4 Target sequence for ssAONI T T GGACAGT GGGCT GGT GT GGCAGGT AAGT AT GC CAGG + / - 10 nucleotides

[0105] 5 Target sequence for ssAONI CAGT GGGCT GGT GT GGCAGGT AAGT AT G

[0106] + / - 5 nucleotides

[0107] 6 Target sequence for ssAONI GGCT GGT GT GGCAGGT AA

[0108] 7 Target sequence for ssAON2 GT T T AAGGCT C CT T GCT T T GGGACAT CACACAC CT T T TA + / - 20 nucleotides T GGT AAGAGAT GT T TAT T T T GCT

[0109] 8 Target sequence for ssAON2 CCTTGCTTT GGGACAT CACACAC CT T T TAT GGT AAGAGA + / - 10 nucleotides TGT

[0110] 9 Target sequence for ssAON2 CT T T GGGACAT CACACAC CT T T TAT GGT AAGA

[0111] + / - 5 nucleotides

[0112] 10 Target sequence for ssAON2 GGACAT CACACAC CT T T TAT GG

[0113] 11 Target sequence for ssAON3 T GGCAT T T GGACAGT GGGCT GGT GT GGCAGGT AAGT AT G + / - 20 nucleotides C CAGGGCT T ACAT CAC C CAC

[0114]

[0115] Target sequence for ssAON3 ACAGT GGGCT GGT GT GGCAGGT AAGT AT GC CAGGGCT T A + / - 10 nucleotides

[0116] Target sequence for ssAON3 GGGCT GGT GT GGCAGGT AAGT AT GC CAGG

[0117] + / - 5 nucleotides

[0118] Target sequence for ssAON3 GGT GT GGCAGGT AAGT AT G

[0119] Target sequence for ssAON4 CAT T T T ACAT GGAAT GGGT T T AAGGCT C CT T GCT T T GG + / - 20 nucleotides GAC AT C AC AC AC C T T T T AT G

[0120] Target sequence for ssAON4 GGAAT GGGT T T AAGGCT C CT T GCT T T GGGACAT CACAC + / - 10 nucleotides

[0121] Target sequence for ssAON4 GGGTTTAAGGCTCCTTGCTTTGGGACAT

[0122] + / - 5 nucleotides

[0123] Target sequence for ssAON4 TAAGGCTCCTTGCTTTGG

[0124] Target sequence for ssAON5 T T ACAT GGAAT GGGT T T AAGGCT C CT T GCT T T GGGACAT + / - 20 nucleotides CACAC AC C T T T TAT GC AC AT

[0125] Target sequence for ssAON5 T GGGT T T AAGGCT C CT T GCT T T GGGACAT CACACAC CT T + / - 10 nucleotides

[0126] Target sequence for ssAON5 TTAAGGCTCCTTGCTTTGGGACATCACAC

[0127] + / - 5 nucleotides

[0128] Target sequence for ssAON5 GCTCCTTGCTTTGGGACAT

[0129] Target sequence for GAP2 + / - GT T T AAGGCT C CT T GCT T T GGGACAT CACACAC CT T T TA 20 nucleotides T GGT AAGAGAT GT T TAT T T T GCT

[0130] Target sequence for GAP2 + / - CCTTGCTTT GGGACAT CACACAC CT T T TAT GGT AAGAGA 10 nucleotides TGT

[0131] Target sequence for GAP2 + / - CT T T GGGACAT CACACAC CT T T TAT GGT AAGA 5 nucleotides

[0132] Target sequence for GAP2 GGACAT CACACAC CT T T TAT GG

[0133] Target sequence for GAP4 + / - CAT T T T ACAT GGAAT GGGT T T AAGGCT C CT T GCT T T GG 20 nucleotides GAC AT CACAC AC C T T T TAT G

[0134] Target sequence for GAP4 + / - GGAAT GGGT T T AAGGCT C CT T GCT T T GGGACAT CACAC 10 nucleotides

[0135] Target sequence for GAP4 + / - GGGTTTAAGGCTCCTTGCTTTGGGACAT

[0136] 5 nucleotides

[0137] Target sequence for GAP4 TAAGGCTCCTTGCTTTGG

[0138]

[0139] 31 Target sequence for GAP6 + / - AAT T T CAGGACT AT GT CAAAGCT GGT GGCAT T CT T CAGG 20 nucleotides AGGATATTTCTGAAGCTTGTC

[0140] 32 Target sequence for GAP6 + / - CT AT GT CAAAGCT GGT GGCAT T CT T CAGGAGGAT AT T T C 10 nucleotides T

[0141] 33 Target sequence for GAP6 + / - T CAAAGCT GGT GGCAT T CT T CAGGAGGAT A

[0142] 5 nucleotides

[0143] 34 Target sequence for GAP6 GCTGGTGGCATTCTTCAGGA

[0144] 35 Sequence of ssAONI T T AC CT GC CACAC CAGC C

[0145] 36 Sequence of ssAON2 C CAT AAAAGGT GT GT GAT GT C C

[0146] 37 Sequence of ssAON3 CATACTTACCTGCCACACC

[0147] 38 Sequence of ssAON4 C CAAAGCAAGGAGC CT T A

[0148] 39 Sequence of ssAON5 AT GT C C CAAAGCAAGGAGC

[0149] 40 Sequence of GAP2 [ C CAT ] AAAAGGT GT GT GAT [ GT C C ]

[0150] 41 Sequence of GAP4 [ CCA] AAGCAAGGAGCC [ TTA]

[0151] 42 Sequence of GAP6 [TCCT] GAAGAATGCCAC [ CAGC]

[0152]

[0153] Description of the figures

[0154] Figure 1 - General summary of the of the strategy. A) Lysine catabolism pathway. ALDH&A1 and GCDH are enzymes involved in PDE and GA1 , respectively. The general strategy is to inhibit the first step to avoid lysine to enter in the catabolic pathway and produce and accumulate toxic metabolites. For that the AASS enzyme is targeted using antisense technology. B) Representation on how splice-switching antisense oligonucleotides (ASO or AON) work. ASO-mediated skipping of regular exons will lead to an out-of-frame transcript that will be degraded via nonsense-mediated decay (NMD). Thereby, reducing the AASS levels. C) Gapmers bind to the pre-mRNA and mRNA and degrade the transcript by recruiting RNaseH, decreasing the overall expression of AASS.

