Compounds for treatment of liver diseases

Abstract

The present disclosure relates to the field of chemistry, specifically to pharmaceutical and medicinal chemistry. More particularly, it concerns chemical compounds and their use in the treatment of fatty liver diseases (steatohepatitis), such as metabolic dysfunction-associated steatotic liver disease (MASLD) and metabolic dysfunction-associated steatohepatitis (MASH).

Description

[0001] P7372PC00

[0002] Compounds for treatment of liver diseases

[0003] Technical field

[0004] The present disclosure relates to the field of chemistry, specifically to pharmaceutical and medicinal chemistry. More particularly, it concerns chemical compounds and their use in the treatment of fatty liver diseases (steatohepatitis), such as metabolic dysfunction-associated steatotic liver disease (MASLD) and metabolic dysfunction-associated steatohepatitis (MASH).

[0005] Background

[0006] Fatty liver diseases encompass a spectrum of conditions characterized by excessive fat accumulation in liver cells, ranging from relatively non-progressive or stable forms to more severe inflammatory and fibrotic stages. These diseases are known by several terms and abbreviations, including metabolic dysfunction-associated steatotic liver disease (MASLD), metabolic-associated fatty liver disease (MAFLD), and non-alcoholic fatty liver disease (NAFLD). MASLD and MAFLD reflect the modern understanding of these conditions as closely linked to metabolic dysfunction, while NAFLD remains a widely recognized term in clinical and historical contexts. The more severe form, metabolic dysfunction-associated steatohepatitis (MASH), previously referred to as non-alcoholic steatohepatitis (NASH), typically involves hepatocellular inflammation, injury, and fibrosis, and may progress to cirrhosis or hepatocellular carcinoma.

[0007] MASLD is the most prevalent chronic liver condition worldwide, with an estimated global prevalence of 38%, rising to over 90% among obese individuals. It is widely regarded as the hepatic manifestation of metabolic syndrome, a systemic disorder characterized by impaired energy homeostasis. Key contributing factors include diets rich in saturated fats and sugars, alongside obesity, insulin resistance, and dyslipidemia. The progression of MASLD to MASH in approximately 25% of patients is particularly concerning, as MASH is associated with severe liver damage, fibrosis, and an elevated risk of cirrhosis and liver cancer.

[0008] Despite the increasing prevalence of fatty liver diseases, particularly among children, effective therapeutic options remain limited. Current treatment strategies rely heavily on lifestyle modifications, such as dietary changes and increased physical activity. While these interventions can be effective in managing early stages of the disease,P7372PC00

[0009] adherence remains a significant challenge, and they often fail to address more advanced disease states. Recently, the first pharmacological treatment for MASH was approved; however, its efficacy is contingent on concurrent lifestyle modifications, and its long-term effectiveness remains uncertain.

[0010] On this basis, it is the objective of the present disclosure to provide solutions to address the urgent need for effective treatments of fatty liver diseases.

[0011] Summary

[0012] The present disclosure addresses the above-mentioned need by evidencing that activation of GPR39 show a beneficial effect on the treatment of fatty liver disease. Accordingly, the present disclosure establishes that fatty liver disease may be treated using GPR39 agonists. The instant disclosure also provides such GPR39 agonists for use in the treatment of fatty liver diseases.

[0013] One aspect of the present disclosure provides a GPR39 agonist for use in the treatment of a fatty liver disease (hepatic steatosis). One preferred aspect of the disclosure provides a compound for use in the treatment of a fatty liver disease (hepatic steatosis), wherein the compound has the structure of formula (I),

[0014]

[0015] or a tautomer or a stereoisomer such as an enantiomer, thereof,

[0016] or pharmaceutically acceptable salt thereof.

[0017] The disclosed GPR39 agonistic compounds have in preclinical murine models been demonstrated to:

[0018] • Reduce liver weight and hepatic triglyceride content

[0019] • Reduce plasma level markers of hepatocellular damage (ALT and AST) • Reduce plasma levels of triglycerides and free fatty acids

[0020] • Treat and prevent the development of HF-MCD diet-induced MASH

[0021] • Reverse MASLD after onset in HFD diet induced obese miceP7372PC00

[0022] One aspect of the present disclosure also provides for pharmaceutical compositions comprising a compound of formula (I):

[0023]

[0024] formula (I),

[0025] or a tautomer or a stereoisomer such as an enantiomer thereof,

[0026] or a pharmaceutically acceptable salt thereof;

[0027] and

[0028] a Zn2+source.

[0029] Another aspect of the present disclosure provides for kit of parts comprising:

[0030] i) a compound of formula (I):

[0031] F

[0032] /

[0033] zr-NH N=A

[0034] N^N HN~^

[0035]

[0036] ° formula (I),

[0037] or a tautomer or a stereoisomer such as an enantiomer thereof,

[0038] or a pharmaceutically acceptable salt thereof

[0039] and

[0040] ii) a Zn2+source.

[0041] Description of Figures

[0042] Figure 1. A. Experimental setup. WT male mice were fed HFD for 17 weeks, the baseline group was sacrificed and 3 interventions carried out for 7 weeks: HFD with 120 mg / kg / day of TM-N1324 or vehicle or normal chow with vehicle (n=10-12 / group). B. Plasma levels of TM-N1324 (n=6). C. Liver weight (n=5-7 / group). D. Hepatic triglyceride (TG) content. E. Histological scoring of liver steatosis with representative H&E staining. Scale bar = 500 pM. F. Plasma ALT levels. G. Plasma AST levels. H.

[0043] Liver mRNA levels of HFD-TM-N1324-treated mice relative to HFD-vehicle-treated, studied relative to TBP mRNA (n=8 / group). Data are means ± SEM, median for histological data (E). *p<0.05, **p<0.01, ***p<0.001. ALT, alanine aminotransferase; AST, aspartate aminotransferase; EE, energy expenditure; HFD, high-fat diet; NC,P7372PC00

[0044] normal chow; OGTT, oral glucose tolerance test; TD-NMR, time-domain nuclear magnetic resonance.

[0045] Figure 2. WT male mice were fed HFD for 17 weeks, the baseline group sacrificed and 3 interventions carried out for 7 weeks: HFD with 120 mg / kg / day of TM-N1324 or vehicle or normal chow with vehicle (n=10-12 / group). A. Quantification and representative immunoblots of hepatic ERK, phosphorylated ERK (pERK), SREBP2 and PPARy protein levels (n=4 / group). B. Liver mRNA levels of HFD-TM-N1324-treated mice relative to HFD-vehicle-treated, studied relative to TBP mRNA (n=8 / group). C. Hepatic protein abundance in the HFD-TM-N1324-treated mice relative to HFD-vehicle-treated determined by proteomics analysis (n=6 / group). Heatmap displaying abundance of significantly altered fatty acid (FA) metabolism proteins. D. Quantification and representative immunoblots of hepatic FAS, CD36 and PLIN2 protein levels (n=4 / group). E. Primary hepatocytes from WT and GPR39KO mice were treated with vehicle, 0.1 or 1 pM TM-N1324 or 0.1 pM PMA (phorbol 12-myristate 13-acetate, protein kinase C activator). Quantification and representative immunoblots of ERK, phosphorylated ERK (pERK) and phosphorylated MEK (pMEK). n=6 independent experiments for ERK and pERK, 2 for pMEK. F-H. Oral glucose tolerance test (OGTT) performed after 6 weeks of interventions and a 4h fast (n=8 / group). F. OGTT and AUG. OGTT: *-***: HFD-TM-N1324-treated compared to HFD-vehicle-treated. #: HFD-TM-N 1324-treated compared to normal chow-vehicle-treated. G. Plasma insulin levels determined at 0 and 15 min time points of the OGTT. H. HOMA-IR scores determined from the 0 min levels of glucose and insulin of the OGTT. I. mRNA levels of HFD-TM-N 1324-treated mice relative to HFD-vehicle-treated, studied relative to TBP mRNA (n=8 / group). J. Plasma FGF21 levels. K. Plasma leptin levels. L. Plasma adiponectin levels. M. Plasma glucagon levels. Data are means ± SEM. *p<0.05, **p<0.01, ***p<0.001. AUG, area under the curve; HFD, high-fat diet; HOMA-IR, homeostatic model assessment for insulin resistance. N.-O. mRNA levels of primary hepatocytes from WT and GPR39KO mice treated with 1 pM TM-N1324 or DMSO (N) or additionally with 110126 (MEK1 / 2 inhibitor) (O). n=3 independent experiments. Data are means ± SEM. *p<0.05, **p<0.01, ***p<0.001. HFD, high-fat diet.

[0046] Figure 3. WT male mice were fed HFD for 17 weeks, the baseline group sacrificed and 3 interventions carried out for 7 weeks: HFD with 120 mg / kg / day of TM-N1324 or vehicle or normal chow with vehicle (n=10-12 / group). A. Body weight development (*P7372PC00

[0047] and *** indicate AUC) and delta change during the interventions. B. Delta change of fat and lean mass during the interventions. C-H. The HFD fed groups were studied with an automated metabolic and behavioral measurement system during the 5thweek of interventions (n=8 / group). C. Cumulative food intake and AUC. D. Cumulative water intake and AUC. E. Water vapor loss and AUC. F. Respiratory exchange ratio (RER) and AUC. G. Energy expenditure and AUC H. Total activity and AUC. I. Plasma total ghrelin levels. J. Plasma active ghrelin levels. K. mRNA levels of HFD-TM-N1324-treated mice relative to HFD-vehicle-treated, studied relative to TBP mRNA (n=8 / group). L. Plasma GLP1 levels. Data are means ± SEM. *p<0.05, **p<0.01, ***p<0.001. AUC, area under the curve; GLP1, glucagon-like peptide 1; HFD, high-fat diet.

[0048] Figure 4. A. Experimental setup. WT male mice were fed HF-MCD diet supplemented with 30 mg / kg / day (3 and 9 weeks) or 120 mg / kg / day (3 weeks) of TM-N1324 or vehicle. B. Delta change of body weight. C. Plasma levels of TM-N1324 (n=4-5 / group).

[0049] D. Liver weight E. Hepatic triglyceride (TG) content. F-H. Histological scoring of liver steatosis, inflammation and fibrosis with representative H&E and Sirius Red staining. Scale bars = 500 pM for steatosis, 150 pM for inflammation, 100 pM for fibrosis. I. Plasma ALT levels. J. Plasma AST levels. K. Liver mRNA levels of TM-N1324-treated mice relative to the corresponding vehicle-treated, studied relative to TBP mRNA. Data are means ± SEM, median for histological data (F-H). *p<0.05, **p<0.01, ***p<0.001. ALT, alanine aminotransferase; AST, aspartate aminotransferase; FA, fatty acid; HF-MCD diet, high fat, low methionine, choline deficient diet.

[0050] Figure 5. A,B,F,G. WT male mice were fed HFD for 17 weeks, the baseline group sacrificed and 3 interventions carried out for 7 weeks: HFD with 120 mg / kg / day of TM-N1324 or vehicle or normal chow with vehicle (n=10-12 / group). C-E,H,I. WT male mice were fed HF-MCD diet supplemented with 30 mg / kg / day (3 and 9 weeks) or 120 mg / kg / day (3 weeks) of TM-N1324 or vehicle (n=6-11 / group). A. Hepatic protein abundance in the HFD-TM-N1324-treated mice relative to the HFD-vehicle-treated, determined by proteomics analysis. Heatmap displaying cholesterol metabolism proteins with a significantly altered abundance (n=6 / group). B. Plasma total cholesterol, HDL and LDL / VLDL levels. C. Plasma total cholesterol, HDL and LDL / VLDL levels. D. Plasma ApoB100 levels. E. Hepatic total cholesterol, HDL and LDL / VLDL levels. F. Plasma triglyceride levels. G. Plasma free fatty acid (FFA) levels.P7372PC00

[0051] H. Plasma triglyceride levels. I. Plasma free fatty acid levels. Data are means ± SEM. *p<0.05, **p<0.01, ***p<0.001. ApoB100, apolipoprotein B100; chol, cholesterol; HFD, high fat-diet; HF-MCD diet, high fat, low methionine, choline deficient diet.

[0052] Figure 6. A-E. WT male mice were fed HFD for 17 weeks and interventions carried out for 7 weeks: HFD with 120 mg / kg / day of TM-N1324 or vehicle. A. Significantly altered hepatic protein abundance in the HFD-TM-N1324-treated mice relative to the HFD-vehicle-treated determined by proteomics analysis (n=6 / group). B. Quantification and representative immunoblots of hepatic ADP ribosylated protein levels (n=4 / group). C-E. n=5 / group. C. Liver NAD+ levels. D. Liver NADH levels. E. Liver NAD+ / NADH ratio. F.

