Pharmaceutical composition for preventing or treating periodontal disease comprising GPR40 agonist

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating periodontal disease, comprising a GPR40 agonist compound as an active ingredient, and a formulation thereof. In the present invention, EFL-601 exhibited anti-inflammatory effects in vascular endothelial cells and gingival fibroblasts. In addition, EFL-601 inhibited osteoclast differentiation induced by RANKL treatment in RAW 264.7 cells. Furthermore, EFL-601 inhibited inflammatory cytokine expression and alveolar bone loss in a periodontitis model. These results suggest that EFL-601 can be used for preventing and treating periodontitis.

Description

Pharmaceutical composition for the prevention or treatment of periodontal disease containing a GPR40 agonist

[0001] The present invention relates to a pharmaceutical composition for the prevention or treatment of periodontal disease comprising a GPR40 agonist as an active ingredient.

[0002] Periodontal disease is a condition caused by toxic substances produced by microbial communities of dental calculus and plaque on the tooth surface, as well as inflammatory responses in the tissues surrounding the teeth. As periodontal disease progresses, pathological tissue reactions cause the gingival sulcus to deepen, forming periodontal pockets and leading to bone loss, which ultimately results in tooth loss. Periodontitis is one of the most common oral diseases in adults, exhibiting a high prevalence rate of 20–50%. Furthermore, as the mechanisms by which bacteria associated with periodontal disease induce and exacerbate systemic diseases such as diabetes and cardiovascular disease have recently been elucidated, the importance of preventing and treating periodontal disease is growing even more.

[0003] GPR40 is a G protein-coupled receptor that recognizes fatty acids and is known to be involved in inflammatory responses and immunomodulation. In particular, GPR40 is expressed in bone cells, and its activation is known to inhibit osteoclast differentiation, which contributes to preventing bone loss. GPR40-deficient mice (GPR40 - / -) exhibited osteoporotic characteristics, and the GPR40 agonist GW9508 was reported to inhibit bone loss by suppressing osteoclast differentiation (Wauquier F et al., J Biol Chem. 288:6542-6551 (2013)). Furthermore, it has been reported that hyaluronic acid increases GPR40 expression and decreases the expression of inflammatory cytokines in gingival epithelial cells treated with periodontal pathogens, thereby improving periodontitis in a periodontitis model (Miki Yamada et al., Sci Rep. 8:9008 (2018)). Therefore, GPR40 is currently being suggested as a potential target for the treatment of periodontitis, and active research on this is necessary.

[0004] Accordingly, the inventors of the present invention completed the present invention by researching a method for inhibiting periodontitis, confirming that EFL-601 increases the activity of GPR40 and inhibits the expression of inflammatory cytokines and osteoclast differentiation, and confirming that it is effective in the prevention and treatment of periodontitis.

[0005] Accordingly, to achieve the above objective, one aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of periodontal disease comprising at least one active ingredient selected from the group consisting of a compound represented by the following chemical formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof:

[0006] <Chemical Formula I>

[0007]

[0008] In the above chemical formula I, R 1Silver halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyl; R 2 and R 3 Each independently consists of hydrogen, halogen, hydroxy, and C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyl; R 4 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyl; R 5 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 Alkylamino and di(C 1-6 Selected from the group consisting of alkyl)amino; said n is an integer from 0 to 2.

[0009] Another aspect of the present invention provides a pharmaceutical formulation comprising at least one selected from the group consisting of a compound represented by Formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof; and a temperature-sensitive polymer.

[0010] Another aspect of the present invention provides a method for preventing or treating periodontal disease comprising the step of administering to an individual at least one selected from the group consisting of a compound represented by the formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof.

[0011] Another aspect of the present invention provides at least one use for the prevention or treatment of periodontal disease selected from the group consisting of a compound represented by the formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof.

[0012] In the present invention, EFL-601 activated GPR40 and exhibited anti-inflammatory effects in vascular endothelial cells and gingival fibroblasts. In addition, it inhibited osteoclast differentiation in RAW 264.7 cells induced by treatment with RANKL (receptor activator of nuclear factor kappa-B ligand). Furthermore, EFL-601 inhibited the expression of inflammatory cytokines and inhibited alveolar bone loss in a periodontitis model. Based on these results, it is believed that EFL-601 can be used for the prevention and treatment of periodontitis.

[0013] Figure 1 shows Ca2 released after treating CHO-K1 recombinant cells expressing human GPR40 with EFL-601 or the control substance DHA (docosahexaenoic acid) at different concentrations. 2 + By measuring and checking the activation% compared to baseline, EC 50This is a graph showing the results (Aequorin assay, n=2).

[0014] Figure 2 shows the results of confirming changes in intracellular NF-κB phosphorylation after treating HUVEC cells (A) or HGF-1 cells (B) with PgLPS (Porphyromonas gingivalis-derived lipopolysaccharide), or EFL-601 and PgLPS for 0.5 hours, and a graph quantifying the results (Mean±SEM, n=3). *p<0.05 vsPgLPS by Dunnett's multiple comparison.

