Selective KCNQ2 inhibition

Abstract

This disclosure relates to selective blockers or inhibitors of expression and activity of the voltage sensing potassium (K+) channel Kv7.2, more in particular to RNAi oligonucleotides targeting a hotspot region spanning the 3' end of exon 2 and the 5' end of exon 3 of KCNQ2 transcripts. Such selective blockers or inhibitors are in particular useful in treating disorders or symptoms of disorders in carriers of KCNQ2 gain of function mutations.

Description

[0001] RoRad / KCNQ2 / 878

[0002] SELECTIVE KCNQ2 INHIBITION

[0003] FIELD OF THE INVENTION

[0004] This disclosure relates to selective blockers or inhibitors of expression and activity of the voltage sensing potassium (K+) channel Kv7.2, more in particular to RNAi oligonucleotides targeting a hotspot region spanning the 3' end of exon 2 and the 5' end of exon 3 of KCNQ2 transcripts. Such selective blockers or inhibitors are in particular useful in treating disorders or symptoms of disorders in carriers of KCNQ2 gain of function mutations.

[0005] BACKGROUND TO THE INVENTION KCNQ2 and KCNQ3 encode subunits, Kv7.2 and Kv7.3, respectively, of a voltage-sensing K+ channel that is widely expressed in the central nervous system. Kv7.2 channels play an important role in reducing neuronal excitability by promoting membrane repolarization and dampening repetitive firing. Loss-of-function (LOF) pathogenic variants in KCNQ2 and KCNQ3 (inherited or occurring de novo) typically result in neonatal seizures, with the more severe dominant negative mutations leading to additional severe, neurodevelopmental delay (NDD) or disability. The occurrence of neonatal seizures is therefore often the basis for screening for the presence of mutations in the KCNQ2 gene. Recently, several pathogenic KCNQ2 and KCNQ3 gain of function (GOF) variants have been described which increase Kv7.2 channel activity, globally dysregulating neuronal excitability. GOF pathogenic variants in KCNQ2 and KCNQ3 lead to neurodevelopmental and autism spectrum disorders, with childhood onset epilepsy in some individuals (Varghese et al. 2023, J Neurosci 43:6479-6494). Known KCNQ2 GOF variants include R144Q / W / G, V175L, R198Q, R201C / H, Y141N, and G239S (Bayat et al. 2024, Neurotherapeutics 21:e00296).

[0006] Kv7.2-specific treatment options are limited and therapeutic strategies primarily focus on targeting the symptoms and not the underlying cause. Control of seizures is important to prevent sudden unexpected death in epilepsy (SUDEP) and includes administration of antiseizure drugs such as carbamazepine or phenytoin (Pisano et al. 2015, Epilepsia 56:685-691). In cases of Kv7.2 loss-of-function, the therapeutic aim is to increase Kv7.2 function (increase overall Kv7.2 activity and / or increase expression of wild-type Kv7.2), and the potassium channel opener retigabine or ezogabine has been prescribed to individuals with LoF variants (Weckhuysen et al. 2013, Neurology 81:1697-1703; Millichap et al. 2016, Neurol Genet 2:e96). In a trial aiming at treating focal-onset seizures with retigabine, a series of adverse effects were reported (Porter et al. 2007, Neurology 68:1197-204) - nevertheless, retigabine was granted orphan status by EMEA (EU / 3 / 20 / 2332).

[0007] In case of Kv7.2 gain-of-function, the therapeutic aim is to decrease Kv7.2 function or activity. In this patient group, the primary clinical concerns are the neurodevelopmental problems. The antidepressantRoRad / KCNQ2 / 878

[0008] amitriptyline, one of its effects being non-selective blockade of multiple ion channels, was reported to help a patient with a mild GOF mutation (Bayat et al. 2024, Neurotherapeutics 21:e00296). A follow up retrospective study showed the effects of amitriptyline remain unclear in the absence of a formal trial (De Wachter et al. 2025, Epilepsia 66:1628-1640).

[0009] WO2021 / 178769 discloses a number of hotspots in KCNQ2 RNA transcripts that are amenable for reducing their abundance by means of antisense oligonucleotides (ASOs).

[0010] US2021 / 268667 relates to ASOs targeting alternative splicing in genes, more in particular inducing skipping of a non-sense mediated mRNA decay (NMD)-inducing exon present in pre-mRNA, therewith elevating the mRNA and protein levels. One of the many target genes listed in US2021268667 is KCNQ2. WO2023 / 102242 and WO2023 / 102548 relates to ASOs optionally including a spacer ("splice switcher" ASOs) with the aim of reducing the number mis-spliced transcripts and increasing the number of full length transcripts, KCNQ2 again being one of the many envisaged target genes.

[0011] SUMMARY OF THE INVENTION

[0012] The invention is set out in the appended set of claims.

[0013] This disclosure relates to oligonucleotides with a length of 10 to 50 nucleotides, wherein said oligonucleotide comprises a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of any one of SEQ ID NOs:1 to 8, 10, 14 to 16, 36 or 37; or a pharmaceutically acceptable salt thereof. In particular thereto, these oligonucleotides are capable of inhibiting the expression of a wild-type KCNQ2 gene and / or of a gain of function mutant KCNQ2 gene in a cell. In one embodiment, the sequence of contiguous nucleotides of such an oligonucleotide is fully complementary to an equal length portion of SEQ ID NOs:1 to 8, 10, 14 to 16, 36 or 37. In one embodiment, any such oligonucleotide is a single stranded nucleic acid molecule, or alternatively is an antisense oligonucleotide or the antisense portion of an RNAi molecule. In a further embodiment any of such oligonucleotides may be comprising a modified nucleoside and / or a modified internucleoside linkage. In a further embodiment any of such oligonucleotides may be a gapmer oligonucleotide. Relating to the sequence of any of such oligonucleotides, the sequence of contiguous nucleotides may be a sequence of at least 15 nucleotides in length. Relating to the sequence of any of such oligonucleotides, the sequence of contiguous nucleotides constituting the gap of the gapmer may be a sequence of at least 10 nucleotides in length.

[0014] This disclosure further relates to compositions comprising any of the above oligonucleotides or pharmaceutically acceptable salt thereof. In particular, such compositions may further be comprising a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.RoRad / KCNQ2 / 878

[0015] This disclosure further relates to any of the above oligonucleotides or compositions for use as a medicament; or more in particular for use in treating, suppressing or preventing a disorder or a complication of a disorder associated with KCNQ2 overactivity in a subject; for use in treating, suppressing or preventing a disorder or a complication of a disorder in a subject having a KCNQ2 gain of function mutation; or for use in treating, suppressing or preventing a disorder or a complication of a disorder in a subject diagnosed to have a KCNQ2 gain of function mutation. Herein, the disorder may be a neurological disorder, or the complication of the disorder may be the complication of a neurological disorder. Such neurological disorder or complication of neurological disorder in particular is epileptic activity, epileptic spasms, non-epileptic myoclonus or epileptic seizures.

[0016] BRIEF DESCRIPTION OF THE FIGURES FIGURE 1. Nucleotide sequence of the joined KCNQ2 exon2 / exon3 mRNA region of the KCNQ2 gene ("exon2-3", SEQ ID NO:12; as derived from GenBank accession number NM_172107.4) and of the reverse complement nucleotide sequences of the ASOs tested in the ASO walk (" ASOxnrc" wherein x is +, -, or nothing; n is the indicated number: 1, 2, 3, 4, 6, 8, or 16); and rc stands for reverse complement). The boundary between the exon2 and exon3 regions is indicated by a vertical line between nucleotides 91 and 92 of SEQ ID NO:12. ASOxnrc sequences in grey-shaded italics are not active in inhibiting KCNQ2 expression, thus defining a 64-nt ASO hotspot region spanning nucleotides 51 to 114 of SEQ ID NO:12, or, alternatively, spanning 41 nucleotides of exon2 and 23 nucleotides of exon3.

[0017] FIGURE 2. (A) Profile of KCNQ2 expression after 72 hrs incubation with 1 or 3 pM ASO or ASO-MOE treatment; n=l. (B) Profile of KCNQ3 expression after 72 hrs of 1 pM ASO treatment; n=l. KCNQ2 and KCNQ3 expression is indicated as % relative to vehicle control treatment.

[0018] FIGURE 3. Amino acid sequence of the Kv7.2 protein encoded by KCNQ2 (Uniprot 043526-1). The boxed region is targeted by the ASOs in the corresponding (pre-)mRNA. The wild-type amino acids known to be the location of gain of function mutations are indicated as underlined bold residues and are located in exon 3 (Y141 and R144), exon 4 (V175, R198, R201) and exon 5 (G239).

[0019] FIGURE 4. Time course of KCNQ2 RNA knockdown with 1 pM ASO treatment. ASOs 3, 8 and 16 induced a reduction of KCNQ2 transcript after 48 hrs treatment, which was sustained for 1 week of incubation; n=3, *p<0.05. KCNQ2 expression is indicated as % relative to vehicle control.

[0020] FIGURE 5. Concentration-response profiles of ASO3, 8 and 16. No effect of the negative Ctrl ASO on KCNQ2 expression was detected at any concentrations used; relative expression is shown for the highest two concentrations tested for reference; n=3. KCNQ2 expression is expressed as % relative to vehicle control.RoRad / KCNQ2 / 878

[0021] FIGURE 6. Expression of recombinant GFP-tagged KCNQ2 protein heterologously expressed in HEK cells. Compared to the negative Ctrl ASO treatment, significantly lower fluorescence signal was measured in wells treated with ASO3, 8 and 16 for all timepoints between 12 hrs and 3 days; n=4, *p <0.05. Expression of GFP-tagged KCNQ2 is indicated as % relative to vehicle control.

[0022] FIGURE 7. Functional effects of ASO-treatment on R201C GOF KCNQ2 neuronal cells (heterozygous mutation) cultured for 49 days as determined by high-density microelectrode array (HD-MEA) measurements. A Crispr-corrected isogenic wildtype of the R201C line is included for comparison. (A) The percentage of recording electrodes detecting biological signal ("active area [%]"); (B) spike frequency (in Hertz) over the entire chip ("mean fire rate [Hz]"); (C) network burst activity ("spikes per burst (count)"); and (D) Network burst duration ("burst duration [sec]"). *DIV49 comparison between ASO3 and Ctrl ASO treatment; n>3, *p<0.05. (E) Greater than 90% reduction of KCNQ2 expression after 49 days of incubation with ASOs was measured using RNA extracted from cells plated in parallel to those cultures used for HD-MEA experiments; n>3, *p<0.05. DIV: days in vitro (same as days in culture).

[0023] FIGURE 8. Alignment of the nucleotide sequence of intron 2 of KCNQ2 with the reverse complement sequence of ASO17.

[0024] FIGURE 9. Expression levels of human neuronal KCNQ250 days after a single 1 pM exposure at DIV1 with ASO3, negative control ASO (no human target), or ASO17. Wells received half-media changes twice weekly without further addition of ASO or PBS. Only ASO3 induced long-term sustained reduction of KCNQ2 transcript (n=3; each replicate represents two pooled wells across N=3 batches: ****ANOVA, p<0.05).

[0025] FIGURE 10. Effect of ASO3 treatment on the mean firingRate (spike frequency [Hz]) R201C KCNQ2-GOF phenotype. (A): effect of 1 pM ASO3 and a control ASO ("ctrl ASO) administered at timepoint DIV1. (B): effect of 50 nM ASO3 and a control ASO ("ctrl ASO) administered at timepoint DIV1. (C): effect of 1 pM ASO3 and a control ASO ("ctrl ASO) administered at timepoint DIV35 (indicated by black vertical bar. (D): firing rate area under the curves for the indicated ASOs and concentrations. (E): firing rate area between the curves for the indicated ASOs and concentrations. ****p<0.05; n>9

[0026] FIGURE 11. Rescue of KCNQ2-GOF hypoexcitable phenotype by (A) ASO3 administered at 1 pM at DIV1 in a R201H KCNQ2 GOF cell line; (B), (C) and (D) ASO 8, ASO16 and ASO17, respectively, administered at 1 pM at DIV1 in a R201C KCNQ2 GOF cell line. n=3 for (A) to (C), n=6 for (D).