[0053] Experimental setup. Nampfm-Albc,emale mice were fed HF-MCD diet supplemented with 30 mg / kg / day of TM-N1324 or vehicle for 3 weeks (n=10-11 / group). G. Cumulative water intake. H. Liver weight. I. Hepatic triglyceride (TG) content. J-L. Histological scoring of liver steatosis, inflammation and fibrosis with representative H&E and Sirius Red staining. Scale bars = 500 pM for steatosis, 150 pM for inflammation, 100 pM for fibrosis. M. Plasma ALT levels. N. Plasma AST levels. O. IP3 production in hGPR39-COS7 cells treated with 100 (-4), 10 (-5), 1 (-6), 0.1 (-7), 0.01 (-8), 0.001 (-9) and 0.0001 pM TM-N1324 and with or without indicated concentrations of FK866 (n=2). P. Liver mRNA levels of TM-N1324-treated mice relative to the corresponding vehicle-treated, studied relative to TBP mRNA (n=8 / group). Q. Quantification and representative immunoblots of hepatic ADP ribosylated protein levels (n=4 / group for WT and 7-9 / group for Namptfl / fl-AlbCremice). Data are means ± SEM, median for histological data (J-L). *p<0.05, **p<0.01, ***p<0.001. ADP, adenosine diphosphate; ALT, alanine aminotransferase; AST, aspartate aminotransferase; FA, fatty acid; HF-MCD diet, high fat, low methionine, choline deficient diet; NAD / NADH, nicotinamide adenine dinucleotide.

[0054] Figure 7. Experimental setup. GPR39KO and WT-littermate male mice were fed HF-MCD diet supplemented with 120 mg / kg / day of TM-N1324 or vehicle for 3 weeks (n=4-9 / group). B. Liver mRNA levels studied relative to GAPDH mRNA. Stars above the KO groups indicate the significance of comparison to both WT groups separately: all 4 comparisons are of the same significance of ***p <0.001. C. Total water intake. D. Delta change of body weight. E. Liver weight. F. Hepatic triglyceride (TG) content. G, H. Histological scoring of liver steatosis and inflammation. I. Plasma ALT levels. J. Plasma AST levels. K. Liver mRNA levels of TM-N1324-treated mice relative to theP7372PC00

[0055] corresponding vehicle-treated, studied relative to GAPDH mRNA. Data are means ± SEM, median for histological data (G,H). *p<0.05, **p<0.01, ***p<0.001. ALT, alanine aminotransferase; AST, aspartate aminotransferase; FA, fatty acid; HF-MCD diet, high fat, low methionine, choline deficient diet.

[0056] Figure 8. Experimental setup. WT female mice were fed HF-MCD diet for 2.5 weeks, the baseline group was sacrificed and interventions carried out for 3 weeks: HF-MCD diet with 120 mg / kg / day of TM-N1324 or vehicle (n=10 / group, 4 / baseline group). B. Cumulative food intake. C. Cumulative water intake. D. Body weight at sacrifice. E. Liver weight. F. Hepatic triglyceride (TG) content. G-l. Histological scoring of liver steatosis, inflammation and fibrosis with representative H&E staining for steatosis and inflammation. Scale bars = 500 pM for steatosis, 150 pM for inflammation. J. Plasma ALT levels. K. Plasma AST levels. L. A schematic diagram illustrating the hepatic, systemic and hepatocellular effects of TM-N1324-treatment in mice. Data are means ± SEM, median for histological data (G-l). *p<0.05, **p<0.01, ***p<0.001. ALT, alanine aminotransferase; AST, aspartate aminotransferase; HF-MCD diet, high fat, low methionine, choline deficient diet.

[0057] Figure 9. A. Actual ingested TM-N1324 doses calculated based on measured food consumption and body weight for all models. B. WT male mice were fed HFD for 17 weeks and interventions carried out for 7 weeks: HFD with 120 mg / kg / day of TM-N1324 or vehicle. Liver mRNA levels of HFD-TM-N1324-treated mice relative to HFD-vehicle-treated, studied relative to TBP mRNA (n=8 / group). C,D. Clustering analysis on RNAseq data. C. Gpr39 expression in different hepatic cell populations. D. Gpr39 expression in the central and portal zones of liver. Pseudocount counts per million. Data are means ± SEM. **p<0.01. HFD, high-fat diet. HF-MCD, high fat, low methionine, choline deficient.

[0058] Figure 10. WT male mice were fed HFD for 17 weeks, the baseline group sacrificed and 3 interventions carried out for 7 weeks: HFD with 120 mg / kg / day of TM-N1324 or vehicle or normal chow with vehicle. Hepatic protein abundance in the HFD-TM-N1324-treated mice relative to HFD-vehicle-treated determined by proteomics analysis (n=6 / group). HFD, high-fat diet.

[0059] Figure 11. WT male mice were fed HF-MCD diet supplemented with 30 mg / kg / day (3 and 9 weeks) or 120 mg / kg / day (3 weeks) of TM-N1324 or vehicle (n=6-11 / group). A-P7372PC00

[0060] B. Liver mRNA levels of TM-N1324-treated mice relative to the corresponding vehicle-treated, studied relative to TBP mRNA. C. Plasma total ghrelin levels. D. Plasma active ghrelin levels. E. Plasma GLP1 levels. F. Total food intake. G. Total water intake. H. Delta change of fat and lean mass. Data are means ± SEM. *p<0.05, ***p<0.001.

[0061] GLP1, glucagon-like peptide 1.

[0062] Figure 12. A,E. WT male mice were fed HFD for 17 weeks and interventions carried out for 7 weeks: HFD with 120 mg / kg / day of TM-N1324 or vehicle. A. Liver NADP and NADP+ levels (n=5 / group). B-D. Nampfm-AlbCremale mice were fed HF-MCD (high-fat, methionine-choline-deficient) diet supplemented with 30 mg / kg / day of TM-N1324 or vehicle for 3 weeks (n=10-11 / group). B. Cumulative food intake. C. Delta change of body weight. D. Plasma total ghrelin levels. E. Significantly altered hepatic protein abundance in the HFD-TM-N1324-treated mice relative to the HFD-vehicle-treated determined by proteomics analysis (n=6 / group). Data are means ± SEM. NADP, nicotinamide adenine dinucleotide phosphate.

[0063] Figure 13. GPR39KO and WT littermate male mice were fed HF-MCD (high-fat, methionine-choline-deficient) diet supplemented with 120 mg / kg / day of TM-N1324 or vehicle for 3 weeks (n=4-9 / group). A. Plasma total ghrelin levels. B. Plasma active ghrelin levels. C. Plasma GLP1 levels. D. Total food intake. E. Plasma total cholesterol levels. F. Plasma triglyceride levels. G. Plasma free fatty acid (FFA) levels. Data are means ± SEM. Choi, cholesterol; GLP1, glucagon-like peptide 1.

[0064] Figure 14. WT female mice were fed HF-MCD diet for 2.5 weeks, the baseline group was sacrificed and interventions carried out for 3 weeks: HF-MCD diet with 120 mg / kg / day of TM-N1324 or vehicle (n=10 / group, 4 / baseline group). A. Plasma total ghrelin levels. B. Plasma active ghrelin levels. C. Plasma GLP1 levels. D. Plasma total cholesterol, HDL and LDL / VLDL levels. E. Plasma triglyceride levels. F. Plasma free fatty acid (FFA) levels. Data are means ± SEM. *p<0.05, **p<0.01. Choi, cholesterol; GLP1, glucagon-like peptide 1; HF-MCD, high fat, low methionine, choline deficient.

[0065] Detailed description

[0066] Definitions

[0067] The term ‘agonist’ as used herein refers to a substance that binds to a specific receptor and activates it, thereby eliciting a biological response.P7372PC00

[0068] The term ‘GPR39 agonist' as used herein refers to a substance that binds to and activates G protein-coupled receptor 39 (GPR39), thereby eliciting a biological response. GPR39 is activated by extracellular Zn2+, which enhances its activity. A GPR39 agonist may act by interacting with the receptor in the presence of Zn2+or independently of Zn2+to modulate its function and associated biological processes.

[0069] The term 'synergistic' as used herein refers to the interaction between two or more entities that results in a combined effect greater than the sum of their individual effects. Such synergy may be quantitative, qualitative, or both, and can be demonstrated through any appropriate means showing that the combined effect exceeds what would be expected from the entities acting independently. As shown herein below, the compounds of the disclosure may exhibit synergy when administered with a Zn2+source in the therapies outlines herein.

[0070] The terms ‘treatment’ or ‘treating’ as used herein refers to an approach for obtaining beneficial or desired results including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease or disorder, stabilized (i.e., not worsening) state of disease or disorder, prevention of the disease or disorder, delay or slowing of disease or disorder progression, amelioration or palliation of the disease state, and remission (whether partial or total) whether detectable or undetectable.

[0071] The term ‘tautomer’ as used herein refers to one of two or more structural forms of a molecule that exist in equilibrium, wherein tautomeric forms arise from the swapping of a single bond with an adjacent double bond, accompanied by the concomitant migration of a proton.

[0072] The term “pharmaceutically effective amount” of a compound as used herein refers to an amount sufficient to cure, alleviate, prevent, reduce the risk of, or partially arrest the clinical manifestations of a given disease or disorder and its complications. An amount adequate to accomplish this is defined as "therapeutically effective amount". Effective amounts for each purpose will depend on the severity of the disease or injury as well as the weight and general state of the subject. It will be understood that determining an appropriate dosage may be achieved using routine experimentation, byP7372PC00

[0073] constructing a matrix of values and testing different points in the matrix, which is all within the ordinary skills of a trained physician or veterinary.

[0074] The terms “approximately” and “about” as referred herein are synonymous. In some embodiments, “approximately” and “about” refer to the recited amount, value, or duration ± 5%, ± 4.5%, ± 4%, ±3.5%, ±3%, ±2.5%, ±2%, ±1.75%, ±1.5%, ±1.25%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ± 0.5% ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.09%, ±0.08%, ±0.07%, ±0.06%, ±0.05%, ±0.04%, ±0.03%, ±0.02%, or ±0.01%. In some embodiments, “approximately” and “about” refer to the listed amount, value, or duration ±2.5%, ±2%, ±1.75%, ±1.5%, ±1.25%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ± 0.5%. In some embodiments, “approximately” and “about” refer to the listed amount, value, or duration ±1%. In some embodiments, “approximately” and “about” refer to the listed amount, value, or duration ±0.5%. In some embodiments, “approximately” and “about” refer to the listed amount, value, or duration ±0.1%.

[0075] The term ‘pharmaceutically acceptable salt’ of a compound as used herein refers to a salt that is pharmaceutically acceptable, as defined herein, and that possesses the desired pharmacological activity of the parent compound. A pharmaceutically acceptable salt is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable and includes that which is acceptable for veterinary as well as human pharmaceutical use. Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids, e.g. hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid; or formed with organic acids, e.g. acetic acid, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, citric acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, hydroxynaphtoic acid, 2-hydroxyethanesulfonic acid, lactic acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, muconic acid, 2-naphthalenesulfonic acid, propionic acid, salicylic acid, succinic acid, tartaric acid, p-toluenesulfonic acid, trimethylacetic acid; or salts formed when an acidic proton present in the parent compound either is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion, or an aluminum ion; or coordinates with an organic or inorganic base. Acceptable organic bases include e.g. diethanolamine, ethanolamine, N-methylglucamine, triethanolamine, morpholine, and tromethamine. Acceptable inorganic bases include e.g. ammonia, aluminum hydroxide, calcium hydroxide, potassium hydroxide, sodium carbonate and sodium hydroxide.P7372PC00

[0076] The phrases “n to m”, “from n to m” or “between n and m” as used herein refers to a range that is at least n and at the most m. I.e. the term indicates that there is not more than m.

[0077] As used herein, the terms non-alcoholic fatty liver disease (NAFLD)’ and metabolic dysfunction-associated fatty liver disease (MAFLD)’ refer to liver conditions characterized by excessive fat accumulation in the liver, not caused by significant alcohol consumption. The term metabolic dysfunction-associated steatotic liver disease (MASLD)’ is an updated term for NAFLD, emphasizing its metabolic origins. The terms non-alcoholic steatohepatitis (NASH)’ and metabolic dysfunction-associated steatohepatitis (MASH)’ refer to advanced forms of NAFLD / MAFLD / MASLD, characterized by liver inflammation and fibrosis. For the purposes of this disclosure, the terms NAFLD, MAFLD, and MASLD are used interchangeably, as are the terms NASH and MASH.

