Pharmaceutical composition for preventing or treating parkinson's disease and method for screening same, method for preventing or treating parkinson's disease using said pharmaceutical composition, and usage in manufacture of said pharmaceutical composition

Abstract

Provided is a pharmaceutical composition that has fewer side effects and that makes it possible to obtain an effect of preventing or treating Parkinson's disease A pharmaceutical composition for preventing or treating Parkinson's disease according to an embodiment of the present invention contains a nucleic acid that inhibits the expression of Rap1GAP.

Description

A pharmaceutical composition for preventing or treating Parkinson's disease, a screening method therefor, a method for preventing or treating Parkinson's disease using the pharmaceutical composition, and the use of the pharmaceutical composition in its manufacture.

[0001] The present invention relates to a pharmaceutical composition for preventing or treating Parkinson's disease, a screening method for the same, a method for preventing or treating Parkinson's disease using the pharmaceutical composition, and the use of the pharmaceutical composition in the manufacture of the same.

[0002] Parkinson's disease is a disorder in which dopamine-producing cells in the substantia nigra of the midbrain degenerate and are lost, causing damage to the substantia nigra-striatal nerve and resulting in motor impairments and other symptoms. The main symptoms of Parkinson's disease include motor symptoms such as bradykinesia, resting tremor, muscle rigidity, and postural instability, as well as non-motor symptoms such as psychiatric symptoms, sleep disorders, and autonomic dysfunction. Drug therapy is the main treatment for Parkinson's disease. Drugs used to treat Parkinson's disease include levodopa (L-DOPA) and MAO-B inhibitors, which increase the amount of dopamine in the synaptic cleft. Levodopa, a precursor of dopamine, is converted to dopamine in the brain and increases the amount of dopamine in the brain. MAO-B inhibitors can suppress the decrease in dopamine levels by inhibiting MAO-B, which breaks down dopamine. Dopamine receptor agonists are also known drugs used to treat Parkinson's disease.

[0003] In recent years, elucidation of the mechanism that regulates cellular excitability by dopamine has been progressing, and it has been reported that the Ras-proximate-1 (hereinafter also referred to as Rap1) signaling pathway, which is one of the signal transduction pathways, is involved (Non-Patent Document 1 and Non-Patent Document 2). The D1 receptor (hereinafter also referred to as D1R), which is a dopamine receptor, activates a phosphorylating enzyme called protein kinase A (hereinafter also referred to as PKA) that is related to cellular excitability and reward (pleasure)-related behaviors, and enhances cellular excitability. The Rap1 signaling pathway, which is one of the signal transduction pathways, includes RapGEF, which is a Rap1 activator, and Rap1GAP, which is a Rap1 inactivator. When a large amount of dopamine is released, activation of the PKA-Rap1 signal occurs via D1R. When cellular excitability is enhanced by the Rap1 signal, nerve activity increases in response to excitatory inputs such as glutamate, and reward (pleasure)-related behaviors are triggered. It has also been reported that via the PKA / Rap1 / MAPK pathway, KCNQ2, which is a voltage-gated potassium channel, is phosphorylated to enhance membrane excitability, increase the excitability and firing rate of D1R-expressing medium spiny neurons (D1R-MSN), and promote reward-related behaviors.

[0004] Nagai et al., 2016, Neuron 89, 550-565 Tsuboi et al., 2022, Cell Reports 40, 111309

[0005] It is known that long-term administration of levodopa, which increases dopamine levels, causes motor complications such as wearing-off, in which the therapeutic effect diminishes, and induction of dyskinesia, which is involuntary movement. In addition, the use of dopamine receptor stimulants may cause emotional problems such as gambling addiction and overeating in some cases. Therefore, there is a demand for a pharmaceutical composition that has fewer side effects and can provide preventive or therapeutic effects for Parkinson's disease.

[0006] 1. A pharmaceutical composition for preventing or treating Parkinson's disease according to an embodiment of the present invention comprises a nucleic acid that suppresses the expression of Rap1GAP. 2. In the pharmaceutical composition for preventing or treating Parkinson's disease described in 1 above, the nucleic acid may be at least one selected from the group consisting of miRNA, siRNA, shRNA, dsRNA, and antisense oligonucleotides. 3. In the pharmaceutical composition for preventing or treating Parkinson's disease described in 1 or 2 above, the Rap1GAP may be at least one selected from the group consisting of Rap1GAP1, Rap1GAP2, SPAR1, GARNL3, RalGAPA1, and RalGAPA2. 4. In the pharmaceutical composition for preventing or treating Parkinson's disease described in any of 1 to 3 above, the nucleic acid may be at least one selected from the group consisting of Sequence IDs 1 to 6 and nucleic acids having 80% or more homology to these sequences. 5. In another aspect of the present invention, a method for screening pharmaceutical compositions for preventing or treating Parkinson's disease may be provided. This screening method comprises preparing a test substance that may suppress the expression of Rap1GAP or inhibit the activity of Rap1GAP, administering the test substance to a non-human animal model of Parkinson's disease, and evaluating the efficacy of the test substance in the non-human animal model of Parkinson's disease. 6. In the screening method for pharmaceutical compositions for preventing or treating Parkinson's disease described in 5 above, the non-human animal model of Parkinson's disease may be a unilateral non-human animal model of Parkinson's disease, and the evaluation may be a comparison between the side with Parkinson's disease and the side without Parkinson's disease. 7. In another aspect of the present invention, a method for preventing or treating Parkinson's disease is provided. This treatment method comprises administering the pharmaceutical composition described in any of 1 to 4 above to a target. 8. In yet another aspect of the present invention, a use in the manufacture of a pharmaceutical composition is provided. In this use, a nucleic acid that suppresses the expression of Rap1GAP is used in the manufacture of a pharmaceutical composition for preventing or treating Parkinson's disease.