[0027] DETAILED DESCRIPTION

[0028] As obviated from the introduction, a balanced activity of the voltage sensing potassium channel Kv7.2 or KCNQ2 is crucial for normal neuronal function and activity. That balance can be disturbed by too low KCNQ2 or Kv7.2 activity (loss-of-function, LOF) or by too high KCNQ2 or Kv7.2 activity (gain-of-function, GOF). In specifically targeting too high KCNQ2 or Kv7.2 activity, therapies partially knocking out KCNQ2RoRad / KCNQ2 / 878

[0029] or Kv7.2 expression is a viable option in treating disorders or symptoms of disorders associated with Kv7.2 / KCNQ2 gain-of-function mutations. The approach taken as set out herein relies on knock-down of expression of wild-type and / or GOF KCNQ2 expression. As knockdown approaches are not 100% successful, leftover wild-type KCNQ2 protein and leftover GOF KCNQ2 protein together establish a total level of KCNQ2 functional activity that is normalized or is reaching wild-type-like levels compared to the situation in which there is no knock-down of expression of wild-type and / or GOF KCNQ2 expression, as is illustrated herein in Figure 7: indeed, upon in vitro reduction of > 90% expression of wild-type and GOF KCNQ2 in a heterozygous GOF KCNQ2 mutant neuronal cell line, near normal neuronal functionalities were detected.

[0030] Based hereon, a number of aspects and embodiments of this disclosure are described; terms as used while describing these aspects and embodiments are subsequently explained and defined in further detail in order to clarify their meaning in as far as would be required and / or in order to provide some scope of equivalents.

[0031] In one aspect, this disclosure relates to oligonucleotides with a length of 10 to 50 nucleotides, wherein said oligonucleotides are comprising a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:36 or SEQ ID NO:37, to an equal length portion of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:36 or SEQ ID NO:37 in which thymine residues are exchanged for uracil residues, to an equal length portion of any one of SEQ ID NOs: 1 to 7, 8 or 10, or to an equal length portion of any one of SEQ ID NOs: 1 to 7, 8 or 10 in which thymine residues are exchanged for uracil residues; or a pharmaceutically acceptable salt of such oligonucleotides. Herein, SEQ ID NO:14 is representing the contiguous region spanning the 3' end of exon 2 (subregion defined in / by SEQ ID NO:15) and the 5' end of exon 3 (subregion defined in / by SEQ ID NO:16) of the KCNQ2 transcript; this region has been delineated herein as a hotspot region particularly amenable for reducing KCNQ2 expression, in particular of reducing expression of wild-type KCNQ2 and / or gain of function (GOF) mutation KCNQ2 (as the known GOF mutations are located outside the hotspot region, see Figure 3). Herein, anyone of SEQ ID NOs:1 to 7 represent the reverse complement sequences of exemplary oligonucleotides targeting the hotspot region and resulting in reduced KCNQ2 expression, and together defining the hotspot region of SEQ ID NO:14. SEQ ID NO:36 is a subregion of SEQ ID NO:14. SEQ ID NO:37 comprises SEQ ID NO:14 as subregion and enlarges the hotspot region with a region amenable for reducing KCNQ2 expression in a delayed but prolonged manner (see further). In particular, as explained above, the levels of KCNQ2 expression remaining after targeting the hotspot region with an antisense oligonucleotide (single stranded or comprised in a double stranded molecule) are sufficient for normal neuron function, or, alternatively are normalizing neuron function (as comparedRoRad / KCNQ2 / 878

[0032] to the situation in which expression of wild-type KCNQ2 and GOF mutant KCNQ2 result in disturbed neuron function). The "a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of any one of SEQ ID NOs: 1 to 7, 8, 10, 14, 15, 16, 36 or 37, or to an equal length portion of SEQ ID NOs: 1 to 7, 8, 10, 14, 15, 16, 36 or 37 in which thymine residues are exchanged for uracil residues" is referred to hereinafter also as "the sequence of contiguous nucleotides" or "the sequence of contiguous nucleotides in / of (any of / any one of) the above or herein described oligonucleotides".

[0033] Thus, in one embodiment, the above oligonucleotides in particular are oligonucleotides capable of inhibiting the expression of a wild-type KCNQ2 gene and / or of a gain of function mutant KCNQ2 gene in a cell, in particular in a cell carrying a GOF KCNQ2 mutation such as a heterozygous GOF KCNQ2 mutation. In another, not mutually exclusive embodiment, the above oligonucleotides in particular are oligonucleotides capable of normalizing KCNQ2 function or activity in a cell carrying a GOF KCNQ2 mutation such as a heterozygous GOF KCNQ2 mutation. In particular, such cell is a neuronal cell.

[0034] KCNQ2 function can be defined in different ways. Normal KCNQ2 activity is required for maintaining the neuronal excitatory-inhibitory balance; as such normal KCNQ2 activity is required to prevent or to dampen excessive repetitive firing. Normal KCNQ2 activity is reducing neuronal excitability by promoting membrane repolarization. Normal KCNQ2 activity is furthermore required to maintain a correct M-current, the slowly activating and deactivating potassium determining the subthreshold electrical excitability of neurons (Wang et al. 1998, Science 282:1890-1893). Parameters that can be used to explore, e.g. in vitro, the function or activity of KCNQ2-comprising channels include the total neuronal firing rate, the interspike interval among the fastest firing spikes, and the rate of development (time to reach % active electrode milestones) (see Examples herein).

[0035] In another embodiment, the sequence of contiguous nucleotides of the above described oligonucleotides is fully complementary to an equal length portion of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:36, or SEQ ID NO:37, to an equal length portion of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:36 or SEQ ID NO:37 in which thymine residues are exchanged for uracil residues, to an equal length portion of any one of SEQ ID NOs: 1 to 7, 8 or 10, or to an equal length portion of any one of SEQ ID NOs: 1 to 7, 8 or 10 in which thymine residues are exchanged for uracil residues.

[0036] In a further embodiment, any of the above described oligonucleotides is a single stranded nucleic acid molecule. Furthermore in particular, such a single stranded oligonucleotide is chosen from or selected from the group consisting of an antisense oligonucleotide and the antisense portion of an RNAi (such as siRNA or shRNA) molecule.RoRad / KCNQ2 / 878

[0037] In another embodiment, any of the above described oligonucleotides may comprise naturally occurring nucleotides, or may comprise a modified nucleoside and / or a modified internucleoside linkage. Nucleotide modifications may reside in the sugar moiety and / or in the nucleobase moieties of the nucleoside and / or in the internucleoside linkage; such possible modifications are described in more detail hereinafter.

[0038] In a further embodiment, any of the above described oligonucleotides may be gapmer oligonucleotides, such as an LNA gapmer oligonucleotide. In particular, the sequence of contiguous nucleotides constituting the gap of a gapmer is a sequence of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24, or 25 nucleotides in length. In a particular embodiment thereto, the gap of a gapmer is a sequence of at least 5, at least 10, or at least 15 nucleotides in length. Furthermore in particular, the sequences of contiguous nucleotides constituting a wing of a gapmer (one wing flanking the 5' end of the gap, one wing flanking the 3' end of the gapmer) is a sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24, or 25 nucleotides in length. In a particular embodiment thereto, a wing of a gapmer is a sequence of at least 1, or at least 5 nucleotides in length.

[0039] In yet a further embodiment, the sequence of contiguous nucleotides in any of the above described oligonucleotides in particular is a sequence of, or a sequence of at least, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In a particular embodiment thereto, the sequence of contiguous nucleotides in any of the above described oligonucleotides in particular is a sequence of at least 15, at least 20, or at least 25 nucleotides in length. Other embodiments / description relating to the length of these oligonucleotides are described in more detail hereinafter.

[0040] In a further embodiment, any one of the above oligonucleotides with a length of 10 to 50 nucleotides, wherein said oligonucleotide comprises a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of any one of SEQ ID NOs:l-7, 8, 10, 14, 15, 16, 36 or 37, or to an equal length portion of any one of SEQ ID NOs:l-7, 8, 10, 14, 15, 16, 36 or 37 in which thymine residues are exchanged for uracil residues, is further defined or characterized by:

[0041] - the region of complementarity to the KCNQ2 nucleotide sequence being limited to SEQ ID NO:14, confined to SEQ ID NO:14, or not extending outside SEQ ID NO:14, i.e. is not extending at its 5' or 3' end into e.g. SEQ ID NO:12 or into the KCNQ2 nucleotide sequence represented by GenBank accession number NM_172107.4 (as partly represented in Figure 1 / SEQ ID NO:12); or

[0042] - the region of complementarity to the KCNQ2 nucleotide sequence being limited to SEQ ID NO:15, confined to SEQ ID NO:15, or not extending outside SEQ ID NO:15, i.e. is not extending at its 5' or 3' end into e.g. SEQ ID NO:12 or into the KCNQ2 nucleotide sequence represented by GenBank accession number NM_172107.4 (as partly represented in Figure 1 / SEQ ID NO:12); orRoRad / KCNQ2 / 878

[0043] - the region of complementarity to the KCNQ2 nucleotide sequence being limited to SEQ ID NO:16, confined to SEQ ID NO:16, or not extending outside SEQ ID NO:16, i.e. is not extending at its 5' or 3' end into e.g. SEQ ID NO:12 or into the KCNQ2 nucleotide sequence represented by GenBank accession number NM_172107.4 (as partly represented in Figure 1 / SEQ ID NO:12); or

[0044] - the region of complementarity to the KCNQ2 nucleotide sequence being limited to SEQ ID NO:36, confined to SEQ ID NO:36, or not extending outside SEQ ID NO:36, i.e. is not extending at its 5' or 3' end into e.g. SEQ ID NO:12 or into the KCNQ2 nucleotide sequence represented by GenBank accession number NM_172107.4 (as partly represented in Figure 1 / SEQ ID NO:12); or

[0045] - the region of complementarity to the KCNQ2 nucleotide sequence being limited to SEQ ID NO:37, confined to SEQ ID NO:37, or not extending outside SEQ ID NO:37, i.e. is not extending at its 5' or 3' end into e.g. SEQ ID NO:12 or into the KCNQ2 nucleotide sequence represented by GenBank accession number NM_172107.4 (as partly represented in Figure 1 / SEQ ID NO:12); or

[0046] - the region of complementarity to the KCNQ2 nucleotide sequence being limited to either one of SEQ ID NOs:l to, 8 or 10 (meaning SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 or SEQ ID NO:10), confined to either one of SEQ ID NOs:1 to 7, 8 or 10, or not extending outside either one of SEQ ID NOs:1 to 7, 8 or 10, i.e. is not extending at its 5' or 3' end into e.g. SEQ ID NO:12 or into the KCNQ2 nucleotide sequence represented by GenBank accession number NM_172107.4 (as partly represented in Figure 1 / SEQ ID NO:12);

[0047] In view of the above embodiments, the scope of the oligonucleotides is further clarified hereinafter. As such, oligonucleotides with a length of 10 to 50 nucleotides are included, wherein said oligonucleotides comprise:

[0048] - a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of any one of SEQ ID NOs:1-7, 8, 10, 14-16, 36 or 37 or to an equal length portion of any one of SEQ ID NOs:1-7, 8, 10, 14-16, 36 or 37 in which thymine residues are exchanged for uracil residues;- a sequence of 10 to 50 contiguous nucleotides that is fully complementary to an equal length portion of any one of SEQ ID NOs: 1-7, 8, 10, 14-16, 36 or 37 or to an equal length portion of any one of SEQ ID NOs: 1-7, 8, 10, 14-16, 36 or 37 in which thymine residues are exchanged for uracil residues;

[0049] - a sequence of (optionally: at least) 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length that is at least 90% complementary or is fully complementary to an equal length portion of any one of SEQ ID NOs: 1-7, 8, 10, 14-16, 36 or 37 or to an equal length portion of any one of SEQ ID NOs:l-7, 8, 10, 14-16, 36, or 37 in which thymine residues are exchanged for uracil residues; orRoRad / KCNQ2 / 878

[0050] - a sequence of (optionally: at least) 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length that is at least 90% complementary or is fully complementary to an equal length portion of any one of SEQ ID NOs:l-7, 8, 10, 14-16, 36 or 37 or to an equal length portion of any one of SEQ ID NOs:l-7, 8, 10, 14-16, 36 or 37 in which thymine residues are exchanged for uracil residues, wherein the region of complementarity to the KCNQ2 nucleotide sequence is limited to, confined to, or not extending outside SEQ ID NO:14 or SEQ ID NO:15 or SEQ ID NO:16 or SEQ ID NO:36 or SEQ ID NO:37 or SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or SEQ ID NO:10; i.e. is not extending at its 5' or 3' end into e.g. SEQ ID NO:12 or into the KCNQ2 nucleotide sequence represented by GenBank accession number NM_172107.4 (as partly represented in Figure 1 / SEQ ID NO:12).