[0078] Therapy

[0079] One embodiment of the present disclosure provides a GPR39 agonist for use in the treatment of a fatty liver disease (hepatic steatosis). In one embodiment, the GPR39 agonist has the structure of formula (I):

[0080] ci

[0081] Nx.N HN

[0082]

[0083] ° formula (I),

[0084] or a tautomer or a stereoisomer such as an enantiomer thereof,

[0085] or pharmaceutically acceptable salt thereof.

[0086] One embodiment of the present disclosure provides a compound for use in the treatment of a fatty liver disease (hepatic steatosis), wherein the compound has the

[0087] structure of formula (I),

[0088]

[0089] o formula (I),P7372PC00

[0090] or a tautomer or a stereoisomer such as an enantiomer thereof,

[0091] or pharmaceutically acceptable salt thereof.

[0092] In one embodiment, the compound for use in the treatment of a fatty liver disease is a GPR39 agonist.

[0093] In one embodiment of the present disclosure, the compound, e.g. the GPR39 agonist, is administered in combination with a Zn2+source. In one embodiment, the Zn2+source is pharmaceutically acceptable. In one embodiment, the Zn2+source is selected from zinc sulphate, zinc gluconate, zinc acetate, zinc citrate, zinc picolinate, zinc oxide, zinc chloride, zinc oronate, zinc bisglycinate, and zinc carbonate. In one embodiment, said Zn2+source is administered prior to, simultaneously with, or subsequently to the compound of formula (I). In one embodiment, the molar ratio between the compound of formula (I) and the Zn2+source is in the range of 1:10000 to 10:1 in plasma, such as in the range of 1:1000 to 1:10, and preferably approximately 1:100 in plasma.

[0094] In one embodiment, the fatty liver disease is defined as Metabolic Associated Steatohepatitis Liver Disease (MASLD). MASLD encompasses conditions characterized by hepatic steatosis due to metabolic dysfunctions such as obesity, type 2 diabetes, or metabolic syndrome. This disease state may manifest physiological changes including disrupted liver function, elevated oxidative stress, inflammation, and insulin resistance. These can potentially escalate to more severe conditions like fibrosis and cirrhosis, heightening the risk of significant liver-related complications.

[0095] In one embodiment the fatty liver disease is defined as Metabolic Associated Steatohepatitis (MASH). MASH is a severe form of MASLD characterized by inflammation and cellular damage in the liver, compounded by lipid accumulation. This condition correlates with metabolic disorders such as obesity, diabetes, or dyslipidemia. The physiological impacts are considerable, with increased oxidative stress, chronic inflammation, and progressive liver damage, which may lead to critical outcomes including fibrosis, cirrhosis, liver failure, and an increased risk of hepatocellular carcinoma. MASH also severely impacts metabolic regulation and significantly elevates mortality risks related to liver diseases.

[0096] In one embodiment, liver fibrosis is depicted as a complication that has progressedP7372PC00

[0097] from MASH due to chronic inflammation and liver cell damage. This stage is characterized by a progressive accumulation of scar tissue, which impairs liver function and can potentially lead to cirrhosis. Liver fibrosis significantly undermines the liver’s ability to regenerate and sustain metabolic functions, marking an advanced stage of liver disease that originated from metabolic associated steatohepatitis.

[0098] In this embodiment, fatty liver disease involves an inflammatory response triggered by excessive hepatic fat accumulation, typically seen in MASLD and progressing to MASH. This inflammation involves immune system activation and prolonged inflammatory responses, leading to oxidative stress, hepatocellular damage, and fibrogenesis. Over time, this may evolve into severe liver pathologies like cirrhosis or hepatocellular carcinoma, affecting overall liver function and health.

[0099] In one embodiment, MASH is further detailed by its histological features, including hepatocyte injury marked by ballooning degeneration and the presence of Mallory-Denk bodies, accompanied by substantial lobular inflammation. This histological presentation is often associated with fibrosis in specific patterns and represents a clinically progressive form of MASLD, with potential outcomes including cardiovascular events, cirrhosis, or hepatocellular carcinoma. Despite novel biomarkers, histology remains the gold standard for MASH diagnosis.

[0100] In one embodiment, the MASLD is categorised as other specified non-alcoholic fatty liver disease.

[0101] In one embodiment, the MASLD is categorised as an unspecified non-alcoholic fatty liver disease.

[0102] Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) are enzymes that serve as key markers of hepatocellular damage due to their release into the bloodstream following liver cell injury. These enzymes, predominantly found in hepatocytes, are involved in amino acid metabolism, and their elevated serum levels indicate disruption of liver integrity. As shown in the examples below, the compounds of the disclosure is capable of lowering the plasma levels of ALT and AST, serving as an indication that the fatty liver disease is ameliorated. Thus, one embodiment of the present disclosure provides a method of reducing the plasma level of:P7372PC00

[0103] a. alanine aminotransferase (ALT);

[0104] b. aspartate aminotransferase (AST);

[0105] c. triglycerides;

[0106] d. free fatty acids; or

[0107] e. any combination thereof

[0108] in a subject, said method comprising administering a GPR39 agonist.

[0109] In one embodiment, the method reduces the plasma level of alanine aminotransferase (ALT) in a subject, said method comprising administering a GPR39 agonist. In one embodiment, the method reduces the plasma level of aspartate aminotransferase (AST) in a subject, said method comprising, administering a GPR39 agonist. In one embodiment, the reduction of ALT is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70%. In one embodiment, the reduction of ALT is 10-70%, 20-70%, 30-70%, 40-70%, 50-70%, or 60-70%. In one embodiment, the reduction of AST is at least 10% or at least 20%. In one embodiment, the reduction of AST is 10-20%.

[0110] One embodiment of the present disclosure provides a method of reducing hepatic steatosis in a subject, said method comprising administering a GPR39 agonist.

[0111] One embodiment of the present disclosure provides a GPR39 agonist for use in the treatment of inflammation, such as liver inflammation.

[0112] One embodiment of the present disclosure provides a method of reducing inflammation, such as inflammation of the liver, said method comprising, administering a GPR39 agonist.

[0113] One embodiment of the present disclosure provides a GPR39 agonist for use in the treatment of fibrosis, such as liver fibrosis.

[0114] One embodiment of the present disclosure provides a method of reducing fibrosis, such as fibrosis in the liver, said method comprising, administering a GPR39 agonist.P7372PC00

[0115] Pharmaceutical compositions

[0116] One embodiment of the present disclosure provides a pharmaceutical composition comprising, a compound of formula (I):

[0117]

[0118] formula (I),

[0119] or a tautomer or a stereoisomer such as an enantiomer thereof,

[0120] or a pharmaceutically acceptable salt thereof;

[0121] and

[0122] a Zn2+source.

[0123] In one embodiment, the pharmaceutical composition comprises one or more pharmaceutically acceptable adjuvants, excipients, carriers, buffers and / or diluents.

[0124] Kit of parts

[0125] One embodiment of the present disclosure provides a kit of parts comprising:

[0126] i) a compound of formula (I):

[0127]

[0128] formula (I),

[0129] or a tautomer or a stereoisomer such as an enantiomer thereof,

[0130] or pharmaceutically acceptable salt thereof;

[0131] and

[0132] a Zn2+source.

[0133] In one embodiment, the compound and the Zn2+source are for separate or successive administration.P7372PC00

[0134] Examples

[0135] General methods

[0136] Animal experiments

[0137] All animal experiments were performed in accordance with the European directive 2010 / 63 / European Union of the European Parliament and of the Council on the protection of animals used for scientific purposes and with institutional guidelines and approved by the Animal Experiment Inspectorate of Denmark (license number 2019-15-0201-00289). All WT mice were C57BL / 6JRj (Janvier Labs). The hepatocytespecific Nampt KO (HNKO, Nampfm-Albc,e) (Dall, M. et al., 2019) and GPR39KO mice (Holst, B. et al., 2009) were generated as previously described. All mice were housed in a 12h light / dark cycle, had free access to food and water and were single-caged for the treatment periods. Their body weight and water and food consumption were monitored twice weekly. All mice fasted for 2h prior to sacrifice. All diets were pureed with a food processor, TM-N1324 (Frimurer, T. et al., 2017) or vehicle (water) was blended in and the diets were pressed into pellets and stored in -20°C.

[0138] HFD-study: 10-week old WT males were fed a HFD (D12492, Research diets, 60% kcal from fat) for 17 weeks, divided into 4 groups of equal body weight and fat mass and the baseline group was sacrificed. The 3 remaining groups were treated with either HFD supplemented with 120 mg / kg / day of TM-N1324 or vehicle or standard chow SAFE D30 (Scientific Diets, 14.1% kcal from fat) supplemented with vehicle for 7 weeks. The mice were studied with an automated metabolic and behavioral measurement system (Promethion BX1, Sable Systems International) during the 5thweek of treatment. At the start of the treatment and 1 day prior to the sacrifice, the fat and lean masses were determined using Bruker's minispec Whole Body Composition Analyzer based on time-domain nuclear magnetic resonance (TD-NMR, The Minispec LF90II, Bruker).

[0139] HF-MCD diet studies: 8 week old WT males, 8-10 week old Nampf'"-AlbCremales and GPR39KO and their WT littermate males were fed a high-fat, choline-deficient diet with 0.1% methionine (A06071309, Research Diets, 45% kcal fat) supplemented with 30 or 120 mg / kg / day of TM-N1324 or vehicle for 3 or 9 weeks. 10 week old WT females were fed the HF-MCD diet for 2.5 weeks and divided into groups of equal body weight and fat mass. The baseline group was sacrificed and the others treated with the HF-MCD diet supplemented with 120 mg / kg / day of TM-N 1324 or vehicle for 3 weeks.P7372PC00

[0140] Determination of TM-N1324 plasma levels

[0141] Plasma samples were quenched with ice-cold acetonitrile. The supernatants were analyzed by LC-MS with an Agilent 6130 Mass Spectrometer with electron spray ionization (ESI) coupled to an Agilent 1200 HPLC system with a C18 reverse phase column (Zorbax Eclipse XBD-C18, 4.6 mm x 50 mm), an autosampler and diode array detector. A linear gradient of the binary solvent system of buffer A (H2O:acetonitrile:formic acid, 95:5:0.1 v / v%) to buffer B (acetonitrile:formic acid, 100:0.1 v / v%) was used with a flow rate of 1 mL / min. The chromatograms were analyzed based on the selective ion mode (SIM) function and UV absorbance at 214 nm. TM-N1324 concentrations were quantified based on a standard curve.

[0142]

[0143] Hepatic triglyceride levels were determined with the Triglyceride Colorimetric Assay Kit (10010303, Cayman chemical) according to the manufacturer's instructions. Briefly, hepatic triglycerides were extracted from 100 mg of liver tissue, which was homogenized with a TissueLyser II (Qiagen) in NP40 Substitute Assay Reagent supplemented with complete™ Mini Protease Inhibitor Cocktail (11836153001, Merck). The supernatant was used for determination.

[0144] Histology and scoring

[0145] Formalin-fixed, paraffin-embedded tissue samples were cut into 5 pm sections.

[0146] Sections were fixed in PFA and stained with hematoxylin and eosin (H&E) or Sirius Red. The slides were viewed and images acquired using a Leitz Wetzlar microscope and a DeltaPix camera using the DeltaPix InSight software. Histological scoring was performed in a blinded fashion by two experienced anatomists. Hepatic steatosis was scored as a percentage of the area affected: 0, <5%; 1, 5-33%; 2, 34-66%; 3, 67-95%; 4 >95%. Hepatic inflammation was scored as average of foci present at three locations in a 10x field: 0, none; 1, 1 focus; 2, 2-4 foci; 3, >4 foci. Fibrosis was scored: 0, none; 1, perisinusoidal or periportal; 2, perisinusoidal and periportal; 3, bridging fibrosis.

[0147] Plasma liver damage marker analysis

[0148] Plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activity levels were determined with ALT and AST activity assays (MAK052 and MAK055, respectively, both Merck) using the colorimetric detection method.P7372PC00

[0149] Quantitative real-time PCR (qPCR)

[0150] RNA was isolated with RNeasy® Mini Kit (74104, Qiagen) and reverse transcribed. Briefly, 5X First-strand buffer, DTT (18080085, Invitrogen™) and Random Primers (11034731001, Roche) were incubated with the RNA in a thermocycler following addition of dNTP Set, RNaseOUT™ and SuperScript™ III Reverse Transcriptase (10297018, 10777019 and 18080085, all Invitrogen™) and incubation in a thermocycler.

[0151] qPCR was performed with PrecisionPLUS qPCR Master Mix (Z-PPLUS-SY, Primer Design) in a Light Cycler 480 system with the primers presented in Table 1.