[0015] Figure 3 shows the results of confirming changes in intracellular expression of ICAM-1 (intercellular adhesion molecule 1) (A) and VCAM-1 (vascular cell adhesion molecule 1) (B) after treating HUVEC cells with PgLPS, or EFL-601 and PgLPS, for 6 hours, and a graph quantifying the results (Mean±SEM, n=6). *p<0.05 vsPgLPS by Dunnett's multiple comparison

[0016] Figure 4 is a graph showing the results of confirming gene expression of MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) in HUVEC cells via qPCR after treatment with PgLPS, or EFL-601 and PgLPS, for 2 hours (Mean±SEM, n=3). *p<0.05 vsPgLPS by Dunnett's multiple comparison

[0017] Figure 5 is a graph showing the results of confirming gene expression of IL-6 (interleukin-6) and TNF-α (tumor necrosis factor α) by qPCR in HUVEC cells after treatment with PgLPS, or EFL-601 and PgLPS, for 2 hours (Mean±SEM, n=3). *p<0.05 vsPgLPS by Dunnett's multiple comparison

[0018] Figure 6 is a graph showing the results of measuring the concentrations of IL-6 and TNF-α in the cell culture medium after treating HUVEC cells with PgLPS, or EFL-601 and PgLPS, for 6 hours (Mean±SEM, n=3). *p<0.05 vsPgLPS by Dunnett's multiple comparison

[0019] Figure 7 shows the results of confirming osteoclast differentiation in RAW 264.7 cells by TRAP (tartrate-resistant acid phosphatase) staining after treatment with RANKL (receptor activator of nuclear factor kappa-B ligand) alone, or EFL-601 or Fasiglifam and RANKL for 96 hours.

[0020] Figure 8 is a graph showing the results of confirming gene expression of Ctsk (cathepsin K), Acp5 (acid phosphatase 5, TRAP), and MMP-9 by qPCR in RAW 264.7 cells after treatment with RANKL alone, or EFL-601 or Fasiglifam and RANKL for 72 hours (Mean±SEM, n=4). *p<0.05, **p<0.01, ***p<0.001 vs DMSO by Dunnett's multiple comparison

[0021] Figure 9 is a graph showing the results of confirming changes in gene expression of IL-1β and IL-6 in gingival tissue induced by EFL-601 administration in a rat periodontitis model using qPCR (Mean±SEM, n=7 or 8). *p<0.05 vs vehicle by Dunnett's multiple comparison

[0022] Figure 10 shows the results of analyzing changes in bone parameters caused by EFL-601 administration in a rat periodontitis model using Micro-CT, including figure (A) and graph (B) (Mean±SD, n=7 or 8). *p<0.05 vs vehicle by Dunnett's multiple comparison

[0023] Figure 11 shows (A) and a graph (Mean±SD, n=8) representing the results of confirming the degree of alveolar bone loss induced by EFL-601 administration in a rat model of periodontitis through methylene blue staining and measurement of the CEJ-ABC (cementum-enamel junction to alveolar bone crest) distance. *p<0.05 vs vehicle by Dunnett's multiple comparison

[0024] FIG. 12 is a graph showing the results of measuring the time-dependent drug release in an injectable formulation, which is one embodiment of the present invention.

[0025] Pharmaceutical composition

[0026] One aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of periodontal disease comprising at least one active ingredient selected from the group consisting of a compound represented by the following chemical formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and isomers thereof:

[0027] <Chemical Formula I>

[0028] .

[0029] In the above chemical formula I, R 1 Silver halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 It can be selected from the group consisting of hydroxyalkyl groups.

[0030] In the above chemical formula I, R 2 and R 3 Each independently consists of hydrogen, halogen, hydroxy, and C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 It can be selected from the group consisting of hydroxyalkyl groups.

[0031] In the above chemical formula I, R 4 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 It can be selected from the group consisting of hydroxyalkyl groups.

[0032] In the above chemical formula I, R 5 is hydrogen, halogen, hydroxy, C1-6 Alkoxy, amino, C 1-6 Alkylamino and di(C 1-6 It can be selected from the group consisting of alkyl)aminos.

[0033] In the above chemical formula I, n is an integer from 0 to 2.

[0034] In one embodiment, the above R 1 Silver halogen, hydroxy, C 1-4 Alkoxy, amino, C 1-4 alkylamino, di(C 1-4 Alkyl)amino, nitro, cyano, carboxy, C 1-4 Alkyl carbonyl, carbamoyl, C 1-4 Alkylcarbamoyl, di(C 1-4 Alkyl)carbamoyl, C 1-4 Alkyl, C 1-4 Haloalkyl and C 1-4 It can be selected from the group consisting of hydroxyalkyls. In one embodiment, the R 1 C 1-6 It may be an alkyl. In one embodiment, the R 1 C 1-4 It may be an alkyl group. For example, the above R 1 It may be methyl, ethyl, propyl, or butyl. In one embodiment, R 1 It may be methyl. The above n may be an integer from 0 to 2, and when n is 2, R 1 At least one of them is C 1-6 It can be an alkyl.