[0007] According to embodiments of the present invention, a pharmaceutical composition is provided that has fewer side effects and provides a preventive or therapeutic effect on Parkinson's disease. A method for screening such pharmaceutical compositions is also provided.

[0008] This is a schematic diagram illustrating the mechanism of the motor function improvement effect of the pharmaceutical composition according to the embodiment of the present invention. This is a graph showing the asymmetric scores of a control unilateral Parkinson's disease model mouse and a unilateral Parkinson's disease model mouse administered with Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, or Rap1GAP1 miRNA_C, before administration (Pre), and on days 7, 14, 21, and 28, with day 0 being the day of administration. This is a graph showing the asymmetric scores of a control unilateral Parkinson's disease model mouse and a unilateral Parkinson's disease model mouse administered with SPAR1 miRNA_A, SPAR1 miRNA_B, or SPAR1 miRNA_C, before administration (Pre), and on days 7, 14, 21, and 28, with day 0 being the day of administration. This graph shows the number of spontaneous rotational movements over 10 minutes before administration (Pre), and on days 7, 14, 21, and 28 (day 0) of administration to unilateral Parkinson's disease model mice, and to unilateral Parkinson's disease model mice administered with Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, or Rap1GAP1 miRNA_C. The top image shows the expression of Rap1GAP1 in striatal samples taken from the Parkinson's disease-affected side of a control unilateral Parkinson's disease model mouse and a unilateral Parkinson's disease model mouse administered with Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, and Rap1GAP1 miRNA_C. The bottom image shows the expression of SPAR1 in striatal samples taken from the Parkinson's disease-affected side of a control unilateral Parkinson's disease model mouse and a unilateral Parkinson's disease model mouse administered with SPAR1 miRNA_A, SPAR1 miRNA_B, and SPAR1 miRNA_C. The bottom image shows the expression of SPAR1 in striatal samples taken from the Parkinson's disease-affected side of a control unilateral Parkinson's disease model mouse and a graph showing the expression of SPAR1.

[0009] A. Pharmaceutical Composition The pharmaceutical composition for preventing or treating Parkinson's disease according to an embodiment of the present invention (hereinafter also referred to as the pharmaceutical composition of the embodiment of the present invention) contains a nucleic acid that suppresses the expression of Rap1GAP. Figure 1 is a schematic diagram showing the mechanism of the motor function improvement effect of the pharmaceutical composition of the embodiment of the present invention. Drugs generally used to treat Parkinson's disease can restore neurotransmission by increasing the amount of dopamine or stimulating dopamine receptors, for example, by stimulating the signaling pathway of striatal direct pathway neurons. Active Rap1-GTP is converted to inactive Rap1-GDP by Rap1GAP. The pharmaceutical composition for preventing or treating Parkinson's disease according to an embodiment of the present invention contains a nucleic acid that suppresses the expression of Rap1GAP. If the expression of Rap1GAP is suppressed, the conversion of active Rap1-GTP to inactive Rap1-GDP can be suppressed. As a result, membrane excitability increases, for example, the responsiveness of glutamate receptors to glutamate input improves, and neurotransmission of neurons can be restored. If neurotransmission is restored, the decline in motor function associated with Parkinson's disease may improve. The pharmaceutical composition of the embodiment of the present invention can improve the decline in motor function associated with Parkinson's disease without increasing dopamine levels or stimulating dopamine receptors. Therefore, it can suppress the occurrence of motor complications such as reduced efficacy and induction of involuntary movements, as well as side effects such as emotional problems, that occur when taking medications for the treatment of Parkinson's disease.

[0010] The nucleic acids contained in the pharmaceutical compositions of the embodiments of the present invention suppress the expression of Rap1GAP. The Rap1GAP whose expression is suppressed by the above nucleic acids are any suitable Rap1GAP family, such as Rap1GAP1, Rap1GAP2, spine-associated RapGAP protein (hereinafter also referred to as SPAR)1, GTPase Activating Rap / RanGAP Domain Like (hereinafter also referred to as GARNL)3, and RalGTTPase-activating protein (hereinafter also referred to as RalGAP)A1, RalGAPA2, etc. Among these, Rap1GAP1, SPAR1, and GARNL3 are preferred. Rap1GAP1 is found in large quantities in the striatum, and suppressing its expression may lead to greater preventive or therapeutic effects on Parkinson's disease.

[0011] The GenBank accession number for RAP1GAP1 is NM_001145658.3 for humans and NM_001081155.4 for mice. The GenBank accession number for RAP1GAP2 is NM_001411049.1 for humans and NM_001364131.1 for mice. The GenBank accession number for SPAR1 is NM_015556.4 for humans and NM_172579.4 for mice. The GenBank accession number for GARNL3 is NM_032293.5 for humans and NM_001355200.1 for mice. The GenBank accession number for RALGAPA1 is NM_001346243.2 for humans and NM_001112714.3 for mice. The GenBank accession number for RALGAPA2 is NM_020343.4 for humans and NM_001033348.4 for mice.

[0012] Any suitable nucleic acid can be used as the nucleic acid mentioned above. Examples include miRNA, siRNA, shRNA, dsRNA, and antisense oligonucleotides (ASOs). These are suitable for use because they have high specificity and target selectivity, and have high affinity with known delivery technologies and drug forms. Only one nucleic acid may be used, or two or more may be used in combination.