[0152] Determination of protein expression levels

[0153] Proteins were isolated from the liver tissue by homogenization with a TissueLyser II (Qiagen) in RIPA lysis buffer (20-188, Merck Millipore) supplemented with complete™ Mini Protease Inhibitor Cocktail (11836153001, Merck) and Phosphatase Inhibitor Cocktail 3 (P0044, Merck). Protein concentration was determined from the supernatant with the Pierce™ BCA Protein Assay Kit (23225, Thermo Scientific™). 15-50 pg of protein per sample was run on a reducing gel, transferred to a PVDF membrane and probed with antibodies presented in Table 1. Densities of bands were quantified with Odyssey® XF Imaging System (LI-COR Biosciences) and normalized to GAPDH.

[0154] Mass spectrometry proteomics data acquisition

[0155] The liver proteome mass spectrometry (MS) analysis was performed on 6 WT mice from each HFD group. The mice were anesthetized with 3-5% isoflurane in a SomnoSuite anesthesia system (Kent Scientific Corporation). Standard transcardial perfusion was performed with a MasterFlex digital peristaltic pump (3 min, 5 ml / min) with sterile ice-cold 0.9% NaCI supplemented with complete™ Mini Protease Inhibitor Cocktail (11836153001, Merck) and Phosphatase Inhibitor Cocktail 3 (P0044, Merck). Animals were euthanized by cervical dislocation and livers collected.

[0156] RT livers were snap-frozen in liquid nitrogen and pulverized three times in a tissue extraction bag (tissueTUBE TT1, extra thick, Covaris Inc) using Covaris CP02 Automated Pulverizer on impact level 4. Samples were solubilized with extraction buffer (4% SDS, 100 mM Tris pH 8.5, 5 mM tris(2-carboxyethyl)phosphine (TCEP), and 5.5 mM 2-chloroacetamide (CAA)) followed by sonication on ice for 1 min (1 sec ON, 1 sec OFF, 60% amplitude) after heat treatment for 15 min at 95°C. Overnight digestion was made using the PAC protocol implemented for the KingFisherTM Flex robotP7372PC00

[0157] (Thermo Fisher Scientific) in 96-well format as described previously (Ye, Z. et al., 2022; Batth, T. S. et al., 2019).

[0158] Samples were desalted on SepPak Cis reversed-phase columns and 750 ng peptides were immobilized and purified on EvoTips. Samples were analyzed with the Evosep One LC system with a pPAC column (Thermo Fisher Scientific) at 50°C. The Orbitrap Exploris 480 MS (Thermo Fisher Scientific, Bremen, Germany) was operated in data-independent acquisition (DIA) mode using the Xcalibur software. The spray voltage, funnel RF level, and heated capillary temperature were set at 2 kV, 40, and 275°C, respectively. Full MS resolutions and AGO target were set at 60,000 at m / z 200 and 300%, respectively, with an IT of 45 ms. 48 DIA-MS / MS windows of 13.7 m / z scanning from 472 to 1143 m / z with a 1 Da overlap was applied. The resolution was set at 15,000 and IT at 22 ms, with a normalized collision energy of 27%. All data were gathered in profile mode using positive polarity.

[0159] Proteomics data analysis

[0160] Raw files were searched using Spectronaut (v17) with a spectral library-free approach (directDIA) using a mouse protein sequence database (Uniprot reference proteome 2021 release, 17,492 entries), including common contaminants. Carbamylation of cysteines was set as a fixed modification, whereas oxidation of methionines, acetylation of protein N-termini, and phosphorylation of serine, threonine and tyrosine were set as possible variable modifications. Cross-run normalization was turned on. Proteome data were then analyzed using R (v4.1.3), Iog2 transformed, and required three valid values in at least one experimental group to retain proteins. The Dapar package (v 1.18.3) was used for data interpretation and adhered to the Prostar data analysis pipeline. Normalization used the loess function. Imputation of missing values was performed in two stages according to the nature of the missing values.

[0161] Differentially expressed sites were computed using a two-sided Student's / -test, with p-values adjusted by the Benjamini-Hochberg procedure.

[0162] Hepatocyte isolation and experiments

[0163] Primary hepatocytes were isolated from 10-14 week old male mice by collagenase perfusion and purified by centrifugation in a 90% Percoll gradient in PBS, as described previously (Sanders, M. J. et al., 2022; Patel, K. et al., 2014). Cells of over 90% viability were allowed to attach for 3 h in Eagle-199 (M199) medium containing 100 ll / rnlP7372PC00

[0164] penicillin, 100 pg / ml streptomycin, and 10% (v / v) foetal bovine serum. The hepatocytes were then washed with serum-free M199 and cultured in M 199 supplemented with the antibiotics, 10 nM insulin and 100 nM dexamethasone overnight at 37°C with 5% CO2. Next, the cells were treated with the following compounds: 0.1 pM or 1 pM TM-N1324, 100 nM phorbol 12-myristate 13-acetate (PMA; MedChemExpress, HY-18739) or vehicle (0.1% DMSO). The cells were lysed on ice with lysis buffer (50 mM Tris-HCI, pH 7.5, 150 mM NaCI, 1 mM EDTA, 1 mM EGTA, 0.27 M sucrose, 1% w / v Triton X-100, 20 mM glycerol-2 phosphate disodium, 50 mM NaF, 5 mM Na4P2O?.10 H2O, 1 mM DTT) containing protease and phosphatase inhibitors (0.5 mM PMSF, 1 mM benzamidine HCI, 1 pg / mL leupeptin, 1 pg / mL pepstatin A, 1 pM microcystin-LR, 1 mM NasVOt). Lysates were centrifuged and the protein concentration of the supernatant was determined with the Pierce™ Bradford Protein Assay Kit (23200, Thermo Scientific™) and quantified with the Hidex™ Plate Reader. 10 pg of protein per sample was run on a Criterion™ Tris-glycine polyacrylamide gel (5678095, Bio-Rad), transferred to a nitrocellulose membrane, and probed at 4 °C overnight with antibodies presented in Table 2. Membranes were imaged using the Odyssey® Fc LiCor system and the densitometry analysis was performed with the LiCor Image Studio™ Lite.

[0165] Oral glucose tolerance test (OGTT)

[0166] The OGTT was performed on the HFD-fed WT mice 1 week before sacrifice. Mice fasted for 4h and were orally administered with 2 mg / g of glucose and the blood glucose levels were monitored for 120 min with glucometers (Contour XT, Bayer). Plasma insulin levels were determined with the Ultra Sensitive Mouse Insulin ELISA Kit (90080, Crystal Chem), and HOMA-IR scores were calculated from the fasting blood glucose and plasma insulin levels.

[0167] Plasma hormone levels

[0168] The plasma levels of FGF21 (ab212160, Abeam), glucagon (81518, Crystal Chem), leptin (EZML-82K, Merck), adiponectin (ab226900, Abeam) and Glucagon Like Peptide 1 (GLP1, 81508, Crystal Chem) were determined with the ELISA method according to the manufacturer's instructions. The plasma levels of total ghrelin and active ghrelin were determined with the ELISA method from Merck (EZRGRT-91K and EZRGRA-90K, respectively). Absorbances were determined with the CLARIOstar Plus plate reader (BMG Labtech).P7372PC00

[0169] Plasma lipid analyses

[0170] The plasma total cholesterol, HDL and LDL / VLDL were determined using the Cholesterol Assay Kit - HDL and LDL / VLDL (ab65390, Abeam). The Triglyceride Colorimetric Assay Kit (10010303, Cayman chemical) and the Free Fatty Acid Quantitation Kit (MAK044-1KT, Merck) were used to determine their respective plasma levels. The plasma levels of Apo-B100 (MBS264905, MyBioSource) were determined with the ELISA method according to the manufacturer's instructions.

[0171] Hepatic cholesterol levels

[0172] The hepatic total cholesterol, HDL and LDL / VLDL were determined using the Cholesterol Assay Kit - HDL and LDL / VLDL (ab65390, Abeam). Briefly, 20 mg of liver tissue was homogenized with a TissueLyser II (Qiagen) and the supernatant was used for determination of total cholesterol. HDL and LDL / VLDL were isolated from the supernatant according to the manufacturer's instructions.

[0173] NAD+ / NADH determination

[0174] The hepatic content of NAD+and NADH was quantified by an enzymatic cycling assay as previously described (Dall, M. et al, 2018). Briefly, 10-15 mg of liver tissue was homogenized in 0.6 M perchloric acid (PCA, NAD+) or in 0.1 M NaOH and incubated at 70°C (NADH) and centrifuged. The NAD+supernatant was diluted 1:1000 in 100 mM Na2HPO4 and the NADH supernatant 1:500 in 10 mM Tris-HCl. After the addition of the reaction buffer, fluorescence (Ex 540 nm / Em 580 nm) was determined with a Hidex Sense Microplate Reader and the levels were determined relative to standard curve and normalized to protein content. The protein content was directly determined for NADH, while the NAD+pellets were dissolved in 0.2 M NaOH and incubated at 95°C. Protein concentrations were determined by a standard BCA assay.

[0175] Inositol phosphate (IP) accumulation assay

[0176] The IP accumulation assay was performed as previously described (Frimurer, T. M. et al, 2017). Briefly, human GPR39 (hGPR39) was cloned into the pCMV-Tag (2B) vector encoding an N-terminal FLAG tag (Stratagene). COS7 cells were maintained in Dulbecco’s modified Eagle’s medium (21885-025, Gibco) supplemented with 10% FBS, 2 mM glutamine, 100 units / ml penicillin, and 100 pg / ml streptomycin at 37°C with 10% CO2. 20,000 cells / well were cultured overnight in 96-well plates and transfected (40 pg DNA / well) using the calcium phosphate precipitation method with chloroquine addition.P7372PC00

[0177] The cells were incubated overnight in growth medium containing 0.5 pCi / ml myo-[2-3H]-inositol. The following day, 100 l of HBSS containing 10 mM LiCI was added to each well and subsequently, 10, 1, 0.1 and 0.01 pM FK866 (NAMPT inhibitor, HY-50876, MedChemExpress), which was incubated for 20 minutes followed by a 1.5h incubation with 100, 10, 1, 0.1, 0.01, 0.001 and 0.0001 pM TM-N1324. The cells were lysed and yttrium silicate Scintillation Proximity Assay (YSi-SPA) beads (PerkinElmer) were added to the lysates. The plates were shaken, centrifuged and incubated at RT for 4h, and p-radiation was measured using a MicroBeta machine. Experiments were performed in duplicates, and EC50 values were calculated via non-linear regression using GraphPad PRISM.

[0178] Statistics

[0179] Statistical tests were performed using Student’s two-tailed unpaired t-test to compare two groups or one-way or two-way ANOVA followed by Sidak's post-hoc test for multiple comparisons. Nonparametric scoring data were tested using the Mann-Whitney II test for two groups or Kruskal-Wallis test followed by Dunn’s test for multiple comparisons. Statistical tests were performed with GraphPad Prism 9.5.1. Data are presented as mean ± SEM, scoring data as median. Significance is indicated as *p< 0.05, **p< 0.01 and ***p< 0.001.

[0180] Clustering analysis on RNAseq data

[0181] Clustering analysis was performed on RNAseq data published previously by some of the authors (Dall, M. et al., 2021). Gene Expression Omnibus (GEO) database (accession numbers GSE173406 and GSE174234).