[0155] Figure 2 - Evaluation of the effect of antisense molecules in control fibroblasts. A) RT-PCR analysis of cells subjected to AON (ssASOs) treatment in the absence (-) or presence (+) of cycloheximide to block nonsense-mediated decay (NMD). B) Evaluation of AASS downregulation using gapmers or ssASOs at different concentrations. Different amplicons were analyzed to check the overall downregulation. ACTB was used as a loading control. C) and D) Effect of the silencing at protein level using two antibodies against AASS (C, out of stock) and an antibody against the long AASS isoform (D) upon treatment with the different antisense molecules. GAPDH was used as loading control.Figure 3 - Effect of gapmers in iPSC-derived astrocytes. A) Western blot analysis in control astrocytes after delivering Gapmer 2 and 6 (also called G1 and G3) 7 days and 14 days postdelivery. B) Dose-response studies either using liposome-based delivery (+Fugene condition) or gymnotic delivery (-Fugene). Effect was measured based on amount of protein detected by western blot. GAPDH was used as loading control.

[0156] Figure 4 - qPCR analysis of AASS down regulation after delivery of gapmers in control (WT), PDE and GA1 fibroblasts. All the lines showed a consistent downregulation of AASS.

[0157] Figure 5 - Rescue of metabolic and cellular phenotypes in PDE astrocytes by the decrease of AASS enzyme. A. Schematic overview of ALDH7A1 KO (KO) hiPSC line and ALDH7A1 / AASS DKO (DKO) hiPSC line, including western blot for AASS, ALDH7A1 and GAPDH proteins. B. Schematic representation of ALDH7A1 deficiency combined with AASS deficiency in the lysine pathway including the corresponding biomarkers. The normalized intensity of P6C, PA and AAA measured via NGMS in KO, DKO and C1 astrocytes is depicted. N = 3 for C1 ; N = 3 for KO; N = 3 for DKO. Statistically significant differences were tested through ordinary one-way ANOVA and Tukey’s multiple comparison test. C. Fold change (FC) of Basal respiration (BR), ATP production (AP), proton leak (PL), maximal respiration (MR), spare capacity (SC) and non-mitochondrial oxygen consumption (NMOC) is depicted for KO, DKO and C1 astrocytes at DIV 35. For BR, AP, PL and NMOC: N = 29 for C1 ; N = 28 for KO; N = 27 for DKO. For MR and CP: N = 14 for C1 ; N = 14 for KO; N = 13 for DKO. Statistically significant differences were tested through unpaired t test or Mann-Whitney test. D. Representative images of 8-Oxo-dG immunostaining (Scale bar = 50 pm) and FC of mean intensity of 8-Oxo-dG per well relative to average intensity of C1 shown for KO, DKO and C1 astrocytes. E. Representative images of 4-HNE immunostaining (Scale bar = 50 pm) and FC of mean intensity of 4-HNE per well relative to average intensity of C1 shown for KO, DKO and C1 astrocytes. For both D. and E., statistically significant differences were tested through Kruskal-Wallis test combined with Dunn’s testing. For all graphs in this figure statistical significance is indicated by: *P < 0.05, **P < 0.01 , ***P < 0.005, ****P < 0.0001. Data presented in this figure were collected in at least 2 independent experiments.

[0158] Figure 6 - Gapmer-mediated rescue of metabolic phenotype and oxygen consumption rate in and PDE P2 astrocytes. All experiments included non-treated control (NT), G3 at 0.5 pM (and 0.05 pM) and a sense oligonucleotide (SonG) control at 0.5 pM. A. Relative expression of the regions exon 4-5 and exon 6-8 of AASS by qPCR in P2 astrocytes seven days upon G3-delivery. Expression of genes was normalized against GUSB. Data represents the percentage of remaining AASS expression relative to the SonG condition. Statistically significant differences were tested through ordinary one-way ANOVA and Dunnett’s multiple comparison test. B. Semi-quantification of AASS protein levels relative to GAPDH and representative western blot of P2 astrocytes seven days upon G3-delivery. Statistically significant differences were tested through ordinary one-way ANOVA and Dunnett’s multiple comparison test. C. Schematic representation of ALDH7A1deficiency combined with G3-mediated AASS downregulation in the lysine pathway including the corresponding biomarkers. The normalized intensity of PA and Fold Change (FC) of normalized P6C and AAA via NGMS for NT, G3 and SonG conditions in P2 astrocytes are depicted. N = 3 for NT; N = 3 for G3; N = 3 for SonG. Statistically significant differences were tested through ordinary one-way ANOVA and Tukey’s multiple comparison test. D. Fold change (FC) of Basal respiration (BR), ATP production (AP), proton leak (PL), maximal respiration (MR), spare capacity (SC) and non-mitochondrial oxygen consumption (NMOC) is depicted for NT, G3 and SonG conditions in P2 astrocytes. Statistically significant differences were tested through unpaired t test or Mann-Whitney test. E. Representative images of 8-Oxo-dG immunostaining (Scale bar = 50 pm) and FC of mean intensity of 8-Oxo-dG per well relative to average intensity of NT shown for NT, G3 and SonG conditions in P2 astrocytes. F. Representative images of 4-HNE immunostaining (Scale bar = 50 pm) and FC of mean intensity of 4-HNE per well relative to average intensity of NT shown for NT, G3 and SonG conditions in P2 astrocytes. For both E. and F., statistically significant differences were tested through Kruskal-Wallis test combined with Dunn’s testing. For all graphs in this figure statistical significance is indicated by: *P < 0.05, **P < 0.01 , ***P < 0.005, ****P < 0.0001. Data presented in this figure were collected in at least 2 independent experiments.

[0159] Figure 7 - Evaluation of gapmers in murine primary cultures of wild-type astrocytes. A) qPCR analysis assessing Aass downregulation and B) the effect at protein level. Tubulin was used as loading control. Gapmer 2, 4 and 6 are also called G1 , G2 and G3 respectively.

[0160] Figure 8 - Evaluation of ssASOs in murine primary cultures of wild-type astrocytes. A) qPCR analysis assessing Aass downregulation and B) the effect at protein level. Tubulin was used as loading control.

[0161] Figure 9 - Cell viability assays for all the molecules screened in mouse cultures. A) analysis of the gapmer molecules (Gapmer 2, 4 and 6 (or G1 , G2 and G3 respectively) were evaluated. B) ssASOs were also evaluated. No toxic effect were observed.

[0162] Further embodiments

[0163] Further embodiments of the invention are set forth here below.