[0035] In one embodiment, the above R 2 and R 3 Each independently consists of hydrogen, halogen, hydroxy, and C 1-4 Alkoxy, amino, C 1-4 alkylamino, di(C 1-4 Alkyl)amino, nitro, cyano, carboxy, C 1-4 Alkyl carbonyl, carbamoyl, C 1-4 Alkylcarbamoyl, di(C 1-4 Alkyl)carbamoyl, C 1-4 Alkyl, C1-4 Haloalkyl and C 1-4 It can be selected from the group consisting of hydroxyalkyls. In one embodiment, the R 2 and R 3 It can be hydrogen.

[0036] In one embodiment, the above R 4 is hydrogen, halogen, hydroxy, C 1-4 Alkoxy, amino, C 1-4 alkylamino, di(C 1-4 Alkyl)amino, nitro, cyano, carboxy, C 1-4 Alkyl carbonyl, carbamoyl, C 1-4 Alkylcarbamoyl, di(C 1-4 Alkyl)carbamoyl, C 1-4 Alkyl, C 1-4 Haloalkyl and C 1-4 It may be selected from the group consisting of hydroxyalkyls. In one embodiment, the R 4 is hydrogen or C 1-6 It may be an alkyl. In one embodiment, the R 4 is hydrogen or C 1-4 It may be an alkyl. In one embodiment, the R 4 may be hydrogen, methyl, ethyl, propyl, or butyl. In one embodiment, R 4 It can be methyl.

[0037] In one embodiment, the above R 5 is a hydroxyl, C 1-4 Alkoxy, amino, C 1-4 alkylamino or di(C 1-4 It may be an alkyl)amino. In one embodiment, the R 5 is a hydroxy or C 1-6 It may be an alkoxy. In one embodiment, the R 5 It can be a hydroxyl group.

[0038] In one embodiment, the above formula I may have the structure of the following formula I-1. In this case, the compound having the structure of the above formula I-1 may be 3-(4-((1-(4-(allyloxy)-6-methylpyrimidin-2-yl)-1,2,3,6-tetrahydropyridin-4-yl)methoxy)phenyl)hex-4-ynoic acid. In the present invention, the compound having the structure of the following formula I-1 is named EFL-601.

[0039] <Chemical Formula I-1>

[0040] .

[0041] The term "halogen" as used in this specification refers to an atom belonging to Group 17 of the periodic table. Halogen atoms include fluorine, chlorine, bromine, and iodine, and may be used interchangeably with the term "halo," which refers to a monovalent functional group composed of a halogen.

[0042] The above "alkyl" means a fully saturated branched or unbranched (or straight-chain or linear) hydrocarbon. The above alkyl may be a substituted or unsubstituted alkyl. The above C 1-20 Alkyl groups are, for example, C 1-15 , C 1-10 or C 1-6 It may be an alkyl. The above C 1-6 Alkyl is C 1-5 , C 1-4 , C 1-3 or C 1-2 It may be an alkyl. The alkyl may be, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, n-pentyl, isopentyl, neopentyl, iso-amyl, or n-hexyl.

[0043] The above "hydroxy" refers to the -OH functional group (hydroxyl group).

[0044] The above "alkoxy" refers to an alkyl group bonded to an oxygen (-O-) atom. The above C 1-20Alkoxy, for example, C 1-15 , C 1-10 or C 1-6 It may be an alkoxy. The above C 1-6 Alkoxy is C 1-5 , C 1-4 , C 1-3 or C 1-2 It may be an alkoxy group. Non-limiting examples of alkoxy groups may include methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, sec-butoxy, iso-butoxy, tert-butoxy, etc.

[0045] The above "amino" refers to -NH2.

[0046] The above "alkylamino" refers to a substituent in which one of the two hydrogen (H) atoms of the amino group is substituted with an alkyl group. Examples of alkylamino groups may include, but are not limited to, methylamino, ethylamino, and propylamino.

[0047] The above "di(alkyl)amino" refers to a substituent in which two hydrogen atoms of the amino group are each substituted with an alkyl group. The two alkyls of the di(alkyl)amino group may be the same or different.

[0048] The above "Nitro" refers to -NO2.

[0049] The above "cyano" is -CN, which refers to a functional group consisting of a triple bond between a carbon atom and a nitrogen atom.

[0050] The above "carboxy" refers to -COOH. The salt of carboxy refers to the conjugate base of a carboxylic acid.

[0051] The above "alkyl carbonyl" refers to a -C(=O)-alkyl radical, where 'alkyl' is the same as described above. For example, it may include methyl carbonyl (acetyl, -C(=O)CH3), ethyl carbonyl, n-propyl carbonyl, iso-propyl carbonyl, n-butyl carbonyl, sec-butyl carbonyl, iso-butyl carbonyl, tert-butyl carbonyl, n-octyl carbonyl, etc.