[0182] NADP+ determination

[0183] The hepatic content of NADP+ was quantified by an enzymatic cycling assay as previously described (Dall, M. et al., 2018). Briefly, 10-15 mg of liver tissue was homogenized in 0.6M perchloric acid (PCA) and centrifuged. The supernatant was diluted 1:100 in 100 mM Na2HPO4. After the addition of the reaction buffer, fluorescence (Ex 540 nm / Em 580 nm) was determined with a Hidex Sense Microplate Reader and the levels were determined relative to standard curve and normalized to protein content. The pellets from the PCA extraction were dissolved in 0.2M NaOH and incubated at 95°C. Protein concentrations were determined by a standard BCA assay.P7372PC00

[0184] Table 1. QPCR primer sequences

[0185] Gene Forward primer (5'^ 3') Reverse primer (5'^ 3') Acta2 GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA Actb AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Ccl2 CCTGCTGTTCACAGTTGCC ATTGGGATCATCTTGCTGGT Cd36 AGATGACGTGGCAAAGAACAG CCTTGGCTAGATAACGAACTCTG Cd68 TGTCTGATCTTGCTAGGACCG GAGAGTAACGGCC 1 1 1 1 1 G 1 G Col1a1 GCTCCTCTTAGGGGCCACT CCACGTCTCACCATTGGGG Col4a1 CTGGCACAAAAGGGACGAG ACGTGGCCGAGAATTTCACC Cptla GAGACTTCCAACGCATGACA ATGGGTTGGGGTGATGTAGA F4 / 80 GGATGTACAGATGGGGGATG CATAAGCTGGGCAAGTGGT AAGGTGAAGAGCATCATAACCC

[0186] Fabp4 TCACGCCTTTCATAACACATTCC T GAGACGTGTCACTCCTGGACTT

[0187] Fasn TCCTGGAACGAGAACACGATCT

[0188] G

[0189] Gapdh TGTGTCCGTCGTGGATCTGA TTGCTGTTGAAGTCGCAGGAG Ghsr TGGAGATCGCGCAGATCAG CCGGGAACTCTCATCCTTCAG Glut2 TTCCAGTTCGGCTATGACATCG CTGGTGTGACTGTAAGTGGGG Gpr39 CTTTGCCATGGGTATCGAGT CGTGCAGATGGACATATTGG Gpx1 AGTCCACCGTGTATGCCTTCT GAGACGCGACATTCTCAATG 1110 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG 111b GCAACTGTTCCTGAACTCAACT ATC I l l i GGGGTCCGTCAACT 116 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC Irs1 CGATGGCTTCTCAGACGTG CAGCCCGCTTGTTGATGTTG Irs2 GTAGTTCAGGTCGCCTCTGC TTGGGACCACCACTCCTAAG Mmp9 CTGGACAGCCAGACACTAAAG CTCGCGGCAAGTCTTCAGA Pgcla AGCCGTGACCACTGACAACGAG GCTGCATGGTTCTGAGTGCTAAG Plin2 GACCTTGTGTCCTCCGCTTAT CAACCGCAATTTGTGGCTC Plin4 GTGTCCACCAACTCACAGATG GGACCATTCC I l l i GCAGCAT Pnpla3 TCACCTTCGTGTGCAGTCTC CCTGGAGCCCGTCTCTGAT GTTCTTCTTCTGAATCTTGCAGC

[0190] Ppara CCTGAACATCGAGTGTCGAATAT

[0191] T

[0192] Pparg GCCCACCAACTTCGGAATC TGCGAGTGGTCTTCCATCAC Srebfl GAGCCATGGATTGCACATTT CTCAGGAGAGTTGGCACCTG

[0193]

[0194] P7372PC00

[0195] Tbp AGAACAATCCAGACTAGCAGCA GGGAACTTCACATCACAGCTC Tgfa CACTCTGGGTACGTGGGTG CACAGGTGATAATGAGGACAGC Tgfbl CACTGGAGTTGTACGGCAGTG AGAGCAGTGAGCGCTGAATC Timp 1 GCAACTCGGACCTGGTCATAA CGGCCCGTGATGAGAAACT Tnfa CAAAATTCGAGTGACAAGCCTG GAGATCCATGCCGTTGGC

[0196]

[0197] Table 2. Antibodies for western blot with mouse liver

[0198] Catalog

[0199] Antibody Dilution Manufacturer number

[0200] Anti-CD36 antibody 1:5000 ab124515 Abeam Santa Cruz Anti-ERK 1 / 2 Antibody (C-9) 1:1000 sc-514302

[0201] Biotechnology Anti-PLIN2 antibody 1:1000 A9828 antibodies.com FABP2 / I-FABP Antibody 1:1000 9A9B7B3 Novus Biologicals Cell signaling GAPDH Antibody (H-12) 1:1000 sc- 166574

[0202] technology Phospho-Erk1 / 2 Cell signaling 1:2000 4370S

[0203] (Thr202 / Tyr204) technology Cell signaling Poly / mono-ADP ribose ab 1:1000 E6F6A

[0204] technology SREBP2 Antibody 1:500 NB100-74543 Novus Biologicals Anti-PPAR gamma (Ser112) 1:1000 MAB3632 Merck Millipore

[0205]

[0206] Table 3. Antibodies for western blot with primary hepatocytes

[0207] Antibody Dilution Catalog no. Manufacturer Cell signaling Phospho-Erk1 / 2 (Thr202 / Tyr204) 1:1000 4370S

[0208] technology Cell signaling p44 / 42 MAPK (Erk1 / 2) (137F5) 1:1000 4695

[0209] technology Phospho-MEK1 / 2 (Ser217 / 221) Cell signaling 1:1000 9154

[0210] (41 G9) technology Cell signaling Vinculin (E1E9V) XP® 1:10000 13901

[0211] technology Anti-GAPDH antibody 1:5000 G8795 Sigma-Aldrich

[0212]

[0213] P7372PC00

[0214] Example 1. GPR39 activation by TM-N1324 reverses HFD-induced hepatic fat accumulation and liver damage and downregulates inflammatory and fibrotic mRNA levels.

[0215] We investigated the potential of the GPR39 agonist TM-N1324 to reverse components of the metabolic syndrome and its liver manifestation MASLD. WT mice were fed a HFD for 17 weeks and MASLD development was verified by sacrificing the baseline group. The rest of the mice were then divided into 3 groups and interventions were carried out for 7 weeks: HFD supplemented with 120 mg / kg / day of TM-N1324 or vehicle or normal chow with vehicle (Fig. 1A). For diets supplemented with TM-N1324, the actual ingested doses were calculated based on measured food consumption and body weight of the mice and found to be very close to the aimed doses for all models presented in this paper, with the average for this HFD model being 117 mg / kg / day (Figure 9A). The plasma levels of TM-N1324 after ad libitum feeding and a 2h fast (Fig.

[0216] 1B) were comparable to previously published levels of the same dose (120 mg / kg) achieved by oral gavage (Grunddal, K. V. et al., 2021). The treatment modestly upregulated hepatic Gpr39 mRNA (Figure 9B).

[0217] Most importantly, the TM-N1324 treatment effectively decreased the liver weight and the hepatic triglyceride content of the treated mice compared to both, the vehicle-treated and the baseline groups (Fig. 1C,D). TM-N1324 combined with a HFD was more effective in reducing liver weight and triglycerides than switching the mice to normal chow (Fig. 1C,D). Histological evaluation of steatosis was in agreement with these results (Fig. 1E): Compared to the baseline group, the TM-N1324 treatment resolved the steatosis, whereas in the vehicle-treated mice it was further aggravated. Plasma levels of alanine and aspartate aminotransferases (ALT and AST, Fig. 1F,G), markers of hepatocellular damage, were likewise reduced by the TM-N1324 treatment compared to the vehicle-treated and the baseline groups. Histologically, the HFD-treatment did not result in observable inflammation or fibrosis. However, various mRNA level markers of hepatic inflammation and fibrosis were significantly downregulated by the TM-N1324 treatment compared to the vehicle-treatment (Fig. 1H). To investigate which hepatic cell type is responsible for the GPR39-mediated effects in the liver, clustering analysis on previously published RNAseq data (Dall, M. et al., 2021) was performed. We observed that Gpr39 expression was most abundant in the hepatocytes, with minimal expression levels seen in the stellate cells, endothelial cells, leukocytes and kupfer cells (Figure 9C). Additionally, Gpr39 was highly expressed in both, central and portal zones of the liver, with slightly higher expression in the centralP7372PC00

[0218] zone (Figure 9D). The expression was also retained in primary hepatocytes that were cultured for 24h (Figure 9C). This indicates that the effects by TM-N1324 are mediated by GPR39 signaling in the hepatocytes as opposed to other hepatic cell populations.

[0219] Example 2. TM-N1324 treatment regulates hepatic lipid metabolism through the ERK / MAPK pathway.

[0220] GPR39 activation has been reported to activate the extracellular signal-regulated kinase (ERK1 / 2) signaling (Holst, B. et al., 2004; Azriel-Tamir, H. et al., 2004) and the GPR39 KO mice have been shown to have reduced hepatic ERK phosphorylation (Shendge, A. K. et al., 2024). Additionally, TM-N1324 signals via Gaqj (Grunddal, K. V. et al., 2021), whose activation results in phosphorylation of ERK1 / 2 (Goldsmith, Z. G. et al., 2007). Subsequently, ERK1 / 2-mediated phosphorylation inhibits PPARa and PPARy (Adams, M. et al., 1997; Camp, H. S. et al., 1997), the master regulators of hepatic lipid metabolism, and the inhibition and knockout of PPARa and PPARy have been shown to reduce liver fat accumulation (Wang, Y. et al., 2020). The phosphorylation of ERK also increases SREBP2 expression (Kotzka, J. et al., 2000; Kotzka, J. et al., 1998), which in turn increases VLDL secretion, resulting in increased delivery of liver-derived triglycerides to peripheral tissues, thus reducing triglyceride accumulation in the liver (Kawano, Y. et al., 2013). Therefore, we investigated whether this pathway could be behind the observed liver-protective effects. Indeed, the protein levels of ERK1 / 2, phosphorylated ERK1 / 2 and total SREBP2 were higher in the TM-N 1324-treated mouse livers than in the vehicle-treated, whereas those of phosphorylated PPARy were lower (Fig. 2A). Phosphorylated PPARa was not detectable with antibodies against Ser12 or Ser21, however, Ppara and Ppary were likewise downregulated at the mRNA level, as were various of their direct target genes of hepatic fatty acid metabolism, Fasn, Plin2, Plin4, Cd36 and Fabp4, as well as Srebfl and its target gene Pnpla3 (Fig. 2B).

[0221] Next, to verify the TM-N1324-induced effects on hepatic lipid metabolism, we analyzed the liver proteome by liquid chromatography tandem mass spectrometry (LC-MS / MS). A high number of proteins differing in abundance between the HFD-fed TM-N1324 and vehicle-treated groups was detected (Figure 10). 43 of them were related to fatty acid oxidation and transport, lipogenesis and lipolysis and downregulated by the TM-N1324 treatment compared to the vehicle-treated (Fig. 2C). The reduced levels of FAS, CD36 and PLIN2 were further verified by Western blot analyses (Fig. 2D).

[0222] In order to verify that the observed effects on the ERK pathway are actually mediatedP7372PC00

[0223] by TM-N1324 via GPR39, we next isolated primary hepatocytes from WT and GPR39-deficient (GPR39 KO) mice and treated them with vehicle, 0.1 or 1 pM TM-N1324 or, as a positive control, 0.1 pM phorbol 12-myristate 13-acetate (PMA), which is a protein kinase C activator resulting in ERK phosphorylation. We observed increased levels of ERK and phosphorylated ERK, and additionally, phosphorylated mitogen-activated protein kinase kinase 1 / 2 (MEK1 / 2), when WT cells were treated with 1 pM TM-N1324, but not with the vehicle (Fig. 2E). Additionally, no effects were observed in the GPR39KO hepatocytes, indicating that ERK activation in the mouse livers is indeed mediated by GPR39 upon stimulation with TM-N1324 (Fig. 2E).

[0224] Next, the metabolic effects at mRNA level were studied in the primary hepatocytes treated with TM-N1324 or DMSO. Similar to the effects observed in the mice, the levels of Pparg, Plin4, Cd36 and Cptla were downregulated by TM-N1324 in the WT, but not in the KO cells, indicating the in vivo results were GPR39-mediated and hepatocyte-induced rather than systemic effects on the liver (Fig. 2N). ERK inhibition by 110126 restored the mRNA levels of Plin4, Cd36 and Cptla (Fig. 20), while Pparg mRNA was only partly affected, consistent with the PPAR effects being systemically induced. Interestingly, the direct target of PPARy, Plin2, was unaffected by the TM-N1324 treatment, indicating that this effect in the mice is hepatocyte-independent, likely via the systemic effects of PPARy. ERK appears to provide an additional, target-selective brake on the lipid program that is independent of PPARy.

[0225] Together these data indicate that TM-N1324-induced GPR39 activation reduces HFD-induced hepatic lipid accumulation via the ERK1 / 2 / PPAR / SREBP2-axis and results in significant downregulation of hepatic lipid metabolism.

[0226] Example 3. TM-N1324 treatment improves glucose tolerance and insulin resistance and resolves leptin resistance.