[0164] 1. An antisense oligonucleotide moiety for the degradation of an AASS transcript, wherein the antisense oligonucleotide moiety binds to or is complementary to a polynucleotide part within SEQ ID NO: 1 or SEQ ID NO: 2, said polynucleotide part having a nucleotide sequence selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 34.

[0165] 2. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to embodiment 1 , wherein the antisense oligonucleotide moiety comprises an RNA residue, a DNAresidue, and / or a nucleotide analogue or equivalent, preferably wherein the antisense oligonucleotide moiety comprises both RNA and DNA residues.

[0166] 3. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to embodiment 1 or 2, wherein the antisense oligonucleotide moiety is a gapmer.

[0167] 4. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of the preceding embodiments, wherein the antisense oligonucleotide moiety has a length of from about 8 to about 40 nucleotides, preferably from about 10 to about 40 nucleotides, more preferably from about 14 to about 30 nucleotides, more preferably from about 16 to about 24 nucleotides, such as 16, 17, 18, 19, 20, 21 , 22, 23 or 24 nucleotides.

[0168] 5. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of the preceding embodiments, wherein said antisense oligonucleotide moiety comprises or consists of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 35, 36, 37, 38, 39, 40, 41 , or 42.

[0169] 6. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of the preceding embodiments, comprising a phosphorothioate modification in its phosphate backbone.

[0170] 7. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of the preceding embodiments, comprising a 2'-0 alkyl modified nucleotide, such as a 2'-O-methyl modified ribose, a 2'-O-ethyl modified ribose, a 2'-O-propyl modified ribose, 2-O’-methoxy ethyl ribose and / or substituted derivatives of these modifications such as halogenated derivatives, preferably the antisense oligonucleotides comprise an 8-oxo-Guanine (8-oxoG) modification.

[0171] 8. A pharmaceutical composition comprising an antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of embodiments 1 - 7, and further comprising a pharmaceutically acceptable excipient.

[0172] 9. A pharmaceutical composition according to embodiment 8, wherein the pharmaceutical composition is for administration to the brain or the liver.

[0173] 10. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of embodiments 1 - 7 or the pharmaceutical composition according to embodiment 8 or 9, for use as a medicament, preferably for use as a medicament for treatment, prevention and / or delay of a lysine metabolism disorder or a condition requiring the degradation of an AASS (pre)mRNA.11. Use of the antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of embodiments 1 - 7 or the pharmaceutical composition according to embodiment 8 or 9, for treatment, prevention and / or delay of a lysine metabolism disorder or a condition requiring the degradation of an AASS (pre)mRNA.

[0174] 12. A method of treatment of a lysine metabolism disorder or condition requiring the degradation of an AASS (pre)mRNA in a subject in need thereof, comprising administration of an antisense oligonucleotide moiety for the degradation of an AASS transcript as defined in embodiments 1 - 7 or administration of the pharmaceutical composition according to any one of embodiments 8 or 9.

[0175] 13. A method for the degradation of an AASS transcript in a cell, the method comprising contacting the cell with an antisense oligonucleotide moiety for the degradation of an AASS transcript as defined in embodiments 1 - 7 or with the pharmaceutical composition according to any one of embodiments 8 or 9.

[0176] 14. An antisense oligonucleotide moiety for the degradation of an AASS transcript for the use according to embodiment 10, the use according to embodiment 11 or the method according to embodiment 12 or 13, wherein the lysine metabolism disorder is Pyridoxine dependent epilepsy (PDE) and / or Glutaric Aciduria type I (GA1).

[0177] Examples

[0178] Introduction

[0179] Pyridoxine-dependent epilepsy (PDE) and Glutaric Aciduria type 1 (GA1) are rare neurometabolic disorders of lysine catabolism, caused by pathogenic variants in ALDH7A1 or GCDH, respectively, which represent the first and fifth step of the lysine degradation pathway [1]. Deficiency of the encoded enzymes results in accumulation of neurotoxic metabolites causing debilitating neurological sequelae in patients. The lysine catabolism pathway starts with an enzyme with double function, the alpha-aminoadipic semialdehyde synthase (AASS). This enzyme is encoded by the AASS gene. The AASS gene has two isoforms, one long isoform containing the lysine-ketoglutarate reductase (LKR) domain at the N terminus and the saccharopine dehydrogenase (SDH) domain at the C-terminal part of the protein. The second isoform only encodes for the SDH domain. The LKR function is involved in the first step of the lysine degradation, while the SDH activity is involved in the second step of the pathway [2]. It is believed, that patients carrying pathogenic variants in AASS affecting the LKR part of the gene, do not show any significant clinical phenotypes, suggesting that targeting this domain could be a therapeutic strategy to avoid the entrance of the lysine in the pathway and subsequent accumulation of toxic metabolites in the PDE and GA1 conditions.However, variants in SDH do cause some clinical phenotypes, most probably linked to a toxic effect by the accumulation of saccharopine, the product of the LKR reaction.

[0180] Here, the inventors utilize antisense oligonucleotides to specifically knockdown the long A4SS isoform, and therefore its LKR activity, by either disrupt the reading frame of the transcript using splice-switching ASOs or by activating RNase H using Gapmer ASOs (Figure 1).

[0181] Materials and Methods

[0182] Design Oligonucleotides:

[0183] Splice-switching ASOs were designed following established guidelines [3]. All ss-ASOs were ordered from Eurogentec using the 2’MOE / PS chemical modification. Using the properties of the in silico predictions, 3 gapmers ASOs were designed, two of them following a 4+14+4 (gapmer 2), 3+12+3 (gapmer 4) and 4+12+4 (gapmer 6) with LNA / PS wings. In addition, for gapmer 6, the same molecule was ordered using 2’MOE / PS-modified wings.

[0184] Screening in (patient) fibroblast cells:

[0185] Fibroblasts were cultured in 6-well plates. Particularly, 200,000 cells / well were plated the day before transfection. The corresponding amount of ASOs (from a 100 pM stock resuspended in PBS 1x autoclaved twice) were diluted in Optimem medium (Thermo Scientific) with 1 pl FuGENE® HD Transfection Reagent (Promega) to enhance transfection efficiency. This ASO mix was added in a drop-wise manner to the wells with a final concentration ranging from 0.1 pM to 1 pM depending on the experiment and the type of molecule. The transfected cells were incubated at 37°C, 5% CO2 for either 48 h or 96 h depending on the experiment. In addition, for ss-ASOs cycloheximide (CHX, Sigma) was added at 100 pg / ml for 5 hours to inhibit the nonsense-mediate decay. Subsequently, cells were subjected to RNA isolation and cDNA synthesis for RT-PCR and qPCR analyses, or protein extraction for western blot. ASOs were tested in control and patient-derived fibroblast lines.