[0013] The sequences of the above nucleic acids can be determined by any appropriate method. For example, in the case of miRNA, the sequence can be determined by obtaining the nucleotide sequence information of Rap1GAP miRNA from the miRBase database or similar. In the case of siRNA, base sequence information can be obtained by searching using search software such as the siRNA Target Finder provided by Ambion (http: / / www.ambion.com / jp / techlib / misc / silan_finder.html), the insert design tool for pSilencer™ Expression Vector (http: / / www.ambion.com / jp / techlib / misc / psilencer_converter.html), and the GeneSeeer provided by RNAi Codex (http: / / codex.cshl.edu / scripts / newsearchhairpin.cgi).

[0014] Specifically, nucleic acid sequences capable of suppressing Rap1GAP can be obtained using the BLOCK-iT RNAi Designer provided by ThermoFisher (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ). Specifically, by setting the target mRNA region as the ORF (Open Reading Frame) and specifying the GC content in the bases to be in the range of 30% to 50%, sequence information for miRNA capable of suppressing Rap1GAP can be obtained. Furthermore, in order to avoid off-target effects, sequences that do not show homology with other genes may be selected.

[0015] Specifically, the above-mentioned nucleic acids include nucleic acids having the following sequences. As a miRNA for Rap1GAP1, a nucleic acid having any of the sequences of Sequence ID No. 1 to 3 below is included. As a miRNA for SPAR1, a nucleic acid having any of the sequences of Sequence ID No. 4 to 6 below is included. Furthermore, nucleic acids having homology to these sequences of, for example, 60% or more, preferably 70% or more, more preferably 80% or more, even more preferably 85% or more, particularly preferably 90% or more, and even more preferably 95% or more may be used. Sequence ID 1: AAAGTCCCTGCCTTCGTGGGAAT Sequence ID 2: GTTTCTGGGCCAGAAAAGTGAA Sequence ID 3: ATCCCTGATTGTCCCTGGGAAAA Sequence ID 4: GGGAATATGGCAGCACATTT Sequence ID 5: TGTCGGTGGAGAGCTTCATTA Sequence ID 6: ATCGAAGGTACTGCCTGGCTTT

[0016] Preferably, the nucleic acid represented by SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 is used. By using the above nucleic acid, the expression of Rap1GAP1, which is frequently observed in the striatum, can be suppressed, and a greater preventive or therapeutic effect can be achieved.

[0017] The above nucleic acids can be synthesized by any suitable method. For example, synthesis methods include solid-phase synthesis using phosphoramidites and solid-phase synthesis using hydrogen phosphonates. The nucleic acids may also be synthesized using any suitable automated nucleic acid synthesizer (e.g., Applied Biosystems, Dainippon Seiki, etc.). Alternatively, commercially available nucleic acids may be used. If the nucleic acid is miRNA, it can be prepared by obtaining the base sequence information of Rap1GAP's miRNA from the miRBase database, etc., and synthesizing it using any suitable automated DNA / RNA synthesizer (Applied Biosystems, Beckman, etc.).

[0018] The 3' and / or 5' ends of the above nucleic acids may be subjected to any appropriate modifications. Specifically, any appropriate ligand may be attached. The attachment of a ligand can improve the stability or binding affinity of the nucleic acid and improve intracellular dynamics, including intracellular uptake of the nucleic acid. Ligands can be used as components of transport carriers (liposomes, lipid nanoparticles (LNPs), polymers, micelles, virus particles, etc.) of drug delivery systems (DDS). Examples of ligands include lipids such as fatty acids, fatty acid chains, cholesterol, and phospholipids; sugars such as N-acetylgalactosamine; vitamins; peptides such as membrane-permeable peptides, cell-targeting peptides, receptor-binding peptides, endosome escape-promoting peptides, RGD peptides, peptides with high affinity for blood components, and tissue-targeting peptides; and polyethylene glycol (PEG). When attaching ligands to nucleic acids, a linker may be used.

[0019] The nucleic acid may be a prodrug of the nucleic acid, a pharmaceutically acceptable salt, or a pharmaceutically acceptable salt of the prodrug. Examples of pharmaceutically acceptable salts include alkali metals, alkaline earth metals, magnesium, transition metals, ammonia, salts with organic bases and amino acids, or salts with inorganic acids and organic acids.

[0020] In the above pharmaceutical composition, the nucleic acid may be introduced into any suitable vector. Examples of vectors include viral vectors such as lentiviruses, retroviruses, adenoviruses, adeno-associated viruses, and vaccinia viruses, as well as plasmid vectors.

[0021] The above pharmaceutical composition may include a carrier for delivering the nucleic acid. For example, the nucleic acid can be supported on nanoparticles such as lipid nanoparticles, polymer micelles, or liposomes. Depending on the purpose, it may also include lipid-based transfection agents, polymer-based transfection agents, magnetic particle-based transfection agents, etc.

[0022] The above-described pharmaceutical composition may be used in combination with any suitable Parkinson's disease treatment, such as a conventional Parkinson's disease treatment. When the pharmaceutical composition of the embodiment of the present invention is used in combination with a conventional Parkinson's disease treatment, an effect for preventing or treating Parkinson's disease can be obtained with a small amount of use, and the occurrence of side effects can be reduced.

[0023] The above-mentioned pharmaceutical composition is administered by any suitable method. The preferred method of administration is parenteral administration. Parenteral administration methods include intravenous injection or infusion, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration by aspiration or inhalation, subdural administration, intraventricular administration, and intracerebral administration. The parenteral pharmaceutical composition may contain buffers, diluents, and other suitable additives as needed. In the case of injections, the formulation can be prepared by sterilization with any suitable carrier.

[0024] Administration is carried out at an appropriate dose and frequency, depending on the severity of the condition being treated, the degree of response, etc. Using the pharmaceutical composition of the embodiment of the present invention, the occurrence of side effects from long-term administration can be suppressed. The target animals are typically humans or non-human mammals (mice, rats, rabbits, monkeys, dogs, horses, etc.).