[0051] It will be clear that the length of the "sequence of 10 to 50 contiguous nucleotides" is in part defined by the sequence which is referred to. For instance SEQ ID NOs:1, 3-7, 8 and 10 are 16 nucleotides in length, which implies that the "sequence of 10 to 50 contiguous nucleotides" in fact is a sequence of 10 to 16 ((optionally: at least) 10, 11, 12, 13, 14, 15 or 16) contiguous nucleotides. SEQ ID NO:2 is 15 nucleotides in length implying that the "sequence of 10 to 50 contiguous nucleotides" in fact is a sequence of 10 to 15 ((optionally: at least) 10, 11, 12, 13, 14, or 15) contiguous nucleotides. SEQ ID NO:15 is 41 nucleotides in length implying that the "sequence of 10 to 50 contiguous nucleotides" in fact is a sequence of 10 to 41 ((optionally: at least) 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or 41) contiguous nucleotides. SEQ ID NO:16 is 23 nucleotides in length implying that the "sequence of 10 to 50 contiguous nucleotides" in fact is a sequence of 10 to 23 ((optionally: at least) 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides. SEQ ID NO:36 is 48 nucleotides in length implying that the "sequence of 10 to 50 contiguous nucleotides" in fact is a sequence of 10 to 48 ((optionally: at least) 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48) contiguous nucleotides. SEQ ID NO:14 is 64 nucleotides in length. SEQ ID NO:37 is 80 nucleotides in length.

[0052] A further embodiment covers oligonucleotides with a length of 10 to 50 nucleotides, wherein said oligonucleotides are comprising:

[0053] - a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of SEQ ID NO: 3, 4, 5, 7, 15 or 36; or

[0054] - a sequence of 10 to 50 contiguous nucleotides that is fully complementary to an equal length portion of SEQ ID NO:3, 4, 5, 7, 15 or 36; orRoRad / KCNQ2 / 878

[0055] - a sequence of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length that is fully complementary to an equal length portion of SEQ ID NO: 1, 2, 14 or 16; or

[0056] - a sequence of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length that is fully complementary to an equal length portion of SEQ ID NO:6, 14; or

[0057] - a sequence of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length that is fully complementary to an equal length portion of SEQ ID NO: 5, 14, 15 or 36;

[0058] and wherein the region of complementarity is confined to SEQ ID NO:14,

[0059] and wherein the sequence of 10 to 50 contiguous nucleotides is at most 16 contiguous nucleotides in case of complementarity (relative) to an equal length portion of SEQ ID NOs: 1, 3, 4, 5, 6 or 7, is at most 15 contiguous nucleotides in case of complementarity (relative) to SEQ ID NO:2, is at most 41 contiguous nucleotides in case of complementarity (relative) to an equal length portion of SEQ ID NO:15, is at most 23 contiguous nucleotides in case of complementarity (relative) to an equal length portion of SEQ ID NO:16, or is at most 48 contiguous nucleotides in case of complementarity (relative) to an equal length portion of SEQ ID NO:36.

[0060] A further embodiment covers oligonucleotides with a length of 10 to 50 nucleotides, wherein said oligonucleotides are comprising a sequence of 10 to 50 contiguous nucleotides that is at least 90% or fully complementary to an equal length portion of SEQ ID NO: 8, 10 or 37, wherein the region of complementarity is confined to SEQ ID NO:37,

[0061] and wherein the sequence of 10 to 50 contiguous nucleotides is at most 16 contiguous nucleotides in case of complementarity (relative) to an equal length portion of SEQ ID NOs: 8 or 10.

[0062] In a further aspect, this disclosure relates to compositions comprising any one of the above described oligonucleotides or pharmaceutically acceptable salt thereof / of any one of the above described oligonucleotides. In particular, such compositions may further be comprising a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. Further in particular, such compositions are pharmaceutical compositions, e.g. medicaments.

[0063] A diluent, solvent, carrier, salt and / or adjuvant in general is both pharmaceutically acceptable (which can be administered to a subject without in itself causing severe side effects) and suitable for supporting stability, and storage if required, of the oligonucleotides as described hereinabove; and is alternatively defined as a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0064] Such pharmaceutical composition can optionally comprise a further therapeutic agent.RoRad / KCNQ2 / 878

[0065] In another aspect, this disclosure relates to any one of the above oligonucleotides or compositions for use as a medicament or for use in the manufacture of a medicament.

[0066] In another aspect, this disclosure relates to any one of the above oligonucleotides or compositions for use in treating, suppressing or preventing a disorder or a symptom or complication of a disorder associated with KCNQ2 overactivity in a subject; for use in treating, suppressing or preventing a disorder or a symptom or complication of a disorder in a subject having / carrying a KCNQ2 gain of function mutation; or for use in treating, suppressing or preventing a disorder or a symptom or complication of a disorder in a subject diagnosed to have a KCNQ2 gain of function mutation;

[0067] for use in the manufacture of a medicament for treating, suppressing or preventing a disorder or a symptom or complication of a disorder associated with KCNQ2 overactivity in a subject; for use in the manufacture of a medicament for treating, suppressing or preventing a disorder or a symptom or complication of a disorder in a subject having / carrying a KCNQ2 gain of function mutation; or for use in the manufacture of a medicament for treating, suppressing or preventing a disorder or a symptom or complication of a disorder in a subject diagnosed to have a KCNQ2 gain of function mutation.

[0068] Alternatively, any of the above oligonucleotides or compositions are used in a method for treating, suppressing or preventing a disorder or a symptom or complication of a disorder associated with KCNQ2 overactivity in a subject; in a method for treating, suppressing or preventing a disorder or a symptom or complication of a disorder in a subject having / carrying a KCNQ2 gain of function mutation; or in a method for treating, suppressing or preventing a disorder or a symptom or complication of a disorder in a subject diagnosed to have a KCNQ2 gain of function mutation. In these methods, any one of the above oligonucleotides or compositions are administered to a subject in need thereof; in particular, an effective dose of any one of the above oligonucleotides or compositions is administered. Further in particular, the administration of any one of the above oligonucleotides or compositions to the subject is resulting in treating, suppressing or preventing in a subject a disorder or a symptom or complication of a disorder associated with KCNQ2 overactivity or with the activity of a KCNQ2 gain of function mutation.

[0069] In yet another aspect, this disclosure relates to any one of the above oligonucleotides or compositions for use in (or for use in the manufacture of a medicament for) treating, suppressing or preventing in a subject a disorder or a symptom or complication of a disorder associated with KCNQ2 overactivity or with the activity of a KCNQ2 gain of function mutation, comprising:RoRad / KCNQ2 / 878

[0070] isolating a nucleic acid from a sample obtained from the subject - in particular embodiments the nucleic acid is DNA and RNA or mRNA, is DNA, is RNA, is genomic DNA, or is mRNA determining if the subject is having or carrying a KCNQ2 gain of function mutation in the (isolated) nucleic acid; or, alternatively, detecting the presence of a KCNQ2 gain of function mutation (such as a heterozygous KCNQ2 gain of function mutation) in the nucleic acid of the subject

[0071] administering a therapeutically effective amount of any one of the above oligonucleotides or compositions to the subject if the subject is having or carrying a KCNQ2 gain of function mutation (such as a heterozygous KCNQ2 gain of function mutation) in the nucleic acid; or, alternatively, administering a therapeutically effective amount of any one of the above oligonucleotides or compositions to the subject if a KCNQ2 gain of function mutation (such as a heterozygous KCNQ2 gain of function mutation) is detected in the nucleic acid of the subject. Likewise alternatively, methods of treating, suppressing or preventing in a subject a disorder or a symptom or complication of a disorder associated with KCNQ2 overactivity or with the activity of a KCNQ2 gain of function mutation may comprise one or more steps selected from the group consisting of:

[0072] isolating a nucleic acid from a sample obtained from the subject - in particular embodiments the nucleic acid is DNA and RNA or mRNA, is DNA, is RNA, is genomic DNA, or is mRNA determining if the subject is having or carrying a KCNQ2 gain of function mutation in the nucleic acid; or, alternatively, detecting the presence of a KCNQ2 gain of function mutation (such as a heterozygous KCNQ2 gain of function mutation) in the nucleic acid of the subject administering a therapeutically effective amount of any one of the above oligonucleotides or compositions to the subject if the subject is having or carrying a KCNQ2 gain of function mutation (such as a heterozygous KCNQ2 gain of function mutation) in the nucleic acid; or, alternatively, administering a therapeutically effective amount of any one of the above oligonucleotides or compositions to the subject if a KCNQ2 gain of function mutation (such as a heterozygous KCNQ2 gain of function mutation) is detected in the nucleic acid of the subject.

[0073] In particular in relation to any of the above medical uses or methods, the disorder is a neurological disorder, or the symptom or complication of the disorder is the symptom or complication of a neurological disorder. Furthermore in particular, the neurological disorder, symptom or complication of the neurological disorder is a disorder, symptom or complication of a disorder as listed in Table 1. More in particular, the neurological disorder or symptom or complication of the neurological disorder is epileptic activity, epileptic spasms, or epileptic seizures, or any combination of any thereof.RoRad / KCNQ2 / 878

[0074] In a further aspect, this disclosure further relates to (therapeutic / pharmaceutical / medicament) kits or kits of parts comprising a container or vial (any suitable container or vial, such as a pharmaceutically acceptable container or vial) comprising an oligonucleotide or salt thereof as described above or a composition comprising an oligonucleotide or salt thereof as described above; in particular such oligonucleotide comprising an antisense portion targeting the KCNQ2 hotspot region defined in / by SEQ. ID NO:14. Other optional components of such kits include e.g. a container or vial (any suitable container or vial, such as a pharmaceutically acceptable container or vial) comprising a further therapeutic agent. Further optional components of such kit include use instructions (such as e.g. kit insert such as approved by regulatory instance such as FDA or EMEA); one or more containers with sterile pharmaceutically acceptable carriers, excipients or diluents [such as for producing or formulating a (pharmaceutically acceptable) composition of the current disclosure]; one or more syringes; one or more needles; an instrument for intrathecal administration; etc. In particular, such kits may be pharmaceutical kits. Further optional components of such kit include the tools, such as a primer or probe (optionally further e.g. reagents for performing a PCR), for detecting the presence of a KCNQ2 GOF mutation in a nucleic acid as obtained from a subject.

[0075] In one embodiment relating to the oligonucleotides targeting the KCNQ2 hotspot as described herein, these oligonucleotides are specifically or selectively reducing the expression of KCNQ2.

[0076] KCNQ2

[0077] KCNQ2 is also known as potassium voltage-gated channel subfamily KQT member 2, potassium voltage-gated channel subfamily Q member 2, voltage-gated potassium channel subunit Kv7.2, or as Kv7.2. The human gene is located on human chr20:63, 400, 208-63, 472, 677 (GRCh38 / hg38), human chr20:62, 031, 561-62, 104, 008 ((GRCh37 / hgl9 by NCBI Gene), or human chr20:62, 037, 542-62, 103, 993 (GRCh37 / hgl9 by Ensembl). The Uniprot protein accession number is 043526, with secondary accessions including 043796, 075580, 095845, Q4VXP4, Q4VXR6, Q5VYT8, Q96J59, and Q99454. ENSEMBL protein references include: ENSP00000352035, ENSP00000487469, ENSP00000518917, ENSP00000516702, ENSP00000486706, ENSP00000486040, ENSP00000487142, ENSP00000486194, ENSP00000359244, ENSP00000518901, ENSP00000490734, ENSP00000349789, ENSP00000353668, ENSP00000339611, ENSP00000490142, ENSP00000487384, ENSP00000518908, ENSP00000345523, ENSP00000518902, ENSP00000518960, ENSP00000486509, and ENSP00000487563. REFSEQ protein references include: XP_011527113.1, XP_016883330.1, XP_016883331.1, XP_016883332.1, XP_016883333.1, XP_016883334.1, XP_047296100.1, XP_047296101.1, XP_054179400.1, XP_054179401.1, XP_054179402.1, XP_054179403.1, XP_054179404.1, XP_054179405.1, XP_054179406.1, XP_054179407.1, NP_001369164.1, NP_004509.2, NP_742104.1, NP_742105.1,RoRad / KCNQ2 / 878

[0078] NP_742106.1, and NP_742107.1. REFSEQ mRNA sequences include: NM_001382235.1, NM_004518.6, NM_172106.3, NM_172107.4 (partly represented in Figure 1), NM_172108.5, and NM_172109.3.