[0186] Efficacy evaluation in human iPSC-derived astrocytes:

[0187] Control and patient-derived iPSC lines were differentiated to astrocytes using the protocol described in Schuurmans, I.M.E., et al [4]. Astrocytes were seeded onto 12-well culture plates in AM. The day after, the gapmer or SS-ASO was delivered at two different concentrations (0.05 and 0.5 pM), whereas the SON was delivered only at the highest concentration (0.5 pM). One well was kept untreated in parallel. The gapmer was delivered using FuGENE HD reagent (Promega, Madison, Wl, USA) as previously described [3]. AM was refreshed every two to three days (without the gapmer). Seven days after gapmer delivery the astrocytes were either fixated for oxidative stress assays or collected for RNA analysis or western blot. Gymnotic delivery was also tested showing similar results although suggesting higher amounts of molecule were required.Assessment of compatibility in murine cell lines:

[0188] In order to check the compatibility of the different antisense oligonucleotides in the mouse context, the molecules in several mouse cell lines were tested: imCD3, B16F10 and 661W. Cells were cultured in 12-well or 6-well plates, using 200,000 cells / well and 400,000 cells / well, respectively. The corresponding amount of ASOs (from a 100 pM stock resuspended in PBS 1x autoclaved twice) were diluted in Optimem medium (Thermo Scientific) with 1 pl FuGENE® HD Transfection Reagent (Promega) to enhance transfection efficiency. This ASO mix was added in a drop-wise manner to the wells with a final concentration ranging from 0.1 pM to 1 pM depending on the experiment and the type of molecule. The transfected cells were incubated at 37°C, 5% CO2 for either 48 h or 96 h depending on the experiment. In addition, for ss-ASOs cycloheximide (CHX, Sigma) was added at 100 pg / ml for 5 hours to inhibit the nonsense-mediate decay. Subsequently, cells were subjected to RNA isolation and cDNA synthesis for RT-PCR and qPCR analyses.

[0189] Efficacy evaluation in mouse primary astrocytes:

[0190] To collect primary astrocytes from C57BL / 6J, Aldh7a1+ / + (wild-type), Aldh7a1+I- (heterozygous), and Aldh7a1-I- (knockout) mice on the C57BL / 6J background, forebrains were obtained from postnatal 1-3 mouse pups. Briefly, the meninges were removed carefully, and the remaining forebrain tissue was placed into growth medium (DMEM, 10% FBS, 292 pg / ml L-glutamine, 100 units / ml penicillin, 100 pg / ml streptomycin) and triturated using a 5-ml pipette then passed through a 200 pL pipette tip. Cells of each brain were pelleted, re-suspended in growth medium, transferred into a T150 flask, and cultured at 37oC with 5% CO2 for a duration of 14 days to allow for ex vivo maturation of the mixed glial culture, with the growth medium being replenished every 7 days. Following the 14-day incubation period, adherent postmitotic astrocytes were isolated from the loosely attached microglia, pooled by genotype, and seeded at 1.4e5 cells / ml for subsequent treatment. At day 21 , adherent astrocytes were treated with a growth medium supplemented with antisense oligonucleotides (ASOs) at concentrations ranging from 0.5 to 2 pM. The ASO-containing medium was replenished on day 25. This approach facilitated gymnotic-based delivery of the ASOs to the astrocytes, as no transfection reagents were employed for cellular uptake. Cells were harvested on day 29 for mRNA analysis, and on day 33 for protein and ASO toxicity assessments.

[0191] Readouts:

[0192] Human cell models

[0193] RT-PCR and qPCR:

[0194] Total RNA was extracted from the cells using the NucleoSpin RNA Mini Kit (Macherey-Nagel; MN 740955.250) following the manufacturer's instructions, with the exceptions of omitting p-mercaptoethanol and extending the incubation time with rDNase to 30 min instead of 15 min. Subsequently, the RNA was reverse-transcribed into cDNA utilizing the iScript cDNA Synthesis Kit (Bio-Rad; 1708891). For quantitative PCR (qPCR), GoTaq qPCR Master Mix (Promega; A6002) was used. The qPCR was conducted on the 7500 Fast Real-Time PCR System (Applied Biosystems) with the following cycling conditions: denaturation at 95°C for 2 min, followed by 40cycles of 30 sec at 95°C and 30 sec at 60°C, and a melting curve stage of 15 sec at 95°C, 30 sec at 60°C, and 15 seconds at 95°C. All samples were prepared in triplicate, and outliers were identified if a value deviated by more than 0.5 Ct from the other two values within the technical triplicate. The relative mRNA expression was determined using the 2-AACtmethod, normalized to the housekeeping gene GUSB.

[0195] Western blot:

[0196] To lyse the cells, the medium was aspirated, and the cells were washed with PBS. Subsequently, lysis buffer (composed of RIPA buffer (pH 7.5; 50 mM Tris-HCI (Invitrogen; 15567027), 150 mM NaCI (Sigma-Aldrich; S5886), 1 mM EDTA (Sigma-Aldrich; 03690), and 1% Triton X-100 in PBS), supplemented with protease inhibitors (complete Mini; Roche; 11 ,836,153,001) was added to the cells. Prior to blotting, the protein concentration was determined using Pierce™ BCA protein assay according to the manufacturer’s instructions (Thermo Fisher Scientific; 23,227). Subsequently the samples were loaded with an equal amount of protein (ranging from 5 to 15 pg) onto 4-15% Mini-PROTEAN® TGX Stain-Free™ Protein Gels (Bio-Rad; 4568084) for protein separation through SDS-PAGE (Bio-Rad; 30 min at 200 V). Accordingly, the separated proteins were transferred to nitrocellulose membranes (Bio-Rad, #1704158) using the Trans-Blot Turbo Transfer System (BioRad; 7 min at 25 V and constant 1.3 A). Membranes were blocked in 5% non-fat milk (Santa-Cruz; sc-2325) in TBS (Millipore; 524750-1 EA) / 0.1% tween (Merck; 8.22184.0500) (TBS-T) for 1 h at RT and incubated overnight at 4 "C with the respective primary antibodies diluted in 5% non-fat milk in TBS-T. The following primary antibodies were used: rabbit anti-AASS (1 :1000; Prestige antibodies; HPA020734-100UL), rabbit anti-ALDH7A1 (1 :500; Invitrogen; PA5-54750), rabbit anti-GAPDH (1 :2000; Cell Signaling Technology, 2118). Horseradish peroxidase-conjugated goat anti-rabbit antibodies (1 :50,000; Invitrogen, G21234) were used for visualization.