[0227] GPR39 is expressed in the pancreatic islet p-cells, and its deficiency has been shown to impair insulin secretion in isolated pancreatic islets and in vivo (Tremblay, F. et al., 2009; Holst, B. et al., 2009) as well as to alter glucose homeostasis (Verhulst, P. J. et al., 2011). Recently, GPR39KO mice were shown to have elevated fasting blood glucose levels, accompanied by an increased expression of insulin receptor and impairment of its downstream AKT signaling (Shendge, A. K. et al., 2024). Previously, a single oral dose of TM-N1324 had no effect in an oral glucose tolerance testP7372PC00

[0228] (Grunddal, K. V. et al., 2021), but the effect of chronic treatment with a GPR39 agonist on glucose homeostasis and insulin sensitivity has not been previously investigated. As well as governing lipid metabolism, PPARy is a potent modulator of insulin sensitivity in the adipose tissue, where it upregulates genes involved in glucose uptake (Ahmadian, M. et al., 2013). In the liver, PPARa participates in the inhibition of glycolysis and induction of gluconeogenesis (Baes, M. et al., 2010) and regulates FGF-21 (Badman, M. K. et al., 2007). As the effects of TM-N1324 treatment are not liver-targeted but systemic, we next investigated the whole-body glucose and insulin sensitivity of the mice. The TM-N1324 treatment on a HFD improved systemic glucose tolerance and reduced the plasma insulin levels (Fig. 2F,G) more effectively than normal chow treatment. Together with the lower HOMA-IR scores (Fig. 2H), the data indicate that GPR39 activation by TM-N1324 results in improved whole-body glucose tolerance and insulin sensitivity. The hepatic mRNA levels of Irs1 and Irs2 were upregulated by the treatment (Fig. 2I), suggesting improved hepatic insulin sensitivity. Both, circulating FGF-21 and leptin levels are increased in obesity and insulin resistance and associated with metabolic syndrome in humans (Zhang, X. et al., 2008; Gruzdeva, O. et al., 2019). TM-N1324 treatment resolved the FGF-21 and leptin resistance, which had developed in the baseline group and persisted in the vehicle-treated mice (Fig. 2J,K). TM-N1324 treatment did not affect plasma glucagon or adiponectin levels (Fig. 2L,M).

[0229] Example 4. Body weight reduction by TM-N1324 is accompanied by a decreased RER and altered gut hormone levels.

[0230] Notably, the body weight and fat mass of the TM-N1324-treated mice decreased significantly, and the reduction was greater than that caused by the normal chow feeding (Fig. 3A,B). The food intake of the TM-N1324-treated mice was modestly but not significantly reduced (Fig. 3C), whereas there was a significant increase in the water intake and water vapor loss, indicating increased urine production (Fig. 3D,E). Contributing to the lower body weight, the TM-N1324-treated mice had lower respiratory exchange ratio (RER) (Fig. 3F) than the vehicle-treated mice, which suggests higher fatty acid oxidation. No difference was observed in energy expenditure or total physical activity (Fig. 3G,H).

[0231] Plasma total and active ghrelin levels were significantly higher with the TM-N1324 treatment (Fig. 3I,J), which is opposite to previously published results in acute treatment models, where lower food intake and body weight have also been observedP7372PC00

[0232] (Grunddal, K. V. et al., 2021). This is likely a compensatory mechanism for the lower mRNA expression of the ghrelin receptor in a chronic setting (Fig. 3K). Plasma GLP1 levels were increased with the compound treatment (Fig. 3L), similarly to previously published data (Grunddal, K. V. et al., 2021), and in line with the slightly lower food intake.

[0233] Example 5. GPR39 activation by TM-N1324 prevents the development of HF-MCD diet-induced MASH.

[0234] We next used a high fat, low methionine, choline deficient (HF-MCD) diet to induce MASH, resulting in more severe liver damage, inflammation and fibrosis. Methionine and choline are indispensable for hepatic mitochondrial p-oxidation and VLDL synthesis, respectively, and the disease induced by this diet better covers the spectrum of human MASH symptoms (Takahashi, Y. et al., 2017). WT male mice were fed the HF-MCD diet supplemented with 30 or 120 mg / kg / day of TM-N1324 or vehicle for 3 or 9 weeks (Fig. 4A). Due to a rapid weight loss induced by the 120 mg / kg / day dose of TM-N1324 during the 3-week period, the 9-week model was only performed with the 30 mg / kg / day dose, which had no effect on body weight (Fig. 4B). The plasma TM-N1324 levels were similar to those observed with the HFD (Fig. 4C).

[0235] The TM-N1324 treatment effectively protected the mice against hepatic triglyceride accumulation, steatosis (Fig. 4D-F) and liver damage (Fig. 4I,J), the higher dose resulting in more protection. Importantly, protection against hepatic inflammation was also seen with both diet durations and against fibrosis with the 3-week diet (Fig. 4G,H). The majority of the mRNA markers of fatty acid metabolism, inflammation and fibrosis that were significantly altered by TM-N1324 in the HFD-model, were likewise downregulated by the TM-N1324 treatment in this model (Fig. 4K).

[0236] Gpr39 mRNA levels were downregulated in both, 3- and 9-week groups, whereas the ghrelin receptor mRNA was upregulated in the 3-week group but downregulated after 9 weeks (Figure 11A,B). The plasma total ghrelin levels were elevated by the TM-N1324 treatment only in the 3-week group, and no increase was observed in the active ghrelin or GLP1 levels or in food intake with either diet duration (Figure 11 C-F). The total water intake was increased by the TM-N1324 treatment, similarly to the HFD treatment (Figure 11G). Importantly, a body weight-independent liver-protective effect by TM-N1324 could be seen with the 30 mg / kg dose, suggesting liver-mediated protection instead of protection induced by reduced adiposity, as only the 120 mg / kg / day dose resulted in reduction in fat and lean mass (Figure 11 H). However, the protective effectP7372PC00

[0237] was more pronounced in the 120 mg / kg / day group, further supporting a contribution of systemic lipid supply.

[0238] Example 6. TM-N1324 regulates cholesterol metabolism through the ERK-SREBP2 pathway.

[0239] We next investigated the involvement of the earlier-described ERK1 / 2 / SREBP2-axis in cholesterol metabolism, in both, the HFD and the HF-MCD diet-fed mice. In addition to increasing VLDL secretion, SREBP2 is also the master transcriptional regulator of cholesterol biosynthesis (Shimano, H. et al., 2017). The liver proteome analysis of the HFD-fed mice showed that the TM-N1324 treatment upregulated 11 cholesterol synthesis proteins, while HMGCS2 and CYP26A1 were downregulated, and all except NSDHL, CYP51A1 and CYP26A1 are direct SREBP2 target genes (Fig. 5A).

[0240] Additionally, 10 cholesterol transport proteins were downregulated by the TM-N1324 treatment (Fig. 5A). Most notable was the inhibition of the master regulator of triglyceride metabolism, apolipoprotein C-lll (Apoc3), suppressing its function as the lipoprotein lipase inhibitor, thus resulting in increased triglyceride hydrolysis, triglyceride and VLDL clearance from the circulation and hepatic uptake of VLDL (Giammanco, A. et al., 2023). Also ApoB, essential for the assembly and secretion of VLDL and LDL was downregulated by the TM-N1324 treatment, while the intracellular cholesterol transporter NPC1 was upregulated (Fig. 5A). NPC1 is essential for transporting unesterified cholesterol to be used for sterol biosynthesis and membrane integration, preventing its detrimental accumulation (Infante, R. E. et al., 2008;

[0241] Subramanian, K. et al., 2008).

[0242] Compared to the baseline group, the plasma total cholesterol levels of the TM-N1324-treated mice were increased, but less than those of the vehicle-treated mice (Fig. 5B). No difference between the groups was detected in the HDL levels, but the TM-N1324 treatment protected against elevated LDLA / LDL levels observed in the vehicle-treated mice (Fig. 5B). It has previously been reported that the HF-MCD diet reduces circulating total cholesterol and HDL levels (Stankovic, M. N. et al., 2014; Alshawsh, M. A. et al., 2022), and consistently, the vehicle-treated group’s total cholesterol, HDL and LDL / VLDL levels were below the normal range (Fig. 5C). The 120 mg / kg / day TM-N1324 treatment increased their levels back to the normal range (Fig. 5C), likely via normalizing the hepatic lipid metabolism impaired by the HF-MCD diet.

[0243] Additionally, the plasma ApoB100, synthesized by the liver, levels were downregulated by TM-N1324 compared to the vehicle treatment, indicating efficient circulatingP7372PC00

[0244] lipoprotein and cholesterol clearance to counteract the higher levels and corresponding to the hepatic downregulation of ApoB (Fig. 5D). Next, we analyzed the hepatic cholesterol and lipoprotein levels, where no differences were detected in cholesterol or HDL, but a significant increase was detected in the LDL / VLDL by the higher dose-TM-N1324 treatment (Fig. 5E). Additionally, the plasma triglyceride and free fatty acid levels were significantly reduced by TM-N1324 with both diets, the HFD (Fig. 5F,G) and the HF-MCD diet (Fig. 5H,I), the triglyceride reduction being in agreement with the reduced Apoc3 levels.

[0245] These results indicate that TM-N1324 likely increases cholesterol synthesis via increased expression of SREBP2 and its targets in the cholesterol synthesis pathway, accompanied by restorative effects induced by Apoc3 and ApoB downregulation and NPC1 upregulation. In addition, the significantly lower ApoB100 levels in the TM-N1324 treated groups suggest lower risk for atherosclerotic cardiovascular disease. These data suggest that TM-N1324 greatly affects hepatic cholesterol metabolism and the ERK1 / 2 / SREBP2 pathway therefore likely contributes to the observed lower fat accumulation in the TM-N1324-treated livers.

[0246] Example 7. Elevated PARP activity and sufficient hepatic NAD+levels play key roles in the protective effects mediated by TM-N1324.

[0247] The liver proteome data from the HFD model highlighted that NAD / NADP metabolism-related proteins were significantly altered by the TM-N1324 treatment (Fig. 6A). This included proteins involved in the NAD+synthesis as well as NAD consumption enzymes, such as several of the poly-ADP-ribose-polymerases (PARPs), which belong to the ADP-ribosyltransferases and are critical enzymes for DNA repair (Fig. 6A) (Morales, J. C. et al., 2014). The central enzyme for poly-ADP-ribosylated protein (PAR) production in cells, PARP1, was upregulated. Consistent with this observation, hepatic PAR levels were highly elevated by the TM-N1324 treatment (Fig. 6B). As PARP1 is auto-ribosylated, the 102 kDa band likely represents PARP1. To verify NAD+consumption by PARPs, we determined the hepatic levels of NAD+and NADH. Both were lower in the TM-N1324-treated groups (Fig. 6C,D). There was no difference in the NADVNADH ratio (Fig. 6E) or NADP+levels (Figure 12A), indicating increased NAD+consumption by the elevated PARP activity but no redox imbalance caused by it.

[0248] GPR39 has not previously been shown to activate PARPs; however, it has been shown that PARP1 can be activated by binding to ERK2 even in the absence of DNA damage (Cohen-Armon, M. et al., 2007). In addition to PARPs, low NAD+availability potentiallyP7372PC00

[0249] inhibits sirtuins, which has been shown to result in the suppression of ERK signaling (Li, N. et al., 2021 ; Li, Y. et al., 2008; Ding, T. et al., 2021). Thus, if the increased PARP activity contributed to the protective effects induced by TM-N1324, these effects would be dependent on sufficient NAD+levels. Therefore, as PARPs are dependent on NAD+and in this model, ERK2, we hypothesized that adequate intracellular NAD+levels are essential for the liver-protective effects induced by TM-N1324. Nicotinamide phosphoribosyltransferase (NAM PT) catalyzes the rate-limiting step in NAD+biosynthesis (Audrito, V. et al., 2020). Therefore, we repeated the 3-week HF-MCD diet model with simultaneous 30 mg / kg / day TM-N1324 or vehicle treatment in hepatocytespecific NAMPT KO mice, the HNKO mice (Dall, M. et al., 2019) (Nampfm-Albc,e, Fig.

[0250] 6F). The impaired NAD+synthesis in these mice results in -50% lower hepatic NAD+levels compared to the WT mice24. Noteworthily, the effects of TM-N1324 on food and water intake and body weight were similar in both treatment groups of the Nampfm-AlbCremice as they were with the WT male mice (Fig. 6G, Figure 12B,C), as these effects are not liver-mediated.

[0251] To verify that NAMPT deficiency does not directly interfere with the TM-N1324-induced GPR39 signaling, we treated COS7 cells with TM-N1324 and the NAMPT inhibitor FK866 and measured inositol trisphosphate (IP3) production, which was not affected by any concentration of FK866 (Fig. 60). None of the ERK-PPARy-mediated or other mRNA level markers of fatty acid metabolism, inflammation or fibrosis, which were downregulated by TM-N1324 in the WT mice, were affected by the treatment in the Nampf'!f'-AlbCremice (Fig. 6P). This indicates that NAMPT itself is not essential for GPR39-mediated signaling, but that the lack of protective effects is due to the resulting deficiency in NAD+and the subsequent inhibition of ERK signaling. To further verify the role of PARP activity, we measured the hepatic levels of PAR proteins in the Nampfm-AlbCremice. The TM-N1324 treatment did not increase PAR protein levels in these mice. In contrast, significantly increased protein abundance was observed in the WT mice on the HF-MCD diet treated with TM-N1324 (Fig. 6Q). The ERK2-activated PARP1 has been shown to exhibit a significantly greater affinity for NAD+; therefore, the lower NAD+levels resulting from the TM-N1324-treatment would likely not decrease the elevated PARP activity (Cohen-Armon, M. et al., 2007).