[0025] B. Screening Method The screening method for drugs to prevent or treat Parkinson's disease according to embodiments of the present invention includes: preparing a test substance that may suppress the expression of Rap1GAP or inhibit the activity of Rap1GAP (hereinafter also referred to as Step I); administering the test substance to a non-human animal model of Parkinson's disease (hereinafter also referred to as Step II); and evaluating the efficacy of the test substance in the non-human animal model of Parkinson's disease (hereinafter also referred to as Step III). The following will be a specific explanation using the case where the test substance is miRNA as an example.

[0026] [Step I] The test substance may be one that is known to potentially suppress Rap1GAP expression or inhibit Rap1GAP activity, or a new test substance may be screened. For example, if the test substance is miRNA, the screening can be performed by any appropriate method. Specifically, it can be performed by the following method: Transfect any appropriate cell, for example HEK293T cells, with plasmid DNA into which a miRNA sequence has been inserted and plasmid DNA into which cDNA of Rap1GAP (hereinafter also referred to as FLAG-Rap1GAP) with an appropriate polypeptide protein tag, for example FLAG tag, has been inserted, and collect the cells after 48 hours. Perform a Western blot using the collected sample and detect the expression of FLAG-Rap1GAP using a tag antibody (for example, an anti-FLAG antibody when using a FLAG tag). Compare with a control sample expressing only FLAG to confirm whether the expression of FLAG-Rap1GAP is suppressed. If the expression level is lower than that of the control sample, it is determined that FLAG-Rap1GAP expression is suppressed. Alternatively, an adeno-associated virus vector expressing Rap1GAPmiRNA is prepared and inoculated into the striatum of mice. Three to four weeks after Rap1GAPmiRNA inoculation, the striatum is collected from the mice and rapidly frozen in liquid nitrogen. Western blotting is performed using this striatum sample to detect Rap1GAP expression. The expression is then compared to a control sample expressing a fluorescent protein or other substance instead of Rap1GAPmiRNA to confirm whether Rap1GAP expression is suppressed. If the expression level is lower than that of the control sample, it is determined that Rap1GAP expression is suppressed.

[0027] [Step II] Next, the test substance is administered to a non-human animal model of Parkinson's disease. Examples of non-human animals include mammals other than humans. Examples include great apes such as monkeys, rodents (Rodentia), rabbits, cats, dogs, horses, and cattle. From the viewpoint of ease of handling as experimental animals, rodents such as mice, rats, guinea pigs, and hamsters are preferably used. The non-human animal model of Parkinson's disease may be a bilateral non-human animal model of Parkinson's disease, or a unilateral non-human animal model of Parkinson's disease. In one embodiment, a unilateral non-human animal model of Parkinson's disease is used. By using a unilateral non-human animal model of Parkinson's disease, it is possible to compare the function of the Parkinson's disease-affected side and the non-affected side in the same individual. A non-human animal model of Parkinson's disease can be created, for example, by administering 6-hydroxydopamine to the brain.

[0028] The test substance is administered to a non-human animal model of Parkinson's disease by any appropriate method. For example, it may be administered intravenously (e.g., into the brain), intra-abdominantly (e.g., intravenously), intraperitoneally, topically (transdermally), or by inhalation. The administration may be a single dose or multiple doses.

[0029] [Step III] Next, the efficacy of the test substance is evaluated in non-human animal models of Parkinson's disease. The efficacy can be evaluated by any appropriate method. For example, in the case of a non-human animal model of unilateral Parkinson's disease, the efficacy can be evaluated by administering the test substance only to the affected area (e.g., the brain) on the side where Parkinson's disease has developed, and comparing the motor function on the affected side with the motor function on the unaffected side. In the case of a non-human animal model of bilateral Parkinson's disease, the efficacy can be evaluated by administering the test substance to one affected area (e.g., the brain) and comparing the motor function on the side where the test substance was administered with the motor function on the unadministered side. In one embodiment, the efficacy can be evaluated by administering the test substance to any appropriate site (e.g., the brain) on the side where Parkinson's disease has developed in a non-human animal model of unilateral Parkinson's disease, and comparing the motor function on the affected side with the motor function on the unaffected side of this non-human animal model of Parkinson's disease, using the recovery of motor function as the criterion for evaluating the efficacy. For example, the efficacy of a test substance can be evaluated using a non-human animal model of unilateral Parkinson's disease, specifically a rodent, through a cylinder test and measurement of spontaneous rotation. The cylinder test and spontaneous rotation are evaluation methods devised to assess asymmetry in motor activity using naturally occurring behaviors, and are suitable for use as a screening means for motor ability. In the cylinder test, the Parkinson's disease model rodent is first placed in an open-top cylinder that is tall enough to prevent the animal from escaping and wide enough for the animal to turn around. Next, a recording camera is placed next to the cylinder. The test is conducted for, for example, 5 minutes. The experimenter uses the recorded video to measure the number of times the animal leans against the wall using its right and left forelimbs, and calculates a forelimb use asymmetry score based on the results. The unilateral Parkinson's disease model rodent uses the forelimb opposite the Parkinson's disease-affected brain less when supporting its weight against the wall, while control animals without Parkinson's disease use their right and left forelimbs with similar frequency. The efficacy of a test substance can be evaluated by assessing the forelimb use asymmetry score over time and determining whether the score approaches the normal level of 50% after administration of the test substance. For example, an increase in the forelimb use asymmetry score 14 days after administration of the test substance can be evaluated as indicating efficacy.The forelimb use asymmetry score should preferably be significantly improved compared to a control non-human animal model of Parkinson's disease (e.g., a non-human animal model of Parkinson's disease that has not been administered the test substance). Spontaneous rotational movement is measured, for example, by placing a unilateral Parkinson's disease model rodent in a bowl with a spherical bottom and video recording it from above for 10 minutes. The number of times the unilateral Parkinson's disease model rodent performs continuous rotational movements of 180 degrees or more toward the side where Parkinson's disease has developed (e.g., the right side) or the side where Parkinson's disease has not developed (e.g., the left side) is measured. The unilateral Parkinson's disease model non-human animal tends to rotate toward the side where Parkinson's disease has developed, while the control animal rotates to the same extent toward both the left and right sides. If the number of rotations toward the side where Parkinson's disease has developed is significantly reduced, the drug is considered to be effective. Significant improvement or significant reduction means, for example, p < 0.05, preferably p < 0.01.