[0052] The above "carbamoyl" refers to -CONH2.

[0053] The above "alkylcarbamoyl" refers to a substituent in which one hydrogen atom of -NH2 in the carbamoyl is substituted with an alkyl group.

[0054] The above "di(alkyl)carbamoyl" refers to a substituent in which two hydrogen atoms of -NH2 in the carbamoyl are each substituted with an alkyl group. In the di(alkyl)carbamoyl, the two alkyl groups may be the same or different from each other.

[0055] The term "haloalkyl" above refers to an alkyl group substituted with one or more halos or halogen atoms. The halogen may be the same (e.g., CHF2, -CF3) or different (e.g., CF2Cl). Unless otherwise indicated, the haloalkyl group may optionally be substituted with one or more substituents other than the halogen. Examples of haloalkyl groups may include, but are not limited to, fluoromethyl, dichloroethyl, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl groups. Additionally, the haloalkyl may include a perhaloalkyl in which all hydrogens of the alkyl group are substituted with a halogen.

[0056] The above "hydroxyalkyl" refers to an alkyl group substituted with one or more hydroxyl groups (-OH), wherein the alkyl is the same as described above.

[0057] The compound represented by Formula I, its pharmaceutically acceptable salt, its prodrug, its solvate, or its isomer used in the composition according to the present invention may be prepared by various methods based on known methods and / or techniques in the field of organic synthesis. Based on these methods, various derivatives may be synthesized using appropriate synthesis methods depending on the type of substituent.

[0058] The range of active ingredients included in the composition of the present invention includes all of the compound represented by Formula I, its pharmaceutically acceptable salt, prodrug, solvate, and isomer. Unless otherwise stated herein, the term "compound represented by Formula I" may be used to encompass all of the compound itself, its pharmaceutically acceptable salt, prodrug, solvate, and isomer.

[0059] The term “pharmaceuticalally acceptable salt” as used in this specification refers to a formulation of a compound that does not cause severe irritation to an organism to which the compound is administered and does not impair the biological activity and physical properties of the compound. The pharmaceutically acceptable salt includes acid addition salts formed by acids that form non-toxic acid addition salts containing pharmaceutically acceptable anions, such as inorganic acids like hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromide, hydroiodide, etc.; organic carboxylic acids like tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid, etc.; and sulfonic acids like methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc. Meanwhile, base addition salts include alkali metal salts or alkaline earth metal salts formed by lithium, sodium, potassium, calcium, magnesium, etc., amino acid salts such as lysine, arginine, guanidine, etc., and organic salts such as dicyclohexylamine, N-methyl-D-glucarmine, tris(hydroxymethyl)methylamine, diethanolamine, choline, and triethylamine, etc. The compound represented by Formula I used in the present invention can be converted into its salt by conventional methods.

[0060] As used herein, the term "prodrug" refers to a substance that is modified into a parent drug in vivo. Prodrugs are often used because they are easier to administer than parent drugs. For example, they may achieve physiological activity by oral administration, whereas parent drugs may not. Prodrugs may also have improved solubility in the drug composition compared to parent drugs. For example, a prodrug may be a compound administered as an ester that facilitates passage through the cell membrane, in which water solubility is detrimental to mobility but is hydrolyzed by metabolism into an active carboxylic acid once water solubility is beneficial in the cell. Another example of a prodrug may be a short peptide (polyamino acid) attached to an acid group that is converted by metabolism to expose the active site of the peptide.

[0061] The term "solvate" as used in the present invention refers to a compound of the present invention or a salt thereof comprising a stoichiometric or non-stoichiometric amount of solvent bound by non-covalent intermolecular forces. Preferred solvents include volatile, non-toxic, and / or solvents suitable for administration to humans, and if said solvent is water, it refers to a hydrate.

[0062] As used herein, the term "isomer" refers to a compound of the present invention or a salt thereof that has the same chemical formula or molecular formula but is optically or stereochemically different. For example, a compound of the present invention may have a chiral carbon center and, accordingly, may exist in the form of R or S isomers, racemic compounds, individual enantiomers or mixtures, individual diastereomers or mixtures, and all such stereoisomers and mixtures thereof may fall within the scope of the present invention.

[0063] In the present invention, the active ingredient can activate GPR40 (G-protein coupled receptor 40). Preferably, the active ingredient may be a GPR40 agonist.

[0064] As used herein, the term "GPR40" refers to the rhodopsin-like G-protein coupled receptor, also known as free fatty acid receptor 1 (FFAR1). It is primarily expressed in the pancreas, intestine, and brain and can be activated by endogenous ligands, such as long-chain fatty acids. These long-chain fatty acids are known to be involved in glucose homeostasis and metabolic regulation by binding to and activating GPR40 to regulate the secretion of GLP-1 (glucagon-like peptide-1), GIP (gastric inhibitory polypeptide), and PYY (peptide YY).