[0079] Gain of function (GOF) mutations in KCNQ2

[0080] As indicated in the introduction, GOF KCNQ2 variants include R144Q / W / G, V175L, R198Q, R201C / H, Y141N, and G239S - symptoms are summarized in Table 1 (adapted from Bayat et al. 2024, Neurotherapeutics 21:e00296).

[0081] Table 1. Symptoms associated with KCNQ2 gain of function mutations

[0082]

[0083] Oligonucleotide - RNAi - equal length - complementarity

[0084] When referring to "oligonucleotide", "oligomers" or "oligo's", this is to be understood in its common general meaning as a molecule comprising at least one strand of at least 2 covalently linked nucleoside or nucleotide monomers wherein each of the monomers may be naturally occurring or may comprise one or more of any type of chemical modifications in e.g. the sugar moiety and / or oligonucleotide-forming backbone moiety of the monomer. Oligonucleotides generally are of synthetic nature (e.g. via common solid phase chemical synthesis) allowing synthesis of large quantities of uniform or homogenous product. Obviously it may be required to purify, isolate and / or concentrate synthesized oligonucleotides. Oligonucleotides or oligomers are nucleic acid molecules, in particular nucleic acid molecules having a restricted length (number of covalently linked nucleotides together forming a contiguous sequence). The length of synthetic oligomers usually does not exceed about 200 nucleotides, and usually is in the range of 10 to 50 nucleotides. Lengths of the oligonucleotides subject of the current disclosure have already been described hereinabove and will be described further hereinafter.

[0085] Oligonucleotides or oligomers usually are designed to bind to a target nucleic acid - the nucleotide sequence of the oligonucleotide therefore is complementary to the nucleotide sequence of the target nucleic acid. Oligo's find common uses (non-exhaustive list) as primers or probes, and as antisense oligonucleotides (ASOs). The binding of an oligo to a target nucleic acid is mediated via hybridization or Watson-Crick base-pairing (canonical base-pairing: adenine (A) forms a base pair with thymine (T),RoRad / KCNQ2 / 878

[0086] guanine (G) forms a base pair with cytosine (C); if one of the pairing strands is or contains RNA nucleotides, thymine is replaced by uracil (U)).

[0087] Medical applications of oligo's rely on their capacity to interfere with expression of a gene targeted by the oligo (a process known as RNA interference, RNAi). Means to achieve RNAi include RNAse H-mediated transcript knockdown (by means of specifically designed antisense oligonucleotides (ASOs, singlestranded), RNA-induced silencing complex (RISC)- mediated transcript knockdown (by means of small interfering RNAs (siRNAs, double-stranded) or short hairpin RNAs (shRNAs, double-stranded); and modulation of pre-mRNA splicing using splice switching ASOs. Binding of the ASOs (DNA) with the target (pre-)mRNA target sequence (RNA) creates a DNA: RNA hybrid duplex which is recognized by RNase H that cleaves the duplex, therewith resulting in (pre-)mRNA degradation and reduced gene expression. siRNA (and shRNA) is processed by RISC after which the antisense strand (relative to the mRNA target) remains and is forming a RNA:mRNA: RISC complex that subsequently degrades the mRNA. The introduction of one or more modifications in oligo's for medical application may be very useful, e.g. for increasing stability, improving target affinity, improving bioavailability, and / or improving enhance cellular uptake. The terms "antisense oligonucleotides" or " ASOs" are used interchangeably in this disclosure, refer to short oligonucleotides that can alter RNA and reduce, restore, or modify protein expression through various mechanisms. The ASOs are preferably synthetic molecules. In particular, the term ASO is referring to an oligonucleotide capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. An antisense oligonucleotide (ASO), can be, for example a single stranded antisense oligonucleotide, such as a high affinity modified antisense oligonucleotide interacting with RNase H, such as a gapmer. The antisense oligonucleotides can be single stranded or can be part of a double stranded siRNA or shRNA molecule. It is understood that a single stranded oligonucleotides can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity is less than 50% across of the full length of the oligonucleotide.

[0088] The terms "contiguous nucleotides", "contiguous nucleotide sequence" or "contiguous sequence" refer to the region of the oligonucleotide which is complementary to the target nucleic acid (sequence), more in particular complementary to part or portion of the target nucleic acid (sequence)

[0089] having a length equal to the length of the contiguous nucleotide sequence of the oligo, also referred to herein as the equal length part or equal length portion of the target nucleic acid (sequence). Herein, the equal length part or equal length portion of the target nucleic acid (sequence) is likewise a contiguous sequence. Thus, an oligo as referred to herein comprises a contiguous sequence that is complementary to an equal length (contiguous) part or (contiguous) portion of the target sequence. Alternatively, an oligo as referred to herein comprises a (contiguous) sequence that is complementary to an equal lengthRoRad / KCNQ2 / 878

[0090] (contiguous) part or (contiguous) portion of a target sequence. The contiguous sequence of the oligo may comprise the full or entire oligo sequence, or may comprise only a part or portion of the oligo sequence (wherein another part or portion of the oligo is not complementary to the target sequence; such non-complementary part may e.g. be a linker monomer or linker oligo). The terms "reverse complement", "reverse complementary" and "reverse complementarity" as used herein are interchangeable with the terms "complement", "complementary" and "complementarity".

[0091] Complementarity as referred to above does not require full complementarity (100 % complementarity) between the (contiguous) oligo sequence and the (contiguous)(equal length part or portion of the) target sequence. It is indeed common general knowledge that, in order to achieve Watson-Crick base-pairing between two nucleic acid strands, no full homology is required or some degree of mismatching is allowed and not substantially interfering with target-specific binding between the two nucleic acid strands. In particular for ASOs, this has been demonstrated by e.g. Woolf et al. 1992 (Proc Natl Acad Sci USA 89:7305-7309). When referring to oligo's herein, these may in particular contain up to 10% nucleotides that are not complementary to those present in the target sequence. Alternatively phrased, such oligo is thus at least 90%, at least 95% or is 100% complementary to an equal length portion of the sequence of the target sequence. Complementarity can be determined by any known means and can involve using a tool for aligning sequences (e.g. ClustalW, Clustal Omega, Cobalt,...). Calculation of a defined % complementarity for shorter nucleic acid sequences may provide some uncertainties. For instance, a sequence that is 90% complementary with a 15-nt target sequence would have to comprise 13 and a half (13.5) complementary nucleotides. In such cases, it is intended herein that the number of nucleotides that has to be complementary is rounded to the nearest integer, in the exemplary case this would thus mean either 13 or 14 nucleotides that have to be complementary, both are considered equivalents to reach the "at least 90% complementary" criterion. In certain embodiments, the strictest mathematics are applied, and in the exemplary case this would mean that 14 out of the 15 nucleotides would need to be complementary (rounding to the highest integer). In another example, a sequence that is 95% complementary with a 15-nt target sequence would have to comprise 14.25 complementary nucleotides; in the interpretation of equivalents, this would mean at least 14 or 15 complementary nucleotides, in the strictest mathematical interpretation this would mean 15 complementary nucleotide (100% complementary). The degree of complementarity between 2 nucleic acid sequences can alternatively be determined by aligning e.g. the target sequence with the reverse complement sequence of an oligonucleotide (or vice versa). In such alignment, non-complementary residues will appear as nonidentical residues, with the proviso that thymine and uracil are different from / non-identical to adenine but are complementary to adenine (both thymine and uracil can pair with adenine).RoRad / KCNQ2 / 878

[0092] KCNQ2 target sequence - hotspot region

[0093] The KCNQ2 sequence targeted by an oligo as described herein is shown in Figure 1, is defined by region spanning nucleotides 51 to 114 of SEQ ID NO:12 (and is including said nucleotides 51 and 114), or is alternatively defined by the sequence:

[0094] AGGAGTATGAGAAGAGCTCGGAGGGGGCCCTCTACATCCTGGAAATCGTGACTATCGTGGTGTT (SEQ ID NO:14), or by the same sequence in which thymine residues are exchanged for uracil residues.

[0095] The KCNQ2 sequence targeted by an oligo as described herein is a "hotspot region". In general, a hotspot region is a range of nucleotides (such as a contiguous range of nucleotides) on a target nucleic acid that is amenable to reduction of the amount or activity of the target nucleic acid by the action of an oligonucleotide agent or compound, modified oligonucleotide agent or compound, antisense agent or compound, or RNA interfering agent or compound. The term "hotspot region" thus refers to a region of the target nucleotide sequence (i.e. KCNQ2 nucleotide sequence) wherein binding of a sequence within the target region by a complementary oligonucleotide (such as an ASO) results in a reduction in the transcription of the target gene and / or in a reduction of translation from the target RNA transcript. This hotspot region can be divided in 2 subregions, one corresponding to the 3' end of exon 2 of KCNQ2, and one corresponding to the 5' end of exon 3 of KCNQ2. These subregions are defined as follows: region spanning nucleotides 51 to 91 of SEQ ID NO:12 (and including said nucleotides 51 and 91; 3' end of exon 2), or alternatively defined by the sequence:

[0096] AGGAGTATGAGAAGAGCTCGGAGGGGGCCCTCTACATCCTG (SEQ ID NO:15), or the same sequence in which thymine residues are exchanged for uracil residues

[0097] region spanning nucleotides 92 to 114 of SEQ ID NO:12 (and including said nucleotides 92 and 114; 5' end of exon 3), or alternatively defined by the sequence:

[0098] GAAATCGTGACTATCGTGGTGTT (SEQ ID NO:16), or the same sequence in which thymine residues are exchanged for uracil residues.

[0099] In one embodiment, the hotspot region is defined by SEQ ID NO:36 or the same sequence in which thymine residues are exchanged for uracil residues; SEQ ID NO:36 is identical to SEQ ID NO:14 with the exception that SEQ ID NO:36 is lacking the 16 contiguous 5'-end nucleotides of SEQ ID NO:14.

[0100] Re-evaluation of the activity of ASO4 (reverse complement sequence defined by SEQ ID NO:8) and ASO+4 (reverse complement sequence defined by SEQ ID NQ:10) indicated that these induce a transient increase in KCNQ2 expression followed by a strong and long-lasting decrease in KCNQ2 expression, thus indicating a delayed knock-out effect induced by these ASOs. This supports expansion of the hotspot region to the region spanning nucleotides 51 to 130 of SEQ ID NO:12 (and including said nucleotides 51 and 130; includes SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:8), or alternatively defined by the sequence:RoRad / KCNQ2 / 878

[0101] aggagtatgagaagagctcggagggggccctctacatcctggaaatcgtgactatcgtggtgttTGGCG TGGAGTACTTC (SEQ ID NO:37), or the same sequence in which thymine residues are exchanged for uracil residues. Herein the nucleotide sequence in small caps is identical to SEQ ID NO:14; the nucleotide sequence in large caps is the reverse complement nucleotide sequence of ASO+4 (SEQ ID NQ:10) therewith adding 16 nucleotides after the 3' end of SEQ ID NO:14.

[0102] In general, a hotspot region (or simply "hotspot") can be recognized by observing clustering of multiple efficacious oligonucleotide / antisense / RNA interfering agents or compounds that bind to a region (such as contiguous region) of limited length of the target nucleic acid. The increased susceptibility to reduction of the amount or activity of the target nucleic acid within such hotspot regions means that oligonucleotide / antisense / RNA interfering agents or compounds targeting the region have higher efficacy in reducing of the amount or activity of the target nucleic acid than nucleotide / antisense / RNA interfering agents or compounds which target other regions of the target nucleic acid. For example, the accessibility of a target region of a target nucleic acid may influence the efficacy of oligonucleotide / antisense / RNA interfering agents or compounds which target that region, with a hotspot regions having increased accessibility compared to non-hotspot regions. Secondary structures, for instance, that form in the target nucleic acid (e.g., within or proximate to hotspot regions) may affect the ability of an oligonucleotide / antisense / RNA interfering agent or compound to bind the target region and to reduce the amount or activity of the target nucleic acid.