[0030] C. Method for Prevention or Treatment of Parkinson's Disease The therapeutic method of the embodiment of the present invention includes administering the above-mentioned pharmaceutical composition. Specifically, it includes administering the above-mentioned pharmaceutical composition to a subject for whom prevention or treatment of Parkinson's disease is desired by any appropriate method. Any appropriate method can be used as the method of administration. The method of administration is preferably parenteral administration. Parenteral administration methods include intravenous injection or drip infusion, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration by aspiration or inhalation, subdural administration, intraventricular administration, and intracerebral administration.

[0031] As described above, for prevention or treatment, the above pharmaceutical composition may be used in combination with any appropriate Parkinson's disease treatment drug, such as a conventional Parkinson's disease treatment drug. When the above pharmaceutical composition is used in combination with a conventional Parkinson's disease treatment drug, an effect for preventing or treating Parkinson's disease can be obtained with a small amount of use, and the occurrence of side effects can be reduced.

[0032] Administration is carried out at an appropriate dose and frequency, depending on the severity of the condition being treated, the degree of response, etc. Using the pharmaceutical composition of the embodiment of the present invention, the occurrence of side effects from long-term administration can be suppressed. The target animals are typically humans or non-human mammals (mice, rats, rabbits, monkeys, dogs, horses, etc.).

[0033] D. Use in the manufacture of pharmaceutical compositions The use of embodiments of the present invention in the manufacture of pharmaceutical compositions includes using nucleic acids that suppress the expression of Rap1GAP in the manufacture of pharmaceutical compositions. When used, the 3' and / or 5' ends of the nucleic acid may be subjected to any appropriate modifications. Specifically, any appropriate ligand may be attached. The attachment of a ligand can improve the stability or binding affinity of the nucleic acid and improve intracellular dynamics, including intracellular uptake of the nucleic acid. Ligands can be used as components of transport carriers (liposomes, lipid nanoparticles (LNPs), polymers, micelles, virus particles, etc.) of drug delivery systems (DDS). Examples of ligands include lipids such as fatty acids, fatty acid chains, cholesterol, and phospholipids; sugars such as N-acetylgalactosamine; vitamins; peptides such as membrane-permeable peptides, cell-targeting peptides, receptor-binding peptides, endosome escape-promoting peptides, RGD peptides, peptides with high affinity for blood components, and tissue-targeting peptides; polyethylene glycol (PEG), etc. When attaching ligands to nucleic acids, a linker may be used.

[0034] The nucleic acids described above may be used as prodrugs of nucleic acids, pharmaceutically acceptable salts, or pharmaceutically acceptable salts of said prodrugs. Examples of pharmaceutically acceptable salts include salts with alkali metals, alkaline earth metals, magnesium, transition metals, ammonia, organic bases and amino acids, or salts with inorganic acids and organic acids.

[0035] Nucleic acids may be introduced into any suitable vector and used. Examples of vectors include viral vectors such as lentiviruses, retroviruses, adenoviruses, adeno-associated viruses, and vaccinia viruses, as well as plasmid vectors.

[0036] The nucleic acids described above may be used in combination with a carrier for delivering them. For example, the nucleic acids may be supported on nanoparticles such as lipid nanoparticles, polymer micelles, or liposomes. Depending on the purpose, they may also be used in combination with lipid-based transfection agents, polymer-based transfection agents, magnetic particle-based transfection agents, etc.

[0037] The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples.

[0038] [Experimental Example 1] Creation of a unilateral Parkinson's disease model mouse The following materials were prepared to create a unilateral Parkinson's disease model mouse. <Materials>

[0039] 6-hydroxydopamine (6-OHDA) hydrobromide was mixed with 0.02% ascorbic acid-containing physiological saline to prepare a 4 mg / mL solution of 6-OHDA. The solution was stored in a cool, dark place until use and used within 2 hours of preparation. Desipramine hydrochloride (25 mg / kg) was administered intraperitoneally to mice 30 minutes before injecting the 6-OHDA solution. Subsequently, anesthetics (Domitol: 0.75 mg / kg, Midazolam: 4 mg / kg, Betrolfar: 5 mg / kg) were administered intraperitoneally to the mice, and they were restrained in a stereotactic device. Then, the skin of the mouse's head was incised, the bregma and lambda were adjusted horizontally, and a small hole was drilled in the skull. A microsyringe and glass tube were connected with a Teflon® tubing with a joint, and the 6-OHDA solution was filled. The microsyringe was then attached to a micro-infusion pump. Using Bregma as a reference point, a glass tube was inserted into the medial forebrain bundle of the right hemisphere (anterior-posterior axis: -1.0 mm, lateral axis: 1.4 mm, depth from the brain surface: 4.8 mm) using a hydraulic manipulator. Next, 1.2 μL of 6-OHDA solution was injected at a rate of 200 nL / min using a microinfusion pump. After injection, the tube was allowed to stand for 2 minutes, and then slowly withdrawn using a hydraulic manipulator. Subsequently, the skin was sutured, and a medetomidine antagonist (Antisedan: 0.75 mg / kg) was administered intraperitoneally. After confirming that pain sensation had returned to the mouse, the mouse was returned to its cage.