[0197] Metabolomics:

[0198] To measure the PDE biomarkers within the astrocytes, cells were prepared by dissociation using TrypLE, plated onto 12-well plates (Corning) and cultured in AM at 37 °C / 5% CO2. One day prior harvesting, AM was fully refreshed. Biological triplicates of each sample were prepared for nextgeneration metabolic screening (NGMS) analysis according to a previously described protocol{van Scherpenzeel, 2022 #4}. Briefly, the astrocytes were washed twice with RT sample buffer, consisting of ammonium carbonate (75 mM) diluted in MilliQ and adjusted pH of 7.2- 7.4 using acetic acid. Immediately upon washing with sample buffer, the cells were frozen in liquid nitrogen on the culture plates. Metabolite extraction from the frozen cells was done by 2 min incubation with 250 pL cold extraction buffer (2:2:1 (v / v / v) methanol:acetonitrile:MilliQ) followed by another 3 min incubation with new extraction buffer. The two extracts were pooled and centrifuged at 14,000 x g for 3 min at 4 °C. Accordingly, the supernatant was dried using a vacuum centrifuge (SpeedVac) and the samples were stored at -80 °C until further use. Metabolites were reconstituted in 80 pL MilliQ / 0.1% HCOOH and analyzed using an ultra-high-performance liquid chromatographyquadrupole time of flight mass spectrometry (UHPLC-QTOF-MS50). Analyses were performed usingan Agilent 1290 UHPLC system coupled to an Agilent 6545 QTOF mass spectrometer, equipped with a dual electrospray ionization (ESI) source. Each sample was run in duplicate in both negative and positive ionization modes. Two microliters of extracted metabolite sample were injected onto an Acquity HSS T3 (C18, 2.1 x 100 mm, 1.8 pm) column (Waters) operating at 40 °C. Each analytical batch included astrocyte samples, analytical quality control (QC) samples and a pooled sample of all astrocyte samples to check for integrity of the automated data analysis pipeline. The biological triplicates of all samples were measured in duplicate. To correct for possible run-order influence on signal intensities, the technical duplicates were analyzed in antiparallel run order. In addition, eight random astrocytes samples were injected at the start of each analytical batch to condition the analytical platform.

[0199] The output files of the NGMS runs were aligned using the open access software package XCMS (online version 3.7.1 / 2.7.2, XCMS version 1.47.3; https: / / xcmsonline.scripps.edu) in single-job modus51. All integrated peaks were checked manually for correct peak integration and detection. Relative peak area was extracted and accordingly normalized using the house-keeping metabolite phenylalanine.

[0200] Oxidative stress:

[0201] To measure oxidative stress in astrocytes, immunostainings for both 8-Hydroxy-2'-deoxyguanosine (8-Oxo-dG) and 4-Hydroxynonenal (4-HNE) were performed. 8-Oxo-dG is an oxidized derivative of deoxyguanosine, one of the major products of DNA oxidation and therefore considered a measure for oxidative stress58. 4-HNE is an a,p-unsaturated hydroxyalkenal that is produced during LPO in cells. Increased 4-HNE is therefore also associated with increased oxidative stress59. For both assays the astrocytes were plated either onto glass coverslips or on 96-well culture plates. For baseline characterization the cells were fixed at 70-95% confluency, around 3-4 days after seeding. The AON-treated astrocytes were fixated seven days after AON-delivery. Immunostainings for 8-Oxo-dG and 4-HNE were performed as described previously.

[0202] It was imaged at a 20x magnification using the Zeiss Axio Imager Z1. To compare signal intensities between different experimental conditions, all conditions within a batch were acquired with the same settings. Fluorescent signals were quantified using FIJI software. For baseline characterization of the astrocytes, the mean intensity of the 8-Oxo-dG and 4-HNE signal was used, considering the unequally divided signal throughout the cells as well as the varying cell sizes within samples. Since the AON-treated astrocytes were cultured longer and therefore more compact and confluent, the 8-Oxo-dG and 4-HNE signal were distributed more equally, and therefore the integrated density of these markers was used for analysis.

[0203] Seahorse:

[0204] OCR was assessed using the Agilent Seahorse XF Cell Mito Stress Test Kit (Seahorse Bioscience). Astrocytes were seeded at a density of 8,000 cells per well for baseline experiments and 4,000 cells per well for gapmer experiments, in AM supplemented with Primocin and RevitaCellTM at 37 °C / 5% CO2. The day after plating, AM supplemented with Primocin was fully refreshed to withdrawRevitaCellTM from the medium. One hour before the assay, AM was replaced with Agilent Seahorse XF Base Medium supplemented with 10 mM glucose, 1 mM sodium pyruvate and 200 mM L-glutamine, and the cells were incubated at 37 °C without CO2. During the recording, basal oxygen consumption was measured four times, followed by three measurements after each addition of 1 pM oligomycin A, 1 to 4 pM carbonyl cyanide 4-trifluoromethoxy phenylhydrazone (FCCP), 0.5 pM rotenone and 0.5 pM antimycin A. Each measurement cycle consisted of 3 min of mixing, 3 min of waiting, and 3 min of measuring. The OCR values were normalized for protein concentration to account for differences in cell number and cell size. To determine the protein concentration for each well, the Pierce™ BCA protein assay was used according to the manufacturer’s instructions (Thermo Scientific 23225). The most optimal FCCP concentration (e.g. maximal respiration) was determined for each line and used for further analysis.

[0205] Mouse cell models

[0206] RNA analysis:

[0207] Primary astrocytes were lysed, and RNA was extracted using PureLink® RNA Mini Kit (Invitrogen, 12183025). Briefly, cells were in-well lysed using RNA Lysis Buffer supplemented with 1% betamercaptoethanol. To isolate RNA, lysed cells were processed through a silica-based spin cartridge and passed through high concentrations of guanidinium thiocyanate- and ethanol-based washes. RNA samples eluted in water were then assessed for overall quantity and purity using NanoDrop 2000.