[0103] One way of identifying a hotspot region can imply a "walk" (such as ASO walk) starting from a region in a target nucleic acid that is amenable to reduction of the amount or activity of the target nucleic acid by an initially identified active oligonucleotide / antisense / RNA interfering agent or compound. Testing the activity of additional oligonucleotide / antisense / RNA interfering agents or compounds targeting the target nucleic acid in a region neighboring or partially overlapping with the initially identified target nucleic acid region, therewith walking up and / or the target nucleic acid region, can ultimately delineate the boundaries of a hotspot region.

[0104] The KCNQ2 hotspot target sequence defined herein was determined by means of a limited ASO walk. This implies that the boundaries of the KCNQ2 hotspot target sequence may still be subject of change. For instance, as illustrated in Figure 1, ASO+3 is co-defining the hotspot region (active in reducing KCNQ2 expression) whereas ASO4 partly overlapping with ASO+3 is not - here it cannot be excluded that the 3' end of the KCNQ2 hotspot region is not extending beyond nucleotide 114 of SEQ ID NO:12 (such as extending 1, 2, 3, 4 or 5 nucleotides downstream of nucleotide 114 of SEQ ID NO:12), this will require additional ASO walking analysis. Likewise, more detailed ASO walking analysis at the 5' end of the KCNQ2RoRad / KCNQ2 / 878

[0105] hotspot region may well reveal that the true 5' end is somewhat upstream of nucleotide 51 of SEQ ID NO:12, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides upstream of nucleotide 51 of SEQ ID NO:12. In the context of the current disclosure, the oligonucleotides are targeting a defined hotspot region in the KCNQ2 transcript with the aim or reducing expression and / or activity of wild-type and / or gain of function mutant KCNQ2. The effect of administering such oligonucleotide to a cell expressing wild-type and / or GOF mutant KCNQ2 in general will vary with the dose of the oligonucleotide administered.

[0106] Oligonucleotide modifications including gapmers

[0107] Oligonucleotide modifications or modifications of one or more nucleotides in an oligonucleotide may reside at the individual nucleosides (in their sugar moiety and / or nucleobase moiety) and / or at the level of the internucleoside linkages.

[0108] Modifications of the sugar moiety

[0109] A "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. An "unmodified sugar moiety" means a 2'-OH(H) p-D-ribosyl moiety, as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H) p-D-deoxyribosyl moiety, as found in DNA (an "unmodified DNA sugar moiety"). Unmodified sugar moieties have one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. A "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or a sugar surrogate. A "sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids. A "bicyclic nucleoside" means a nucleoside comprising a bicyclic sugar moiety. A "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0110] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosylRoRad / KCNQ2 / 878

[0111] ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2', 4', and / or 5' positions. In certain embodiments one or more non-bridging substituent of non- bicyclic modified sugar moieties is branched. Examples of 2' -substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2'-F, 2'-OCH3(" OI\ / le" or " O-methyl"), and 2'-O(CH2)2OCH3(" MOE"). In certain embodiments, 2' -substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cw alkoxy, O- Ci-C10 substituted alkoxy, O- C1-C10 alkyl, O- C1-C10 substituted alkyl, S-alkyl, N( Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2'-substituent groups described in e.g. US6531584, US5859221, and US6005087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4'-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in W02015 / 106128. Examples of 5'-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5-methyl (R or S), S'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in W02008 / 101157 and US2013 / 0203836. A "2' -substituted nucleoside" means a nucleoside comprising a 2' -substituted sugar moiety. Herein, "2'-substituted" in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH. "2'-MOE" means a 2'-OCH2CH2OCH3 group in place of the 2' -OH group of a ribosyl sugar moiety. A "2'-MOE sugar moiety" is a sugar moiety with a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2'-MOE sugar moiety is in the -D configuration. " MOE" means O-methoxyethyl. A "2'-MOE nucleoside" means a nucleoside comprising a 2'-MOE sugar moiety.

[0112] In certain embodiments, a 2' -substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent group selected from: F, NH2, N3, OCF3OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, 0(CH2)2SCH3, 0(CH2)20N(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=0)-N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl. In certain embodiments, a 2' -substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2' -substituent group selected from: F, OCF3, OCH3, OCH2CH2OCF3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3(" NMA").RoRad / KCNQ2 / 878

[0113] In certain embodiments, a 2' -substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2' -substituent group selected from: F, OCH3, and OCH2CH2OCF3. Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (locked nucleic acid or " LNA", methylene bridge between 2' O and 4' C of ribose), 4'-CH2-S-2', 4'-(CH2)2-0-2' (ethylene bridged nucleic acid or " ENA", ethylene bridge between 2' O and 4' C of ribose), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g. US7399845, US7569686, US7741457, and US8022193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (e.g. US8278283), 4'-CH2-N(OCH3)-2' and analogs thereof (e.g. US8278425), 4'- CH2-O-N(CH3)-2' (e.g. US7696345 and US8124745), 4'-CH2-C(H)(CH3)-2' (e.g. Zhou et al. 2009, J Org Chem 74: 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (e.g. US8278426), 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-O-N(R)-2', 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12 alkyl (e.g. US7427672). The term "cEt" means a 4' to 2' bridge in place of the 2'OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH3)- -0-2', and wherein the methyl group of the bridge is in the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety with a 4' to 2' bridge in place of the 2'OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH3)- -0-2', and wherein the methyl group of the bridge is in the S configuration. "cEt" means constrained ethyl. A "cEt nucleoside" means a nucleoside comprising a cEt sugar moiety.

[0114] In certain embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)X-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Raand Rbis, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=0)-H), substituted acyl, CN, sulfonyl (SO2-J1), or sulfoxyl (SO-J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (CO-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

[0115] Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al. 1997, Nucleic Acids Research 25:4429-4443; Albaek et al. 2006, J Org Chem 77:7731-7740; Singh et al.1998, Chem CommunRoRad / KCNQ2 / 878

[0116] 4:455-456; Koshkin et al. 1998, Tetrahedron 54:3607-3630; Kumar et al. 1998, Bioorg Med Chem Lett 8:2219- 2222; Singh et al. 1998, Org Chem 63:10035-10039; Srivastava et al. 2007, J Am Chem Soc 129:8362- 8379; US7053207; US6268490; US6770748; US6794499; US6670461; US7034133; US8080644; US8034909; US8153365; US7572582; US6525191; W02004 / 106356; WO1999 / 014226; W02007 / 134181; US7547684; US7666854; US8088746; US7750131; US8030467; US8268980; US8546556; US8530640; US9012421; US8501805; US2008 / 0039618; and US2015 / 0191727.

[0117] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside may be in the a-L configuration or in the P-D configuration. a-L-methyleneoxy (4'-CH2-0-2') or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al.

[0118] 2003, Nucleic Acids Research 21:6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides ( e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the -D configuration, unless otherwise specified.

[0119] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5' -substituted and 4'-2' bridged sugars).

[0120] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.

[0121] In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'-position (e.g. US7875733 and US7939677) and / or the 5' position.

[0122] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (" THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (" HNA"), anitol nucleic acid (" ANA"), manitol nucleic acid (" MNA") (e.g. Leumann et al. 2002, Bioorg & Med Chem 10: 841-854), fluoro HNA (" F-HNA"; e.g. US8088904, US8440803, US8796437, US9005906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds. In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (e.g., Braasch et al. 2002, Biochemistry 41:4503-4510, US5698685, US5166315, US5185444, US5034506). In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as "modifed morpholinos."RoRad / KCNQ2 / 878

[0123] In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (" PNA"), acyclic butyl nucleic acid (e.g. Kumar et al. 2013, Org Biomol Chem 11:5853-5865), and nucleosides and oligonucleotides described in WO2011 / 133876.

[0124] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0125] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. In certain embodiments, modified oligonucleotides have a gapmer motif, which is defined by two external regions or "wings" and a central or internal region or "gap." As used herein, "gapmer" means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings." The internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5'-end of the internal region. Unless otherwise indicated, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2'-β-D- deoxynucleoside. In certain embodiments, the gap comprises one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2'-β-D-deoxynucleosides. The term " MOE gapmer" indicates a gapmer having a gap comprising 2'-β-D-deoxynucleosides and wings comprising 2'-MOE nucleosides. The term "mixed wing gapmer" indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and / or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

[0126] The three regions of a gapmer motif (the 5'-wing, the gap, and the 3' -wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3' -most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3' -wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugarRoRad / KCNQ2 / 878

[0127] moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).

[0128] In certain embodiments, the wing of a gapmer is a sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24, or 25 nucleotides in length. In particular embodiments, the wing of a gapmer is a sequence of at least 1, or at least 5 nucleotides in length. In further embodiments, the wing of a gapmer comprises 1 to 5, 1 to 10, 5 to 10, 1 to 20, 5 to 20, 1 to 20, 5 to 20, 1 to 25 or 5 to 25 nucleosides. In particular embodiments, the sequence of the wing is a contiguous sequence, more in particular a contiguous sequence that is at least 90% complementary to an equal length part or portion of the target nucleic acid sequence of interest (such as the KCNQ2 hotspot region identified herein). In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.

[0129] In certain embodiments, the sequence of nucleotides constituting the gap of a gapmer is a sequence of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24, or 25 nucleotides in length. In a particular embodiment thereto, the gap of a gapmer is a sequence of at least 5, at least 10, or at least 15 nucleotides in length. In further embodiments, the gap of a gapmer comprises 1 to 5, 1 to 10, 5 to 10, 1 to 20, 5 to 20, 1 to 20, 5 to 20, 1 to 25 or 5 to 25 nucleosides. In particular embodiments, the sequence of the gap is a contiguous sequence, more in particular a contiguous sequence that is at least 90% complementary to an equal length part or portion of the target nucleic acid sequence of interest (such as the KCNQ2 hotspot region identified herein). In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2'-0Me sugar moiety. As used herein, "2'-deoxyribonucleoside" means a nucleoside comprising a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxyribonucleoside is a 2'-β-D deoxyribonucleoside and comprises a 2'-β-D-deoxyribosyl sugar moiety, which has the P-D configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2'-deoxyribonucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil). "2'-0Me" means a 2'-OCH3 group inRoRad / KCNQ2 / 878

[0130] place of the 2'-OH group of a ribosyl sugar moiety. A "2'-0Me sugar moiety" is a sugar moiety with a 2'-OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2'-0Me sugar moiety is in the P-D configuration. " OMe" means O-methyl. A "2'-0Me nucleoside" means a nucleoside comprising a 2'-0Me sugar moiety.

[0131] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing / gap junction comprise 2'-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing / gap junction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety.

[0132] In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif. In such embodiments, each nucleosideof the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2'-modification.

[0133] Herein, the lengths (number of nucleotides) of the three regions of a gapmer may be provided using the notation [# of nucleotides in the 5'-wing] - [# of nucleotides in the gap] - [# of nucleotides in the 3'-wing] Thus, a 5-10-5 gapmer for instance consists of 5 nucleotides in each wing and 10 nucleotides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2'-p-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer for instance consists of 5 linked 2'-MOE nucleosides in the 5'-wing, 10 linked a 2'-β-D-deoxynucleosides in the gap, and 5 linked 2'-MOE nucleosides in the 3'-wing.

[0134] Modifications of the nucleobase

[0135] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A "5-methyl cytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. A "nucleobaseRoRad / KCNQ2 / 878

[0136] sequence" means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

[0137] As used herein, "nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. A "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. " Linked nucleosides" are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked). In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

[0138] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.