[0040] [Experimental Example 2] Evaluation of Motor Impairment in Hemiplegic Parkinson's Disease Model Mice Motor impairment in uniplegic Parkinson's disease model mice was evaluated using the cylinder test and observation of spontaneous rotational movements. The weight of the uniplegic Parkinson's disease model mice obtained in Experimental Example 1 was measured daily to confirm that weight loss had stopped. Mice whose weight loss had stopped were used in the experiment. <Cylinder Test> A uniplegic Parkinson's disease model mouse was placed in a transparent acrylic cylinder with a diameter of 10 cm and a height of 20 cm, and the mouse's movements were video recorded for 5 minutes. The mouse normally exhibits exploratory behavior in the cylinder, using its forelimbs to lean against the wall and stand up. The number of times the uniplegic Parkinson's disease model mouse leaned against the cylinder with its left or right forelimb was measured. As an asymmetric score for forelimb use, the number of times the left forelimb (opposite to the one injected with 6-OHDA solution) touched the cylinder was calculated as a percentage of the total number of touches. Asymmetric score (%) = {Number of times leaning against the tube with the left forelimb / (Number of times leaning against the tube with the left forelimb + Number of times leaning against the tube with the right forelimb)} × 100 <Observation of spontaneous rotational movement> A unilateral Parkinson's disease model mouse was placed in a bowl with a diameter of 30 cm, and the mouse's movements were video recorded for 10 minutes. The number of times the unilateral Parkinson's disease model mouse made a sweeping turn of 180 degrees or more to the ipsilateral side (right side, Parkinson's disease model) or the opposite side (left side) to which the 6-OHDA solution was injected was measured.

[0041] Mice with an asymmetric score of 40% or higher in the cylinder test were injected with 6-OHDA solution in the same manner as in Experimental Example 1. Mice with an asymmetric score of less than 40% were used as a unilateral Parkinson's disease model. Adeno-associated virus vectors were injected into the unilateral Parkinson's disease model mice using the following procedure.

[0042] <Injection of adeno-associated virus vector> The following materials were prepared, and an adeno-associated virus vector was administered to unilateral Parkinson's disease model mice. <Materials> The viral vectors described in Table 2 were used. The viral vectors used were those distributed by the Viral Vector Development Laboratory, National Institute for Physiological Sciences. As the Rap1GAP1 miRNAs (Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, Rap1GAP1 miRNA_C) to be introduced into each viral vector, and the SPAR1 miRNAs (SPAR1 miRNA_A, SPAR1 miRNA_B, SPAR1 miRNA_C), those described in Table 3 were used.

[0043]

[0044] An anesthetic (Domitor: 0.75 mg / kg, Midazolam: 4 mg / kg, Vetorphale: 5 mg / kg) was intraperitoneally administered to unilateral Parkinson's disease model mice, and the mice were secured in a stereotaxic apparatus. The skin on the head was incised, bregma and lambda were adjusted to be horizontal, and a small hole was drilled in the skull. A microsyringe and a glass tube were connected via a Teflon (registered trademark) tube with a joint, and filled with Fluorinert (3M Company). Next, 5 μL to 10 μL of the viral vector solution was filled while aspirating from the tip of the glass tube, and the microsyringe was attached to a microinjection pump. Using bregma as the reference point, the glass tube was inserted into the striatum of the right hemisphere (anteroposterior axis: +1.2 mm, mediolateral axis: 2.0 mm, depth from the brain surface: 2.5 mm) using a hydraulic manipulator. Next, 0.2 μL of the viral vector was injected at a rate of 100 nL / min using the microinjection pump. After the injection, the system was left to stand for 4 minutes, and the glass tube was slowly pulled out using the hydraulic manipulator. Similarly, the viral vector was injected into the other two sites of the striatum (anteroposterior axis: +0.5 mm, mediolateral axis: 2.5 mm, depth from the brain surface: 2.7 mm; anteroposterior axis: -0.1 mm, mediolateral axis: 3.0 mm, depth from the brain surface: 2.7 mm). Thereafter, the skin was sutured, and a medetomidine antagonist (Antisedan: 0.75 mg / kg) was intraperitoneally administered. After confirming that the pain sensation had returned to the mice, the mice were returned to their rearing cages.

[0045] Cylinder tests and spontaneous rotational movements were observed on days 7, 14, 21, and 28 after injection of vectors containing Rap1GAP1 miRNA (Rap1GAP1miRNA_A, Rap1GAP1miRNA_B, Rap1GAP1miRNA_C) ​​and SPAR1 miRNA (SPAR1miRNA_A, SPAR1miRNA_B, SPAR1miRNA_C). Evaluations were performed on 9 control individuals, 6 individuals administered Rap1GAP1miRNA_A, 6 individuals administered Rap1GAP1miRNA_B, 6 individuals administered Rap1GAP1miRNA_C, 3 individuals administered SPAR1miRNA_A, 3 individuals administered SPAR1miRNA_B, and 3 individuals administered SPAR1miRNA_C. Furthermore, the evaluation results were statistically analyzed using ANOVA.