[0065] The above "agonist" refers to a substance that binds to a receptor and activates the receptor. In the present invention, the GPR40 agonist may be a substance that binds to GPR40 and activates GPR40.

[0066] In the present invention, the active ingredient may be used for the prevention or treatment of periodontal disease.

[0067] As used herein, the term "periodontal disease" refers to a chronic inflammatory disease of the periodontal tissues, also known as gum disease. In this context, the periodontium is the tissue surrounding the teeth, and the periodontal tissues consist of the alveolar bone (gum bone) that firmly holds the teeth, the periodontal ligament connecting the teeth to the alveolar bone, the cementum covering the tooth roots, and the gingiva, which is the soft tissue covering the alveolar bone.

[0068] The aforementioned periodontal disease may be gingivitis or periodontitis. "Gingivitis" is an inflammation of the gums; it is a relatively mild form of periodontal disease with rapid recovery, confined to the gums, or soft tissues. "Periodontitis" refers to a periodontal disease in which inflammation extends not only to the gums but also to the alveolar bone beneath them, resulting in bone loss.

[0069] In one embodiment, a pharmaceutical composition comprising at least one active ingredient selected from the group consisting of a compound represented by Formula I of the present invention, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof can effectively prevent or treat periodontitis by inhibiting inflammatory responses and differentiation of osteoclasts, thereby inhibiting alveolar bone loss.

[0070] As used herein, the term "treatment" may be used to include both therapeutic and preventive treatments. In this context, prevention may be used to mean alleviating or reducing a pathological condition or disease of an individual. Such treatment includes all applications or any form of medication to treat a disease in mammals, including humans. Furthermore, the term includes inhibiting or slowing the progression of a disease, restoring or repairing damaged or deficient functions, partially or completely alleviating a disease, stimulating inefficient processes, or alleviating a severe disease.

[0071] The above pharmaceutical composition may include one or more active ingredients selected from the group consisting of a compound according to one embodiment, stereoisomers thereof, solvates, and pharmaceutically acceptable salts. "Active ingredient" refers to a physiologically active substance used to achieve pharmacological activity. The active ingredient may exhibit activity alone or in combination with an adjuvant (carrier) that is inactive on its own.

[0072] The above pharmaceutical composition may contain an effective amount of a compound according to one embodiment, a stereoisomer thereof, a solvate, or a pharmaceutically acceptable salt. The term "effective amount" means an amount sufficient to produce an effect of preventing or treating a disease when administered to an individual requiring prevention or treatment. The effective amount may be appropriately selected by a person skilled in the art depending on the selected cell or individual. The preferred dosage of the above pharmaceutical composition may be appropriately selected by a person skilled in the art, although it depends on the individual's condition and body weight, the degree of the disease, the form of the drug, the route of administration, and the duration. The effective amount may contain an active ingredient in an amount of about 0.0001% by weight to about 20% by weight relative to the total weight of the above pharmaceutical composition.

[0073] In addition, the pharmaceutical composition according to the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as topical preparations, suppositories, and sterile injectable solutions, according to conventional methods. Suitable formulations known in the art are preferably those disclosed in the literature (Remington's Pharmaceutical Science, recently Mack Publishing Company, Easton, PA).

[0074] The above pharmaceutical composition may include a pharmaceutically acceptable carrier. The term "carrier" is used to mean including excipients, diluents, or adjuvants. The carrier may be selected from the group consisting of, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, physiological saline, buffer solutions such as PBS, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. The composition may include fillers, anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, or combinations thereof.

[0075] The above pharmaceutical composition may be prepared in any formulation according to conventional methods. The composition may be formulated, for example, into an oral formulation (e.g., powder, tablet, capsule, syrup, pill, or granule) or a parenteral formulation (e.g., injection). Additionally, the composition may be prepared into a systemic formulation or a topical formulation.

[0076] In the above pharmaceutical composition, the solid dosage form for oral administration may be a tablet, pill, powder, granule, or capsule. The solid dosage form may further include an excipient. The excipient may be, for example, starch, calcium carbonate, sucrose, lactose, or gelatin. Additionally, the solid dosage form may further include a lubricant such as magnesium stearate or talc. In the above pharmaceutical composition, the liquid dosage form for oral administration may be a suspension, liquid formulation, emulsion, or syrup. The liquid dosage form may include water or liquid paraffin. The liquid dosage form may include an excipient, for example, a humectant, a sweetener, a flavoring agent, or a preservative. In the above pharmaceutical composition, the dosage form for parenteral administration may be a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, or a lyophilized agent. The non-aqueous solvent or suspension agent may include vegetable oil or ester. Vegetable oil may be, for example, propylene glycol, polyethylene glycol, or olive oil. The ester may be, for example, ethyl oleate.

[0077] The pharmaceutical composition of the present invention may be administered to an individual in a therapeutically effective amount or a pharmaceutically effective amount.