[0139] In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CEC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5- ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N- benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5- methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, 1,3- diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in US3687808, in The Concise Encyclopedia Of Polymer Science And Engineering (Kroschwitz, Ed., John Wiley & Sons, 1990, 858-859), Englisch et al. 1991, Angewandte Chemie (International Edition) 30:613, Sanghvi, Y. S., Chapter 15, Antisense Research and Applications (Crooke and Lebleu, Eds., CRC Press, 1993, 273-288), and those disclosed in Chapters 6 and 15, Antisense Drug Technology (Crooke, Ed., CRC Press, 2008, 163-166 and 442-443). Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation,RoRad / KCNQ2 / 878

[0140] US2003 / 0158403, US2003 / 0175906, US4845205, US5130302, US5134066, US5175273, US5367066, US5432272, US5434257, US5457187, US5459255, US5484908, US5502177, US5525711, US5552540, US5587469, US5594121, US5596091, US5614617, US5645985, US5681941, US5811534, US5750692, US5948903, US5587470, US5457191, US5763588, US5830653, US5808027, US6166199, US6005096. In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. A "5-methyl cytosine" means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase. In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 '-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 '-end of the oligonucleotide. In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5 -propynepyrimidine.

[0141] Modifications at the level of the internucleoside linkages

[0142] As used herein, "internucleoside linkage" means the covalent linkage between contiguous nucleosides in / to form an oligonucleotide. The term "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. " Phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. The term "linker-nucleoside" means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0143] 1RoRad / KCNQ2 / 878

[0144] In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage to form an oligonucleotide. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters, which contain a phosphodiester bond (" P(02)=0") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (" P(02)=S"), and phosphorodithioates (" HS-P=S")- Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N, N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorus-containing and non- phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0145] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkage in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population, in at least 70% of the molecules in the population, in at least 75% of the molecules in the population, in at least 80% of the molecules in the population, in at least 85% of the molecules in the population, in at least 90% of the molecules in the population, in at least 95% of the molecules in the population, or in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al. 2003(JACS 125:8307), Wan et al. 2014 (Nucl Acid Res 42:13456),RoRad / KCNQ2 / 878

[0146] and WO2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the Sp configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the Rp configuration (Rp and Sp are the descriptors of planar chirality stereoisomerism). Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

[0147] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'- CH2-N(CH3)-0-5'), amide-3 (3'-CH2-C(=0)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=0)-5'), formacetal (3'-0-CH2-0-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-0-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (for example: Carbohydrate Modifications in Antisense Research, Sanghvi and Cook, Eds.; ACS Symposium Series 580; Chapters 3 and 4, pp 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts.

[0148] In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P(O2)=0). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P(O2)=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp-Sp-Rp motif.RoRad / KCNQ2 / 878

[0149] Modification of oligonucleotide length

[0150] The length of an oligonucleotide as described herein can be varied without eliminating activity. In certain embodiments, oligonucleotides (including oligonucleotides having a sugar moiety modification, nucleobase modification and / or internucleoside linkage modification) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleotides, where X represents the fewest number of nucleotides in the range and Y represents the largest number nucleotides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X< Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25,13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleotides.

[0151] In further embodiments, the sequence an oligonucleotides in particular is a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In a particular embodiment thereto, the sequence has a length of at least 15, at least 20, or at least 25 nucleotides. In other embodiments, oligonucleotides consist of 8 to 50, 10 to 50, 15 to 50, 20 to 50, 8 to 40, 10 to 40, 15 to 40, 20 to 40, 8 to 30, 10 to 30, 15 to 30, 20 to 30 linked nucleotides. In particular embodiments, the sequence of the oligonucleotide is a contiguous sequence, more in particular a contiguous sequence that is at least 90%RoRad / KCNQ2 / 878

[0152] complementary to an equal length part or portion of the target nucleic acid sequence of interest (such as the KCNQ2 hotspot region identified herein).

[0153] Inhibition of KCNQ2

[0154] The oligonucleotides of this disclosure are capable of reducing the expression of KCNQ2 and / or of GOF KCNQ2 and by reducing expression of KCNQ2 and / or of GOF KCNQ2, the total KCNQ2 activity is reduced. The term "antagonist" or "inhibitor" of a target as used interchangeably herein refers to inhibitors of function or to inhibitors of expression of a target of interest. Other interchangeable alternatives for "antagonist" or "inhibitor" include repressor, suppressor, inactivator, and blocker. An "antagonist" thus refers to a molecule that decreases, blocks, inhibits, abrogates, or interferes with target expression, activation, function, or activity.

[0155] Inactivation or inhibition of a process as envisaged in the current disclosure refers to different possible levels of inactivation or inhibition, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or even 100% or more if inactivation or inhibition (compared to a normal situation or compared to the situation prior to starting the inactivation or inhibition). The nature of the inactivating / inhibitory compound is not vital / essential to the invention as long as the process envisaged is inactivated / inhibited such as to treat or inhibit (progression of) the disease or disorder or symptom or complication of the disease or disorder as described herein.

[0156] A specific or selective inhibitor of a target of interest may, depending on the strength of the inhibition exerted by the inhibitor, exert the desired level of inhibition of the target of interest with an IC50 of 1000 nM or less, with an IC50 of 500 nM or less, with an IC50 of 100 nM or less, with an IC50 of 50 nM or less, with an IC50 of 10 nM or less, with an IC50 of 1 nM or less, with an IC50 between 1 pM and InM, or with an IC50 between 0.1 pM and 10 nM.

[0157] Cross-inhibition of more than one target is possible; for clinical development it can e.g. be desired to be able to test an inhibitor in a suitable in vitro model or in vivo animal model before starting clinical testing with the same inhibitor in a human population, which may require the inhibitor to cross-inhibit the animal (or other non-human) target and the orthologous human target.

[0158] Specificity or selectivity of inhibition refers to the situation in which an inhibitor is, at a certain concentration (sufficient to inhibit the target of interest) inhibiting the target gene or protein with higher efficacy (e.g. with an at least 2-fold, 5-fold, or 10-fold lower IC50, e.g. at least 20-, 50- or 100-fold or more lower IC50) than the efficacy with which it is possibly (if at all) inhibiting other targets (targets not of interest). Such specificity or selectivity of inhibition is in particular determined within the setting of the target subject (e.g. human patient, or animal model) and thus can encompass / does not exclude inhibitionRoRad / KCNQ2 / 878

[0159] of (at least one) orthologous target. Exclusivity of inhibition refers to the situation in which an inhibitor is inhibiting only the target of interest.

[0160] As indicated in the Examples, the oligonucleotides targeting the KCNQ2 hotspot region as described or defined herein are selectively or specifically inhibiting expression of KCNQ2 compared to inhibition of the KCNQ2 homologue KCNQ3.

[0161] Treatment / therapeutically effective amount

[0162] The terms therapeutic modality, therapeutic agent, agent, and drug are used interchangeably herein. All refer to a therapeutically active compound, or to a therapeutically active composition (comprising one or more therapeutically active compounds). In particular, the drug is an oligonucleotide comprising an antisense portion targeting the KCNQ2 hotspot region defined in / by SEQ ID NO:14 or targeting a part or portion of that hotspot region.

[0163] " Treatment" / "treating" refers to any rate of reduction, delaying or retardation of the progress of the disease or disorder, or a single symptom or complication thereof, compared to the progress or expected progress of the disease or disorder, or single or complication symptom thereof, when left untreated. This implies that a therapeutic modality on its own may not result in a complete or partial response (or may even not result in any response), but may, in particular when combined with other therapeutic modalities, contribute to a complete or partial response. More desirable, the treatment results in no / zero progress of the disease or disorder, or single symptom or complication thereof (i.e. "inhibition" or "inhibition of progression"), or even in any rate of regression of the already developed disease or disorder, or single symptom or complication thereof. " Suppression / suppressing" can in this context be understood to be comprised within the meaning of the term "treatment / treating". Treatment / treating also refers to achieving a significant amelioration of one or more clinical symptoms associated with a disease or disorder, or of any single symptom or complication thereof. Depending on the situation, the significant amelioration may be scored quantitatively or qualitatively. Qualitative criteria may e.g. by patient wellbeing. In the case of quantitative evaluation, the significant amelioration is typically a 10% or more, a 20% or more, a 25% or more, a 30% or more, a 40% or more, a 50% or more, a 60% or more, a 70% or more, a 75% or more, a 80% or more, a 95% or more, or a 100% improvement over the situation prior to treatment. The time-frame over which the improvement is evaluated will depend on the type of criteria / disease observed and can be determined by the person skilled in the art.

[0164] A "therapeutically effective amount" refers to an amount of a therapeutic agent to treat, inhibit or prevent a disease or disorder, or of any single symptom or complication thereof, in a subject (such as a mammal). Efficacy in vivo can, e.g., be measured by assessing the duration of survival (e.g. overall survival), time to disease progression (TTP), response rates (e.g., complete response and partialRoRad / KCNQ2 / 878

[0165] response, stable disease), length of progression-free survival (PFS), duration of response, and / or quality of life.

[0166] The term "effective amount" or "therapeutically effective amount" may depend on the dosing regimen of the agent / therapeutic agent or composition comprising the agent / therapeutic agent (e.g. medicament or pharmaceutical composition). The effective amount will generally depend on and / or will need adjustment to the mode of contacting or administration. The effective amount of the agent or composition comprising the agent is the amount required to obtain the desired clinical outcome or therapeutic effect without causing significant or unnecessary toxic effects (often expressed as maximum tolerable dose, MTD). To obtain or maintain the effective amount, the agent or composition comprising the agent may be administered as a single dose or in multiple doses. The effective amount may further vary depending on the severity of the condition that needs to be treated; this may depend on the overall health and physical condition of the subject or patient and usually the treating doctor's or physician's assessment will be required to establish what is the effective amount. The effective amount may further be obtained by a combination of different types of contacting or administration.

[0167] The aspects and embodiments described above in general may comprise the administration of one or more therapeutic compounds to a subject (such as a mammal) in need thereof or in need of treatment. In general a (therapeutically) effective amount of (a) therapeutic compound(s) is administered to the mammal in need thereof in order to obtain the described clinical response(s). " Administering" means any mode of contacting that results in interaction between an agent or composition comprising the agent (such as a medicament or pharmaceutical composition) and an object (e.g. cell, tissue, organ, body lumen) with which said agent or composition is contacted. A particular route of administration is intrathecal administration (e.g. by lumbar puncture or by means of an intrathecal pump) which is bypassing the blood brain barrier and is in particular suited for administration to the brain and the spinal cord. The interaction between the agent or composition and the object can occur starting immediately or nearly immediately with the administration of the agent or composition, can occur over an extended time period (starting immediately or nearly immediately with the administration of the agent or composition), or can be delayed relative to the time of administration of the agent or composition. More specifically the "contacting" results in delivering an effective amount of the agent or composition comprising the agent to the object.

[0168] Other definitions

[0169] In order that the present description can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description. The present invention is described with respect to particular embodiments and with reference to certain figures but the inventionRoRad / KCNQ2 / 878

[0170] is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "a nucleotide sequence", is understood to represent one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more" and "at least one" can be used interchangeably herein.

[0171] Furthermore, "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in a phrase such as " A and / or B" herein is intended to include " A and B", " A or B", " A" (alone), and " B" (alone). Likewise, the term "and / or" as used in a phrase such as " A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0172] Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated. Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

[0173] It is understood that wherever aspects are described herein with the language "comprising", otherwise analogous aspects described in terms of "consisting of" and / or "consisting essentially of" are also provided. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps.

[0174] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

[0175] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0176] The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" can modify aRoRad / KCNQ2 / 878

[0177] numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower).

[0178] The terms "defined in / by SEQ ID No: X" or "of SEQ ID No. X" as used herein refer to a biological sequence consisting of the sequence of nucleotides given in the SEQ ID No. X. SEQ ID No. X is interchangeable with SEQ ID NO: X. When the present application refers to " SEQ ID NO: 2-4" or " SEQ ID NO: 2 to 4", this is identical to a group consisting of SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

[0179] The terms "individual" "subject" "host" and "patient" are used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans. The compositions and methods described herein are applicable to both human therapy and veterinary applications. In some aspects, the subject is a mammal, and in other aspects the subject is a human. As used herein, a "mammalian subject" includes all mammals, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like) and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like).