[0208] Following RNA concentration determination, cDNA was synthesized from isolated RNA samples using SuperScript™ VILO™ cDNA Synthesis Kit (Invitrogen, 11754050). Synthesized cDNA was used to evaluate relative quantity of Aass RNA using primers designed in Primer3Plus (Table 1). Beta-actin and Casein kinase II alpha 2 (Csnk2a2) primers were used to generate normalization factors. Real-time fluorescence of Fast SYBR™ Green (Applied Biosystems, 4385612)-bound transcripts was relatively quantified against a standard curve using Quantstudio 5 Real Time PCR System.

[0209] Protein analysis:

[0210] Primary astrocytes were lysed using in-house-prepared Radioimmunoprecipitation assay (RIPA) lysis buffer (50 mM Tris, pH 7.5, 150 mM Sodium Chloride 1% Triton-X, 1% Sodium Deoxycholate, 0.1% Sodium Dodecyl Sulfate, 1% Ethylenediamine tetraacetic acid), supplemented with protease and phosphatase inhibitors. Overall protein content was measured using Bicinchoninic Acid Kit (Sigma, bca1), then, 20 ug of total protein was prepared with Novex™ Tris-Glycine SDS Sample Buffer (Invitrogen, LC2676), 10X Bolt Sample Reducing Agent (Invitrogen, B0009), and heat, then loaded and ran on NovexTM WedgeWell 4-20% Tris-Glycine gels. Proteins were then transferred to polyvinylidene difluoride (PVDF) membranes overnight, blocked with 5% milk in tris-buffered saline with Tween (TBS-T), and incubated with primary and secondary antibodies (Table 2). Blotted membranes were then imaged using LI-COR Odyssey Infrared Imaging System.Cellular Viability Assay:

[0211] Cellular viability of treated and untreated cells plated in 96-well plates was determined using a luciferase-based CellTiter-Glo® Luminescent Cell Viability Assay (Promega, G7570). Luminescent signal produced by luciferase is proportional to the amount of ATP produced by viable cells in each well.

[0212] Results and discussion

[0213] The different molecules were tested in control fibroblasts at RNA level and protein level. Three different ssASO (2, 4, and 5) showed clear splicing modulation. All gapmers also showed decrease of AASS, being gapmer 2 and 6 (also called G1 and G3) the best ones. Different concentrations and times were tested to validate that both ssASOs and gapmers decreased the AASS protein (Figure 2).

[0214] Subsequently, a more relevant model was utilized: iPSC-derived astrocytes. In this case, the authors were able to silence AASS and that silencing was obvious up to 14 days post-delivery. The authors chose 7 days as the end point of our experiments in astrocytes. The authors also performed a dose-response experiment using gymnotic and liposomal delivery. Interestingly, gymnotic delivery showed a relatively clear dose-response in which higher concentration were causing a higher reduction of AASS protein (Figure 3).

[0215] Lastly, the authors tested the two gapmers in patient-derived fibroblasts. In general all amplicons analyzed for all the lines showed a clear decrease in expression (Figure 4).

[0216] Considering that the accumulation of the toxic lysine derivatives in PDE are causative for the neurologic phenotype, therapeutic strategies for PDE should aim to reduce this accumulation by blocking the entrance of lysine into the catabolic pathway. It has been observed that increased lysine levels due to deficiency in the first step of the lysine pathway catalyzed by AASS do not caused any relevant clinical phenotype

[0010] . Therefore, the authors considered AASS a potential target for therapeutic inhibition to reduce the accumulation of toxic lysine derivatives in PDE and GA1. To test this hypothesis, the authors generated a double knock-out (DKO) hiPSC line for ALDH7A1 and AASS (ALDH7A1 / AASS DKO) by targeting AASS through CRISPR / Cas9 genome editing in the ALDH7A1 KO hiPSC line. Western blotting of the ALDH7A1 KO hiPSC line and ALDH7A1 / AASS DKO hiPSC line confirmed full knock-out of ALDH7A1 in both lines, and around 95% reduction of AASS levels in the ALDH7A1 / AASS DKO hiPSC line compared to controls. Notably, the authors observed that AASS levels were already reduced by approximately 50% in the ALDH7A1 KO hiPSC line compared to control (C1), suggesting that cells might already downregulate AASS as homeostatic response to loss of ALDH7A1 (Figure 5A). The ALDH7A1 KO, ALDH7A1 / AASS DKO and C1 lines were differentiated towards astrocytes, all showing expression of the astrocyte markers. To investigate whether targeting AASS in ALDH7A1 KO astrocytes could rescue the metabolic phenotype, the authors measured the PDE biomarkers under basal conditions using NGMS. As expected, AAA levels remained low in the ALDH7A1 / AASS DKO astrocytes compared to the control and similar ALDH7A1 KO astrocytes. The authors observed that P6C and PA were significantly decreased in the ALDH7A 1 / AASS DKO astrocytes compared to the ALDH7A 1KO astrocytes. However, both biomarkers were still significantly increased in the ALDH7A1 / AASS DKO astrocytes when compared to C1 , demonstrating a partial metabolic rescue. These findings suggest that targeting AASS in ALDH7A 1 KO astrocytes partially rescues the metabolic phenotype by significantly reducing P6C and PA levels, although not normalized to control levels (Figure 5B). The authors next assessed whether this partial metabolic restoration was sufficient to rescue the increased oxidative stress levels in ALDH7A1 KO astrocytes. Using 8-Oxo-dG immunostaining, the authors observed a significant decrease of 8-Oxo-dG in the ALDH7A1 / AASS DKO astrocytes compared to the ALDH7A1 KO astrocytes (Figure 5C). The authors also observed a significant decrease of 4-HNE in the ALDH7A1 / AASS DKO astrocytes compared to the ALDH7A1 KO astrocytes, suggesting a reduced oxidative stress response upon targeting of AASS in ALDH7A1 KO astrocytes (Figure 5D). Finally, the authors investigated if AASS inhibition could also restore the increased OCR observed in the ALDH7A1 KO astrocytes. The authors observed that the proton leak and non-mitochondrial oxygen consumption were fully restored in the ALDH7A 1 / AASS DKO. In addition, the authors observed a decrease in basal respiration, ATP production, maximal respiration and spare capacity for the ALDH7A1 / AASS DKO astrocytes compared to the ALDH7A1 KO astrocytes, but these differences did not reach statistical significance. Altogether, these findings indicate that by targeting AASS in PDE astrocytes both the metabolic phenotype as well as cellular phenotypes, defined by increased oxidative stress and OCR, can be ameliorated (Figure 5E).