[0078] As used herein, the term "administration" means introducing a specific substance into an individual by an appropriate method, and the route of administration of the composition may be any general route as long as it can reach the target tissue. The pharmaceutical composition may be administered orally or parenterally, and parenteral administration methods may include intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, topical, intranasal, intrapulmonary, and rectal administration. Specifically, it may be administered topically or topically to a lesion site, but is not limited thereto. The composition may be administered alone or together with other pharmaceutically active compounds. In this case, the composition may be administered to the individual simultaneously, individually, or sequentially with other pharmaceutically active compounds.

[0079] The pharmaceutical composition of the present invention may be administered to a patient in a therapeutically effective amount or a pharmaceutically effective amount.

[0080] Here, "therapeutically effective amount" or "pharmaceuticalally effective amount" refers to an amount of a compound or composition effective for preventing or treating a target disease, meaning an amount sufficient to treat the disease at a reasonable benefit / risk ratio applicable to medical treatment and that does not cause side effects. The level of the said effective amount may be determined based on factors including the patient's health status, type and severity of the disease, drug activity, sensitivity to the drug, method of administration, time of administration, route of administration and elimination rate, duration of treatment, drugs used in combination or concurrently, and other factors well known in the medical field.

[0081] The preferred dosage of the above pharmaceutical composition may vary depending on the patient's condition and body weight, the severity of the disease, the form of the drug, the route of administration, and the duration, but can be appropriately selected by a person skilled in the art. The dosage may be, for example, within the range of about 0.001 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 10 mg / kg, or about 0.1 mg / kg to about 1 mg / kg based on an adult. The administration may be once a day, 2 to 24 times a day, 1 to 2 times every 3 days, 1 to 6 times a week, 1 to 10 times every 2 weeks, 1 to 15 times every 3 weeks, 1 to 3 times every 4 weeks, or 1 to 12 times a year.

[0082] The above individual may be a mammal, for example, a human, cow, horse, pig, dog, sheep, goat, or cat, and preferably a human, but is not limited thereto. The above individual may be an individual that suffers from or is likely to suffer from the above periodontal disease.

[0083] Another aspect of the present invention provides a composition for the prevention or treatment of periodontal disease comprising at least one selected from the group consisting of a compound represented by the formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof as an active ingredient.

[0084] Another aspect of the present invention provides a method for preventing or treating periodontal disease comprising the step of administering to an individual a composition comprising, as an active ingredient, at least one selected from the group consisting of a compound represented by the formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof.

[0085] The above compound, periodontal disease, individual, administration, prevention, and treatment are the same as described above.

[0086] Pharmaceutical preparations

[0087] Another aspect of the present invention provides a pharmaceutical formulation comprising at least one selected from the group consisting of a compound represented by the following formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof; and a temperature-sensitive polymer:

[0088] <Chemical Formula I>

[0089] .

[0090] In the above chemical formula I, R 1 Silver halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 It can be selected from the group consisting of hydroxyalkyl groups.

[0091] In the above chemical formula I, R 2 and R 3 Each independently consists of hydrogen, halogen, hydroxy, and C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 It can be selected from the group consisting of hydroxyalkyl groups.

[0092] In the above chemical formula I, R 4 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 It can be selected from the group consisting of hydroxyalkyl groups.

[0093] In the above chemical formula I, R 5 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 Alkylamino and di(C 1-6 It can be selected from the group consisting of alkyl)aminos.

[0094] In the above chemical formula I, n is an integer from 0 to 2.

[0095] The compound represented by the above chemical formula I, its pharmaceutically acceptable salt, its prodrug, its solvate, and its isomer are the same as those described above.

[0096] In one specific example, chemical formula I may have the structure of the following chemical formula I-1:

[0097] <Chemical Formula I-1>

[0098] .

[0099] In the above pharmaceutical formulation, the compound may be included as an active ingredient in a pharmaceutically effective amount. The effective amount is the same as described above. Specifically, the compound may be included in an amount of about 0.0001 weight% to about 20 weight% with respect to the total weight of the pharmaceutical formulation. In one embodiment, the compound may be included in an amount of about 0.5 weight% to about 1.5 weight% with respect to the total weight.

[0100] The term "thermal responsiveness" as used in this specification refers to a characteristic in which a reversible sol-gel phase transition occurs at a specific temperature, characterized by a change in properties depending on the external temperature. The sol-gel phase transition system is characterized by exhibiting a reversible phase transition phenomenon in which a hydrogel is physically formed due to temperature.

[0101] In the present invention, the pharmaceutical formulation may exhibit temperature sensitivity in which a change of state occurs according to a change in temperature by including a temperature-sensitive biopolymer.