[0046] Figure 2A is a graph showing the asymmetric scores of a control unilateral Parkinson's disease model mouse and a unilateral Parkinson's disease model mouse administered with Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, or Rap1GAP1 miRNA_C, before administration (Pre), and on days 7, 14, 21, and 28 (with day 0 being administration). Figure 2B is a graph showing the asymmetric scores of a control unilateral Parkinson's disease model mouse and a unilateral Parkinson's disease model mouse administered with SPAR1 miRNA_A, SPAR1 miRNA_B, or SPAR1 miRNA_C, before administration (Pre), and on days 7, 14, 21, and 28 (with day 0 being administration). In unilateral Parkinson's disease model mice administered with Rap1GAP1 miRNA_A, the asymmetry score improved to a level close to the normal level of 50% (i.e., no difference between left and right sides) after 14 days of administration. In unilateral Parkinson's disease model mice administered with Rap1GAP1 miRNA_B and Rap1GAP1 miRNA_C, the asymmetry score improved to a level close to 40% after 14 days of administration. In unilateral Parkinson's disease model mice administered with SPAR1 miRNA_A and SPAR1 miRNA_C, the asymmetry score improved to a level close to 40% after 21 days of administration. In the control unilateral Parkinson's disease model mice, no significant change in the asymmetry score was observed from before administration to 28 days. Administration of Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, Rap1GAP1 miRNA_C, and SPAR1 miRNA_A and SPAR1 miRNA_C tended to improve motor function. Significant differences were observed between the control group and the Rap1GAP1 miRNA_A group on days 21 and 28 (days 21 and 28: p < 0.01). Significant differences were also observed between the control group and the Rap1GAP1 miRNA_B group and the Rap1GAP1 miRNA_C group on days 14, 21, and 28 (days 14, 21, and 28: p < 0.05). On days 21 and 28 of administration, the SPAR1 miRNA_A administration group showed a tendency toward improvement (days 21 and 28: p < 0.1).On day 28 after administration, a significant difference was observed between the control administration group and the SPAR1 miRNA_C administration group (p < 0.05). When a viral vector is used, the administered miRNA is expressed in the living body approximately 14 to 21 days after administration, so it is considered that a significant difference in motor function was observed after day 14 or after day 21.

[0047] Figure 3A is a graph showing the number of spontaneous rotational movements over 10 minutes before administration (Pre), and on days 7, 14, 21, and 28 (day 0) of administration to unilateral Parkinson's disease model mice that were administered Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, or Rap1GAP1 miRNA_C, compared to a control mouse. Figure 3B is a graph showing the number of spontaneous rotational movements over 10 minutes before administration (Pre), and on days 7, 14, 21, and 28 (day 0) of administration to unilateral Parkinson's disease model mice that were administered SPAR1 miRNA_A, SPAR1 miRNA_B, or SPAR1 miRNA_C, compared to a control mouse. In the Pre group, rotation was significantly towards the side to which the 6-OHDA solution was injected (Ipsi) (right side, Parkinson's disease model). In unilateral Parkinson's disease model mice administered Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, Rap1GAP1 miRNA_C, and SPAR1 miRNA_A, rotation to the right decreased after day 14, and rotation to the left (Contra) also began to be observed. In unilateral Parkinson's disease model mice administered SPAR1 miRNA_B, rotation to the right decreased after day 21, and in unilateral Parkinson's disease model mice administered SPAR1 miRNA_C, rotation to the left decreased after day 28, and rotation to the left was also observed at this point. In the control unilateral Parkinson's disease model mice, rotation to the right was observed from before administration until day 28. The administration of Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, and Rap1GAP1 miRNA_C, as well as SPAR1 miRNA_A, SPAR1 miRNA_B, and SPAR1 miRNA_C, resulted in improved motor function. On day 21 of administration, a significant difference was observed between the control group and the Rap1GAP1 miRNA_C and SPAR1 miRNA_A groups (p < 0.05).On day 28 of administration, significant differences were observed between the control group and the groups administered Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, and Rap1GAP1 miRNA_C, as well as between SPAR1 miRNA_B and SPAR1 miRNA_C (p < 0.01).

[0048] <Experimental Example 3> Detection of Rap1GAP1, SPAR1, and MAPK expression by Western blotting The following materials were prepared, and expression detection was performed by Western blotting.

[0049] In the second experimental example, adeno-associated virus vectors were injected into unilateral Parkinson's disease model mice (control (untreated unilateral Parkinson's disease model mouse, PD_EGGFP), unilateral Parkinson's disease model mice administered with Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, or Rap1GAP1 miRNA_C, and unilateral Parkinson's disease model mice administered with SPAR1 miRNA_A, SPAR1 miRNA_B, or SPAR1 miRNA_C: 3 individuals each) for more than 28 days. The cervical vertebrae were dislocated, the skulls were decapitated, and the skulls were opened to expose the skulls. The skulls were then cooled by immersion in 2-methylbutane cooled to -30°C for about 10 seconds. Next, the brains were quickly removed and cooled in NMDG-HEPES aCSF (pH 7.35) that had been aerated and cooled with ice. Subsequently, the brain was sectioned into 350 μm coronal sections using a vibratome, and the striatum was excised under microscopic observation using a stereomicroscope and transferred to a tube. The tube was rapidly frozen with liquid nitrogen and stored at -80°C. The brain was divided into two parts: one side administered with 6-OHDA solution and the other side not administered with 6-OHDA solution, and each was used as a separate sample. A RIPA buffer was prepared by adding 0.1% SDS and phosSTOP. 200 μL of the prepared RIPA buffer was added to the striatum sample stored at -80°C. Next, the brain tissue was disrupted with ultrasound, left to stand on ice for 5 minutes, and then centrifuged at a relative centrifugal acceleration of 13,000 g at 4°C for 15 minutes. Then, 180 μL of the supernatant was taken, 60 μL of 4X LSD sample buffer with 4 mM DTT added was added, and the mixture was heated at 95°C for 5 minutes to perform denaturation. Next, the samples were cooled on ice. If electrophoresis was not performed immediately, they were stored at -30°C. A 10% polyacrylamide gel was prepared, the gel was placed in the electrophoresis layer, SDS running buffer was added, and each well was filled with the sample (5 μL to 10 μL) and molecular weight marker, and electrophoresis was performed at 120 V for 90 minutes. After that, the PVDF membrane was immersed in methanol, and then immersed in blotting solution B for at least 15 minutes.Next, filter paper immersed in blotting solution A, filter paper immersed in blotting solution B, membrane, gel, and filter paper immersed in blotting solution C were placed in the transfer cassette in that order, and the transfer was performed using a TransBlot Turbo transfer system (Bio-Rad) in a semi-dry manner at 25V, 1.0A for 30 minutes. After the transfer, the membrane was washed with TTBS and incubated at room temperature for 30 minutes in blocking buffer containing 20% ​​Blocking One and 0.2% Tween 20. The membrane was then washed three times with TTBS and reacted overnight at 4°C with primary antibodies (anti-Rap1GAP1 antibody, 1,000-fold dilution with Can Get Signal Solution 1; anti-SPAR1 antibody, 3,000-fold dilution with Can Get Signal Solution 1; anti-MAPK antibody, 1,000-fold dilution with Can Get Signal Solution). The membrane was then washed three times with TTBS and reacted with secondary antibodies (20,000-fold dilution with blocking buffer containing 20% ​​Blocking One and 0.2% Tween 20) at room temperature for 30 minutes. Subsequently, the membrane was washed four times with TTBS and the signal was detected using an imaging system (product name "Odyssey", LI-COR Biotechnology). The detected signal images were opened in Odyssey Image Studio, a region of interest (ROI) surrounding the signal was set for each sample, and the signal intensity was measured. The signal intensities of Rap1GAP1 and SPAR1 were normalized by dividing them by the signal intensity of MAPK for the same sample (Rap1GAP1 signal intensity / MAPK signal intensity, or SPAR1 signal intensity / MAPK signal intensity) and then compared. The results are shown in Figure 4.