[0180] EXAMPLES EXAMPLE 1. Induced-pluripotent stem cells (iPSC)

[0181] Experiments involving human iPSC were performed with informed consent and approval by the Committee of Medical Ethics of Antwerp University Hospital and University of Antwerp (reference 19 / 20 / 257). All KCNQ2 patient-derived iPSC neurons were previously generated in the lab. These cell lines were genetically engineered to express human neurogenin 1 and 2 (NGN1 and NGN2) under doxycycline induction within the CLYBR safe-harbour locus for differentiation into excitatory cortical-like neurons. This construct additionally utilizes constitutive expression of mCherry under an EF-la promoter. A cell line harbouring the KCNQ2R201C / +variant (p. Arg201Cys or c.601C> T) or the KCNQ2R201H / +variant (Arg201His) was used to study gain-of-function (GOF; heterozygous cell line also expressing wildtype KCNQ2) and a R201C or R201H CRISPR-corrected line was used as a wildtype control line for comparative experiments. To generate progenitor neurons (D3N), iPSCs were first cultured in StemFlex media on Geltrex-coated plates. Then, confluent wells were treated with Accutase and counted before 1x106cells seeded into 6 well plates before induction with 2 pg / mL doxycycline in StemFlex media for 3 days. Resulting D3N were cryopreserved in 90% knockout serum replacement (KOSR) and 10% DMSO to be used for experimentation.

[0182] EXAMPLE 2. Primary mouse astrocytes

[0183] Astrocytes isolated from mouse pups were used to co-culture iPSC neurons for functional electrophysiological development. All animal use (ECD 2020-076) was approved and conducted in accordance with the policies and guidelines set forth by the University of Antwerp. Primary mouseRoRad / KCNQ2 / 878

[0184] astrocytes were isolated from postnatal day 0-3 C57BL / 6 mice following the protocol of Schildge et al.

[0185] 2013 (J Vis Exp 71:e50079). Isolated astrocytes were seeded onto Geltrex coated T75 flasks. Astrocytes were split twice before freezing aliquots of 2x106in 90% FBS + 10% DMSO freezing media. For co-culture experiments, astrocytes were rapidly thawed at 37 °C and plated onto GelTrex coated T75 flasks and cultured for one-week in DMEM +10% FBS before experimentation.

[0186] EXAMPLE 3. GFP-KCNQ2 heterologous expression studies

[0187] HEK293T cells were cultured in DMEM (supplemented with 10% FBS and 5U / mL Penicillin-Streptomycin) using standard cell culture techniques. Cells split to 20% confluency were pre-treated with 1 pM antisense oligonucleotide (ASO) one day before transfection with 0.5 pg pcDNA3-KCNQ2wt using X-tremeGENE 9 DNA Transfection Reagent. The pcDNA3-KCNQ2wt plasmid encodes an EGFP-KCNQ2 (NM_004518) construct under the SV40 promoter. After transfection, cells were cultured in an Incucyte S3 (Sartorius) and phase and GFP images were taken every 4 hrs for 3 days. Cells were monitored for confluency, and GFP signal was analyzed as a proportion of vehicle signal using the Incucyte S3 Live Cell Analysis System.

[0188] EXAMPLE 4. Antisense oligonucleotide (ASOs)

[0189] Commercial positive control (GAPDH targeting), negative control (no human targets), and custom designed (LNA) gapmer phosphorothioate (PS) backbone ASOs were initially purchased through Qiagen. For all other experiments, ASOs were purchased from Axolabs (containing full PS backbones) and all cytosines were substituted with 5-methyl cytosines. LNA gapmers were designed in a 3-X-3 configuration of LNA-DNA-LNA where X = 9-12 DNA nucleotides. 2'-O-methoxyethyl (MOE) sequences were either purchased identical to a reference design, or in the case of ASO3-MOE, as a 3-10-3 MOE configuration. Top scoring ASOs targeting KCNQ2 exons were chosen based on-target selectivity and specificity, lack of secondary structure formation, target sequence identity with mouse and macaque orthologues of KCNQ2, and the predicted acute neurotoxicity score calculated from Hagedorn et al. 2022 (Nucleic Acid Ther 32:151-162). Additional ASOs were generated for "walking" targeting regions in, and proximal to, exons 2 and 3 not covered by the lead ASOs. ASOs were reconstituted as 100 pM stocks in PBS.

[0190] EXAMPLE 5. High-density microelectrode array (HD-MEA)

[0191] HD-MEA plates were pre-treated with 1 ml of 1% Tergazyme for 1 hr, washed 3 times with PBS and sterilized in 70% ethanol for 30 min. After removing ethanol and washing, 1.2 mL of Neurobasal Plus basal media with B-27 Plus supplement (50x) was added per well and incubated for 48 hrs (37 °C) to condition the chips. After 48 hrs of conditioning the chips were coated with 50 pL 0.14% polyethyleneimine (PEI) in borate buffer for 1 hr, then washed with water and dried overnight in a biosafety cabinet. The following day, chips were coated with 20 pg / mL CellAdhere human Laminin-521 for 1 hr at 37 °C before immediate cell plating.RoRad / KCNQ2 / 878

[0192] Frozen D3N were thawed at 37 °C in a warm water bath, and in parallel, mouse astrocytes were dissociated from T75 flasks using 0.05% trypsin. A mixture of 5x105D3N with 5x104astrocytes was added directly to each HD-MEA chip in a 50 pL cell suspension composed of Neurobasal Plus plating media (50x B-27 Plus supplement, 2 mM Glutamax, 50 U / mL Penicillin-Streptomycin, 2 pg / mL doxycycline, 10 ng / mL human BDNF, 10 ng / mL human NT3, 100 pg / mL primocin, 2 pM cytosine b-D-arabinofuranoside, and CEPT cocktail for improved cell survival). Plates were incubated at 37 °C, 5% CO2for 30 min to allow the cells to settle and attach onto the coatings. After cell adherence, an additional 1 mL of Neurobasal Plus plating media was gently added in the wells. Vehicle or ASOs were added to designated wells after 24 hrs in an additional 1 mL volume of Neurobasal Plus plating media.

[0193] All HD-MEA recordings were performed on a MaxTwo (MaxWell Biosystems AG) equipped with 5% CO2and 37°C chamber. Scans were run and analyzed using the MaxLab Live software. Activity and Network Assays were performed twice weekly from day in vitro (DIV; days in culture) 14 to DIV49 at 5% CO2and 37°C. For all recordings, a 300 Hz high-pass filter was applied and a spike detection threshold set to 5.0 standard deviations from baseline. For Activity Assays, a checkerboard pattern configuration was used to scan the 26 400-electrode array for neuron activity. For Network Assays, 1024 electrodes detecting the highest amplitude of signal were selected from the Activity Scan using the neuronal selection configuration. Network measurements were recorded for 10 min. Twice weekly media changes with Neurobasal Plus recording media (50x B-27 Plus supplement, 2 mM Glutamax, 50 U / mL Penicillin-Streptomycin, 10 ng / mL human BDNF, 10 ng / mL human NT3, 100 pg / mL primocin, 2% FBS) took place after recordings to allow >48 hrs of media conditioning.

[0194] EXAMPLE 6. ASOs for KCNQ2 mRNA knockdown

[0195] mRNA experiments

[0196] For mRNA experiments, D3N were thawed in Neurobasal Plus plating media and 1x105cells plated in 50 pL onto Geltrex coated 96-well plates. After 24 hrs, 1 or 3 pM of ASOs or vehicle (PBS) were added to individual wells (n=l) in an additional 50 pL volume of Neurobasal Plus plating media. Cells were maintained in a 37°C 5% CO2incubator for 72 hrs before RNA extraction.

[0197] Concentration-dependent response experiments

[0198] Concentration-dependent response experiments were performed as in the initial screen, but with each ASO tested at 0.1, 1, 10, 100, 500, 1000, and 3000 nM. Each experiment was conducted in triplicate batches of D3N platings.

[0199] Time course experiments

[0200] Time course experiments were performed as in the initial screen, but with each ASO tested at 1 pM. RNA was extracted from wells after 2, 3, 5, or 7 days of ASO treatment. After day 3 of ASO incubation,RoRad / KCNQ2 / 878

[0201] remaining wells received one 50 pL top up with Neurobasal Plus plating media. Each experiment was conducted in triplicate batches of D3N platings.

[0202] Separate protocols were developed for 49-day incubation experiments run in parallel to HD-MEA recordings. In these experiments 96-well plates were first coated with 50 pL 0.14% PEI incubated at 37 °C for 4 hrs, washed thrice with distilled water and placed in a biosafety cabinet overnight to dry. The next day plates were coated with 20 pg / mL CellAdhere human Laminin-521 and incubated at 37 °C for 1 hr before plating 1x105D3N and 1x104astrocytes in 50 pL Neurobasal Plus plating media. After 24 hrs, 1 pM ASOs or vehicle was added in 50 pL Neurobasal Plus plating media. On day 3 of ASO treatment, wells received a 50 pL top-up, followed by twice weekly 50 pL media exchanges with fresh Neurobasal maintenance media. RNA was extracted after 50 days.

[0203] RNA extraction

[0204] RNA extraction and quantitative real time PCR (qRT-PCR) was performed using the Taqman Fast Advanced Gene Expression Cells-to-Ct kit (Invitrogen) according to manufacturer guidelines. Freshly extracted RNA was immediately used for cDNA synthesis. RNA and cDNA were stored at -80 °C until further use.

[0205] qRT-PCR

[0206] Relative quantification of KCNQ2 expression and ASO effectiveness was validated using both SYBR Green reagent and Taqman Gene Expression Assays. For related-target experiments, SYBR Green reagent was used with primers targeting KCNQ3 using GAPDH and TBP reference genes (Table 2). For all other qRT-PCR experiments TaqMan probes for KCNQ2 (Taqman AssaylD: Hs01548342_ml) and the reference gene TBP (Taqman AssaylD: Hs99999910_ml) were used. All qRT-PCR experiments were run on a Quantstudio 6 Flex (Applied Biosystems) and relative expression determined from the AACt method using TBP (Taqman Gene Expression Assays) or TBP and GAPDH (SYBR Green) reference genes. Apart from the initial ASO panel screening (n=l), all experiments were performed at least n=3 and results analyzed in GraphPad Prism. Statistical significance was determined from a two-way ANOVA with Dunnett post-hoc test, or a Student's t-test.

[0207] Table 2. Sequences of SYBR Green primers used for qRT-PCR of the indicated target genes

[0208]

[0209] RoRad / KCNQ2 / 878

[0210] Results

[0211] Pilot experiments identified the 5' region of KCNQ2 exon 3 as possessing susceptibility to efficacious LNA gapmer ASO-targeted mRNA knockdown. Consequently, five ASOs were designed to target sequences adjacent to this region. In addition, "walk" ASOs were designed to encompass gaps between the regions targeted by the "lead" ASOs and to scan the susceptible region, such as to comprehensively characterize the hotspot target region rendering the KCNQ2 (pre-)mRNA susceptible to degradation; additional ASOs were designed against exon 12 (ASO15) and intron 2 (ASO17) for comparison. To compare effects of ASO chemical modifications, we generated a MOE analog of ASO3. ASO characteristics are listed in Table 3. The reverse complement sequences of the ASOs are aligned with the exon2 / 3 KCNQ2 cDNA nucleotide sequence (SEQ ID NO:12) in Figure 1; this except for ASO17, the reverse complement (ASO17rc: SEQ ID NO:38) of which is aligned with intron 2 of KCNQ2 (SEQ ID NO:39) in Figure 8. Intron 2 of KCNQ2 is separating exons 2 and 3 on the KCNQ2 gene.

[0212] Table 3. Panel of ASOs targeting KCNQ2 mRNA (NM_172107.4) with indication of the ASO target region relative to full mRNA and relative to the exon2 / 3 region. " Walk" ASOs are indicated in bold.