[0102] The above temperature-sensitive polymers are gelatin, cellulose, carboxymethyl cellulose (CMC), alginic acid, pectin, carrageenan, chondroitin (sulfate), dextran (sulfate), chitosan, polylysine, collagen, carboxymethyl chitin, fibrin, agarose, pullulan, polylactide, polyglycolide (PGA), polylactide-glycolide copolymer (PLGA), polyanhydride, polyorthoester, polyetherester, polycaprolactone, polyesteramide, poly(butyric acid), poly(valeric acid), polyurethane, polyacrylate, ethylene-vinyl acetate polymer, acrylic-substituted cellulose acetate, and non-degradable It may be one or more selected from the group consisting of polyurethane, polystyrene, polyvinyl chloride, polyvinyl fluoride, poly(vinyl imidazole), chlorosulfonate polyolefins, polyethylene oxide, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), polymethacrylate, hydroxypropylmethylcellulose (HPMC), ethylcellulose (EC), hydroxypropylcellulose (HPC), cyclodextrin, poly(N-isopropylamide) (PNIPAam), poloxamer, polyacrylic acid copolymer, and derivatives thereof, but is not limited thereto.

[0103] Specifically, the temperature-sensitive polymer may be a poloxamer.

[0104] The above-mentioned poloxamer (polyethylene-polypropylene glycol) is a block copolymer polymer having a structure of polyethylene oxide (PEO)-polypropylene oxide (PPO)-polyethylene oxide (PEO). In this case, the polypropylene oxide in the center of the poloxamer is the hydrophobic part, while the polyethylene oxides on both sides are the hydrophilic parts. In an aqueous solution, a micelle structure is formed with an inner hydrophobic part and an outer hydrophilic part due to the affinity of the hydrophilic polyethylene oxide part with water molecules and the repulsion of the hydrophobic polypropylene oxide part with water molecules. A reversible sol-gel phase transition occurs depending on the external temperature; it exists in a sol state at low temperatures but forms a gel at biological temperatures, allowing it to form an in situ gel. Poloxamer can produce polymers with different properties depending on the composition of the ethylene oxide and propylene oxide blocks.

[0105] In one specific example, the above poloxamer may be poloxamer 407.

[0106] The pharmaceutical formulation of the present invention, by including poloxamer, becomes temperature-sensitive and, through the sol-gel phase transition phenomenon, can change from a liquid sol into a solid gel at a temperature similar to body temperature due to the strengthening of attractive forces between nanoparticles, while simultaneously exhibiting enhanced physical properties.

[0107] The temperature-sensitive polymer may be included in an amount of about 10% to about 30% by weight with respect to the total weight of the pharmaceutical formulation. Specifically, the temperature-sensitive polymer may be included in an amount of about 10% to about 30% by weight, about 12% to about 29% by weight, or about 14% to about 28% by weight. In one embodiment, the temperature-sensitive polymer may be included in an amount of about 16.5% to about 25% by weight.

[0108] The above pharmaceutical formulation may further include a stabilizer.

[0109] The above stabilizer can increase adhesiveness and viscosity and enhance emulsion stability, thereby improving the physical properties and tactile sensation of the formulation.

[0110] The above stabilizer may be any one selected from the group consisting of cyclodextrin, carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxyethylmethylcellulose, polyvinyl alcohol, polyacrylic acid, and salts thereof, but is not limited thereto.

[0111] In one specific example, the stabilizer may be cyclodextrin.

[0112] The above "cyclodextrin (CD)" refers to an oligosaccharide obtained by breaking down starch with CTase, and signifies a cyclic structure in which glucose molecules are linked by α-1,4 bonds. Cyclodextrin exhibits hydrophobicity because the inner walls of the cavities within the cyclic molecule are composed of hydrogen and glycosidic oxygen. The above cyclodextrin includes α-CD, β-CD, γ-CD, etc., in which 6, 7, and 8 glucose molecules are linked, respectively.

[0113] In the present invention, the cyclodextrin may be β-cyclodextrin. In one embodiment, the cyclodextrin may be 2-hydroxypropyl-β-cyclodextrin (HP-β-CD).

[0114] The above stabilizer may be included in an amount of about 0.1% to about 20% by weight with respect to the total weight of the pharmaceutical formulation. Specifically, it may be included in an amount of about 0.1% to about 20% by weight, about 0.2% to about 19% by weight, about 0.5% to about 18% by weight, about 1% to about 17% by weight, about 5% to about 16% by weight, or about 10% to about 15% by weight. In one embodiment, the above stabilizer may be included in an amount of about 10% by weight with respect to the total weight of the pharmaceutical formulation, but is not limited thereto.

[0115] If the stabilizer of the present invention is contained in an amount of less than 0.1% by weight relative to the total weight of the pharmaceutical formulation, the viscosity is not sufficiently present, and as a result, a problem may arise in which gelation does not occur sufficiently at the oral temperature due to a decrease in temperature sensitivity. Conversely, if the stabilizer of the present invention is contained in an amount exceeding 20% ​​by weight relative to the total weight of the pharmaceutical formulation, the viscosity is excessive, and gelation occurs in advance before injection into the oral cavity, which may cause a problem in which absorption into the oral cavity is difficult.