[0217] ASO-mediated downregulation of AASS can partially rescue metabolic and cellular phenotypes in PDE patient astrocytes

[0218] To recreate a situation comparable to PDE-affected individuals, in which AASS is present during development and therefore can only be targeted after development, the authors designed an alternative strategy in which the authors partially reduced AASS levels using antisense technology. Two distinct ASO strategies, splice-switching ASOs (ssASOs) and gapmers, were employed to target and promote the degradation of AASS transcripts. ssASOs were designed to target a splice site (enhancer) to promote exon skipping, resulting in an out-of-frame transcript and subsequently degraded by nonsense-mediated decay. In contrast, gapmers contain a DNA core sequence flanked by RNA wings that binds to the pre- and mRNA to degrade the transcript through RNase H recruitment. Our ASOs were designed to target the region encoding for the LKR domain of AASS (the large AASS isoform) leaving the SDH domain (shortest isoform) intact. The authors specially aimed to target the LKR AASS activity, as the accumulation of saccharopine (the product generated by the SDH activity) has been shown to be neurotoxic, while the accumulation of lysine seems to be safe

[0011] .

[0219] As indicated previously, the authors designed three ssASOs (S1 , S2 and S3) and three gapmers (G1 , G2 and G3) (Supplementary Fig. 5b). To evaluate their efficiency to downregulate AASS, wildtype fibroblasts were transfected with liposomes including the ssASOs (0.5 or 1.0 pM), gapmers (0.2 or 0.5 pM) or the respective negative sense control (Son) corresponding to the ssASOs (SonS; at 1.0 pM) or gapmers (SonG; at 0.5 pM). Four days post-delivery AASS downregulation was assessed at RNA level through RT-qPCR and protein level by western blot as shown previously.For the RT-qPCR, amplicons spanning the region between exons 4-5 and exons 6-8 of the AASS transcript were amplified, as these exons are unique to the large AASS isoform and specifically encode the LKR domain. Although the authors observed efficient exon skipping upon transfection with the ssASOs, this did not result in degradation of the AASS transcript. The authors therefore excluded the ssASOs from following experiments. Transfection with the gapmers resulted in approximately 50-80% downregulation of AASS levels relative to non-treated (NT) control. The authors selected G3 for further validation in astrocytes. Accordingly, four to five week old C1 astrocytes were transfected for seven days with G3 using liposomes at concentrations ranging from 0.05 - 0.5 pM. The authors observed approximately 50% remaining AASS expression with RT-qPCR and around 10% remaining AASS levels with western blotting upon G3 delivery at 0.5 pM in C1 astrocytes. Finally, at 0.5 pM G3 resulted in significant reduction of AASS expression relative to NT in both the ALDH7A1 KO and PDE patient astrocytes, ranging from 70-50% downregulation. In ALDH7A1 KO and P3 astrocytes G3 also resulted in significant downregulation at 0.05 pM. AASS downregulation of G3 in P2 astrocytes showed -50% reduction of AASS levels (Figure 6A and 6B). The authors then assessed whether 50% downregulation of AASS in PDE patients could mitigate the metabolic and cellular phenotypes. As the metabolic and OCR parameters were most severely affected in the P2 astrocytes, the authors used this patient line for the functional validations. The metabolic phenotype was assessed using NGMS seven days upon G3-delivery (0.5 pM) including NT and SonG control. As expected, AAA levels remained low in the P2 astrocytes compared to C1 (as indicated by the dotted line). Notably, P6C levels were significantly lower in the G3-treated condition compared to the SonG and almost normalized to C1 levels. Although PA levels were also significantly lower in the G3-treated condition compared to SonG, it was not fully normalized to C1 levels. The authors next evaluated oxidative stress levels following treatment with G3 (0.5 pM) for seven days (Figure 6C). Consistent with previous findings, immunostaining for 8-Oxo-dG and 4-HNE did not reveal increased levels of these markers compared to C1 , and no significant difference was observed between the G3 and control conditions (Figure 6D and 6E). This indicates that when no baseline differences are present, AASS inhibition does not seem to affect oxidative stress levels. However, increased levels of 8-Oxo-dG and 4-HNE in P1 and P3 were also not significantly reduced upon G3 treatment. Lastly, the authors evaluated the ability of G3 (0.5 pM) to reduce the OCR in P2 astrocytes. The authors observed that the basal respiration, ATP production, maximal respiration and proton leak were significantly reduced compared to both NT and SonG controls. The spare capacity and the non-mitochondrial oxygen consumption were only significantly reduced compared to NT. These findings show rescue of most OCR parameters in P2 astrocytes upon G3 treatment. The non-mitochondrial oxygen consumption was also significantly reduced in the SonG condition compared to NT, of which the effects and / or toxicity could be either chemistry or sequence dependent

[0012] . Altogether, our data indicate that G3-mediated downregulation of AASS in mature astrocytes is able to partially restore PDE biomarkers and increased OCRs (Figure 6F).Downregulation of Aass in mouse astrocytes using ASOs decrease AASS protein levels The authors conducted a screening of six distinct antisense oligonucleotides (ASOs) on primary astrocytes derived from wild-type (WT) mice. The screening panel included three gapmer ASOs (Figure 7) and three splice-switching ASOs (Figure 8). Among the gapmers, two exhibited significant dose-dependent knockdown of AASS at both the mRNA and protein levels. Specifically, Gapmer 4 demonstrated approximately 18%, 36%, and 54% reduction in AASS protein levels at concentrations of 0.5 pM, 1 pM, and 2 pM, respectively. Gapmer 6 achieved 57%, 62%, and 66% AASS protein knockdown at the same concentrations (Figure 7). In contrast, only one spliceswitching ASO, ssASO 4, produced a significant, dose-dependent reduction in AASS expression at both the mRNA and protein levels, with approximately 50%, 58%, and 68% knockdown of AASS protein at 0.5 pM, 1 pM, and 2 pM, respectively (Figure 8).

[0220] Notably, these gapmers did not induce significant cytotoxicity at any of the tested concentrations. The authors are currently assessing their efficacy and safety in vivo using Aldh7a1-I- mice (Figure 9). Similar to the gapmers, ssASO 4 did not significantly affect cellular viability. These findings, initially obtained from WT astrocytes, were further validated in Aldh7a1- / - astrocytes at the protein level.