[0213]

[0214] * The nucleotide position numbering of NM_172107.4 or of SEQ ID NO:12 prevails over the nucleotide position numbering in Table 3 in case of any discrepancies.RoRad / KCNQ2 / 878

[0215] Screening of this panel of ASOs identified a hotspot of KCNQ2 knockdown susceptibility in a 64-nucleotide region spanning nucleotides 539-602 of NM_172107.4, or, alternatively, spanning nucleotides 51-114 of SEQ ID NO:12, of which 41 nucleotides reside in exon2 and 23 nucleotides in exon3 (see Figure 1). Within this region all ASOs showed >80% reduction in KCNQ2 transcript abundance relative to vehicle controls, with an average of 85% reduction in the 1 pM treatment group and 94% for 3 pM. In comparison, the MOE gapmer analog of ASO3 elicited a 27% and 55% KCNQ2 transcript reduction at these concentrations. See Figure 2A and Table 4. As indicated in Figure 3, the KCNQ2 amino acid sequence corresponding to the identified hotspot region is not comprising the locations of known KCNQ2 gain of function mutations. ASO17 did not induce a pronounced long-term reduction of KCNQ2 expression, see comparison with ASO3 in Figure 9 (and description of Figure 9 for more details).

[0216] Table 4. Predicted toxicity ("tox score", see Example 4) of the ASOs of Table 3; and abundance of KCNQ2 mRNA detected after treating progenitor neuron cells with 1 and 3 pM of the indicated ASO (normalized to vehicle-treated cells, "%vehicle").

[0217]

[0218] The mRNA region of KCNQ2 exon 2-3 shares 63% sequence identity with KCNQ3. Therefore we also performed qRT-PCR to test for effects on related targets during the initial screen (Figure 2B) and did not observe comparable knockdown of KCNQ3 transcript.

[0219] ASOs 3, 8 and 16 were selected for further characterization. First, to measure the timecourse of KCNQ2 knockdown, neurons were treated with 1 pM ASO or vehicle and RNA extracted after 2, 3, 5 and 7 days of incubation. All KCNQ2-targeting ASOs elicited roughly 50% reduction in mRNA transcript after 48 hrs incubation with maximal reduction measured after 7 days treatment for ASOs 8 and 16, and 5 days for ASO3 (Figure 4). No adverse effects on neurons were observed during any timepoints.RoRad / KCNQ2 / 878

[0220] Next we measured concentration-dependent effects of ASO treatment on KCNQ2 expression after 72 hrs incubation. All KCNQ2-targeting ASOs caused a concentration-dependent reduction in KCNQ2 transcript abundance with comparable potency, and maximal effects at 3 pM (Figure 5). In comparison, the negative control ASO did not have a significant effect at any concentration.

[0221] We subsequently used a HEK cell expression system to measure fluorescent signal from an EGFP-tagged KCNQ2 in the pcDNA3-KCNQ2 plasmid. After 12 hrs incubation, the KCNQ2-targeting ASOs 3, 8 and 16 induced 47%, 61% and 40% reduction in GFP signal compared to the negative control. This effect was sustained over the course of the 3 day experiment (Figure 6).

[0222] To determine the effect of ASO treatment in neurons expressing KCNQ2-gain of function (KCNQ2-GOF) on neuronal network development, we performed longitudinal high-density microelectrode array (HD-MEA) recordings to measure electrophysiological activity. Previous data generated in the lab identified several signatures of dysfunctional hypo-excitability in neuronal networks harbouring KCNQ2-GOF variants compared to isogenic wildtype controls. Activity of these mutant networks develops slower and over a smaller region of the electrode array, with lower mean firing rates (neuron spiking; illustrated in Figure 7 A and B). Furthermore, synchronized network bursting of KCNQ2-GOF neurons feature shorter burst durations and less activity within bursts (fewer spikes per burst; illustrated in Figure 7 C and D). A single 1 pM treatment with ASO3 administered 24 hrs after plating was sufficient to push these key GOF signature metrics towards wildtype values within 3 weeks. These effects were generally sustained for the entire 49 days of recordings. To determine if these long-term electrophysiological effects were associated with sustained depression of KCNQ2 transcript levels, we prepared additional neuron platings in parallel to HD-MEA experiments and extracted RNA coinciding with the final day of HD-MEA recordings. These results revealed 86% reduction in KCNQ2 transcript compared to controls (Figure 7E), consistent with the level of knockdown measured from monoculture time course experiments.

[0223] Furthermore, we defined a KCNQ2 network phenotype characterized by total neuronal firing rate (spike frequency in Hz), spike amplitude (in mV), interspike interval among the fastest firing spikes ( I S I ), and rate of development (time to reach % active electrode milestones; measured as active area, i.e. the percentage of electrodes that are active = measuring biological activity spikes). The KCNQ2-GOF neuronal cell line carrying the R201C KCNQ2 mutation is characterized by a general hypoexcitable network phenotype, i.e. a lower total neuronal firing rate, a lower ISI, a lower amplitude, and a reduced rate of development (longer time to reach % active electrode milestones) compared to wild-type neurons. Treatment of this R201C KCNQ2-GOF cell line with 1 pM or 50 nM ASO3 at DIV1 or 1 pM ASO3 at DIV35, pushes these phenotypes in the direction of the wildtype neuronal network phenotype. The results are illustrated in Figure 10 showing the mean firing rate over time (Figure 10A-10C) as well as the area underRoRad / KCNQ2 / 878

[0224] the curves (Figure 10D) and between the curves (Figure 10E) wherein the area under the curve is calculated (integration of Y (spike frequency metric) * X (time, DIV); the baseline was set to = 0). These data show a greater difference between 1 pM ASO3 and the negative control ASO compared to effects of 50 nM ASO3 and the control, showing a tunable or dose-dependent effect based on ASO concentration.

[0225] Next, the effect of ASO3 on another KCNQ2-GOF neuronal cell line carrying the R201H KCNQ2 mutation was explored. ASO3 pushed the R210H KCNQ2-GOF hypoexcitable features of firing rate and ISI in the direction of wildtype for all active electrodes. This is illustrated in Figure 11A depicting the mean firing rate over time. Further assessed were the effects of ASO8, ASO16 and ASO17 on the R201C KCNQ2-GOF line. ASO 8 and ASO16, but not ASO17, pushed the KCNQ2-GOF hypoexcitable features of firing rate and ISI, in the direction of wildtype for all active electrodes. Treatment with ASO17 failed to reach the same extent of phenotype rescue accompanied by an overall electrophysiological phenotype differing from the one elicited by the other ASOs. This is illustrated in Figure 11B to D, depicting the mean firing rate over time for the different ASOs. These data support the broader applicability of the identified KCNQ2 hotspot region for knockdown of KCNQ2 expression by means of ASOs.

[0226] On a network-wide level, regular synchronized bursting appear later in development (> DIV21), with KCNQ2-GOF characterized by shorter bursts with fewer spikes per burst. Similar to total KCNQ2-GOF activity levels, ASO3 and ASO8 treatment pushed these network parameters towards wildtype levels.

[0227] Furthermore, we compared the effects of ASO treatment to chronic exposure with the Kv7.2 channel blocker, xe-991 (CAS No:122955-42-4; InChI key KHJFBUUFMUBONL-UHFFFAOYSA-N), in the R201C KCNQ2 GOF cell line. In these experiments, 50 nM xe-991 was maintained during every media change throughout the entire recording duration.

[0228] Dissimilar to ASO treatment, xe-991 did not increase the activity metrics ISI and active area. Similar to ASO treatment, xe-991 did increase the activity metric spike firing rate. The network metrics spikes / burst, burst duration and non-burst ISI were similarly affected by ASO treatment and xe-991, whereas burst ISI mean was affected by ASO treatment but not by xe-991. Without being bound or limited to any theory, these differences may be due to some off-target effect of xe-911, a number of such have been reported (e.g. on Kv2.1 and Kv4.3: Wladyka and Kunze 2006, J Physiol 575:175-189; on EAG (KvlO) channels: Wang et al. 1998, Science 282:1890-1893; on ERG (Kvll) channels: Elmedyb et al. 2007, Basic Clin Pharmacol Toxicol 100:316-322; modulation of GlyR activity: Brown et al. 2011, Eur J Neurosci 33:879-889; and some stimulatory effects SOD enzyme activity: Piccirillo et al. 2022, Cell Death Discov 8:391).

Claims

RoRad / KCNQ2 / 878CLAIMS1. An oligonucleotide with a length of 10 to 50 nucleotides, wherein said oligonucleotide comprises a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of any one of SEQ ID NOs:1 to 7, 8, 10, 14 to 16, 36 or 37; wherein the sequence of 10 to 50 contiguous nucleotides is at most 16 contiguous nucleotides in case of complementarity to an equal length portion of SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8 or 10, is at most 15 contiguous nucleotides in case of complementarity to an equal length portion of SEQ ID NO:2, is at most 41 contiguous nucleotides in case of complementarity to an equal length portion of SEQ ID NO:15, is at most 23 contiguous nucleotides in case of complementarity to an equal length portion of SEQ ID NO:16, or is at most 48 contiguous nucleotides in case of complementarity to an equal length portion of SEQ ID NO:36; or a pharmaceutically acceptable salt thereof.

2. The oligonucleotide according to claim 1 wherein the oligonucleotide is capable of inhibiting the expression of a wild-type KCNQ2 gene and / or of a gain of function mutant KCNQ2 gene in a cell.

3. The oligonucleotide according to claim 1 or 2 wherein the sequence of contiguous nucleotides is fully complementary to an equal length portion of any one of SEQ ID NOs:1 to 7, 8, 10, 14 to 16, 36 or 37.

4. The oligonucleotide according to claim 1 or 2, wherein said oligonucleotide comprises:- a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of SEQ ID NO:3, 4, 5, 7, 15 or 36; or- a sequence of 10 to 50 contiguous nucleotides that is fully complementary to an equal length portion of SEQ ID NO:3, 4, 5, 7, 15 or 36; or- a sequence of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length that is fully complementary to an equal length portion of SEQ ID NO:1, 2, 14 or 16; or- a sequence of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length that is fully complementary to an equal length portion of SEQ ID NO:6, 14; or- a sequence of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length that is fully complementary to an equal length portion of SEQ ID NO: 5, 14, 15 or 36;and wherein the region of complementarity is confined to SEQ ID NO:14 or 36.RoRad / KCNQ2 / 8785. The oligonucleotide according to claim 1 or 2, wherein said oligonucleotide comprises:- a sequence of 10 to 50 contiguous nucleotides that is at least 90% complementary to an equal length portion of SEQ ID NO: 8, 10 or 37; or- a sequence of 10 to 50 contiguous nucleotides that is fully complementary to an equal length portion of SEQ ID NO: 8, 10 or 37;wherein the sequence of 10 to 50 contiguous nucleotides is at most 16 contiguous nucleotides in case of complementarity to an equal length portion of SEQ ID NOs: 8 or 10, and wherein the region of complementarity is confined to SEQ ID NO: 37.

6. The oligonucleotide according to any one of claims 1 to 5, wherein the oligonucleotide is a single stranded nucleic acid molecule, optionally the single stranded oligonucleotide is an antisense oligonucleotide or the antisense portion of an RNAi molecule.

7. The oligonucleotide according to any one of the previous claims comprising a modified nucleoside and / or a modified internucleoside linkage.

8. The oligonucleotide according to any one of the previous claims which is a gapmer oligonucleotide.

9. The oligonucleotide according to any one of the previous claims, wherein the sequence of contiguous nucleotides is a sequence of at least 15 nucleotides in length.

10. The oligonucleotide according to claim 8, wherein the sequence of contiguous nucleotides constituting the gap of the gapmer is a sequence of at least 10 nucleotides in length.

11. A composition comprising an oligonucleotide or pharmaceutically acceptable salt thereof according to any one of the previous claims and optionally further comprising a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

12. The oligonucleotide according to any one of claims 1 to 10 or the composition according to claim 11 for use as a medicament.

13. The oligonucleotide according to any one of claims 1 to 10 or the composition according to claim 11 for use in treating, suppressing or preventing a disorder or a complication of a disorder associated withRoRad / KCNQ2 / 878KCNQ2 overactivity in a subject; for use in treating, suppressing or preventing a disorder or a complication of a disorder in a subject having a KCNQ2 gain of function mutation; or for use in treating, suppressing or preventing a disorder or a complication of a disorder in a subject diagnosed to have a KCNQ2 gain of function mutation.

14. The oligonucleotide or composition for use according to claim 13 wherein the disorder is a neurological disorder, or the complication of the disorder is the complication of a neurological disorder.

15. The oligonucleotide or composition for use according to claim 14 wherein the neurological disorder or complication of the neurological disorder is epileptic activity, epileptic spasms, non-epileptic myoclonus or epileptic seizures.

Images