[0050] Figure 4A shows the results of a Western blot (top) and a graph (bottom) of the expression level of Rap1GAP1 in striatal samples taken from the Parkinson's disease-affected side of a control unilateral Parkinson's disease model mouse and a unilateral Parkinson's disease model mouse administered with Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, and Rap1GAP1 miRNA_C. Figure 4B shows the results of a Western blot (top) and a graph (bottom) of the expression level of SPAR1 in striatal samples taken from the Parkinson's disease-affected side of a control unilateral Parkinson's disease model mouse and a unilateral Parkinson's disease model mouse administered with SPAR1 miRNA_A, miRNA_B, and miRNA_C. In striatum samples from the Parkinson's disease-affected side of unilateral Parkinson's disease model mice administered with Rap1GAP1 miRNA_A, Rap1GAP1 miRNA_B, and Rap1GAP1 miRNA_C, Rap1GAP1 expression levels were significantly lower compared to striatum samples from the Parkinson's disease-affected side of control unilateral Parkinson's disease model mice (Rap1GAP1 miRNA_A: p < 0.05, Rap1GAP1 miRNA_B: p < 0.01, Rap1GAP1 miRNA_C: p < 0.05). In striatum samples from the affected side of unilateral Parkinson's disease model mice administered with SPAR1 miRNA_A or SPAR1 miRNA_C, SPAR1 expression levels were significantly lower compared to striatum samples from the affected side of control unilateral Parkinson's disease model mice (SPAR1 miRNA_A: p < 0.05, SPAR1 miRNA_C: p < 0.01). In striatum samples from the affected side of Parkinson's disease model mice administered with SPAR1 miRNA_B, a tendency for decreased SPAR1 expression was observed compared to striatum samples from the affected side of control unilateral Parkinson's disease model mice (SPAR1 miRNA_B: p < 0.1). These results suggest that administering Rap1GAP1 miRNA or SPAR1 miRNA to the brains of Parkinson's disease models reduced the expression levels of Rap1GAP1 and SPAR1, resulting in improved motor function.

[0051] The pharmaceutical compositions of the embodiments of the present invention can be suitably used for the prevention or treatment of Parkinson's disease.

Claims

1. A pharmaceutical composition for preventing or treating Parkinson's disease, comprising a nucleic acid that suppresses the expression of Rap1GAP.

2. The pharmaceutical composition for preventing or treating Parkinson's disease according to claim 1, wherein the nucleic acid is at least one selected from the group consisting of miRNA, siRNA, shRNA, dsRNA, and antisense oligonucleotides.

3. The pharmaceutical composition for preventing or treating Parkinson's disease according to claim 1, wherein Rap1GAP is at least one selected from the group consisting of Rap1GAP1, Rap1GAP2, SPAR1, GARNL3, RalGAPA1, and RalGAPA2.

4. The pharmaceutical composition for preventing or treating Parkinson's disease according to claim 1, wherein the nucleic acid is at least one selected from the group consisting of sequence numbers 1 to 6 and nucleic acids having a homology of 80% or more to these sequences.

5. A method for screening drugs for the prevention or treatment of Parkinson's disease, comprising: preparing a test substance that may suppress the expression of Rap1GAP or inhibit the activity of Rap1GAP; administering the test substance to a non-human animal model of Parkinson's disease; and evaluating the efficacy of the test substance in the non-human animal model of Parkinson's disease.

6. The method for screening drugs for preventing or treating Parkinson's disease according to claim 5, wherein the non-human animal model of Parkinson's disease is a non-human animal model of unilateral Parkinson's disease, and the evaluation is a comparison between the side on which Parkinson's disease develops and the side on which Parkinson's disease does not develop.

7. A method for preventing or treating Parkinson's disease, comprising administering the pharmaceutical composition described in any one of claims 1 to 4 to a target.

8. Use of nucleic acids that inhibit Rap1GAP expression in the manufacture of pharmaceutical compositions for the prevention or treatment of Parkinson's disease.

Images