[0252] These data suggest that TM-N1324 treatment results in ERK2-dependent PARP activation, which likely increases hepatic DNA repair, as well as amplifies ERK signaling, enhancing the ERK-mediated liver-protection. It is noteworthy that no liver-protective effects were observed in the hepatocyte-specific Nampfm-Albc,esetting,P7372PC00

[0253] implicating that the TM-N1324-induced effects are mediated by the hepatocytes.

[0254] Additionally, a large number of oxidoreductase proteins were altered by TM-N1324 treatment, the majority of them being downregulated compared to the vehicle-treatment (Figure 12E). Taking into account the lack of liver damage in the TM-N1324-treated livers (Fig. 1 E,F), the oxidoreductases are likely activated upon need in the vehicle-treated livers to combat the liver damage.

[0255] Example 8. TM-N1324-induced liver-protective effects are specifically mediated by GPR39.

[0256] Next, we wanted to verify whether the protective effects of the TM-N1324 treatment were exclusively mediated by GPR39, by repeating the 3-week HF-MCD diet model with simultaneous treatment with 120 mg / kg / day TM-N1324 or vehicle in GPR39 knockout mice and their WT littermates (Fig. 7A). Gpr39 mRNA levels were undetectable in the KO mice (Fig. 7B), and as with the commercial WT males on the HF-MCD diet, the TM-N1324 treatment reduced the Gpr39 expression in the WT littermates. Total water intake was increased and body weight decreased by the treatment in the WT littermates but not in the KO mice (Fig. 7C,D). Similarly, the TM-N1324 treatment protected the WT littermates against hepatic triglyceride accumulation and liver damage, but had no effect on the liver health of the KO mice (Fig. 7E,F, l-J). The TM-N1324 treatment did not affect plasma total ghrelin, active ghrelin or GLP1 levels or food intake in any groups (Figure 13A-D).

[0257] The TM-N1324 treatment downregulated the majority of the mRNA markers of fatty acid metabolism, inflammation and fibrosis in the WT littermates, but they were unaffected in the KO mice (Fig. 7K), correlating with no liver protection seen in the KO mice and verifying that these mRNA level effects are mediated by GPR39.

[0258] Remarkably, when comparing the vehicle-treated groups to each other, deficiency of GPR39 did not exacerbate the HF-MCD diet-induced liver disease compared to the WT littermates.

[0259] Example 9. GPR39 agonism by TM-N1324 therapeutically treats HF-MCD diet-induced MASH.

[0260] To verify that the pharmaceutical protection observed in male mice also applies to female mice, we next investigated whether the TM-N1324 treatment would be potent enough to reverse an advanced HF-MCD diet-induced MASH in female mice. The mice were pre-exposed to the HF-MCD diet for 2.5 weeks, the MASH development wasP7372PC00

[0261] verified by sacrificing the baseline group, and the rest of the mice were divided into 2 groups and treated with 120 mg / kg / day TM-N1324 or vehicle for 3 weeks (Fig. 8A). The TM-N1324 treatment did not affect plasma total ghrelin, active ghrelin or GLP1 levels or food intake (Fig. 8B, Figure 14A-C), similarly to the GPR39KO WT littermates, whereas water intake was increased and body weight decreased (Fig. 80, D). The TM-N1324 treatment was able to reduce the liver weight, hepatic triglyceride content, steatosis and liver damage from the baseline, and compared to the vehicle-treatment (Fig. 8D-G,J,K). The treatment also ameliorated the development of hepatic inflammation, but did not reverse fibrosis (Fig. 8H , I).

[0262] The plasma cholesterol, HDL and LDL / VLDL were not affected by TM-N1324 in the female mice, whereas the plasma triglyceride and free fatty acid levels were lower than in the vehicle-treated (Figure 13D-F). TM-N1324 was proven effective also in the female mice and in addition to being preventive to the disease development, can also reverse MASH -related symptoms.

[0263] Sequence overview

[0264] QPCR primer sequences from Table 1.

[0265] Forward primers (5'— » 3')

[0266] SEQ ID NO.: 1 (Gene = Acta2)

[0267] GTCCCAGACATCAGGGAGTAA SEQ ID NO.: 2 (Gene = Actb)

[0268] AGAGGGAAATCGTGCGTGAC SEQ ID NO.: 3 (Gene = Cc / 2)

[0269] CCTGCTGTTCACAGTTGCC SEQ ID NO.: 4 (Gene = Cd36)

[0270] AGATGACGTGGCAAAGAACAG SEQ ID NO.: 5 (Gene = Cd68)

[0271] TGTCTGATCTTGCTAGGACCG SEQ ID NO.: 6 (Gene = CollaT)

[0272] GCTCCTCTTAGGGGCCACT SEQ ID NO.: 7 (Gene = Col4a1)

[0273] CTGGCACAAAAGGGACGAG SEQ ID NO.: 8 (Gene = F4 / 80)

[0274] GGATGTACAGATGGGGGATG SEQ ID NO.: 9 (Gene = Fabp4)P7372PC00

[0275] AAGGTGAAGAGCATCATAACCCT SEQ ID NO.: 10 (Gene = Fasn) TCCTGGAACGAGAACACGATCT SEQ ID NO.: 11 (Gene = Gapdh) TGTGTCCGTCGTGGATCTGA SEQ ID NO.: 12 (Gene = G / ?sr) TGGAGATCGCGCAGATCAG SEQ ID NO.: 13 (Gene = G!ut2) TTCCAGTTCGGCTATGACATCG SEQ ID NO.: 14 (Gene = Gpr39) CTTTGCCATGGGTATCGAGT SEQ ID NO.: 15 (Gene = Gpx1) AGTCCACCGTGTATGCCTTCT SEQ ID NO.: 16 (Gene = 1110) GCTCTTACTGACTGGCATGAG SEQ ID NO.: 17 (Gene = 111b) GCAACTGTTCCTGAACTCAACT SEQ ID NO.: 18 (Gene = 116) TAGTCCTTCCTACCCCAATTTCC SEQ ID NO.: 19 (Gene = Irs 1) CGATGGCTTCTCAGACGTG SEQ ID NO.: 20 (Gene = Irs2) GTAGTTCAGGTCGCCTCTGC SEQ ID NO.: 21 (Gene = Mmp9) CTGGACAGCCAGACACTAAAG SEQ ID NO.: 22 (Gene = Pgda) AGCCGTGACCACTGACAACGAG SEQ ID NO.: 23 (Gene = Plin2) GACCTTGTGTCCTCCGCTTAT SEQ ID NO.: 24 (Gene = Plin4) GTGTCCACCAACTCACAGATG SEQ ID NO.: 25 (Gene = Pnpla3) TCACCTTCGTGTGCAGTCTC SEQ ID NO.: 26 (Gene = Ppara) CCTGAACATCGAGTGTCGAATATP7372PC00

[0276] SEQ ID NO.: 27 (Gene = Pparg) GCCCACCAACTTCGGAATC SEQ ID NO.: 28 (Gene = Srebfl) GAGCCATGGATTGCACATTT SEQ ID NO.: 29 (Gene = Tbp) AGAACAATCCAGACTAGCAGCA SEQ ID NO.: 30 (Gene = Tgfa) CACTCTGGGTACGTGGGTG SEQ ID NO.: 31 (Gene = Tgfbl) CACTGGAGTTGTACGGCAGTG SEQ ID NO.: 32 (Gene = TimpT) GCAACTCGGACCTGGTCATAA SEQ ID NO.: 33 (Gene = Tnfa) CAAAATTCGAGTGACAAGCCTG SEQ ID NO.: 67 (Gene = Cptla) GAGACTTCCAACGCATGACA

[0277] Reverse primers (5'^ 3')

[0278] SEQ ID NO.: 34 (Gene = Acta2) TCGGATACTTCAGCGTCAGGA SEQ ID NO.: 35 (Gene = Actb) CAATAGTGATGACCTGGCCGT SEQ ID NO.: 36 (Gene = Cc / 2) ATTGGGATCATCTTGCTGGT SEQ ID NO.: 37 (Gene = Cd36) CCTTGGCTAGATAACGAACTCTG SEQ ID NO.: 38 (Gene = Cd68) GAGAGTAACGGCCTTTTTGTG SEQ ID NO.: 39 (Gene = CollaT) CCACGTCTCACCATTGGGG SEQ ID NO.: 40 (Gene = Co!4a1) ACGTGGCCGAGAATTTCACC SEQ ID NO.: 41 (Gene = F4 / 80) CATAAGCTGGGCAAGTGGT SEQ ID NO.: 42 (Gene = Fabp4)P7372PC00

[0279] TCACGCCTTTCATAACACATTCC SEQ ID NO.: 43 (Gene = Fasn) GAGACGTGTCACTCCTGGACTTG SEQ ID NO.: 44 (Gene = Gapdh) TTGCTGTTGAAGTCGCAGGAG SEQ ID NO.: 45 (Gene = G / ?sr) CCGGGAACTCTCATCCTTCAG SEQ ID NO.: 46 (Gene = G!ut2) CTGGTGTGACTGTAAGTGGGG SEQ ID NO.: 47 (Gene = Gpr39) CGTGCAGATGGACATATTGG SEQ ID NO.: 48 (Gene = Gpx1) GAGACGCGACATTCTCAATG SEQ ID NO.: 49 (Gene = 1110) CGCAGCTCTAGGAGCATGTG SEQ ID NO.: 50 (Gene = 111b) ATCTTTTGGGGTCCGTCAACT SEQ ID NO.: 51 (Gene = 116) TTGGTCCTTAGCCACTCCTTC SEQ ID NO.: 52 (Gene = Irs 1) CAGCCCGCTTGTTGATGTTG SEQ ID NO.: 53 (Gene = Irs2) TTGGGACCACCACTCCTAAG SEQ ID NO.: 54 (Gene = Mmp9) CTCGCGGCAAGTCTTCAGA SEQ ID NO.: 55 (Gene = Pgda) GCTGCATGGTTCTGAGTGCTAAG SEQ ID NO.: 56 (Gene = Plin2) CAACCGCAATTTGTGGCTC SEQ ID NO.: 57 (Gene = Plin4) GGACCATTCCTTTTGCAGCAT SEQ ID NO.: 58 (Gene = Pnpla3) CCTGGAGCCCGTCTCTGAT SEQ ID NO.: 59 (Gene = Ppara) GTTCTTCTTCTGAATCTTGCAGCTP7372PC00

[0280] SEQ ID NO.: 60 (Gene = Pparg)

[0281] TGCGAGTGGTCTTCCATCAC SEQ ID NO.: 61 (Gene = Srebfl)

[0282] CTCAGGAGAGTTGGCACCTG SEQ ID NO.: 62 (Gene = Tbp)

[0283] GGGAACTTCACATCACAGCTC SEQ ID NO.: 63 (Gene = Tgfa)

[0284] CACAGGTGATAATGAGGACAGC SEQ ID NO.: 64 (Gene = Tgfbl)

[0285] AGAGCAGTGAGCGCTGAATC SEQ ID NO.: 65 (Gene = TimpT)

[0286] CGGCCCGTGATGAGAAACT SEQ ID NO.: 66 (Gene = Tnfa)

[0287] GAGATCCATGCCGTTGGC SEQ ID NO.: 68 (Gene = Cptla)

[0288] ATGGGTTGGGGTGATGTAGA

[0289] References

[0290] 1. Dall, M. et al. Mitochondrial function in liver cells is resistant to perturbations in NAD+ salvage capacity. J. Biol. Chem. 294, 13304-13326 (2019).

[0291] 2. Holst, B. etal. G protein-coupled receptor 39 deficiency is associated with pancreatic islet dysfunction. Endocrinology 150, 2577-2585 (2009).

[0292] 3. Frimurer, T. M. et al. Model-Based Discovery of Synthetic Agonists for the Zn2+- Sensing G-Protein-Coupled Receptor 39 (GPR39) Reveals Novel Biological Functions. J. Med. Chem. 60, 886-898 (2017).

[0293] 4. Ye, Z. etal. Characterization of TGF-p signaling in a human organotypic skin model reveals that loss of TGF-pRII induces invasive tissue growth. Sci. Signal. 15, (2022).

[0294] 5. Batth, T. S. et al. Protein aggregation capture on microparticles enables multipurpose proteomics sample preparation. Mol. Cell. Proteomics 18, 1027-1035 (2019).P7372PC00

[0295] 6. Sanders, M. J. etal. Natural (dihydro)phenanthrene plant compounds are direct activators of AM PK through its allosteric drug and metabolite-binding site. J. Biol. Chem. 298, (2022).