[0221] The authors are now replicating these results in Aldh7a1- / - astrocytes and evaluating the potential of the three most effective ASOs to reduce the levels of PDE biomarkers. Additionally, the authors are in the process of establishing an intracerebroventricular injection protocol to assess the in vivo efficacy and safety of these ASOs in Aldh7a1- / - mice previously generated in the Leavitt Laboratory.References

[0222] 1. Leandro, J. and S.M. Houten, The lysine degradation pathway: Subcellular compartmentalization and enzyme deficiencies. Mol Genet Metab, 2020. 131(1-2): p. 14- 22.

[0223] 2. Papes, F., et al., Lysine degradation through the saccharopine pathway in mammals:

[0224] involvement of both bifunctional and monofunctional lysine-degrading enzymes in mouse. Biochem J, 1999. 344 Pt 2(Pt 2): p. 555-63.

[0225] 3. Garanto, A. and R.W.J. Collin, Design and In Vitro Use of Antisense Oligonucleotides to Correct Pre-mRNA Splicing Defects in Inherited Retinal Dystrophies. Methods Mol Biol, 2018. 1715: p. 61-78.

[0226] 4. Schuurmans, I.M.E., et al., Navigating Human Astrocyte Differentiation: Direct and Rapid one-step Differentiation of Induced Pluripotent Stem Cells to Functional Astrocytes Supporting Neuronal Network development. bioRxiv, 2024: p. 2024.03.27.586938.

[0227] 5. van Scherpenzeel, M., et al., Dynamic tracing of sugar metabolism reveals the mechanisms of action of synthetic sugar analogs. Glycobiology, 2022. 32(3): p. 239-250.

[0228] 6. Coene, K.L.M., et al., Next-generation metabolic screening: targeted and untargeted metabolomics for the diagnosis of inborn errors of metabolism in individual patients. J Inherit Metab Dis, 2018. 41(3): p. 337-353.

[0229] 7. Forsberg, E.M., et al., Data processing, multi-omic pathway mapping, and metabolite activity analysis using XCMS Online. Nat Protoc, 2018. 13(4): p. 633-651.

[0230] 8. Chiorcea-Paquim, A.M., 8-oxoguanine and 8-oxodeoxyguanosine Biomarkers of Oxidative DNA Damage: A Review on HPLC-ECD Determination. Molecules, 2022. 27(5).

[0231] 9. Eskelinen, M., et al., Plasma Concentration of the Lipid Peroxidation (LP) Biomarker 4- Etaydroxynonenal (4-HNE) in Benign and Cancer Patients. In Vivo, 2022. 36(2): p. 773- 779.

[0232] 10. Houten, S.M., et al., Genetic basis of hyperlysinemia. Orphanet J Rare Dis, 2013. 8: p. 57.

[0233] 11. Guo, Y., et al., The Metabolite Saccharopine Impairs Neuronal Development by Inhibiting the Neurotrophic Function of Glucose-6-Phosphate Isomerase. J Neurosci, 2022. 42(13): p. 2631-2646.

[0234] 12. Godfrey, C., et al., Delivery is key: lessons learnt from developing splice-switching antisense therapies. EMBO Mol Med, 2017. 9(5): p. 545-557.

Claims

33Claims1. An antisense oligonucleotide moiety for the degradation of an AASS transcript, wherein the antisense oligonucleotide moiety binds to or is complementary to a polynucleotide part within SEQ ID NO: 1 or SEQ ID NO: 2, said polynucleotide part having a nucleotide sequence selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO:6 and SEQ ID NO: 11 to SEQ ID NO: 34.

2. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to claim 1 , wherein the antisense oligonucleotide moiety comprises an RNA residue, a DNA residue, and / or a nucleotide analogue or equivalent, preferably wherein the antisense oligonucleotide moiety comprises both RNA and DNA residues.

3. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to claim 1 or 2, wherein the antisense oligonucleotide moiety is a gapmer.

4. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of the preceding claims, wherein the antisense oligonucleotide moiety has a length of from about 8 to about 40 nucleotides, preferably from about 10 to about 40 nucleotides, more preferably from about 14 to about 30 nucleotides, more preferably from about 16 to about 24 nucleotides, such as 16, 17, 18, 19, 20, 21 , 22, 23 or 24 nucleotides.

5. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of the preceding claims, wherein said antisense oligonucleotide moiety comprises or consists of an oligonucleotide with a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or most preferably 100% sequence identity with a sequence as set forth in SEQ ID NO: 35, 37, 38, 39, 40, 41 , or 42.

6. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of the preceding claims, comprising a phosphorothioate modification in its phosphate backbone.

7. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of the preceding claims, comprising a 2'-0 alkyl modified nucleotide, such as a 2'-O-methyl modified ribose, a 2'-O-ethyl modified ribose, a 2'-O-propyl modified ribose, 2-O’-methoxy ethyl ribose and / or substituted derivatives of these modifications such as halogenated derivatives, preferably the antisense oligonucleotides comprise an 8-oxo-Guanine (8-oxoG) modification.

348. A pharmaceutical composition comprising an antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of claims 1 - 7, and further comprising a pharmaceutically acceptable excipient.

9. A pharmaceutical composition according to claim 8, wherein the pharmaceutical composition is for administration to the brain or the liver.

10. An antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of claims 1 - 7 or the pharmaceutical composition according to claim 8 or 9, for use as a medicament, preferably for use as a medicament for treatment, prevention and / or delay of a lysine metabolism disorder or a condition requiring the degradation of an AASS (pre)mRNA.

11. Use of the antisense oligonucleotide moiety for the degradation of an AASS transcript according to any one of claims 1 - 7 or the pharmaceutical composition according to claim 8 or 9, for treatment, prevention and / or delay of a lysine metabolism disorder or a condition requiring the degradation of an AASS (pre)mRNA.

12. A method of treatment of a lysine metabolism disorder or condition requiring the degradation of an AASS (pre)mRNA in a subject in need thereof, comprising administration of an antisense oligonucleotide moiety for the degradation of an AASS transcript as defined in claims 1 -7 or administration of the pharmaceutical composition according to any one of claims 8 or 9.

13. A method for the degradation of an AASS transcript in a cell, the method comprising contacting the cell with an antisense oligonucleotide moiety for the degradation of an AASS transcript as defined in claims 1 - 7 or with the pharmaceutical composition according to any one of claims 8 or 9.

14. An antisense oligonucleotide moiety for the degradation of an AASS transcript for the use according to claim 10, the use according to claim 11 or the method according to claim 12 or 13, wherein the lysine metabolism disorder is Pyridoxine dependent epilepsy (PDE) and / or Glutaric Aciduria type I (GA1).

Images