[0296] 7. Patel, K. etal. The LKB1 -salt-inducible kinase pathway functions as a key gluconeogenic suppressor in the liver. Nat. Commun. 5, (2014).

[0297] 8. Dall, M. et al. Hepatic NAD+ levels and NAMPT abundance are unaffected during prolonged high-fat diet consumption in C57BL / 6JBomTac mice. Mol. Cell.

[0298] Endocrinol. 473, 245-256 (2018).

[0299] 9. Dall, M. et al. Hepatocyte-specific perturbation of NAD+ biosynthetic pathways in mice induces reversible nonalcoholic steatohepatitis-like phenotypes. J. Biol. Chem. 297, 1 (2021).

[0300] 10. Grunddal, K. V etal. Selective release of gastrointestinal hormones induced by an orally active GPR39 agonist. Mol. Metab. 101207 (2021) doi:10.1016 / j.molmet.2021.101207.

[0301] 11. Holst, B. et al. Common structural basis for constitutive activity of the ghrelin receptor family. J. Biol. Chem. 279, 53806-53817 (2004).

[0302] 12. Azriel-Tamir, H., Sharir, H., Schwartz, B. & Herskfinkel, M. Extracellular zinc triggers ERK-dependent activation of Na + / H+ exchange in colonocytes mediated by the zinc-sensing receptor. J. Biol. Chem. 279, 51804-51816 (2004)

[0303] 13. Shendge, A. K., Sekler, I. & Hershfinkel, M. ZnR / GPR39 Regulates Hepatic Insulin Signaling, Tunes Liver Bioenergetics and ROS Production, and Mitigates Liver Fibrosis and Injury. Redox Biol. 103403 (2024) doi:10.1016 / J.REDOX.2024.103403

[0304] 14. Goldsmith, Z. G. & Dhanasekaran, D. N. G Protein regulation of MAPK networks.

[0305] Oncogene 2007262226, 3122-3142 (2007).

[0306] 15. Adams, M., Reginato, M. J., Shao, D., Lazar, M. A. & Chatterjee, V. K.P7372PC00

[0307] Transcriptional activation by peroxisome proliferator-activated receptor gamma is inhibited by phosphorylation at a consensus mitogen-activated protein kinase site. J. Biol. Chem. 272, 5128-5132 (1997).

[0308] 16. Camp, H. S. &Tafuri, S. R. Regulation of peroxisome proliferator-activated receptor gamma activity by mitogen-activated protein kinase. J. Biol. Chem. 272, 10811— 10816 (1997).

[0309] 17. Wang, Y., Nakajima, T., Gonzalez, F. J. & Tanaka, N. PPARs as Metabolic Regulators in the Liver: Lessons from Liver-Specific PPAR-Null Mice. Int. J. Mol. Sci. 21, (2020).

[0310] 18. Kotzka, J. etal. Sterol regulatory element binding proteins (SREBP)-la and SREBP-2 are linked to the MAP-kinase cascade. J. Lipid Res. 41, 99-108 (2000).

[0311] 19. Kotzka, J. etal. ADD1 / SREBP-1c Mediates Insulin-Induced Gene Expression Linked to the MAP Kinase Pathway. Biochem. Biophys. Res. Commun. 249, 375- 379 (1998).

[0312] 20. Kawano, Y. & Cohen, D. E. Mechanisms of hepatic triglyceride accumulation in non-alcoholic fatty liver disease. J. Gastroenterol. 48, 434-441 (2013).

[0313] 21. Tremblay, F. etal. Disruption of G protein-coupled receptor 39 impairs insulin secretion in vivo. Endocrinology 150, 2586-2595 (2009).

[0314] 22. Verhulst, P. J. et al. GPR39, a receptor of the ghrelin receptor family, plays a role in the regulation of glucose homeostasis in a mouse model of early onset diet-induced obesity. J. Neuroendocrinol. 23, 490-500 (2011).

[0315] 23. Ahmadian, M. etal. PPARy signaling and metabolism: the good, the bad and the future. Nat. Med. 19, 557-566 (2013).

[0316] 24. Baes, M. & Peeters, A. Role of PPARa in Hepatic Carbohydrate Metabolism. PPAR Res. 2010, 12 (2010).P7372PC00

[0317] 25. Badman, M. K. etal. Hepatic Fibroblast Growth Factor 21 Is Regulated by PPARa and Is a Key Mediator of Hepatic Lipid Metabolism in Ketotic States. Cell Metab. 5, 426-437 (2007).

[0318] 26. Zhang, X. etal. Serum FGF21 Levels Are Increased in Obesity and Are Independently Associated With the Metabolic Syndrome in Humans. Diabetes 57, 1246-1253 (2008).

[0319] 27. Gruzdeva, O., Borodkina, D., Uchasova, E., Dyleva, Y. & Barbarash, O. Leptin resistance: underlying mechanisms and diagnosis. Diabetes, Metab. Syndr. Obes. Targets Ther. 12, 191 (2019).

[0320] 28. Takahashi, Y. & Fukusato, T. Animal Models of Liver Diseases. Anim. Model. Study Hum. Dis. Second Ed. 313-339 (2017) doi:10.1016 / B978-0-12-809468-6.00013-9.

[0321] 29. Shimano, H. & Sato, R. SREBP-regulated lipid metabolism: convergent physiology — divergent pathophysiology. Nat. Rev. Endocrinol. 2017131213, 710-730 (2017).

[0322] 30. Giammanco, A., Spina, R., Cefalu, A. B. & Averna, M. APOC-III: a Gatekeeper in Controlling Triglyceride Metabolism. Curr. Atheroscler. Rep. 25, 67 (2023).

[0323] 31. Infante, R. E. etal. NPC2 facilitates bidirectional transfer of cholesterol between NPC1 and lipid bilayers, a step in cholesterol egress from lysosomes. Proc. Natl. Acad. Sci. U. S. A. 105, 15287-15292 (2008).

[0324] 32. Subramanian, K. & Balch, W. E. NPC1 / NPC2 function as a tag team duo to mobilize cholesterol. Proc. Natl. Acad. Sci. U. S. A. 105, 15223-15224 (2008).

[0325] 33. Stankovic, M. N. etal. Time-dependent Changes and Association Between Liver Free Fatty Acids, Serum Lipid Profile and Histological Features in Mice Model of Nonalcoholic Fatty Liver Disease. Arch. Med. Res. 45, 116-124 (2014).

[0326] 34. Alshawsh, M. A. etal. A Comparison of the Gene Expression Profiles of Non- Alcoholic Fatty Liver Disease between Animal Models of a High-Fat Diet andP7372PC00

[0327] Methionine-Choline-Deficient Diet. Molecules 27, (2022).

[0328] 35. Morales, J. C. etal. Review of Poly (ADP-ribose) Polymerase (PARP) Mechanisms of Action and Rationale for Targeting in Cancer and Other Diseases. Crit. Rev. Eukaryot. Gene Expr. 24, 15 (2014).

[0329] 36. Cohen-Armon, M. etal. DNA-independent PARP-1 activation by phosphorylated ERK2 increases Elk1 activity: a link to histone acetylation. Mol. Cell 25, 297-308 (2007).

[0330] 37. Li, N. etal. Inhibition of Sirtuin 3 prevents titanium particle-induced bone resorption and osteoclastsogenesis via suppressing ERK and JNK signaling. Int. J. Biol. Sci.

[0331] 17, 1382-1394 (2021).

[0332] 38. Li, Y., Xu, W., McBurney, M. W. & Longo, V. D. SirT1 inhibition reduces IGF-I / IRS- 2 / Ras / ERK1 / 2 signaling and protects neurons. Cell Metab. 8, 38 (2008).

[0333] 39. Ding, T. & Hao, J. Sirtuin 2 knockdown inhibits cell proliferation and RAS / ERK signaling, and promotes cell apoptosis and cell cycle arrest in multiple myeloma. Mol. Med. Rep. 24, 1-8 (2021).

[0334] 40. Audrito, V., Messana, V. G. & Deaglio, S. NAMPT and NAPRT: Two Metabolic Enzymes With Key Roles in Inflammation. Front. Oncol. 10, 515269 (2020).

Claims

43P7372PC00Claims1. A compound for use in the treatment of a fatty liver disease (hepatic steatosis), wherein the compound has the structure of formula (I),FNClN^N HNformula (I),or a tautomer or a stereoisomer such as an enantiomer thereof,or a pharmaceutically acceptable salt thereof.

2. The compound for use according to claim 1 , wherein the compound is a GPR39 agonist.

3. A GPR39 agonist for use in the treatment of a fatty liver disease (hepatic steatosis).

4. The compound for use according to any one of claims 1 to 3, wherein said compound is administered in combination with a Zn2+source.

5. The compound for use according to claim 4, wherein the Zn2+source is pharmaceutically acceptable.

6. The compound for use according to any one of claims 4 and 5, wherein the Zn2+source is selected from zinc sulphate, zinc gluconate, zinc acetate, zinc citrate, zinc picolinate, zinc oxide, zinc chloride, zinc oronate, zinc bisglycinate, and zinc carbonate.

7. The compound for use according to any one of claims 4 to 6, wherein said Zn2+source is administered prior to, simultaneously with, or subsequently to the compound of formula (I).

8. The compound for use according to any one of claims 4 to 7, wherein the molar ratio between said compound of formula (I) and said Zn2+source is in the range44P7372PC00of 1:10000 to 10:1 in plasma.

9. The compound for use according to any one of the preceding claims, wherein the fatty liver disease is:a. metabolic dysfunction-associated fatty liver disease (MASLD);b. metabolic dysfunction-associated steatohepatitis (MASH);c. liver fibrosis; ord. inflammation associated with a fatty liver disease.

10. The compound for use according to claim 9, wherein the MASLD is:a. non-alcoholic fatty liver disease without non-alcoholic steatohepatitis; b. non-alcoholic steatohepatitis;c. other specified non-alcoholic fatty liver disease; ord. unspecified non-alcoholic fatty liver disease.

11. A method of reducing the plasma level of:a. alanine aminotransferase (ALT);b. aspartate aminotransferase (AST);c. triglycerides;d. free fatty acids; ore. any combination thereofin a subject, said method comprising administering a GPR39 agonist.

12. The method according to claim 11, wherein the GPR39 agonist has the structure of formula (I):ciNx.N HNformula (I),or a tautomer or a stereoisomer such as an enantiomer thereof,or a pharmaceutically acceptable salt thereof.

13. The method according to any one of claims 11 and 12, wherein said reduction of ALT is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at45P7372PC00least 60%, or at least 70%.

14. The method according to any one of claims 11 and 12, wherein said reduction of AST is at least 10% or at least 20%.

15. A method of reducing hepatic steatosis in a subject, said method comprising administering a GPR39 agonist.

16. The method according to claim 15, wherein the GPR39 agonist has the structure of formula (I):cilU / N HNformula (I),or a tautomer or a stereoisomer such as an enantiomer thereof,or a pharmaceutically acceptable salt thereof.

17. A GPR39 agonist for use in the treatment of inflammation, such as liver inflammation.

18. The GPR39 agonist for use according to claim 17, wherein the GPR39 agonist has the structure of formula (I):FNCllU / N HNformula (I),or a tautomer or a stereoisomer such as an enantiomer thereof,or a pharmaceutically acceptable salt thereof.

19. A method of reducing inflammation, such as inflammation of the liver, said method comprising administering a GPR39 agonist.

20. The method according to claim 19, wherein the GPR39 agonist has theP7372PC00structure of formula (I):formula (I),or a tautomer or a stereoisomer such as an enantiomer thereof, or a pharmaceutically acceptable salt thereof.

21. A GPR39 agonist for use in the treatment of fibrosis, such as liver fibrosis,22. The method according to claim 21, wherein the GPR39 agonist has the structure of formula (I):formula (I),or a tautomer or a stereoisomer such as an enantiomer thereof, or a pharmaceutically acceptable salt thereof.

23. A method of reducing fibrosis, such as fibrosis in the liver, said method comprising, administering a GPR39 agonist.

24. The method according to claim 23, wherein the GPR39 agonist has the structure of formula (I):formula (I),or a tautomer or a stereoisomer such as an enantiomer thereof, or a pharmaceutically acceptable salt thereof.

25. A pharmaceutical composition comprising, a compound of formula (I):P7372PC00formula (I),or a tautomer or a stereoisomer such as an enantiomer thereof, or a pharmaceutically acceptable salt thereof;anda Zn2+source.

26. A kit of parts comprising:i) a compound of formula (I):formula (I),or a tautomer or a stereoisomer such as an enantiomer thereof, or a pharmaceutically acceptable salt thereofandii) a Zn2+source.

27. The kit of parts according to claim 26, wherein the compound and the Zn2+source are for separate or successive administration.

Images