[0116] The above pharmaceutical preparation is in a sol state at refrigeration and room temperature, and gelation may proceed in vivo. It is in a sol state at about 0°C to about 25°C, and gelation may proceed at about 26°C to about 40°C. More specifically, it may be in a sol state at about 0°C to about 25°C, about 2°C to about 25°C, about 4°C to about 25°C, about 6°C to about 25°C, about 8°C to about 25°C, about 10°C to about 25°C, about 12°C to about 25°C, about 14°C to about 25°C, about 16°C to about 25°C, about 18°C ​​to about 25°C, about 20°C to about 25°C, or about 22°C to about 25°C. It may be in a gel state at about 26°C to about 40°C, about 28°C to about 40°C, about 30°C to about 40°C, about 32°C to about 40°C, about 34°C to about 40°C, or about 36°C to about 40°C.

[0117] The pharmaceutical formulation of the present invention can have its osmotic pressure and pH adjusted so that it can be injected into the human body or applied orally.

[0118] Specifically, the above pharmaceutical formulation may have a pH of about 6.0 to about 8.0, preferably a pH of about 7.0 to about 8.0, and more preferably a pH of about 7.5.

[0119] The pharmaceutical formulation of the present invention may be administered via a parenteral route. Specifically, the formulation may be administered via a local route, but is not limited thereto. Preferably, the formulation may be used by direct injection into the lesion site or by local injection or local application using a catheter. Here, parenteral, administration, and local administration are the same as those described above. Preferably, the pharmaceutical formulation may be used as an injectable formulation, but is not limited thereto.

[0120] Since the above pharmaceutical formulation includes a temperature-sensitive polymer, it is easy to inject into periodontal pockets due to its high flowability at room temperature, and as it gels at oral temperature to release active ingredients for a certain period, it can not only prevent or improve periodontal diseases such as periodontitis and gingivitis but also inhibit the loss of alveolar bone. Therefore, the above pharmaceutical formulation can be used for the prevention or treatment of periodontal disease. The prevention and treatment of the above periodontal disease are the same as those described above.

[0121] Another aspect of the present invention provides a use for the pharmaceutical formulation to manufacture a drug for the prevention or treatment of periodontal disease. The pharmaceutical formulation and the periodontal disease are the same as those described above.

[0122] The present invention will be explained in detail below through the following examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited by the following examples.

[0123] I. In vitro Mechanism of Action and Effects

[0124] Preparation Example 1. Preparation of EFL-601 represented by Chemical Formula I-1

[0125] The above compound has the structure of the following chemical formula I-1. The above compound was named EFL-601, obtained, and used in experiments (free form, 2995298-57-0, used in cell experiments; Na salt, 2869209-80-1, used in animal and formulation experiments).

[0126] [Chemical Formula I-1]

[0127]

[0128] Example 1. Evaluation of GPR40 agonism of EFL-601

[0129] An Aequorin assay was performed to evaluate the agonism of EFL-601 against GPR40.

[0130] Recombinant CHO-K1 cells stably expressing human GPR40 were cultured in antibiotic-free medium and then isolated by gentle flushing with PBS-EDTA (5 mM EDTA). The cells were recovered by centrifugation and resuspended in assay buffer (HEPES + 0.1% BSA protease-free DMEM / HAM's F12). The cells prepared as described above were incubated with Coelenterazine h (Molecular Probes) at room temperature for at least 4 hours. 50 µL of the cell suspension was treated with 50 µL of EFL-601 or the control substance DHA plated in a 96-well plate and reacted. The resulting emitted light was recorded using a Hamamatsu Functional Drug Screening System 7000 (FDSS 7000).

[0131] As a result, as shown in Fig. 1, based on the Aequorin assay results, EFL-601 is an agonist for GPR40, and EC 50 The value was confirmed to be 92.1 nM.

[0132] Example 2. Confirmation of the anti-inflammatory effect of EFL-601

[0133] The anti-inflammatory effects of the GPR40 agonist EFL-601 were evaluated on inflammatory responses induced by pathogenic stimulation from Porphyromonas gingivalis-derived lipopolysaccharide (PgLPS), a key regulator of inflammatory diseases.

[0134] Example 2.1. Inhibitory effect on the phosphorylation of the inflammatory regulatory factor p-NF-κB

[0135] HUVEC cells (human umbilical vein endothelial cells, ATCC) were cultured in endothelial growth medium-2 (Lonza), and HGF-1 cells (human gingival fibroblast, ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM, Hyclone) mixed with 10% fetal bovine serum (FBS, Gibco), 100 U / mL penicillin, and 100 μg / mL streptomycin (Thermo Fisher Scientific).

[0136] HUVEC or HGF-1 cells were treated with PgLPS (SMB00610, Sigma) alone, or with PgLPS and EFL-601 (test substance, concentration 50 μM), and incubated for 0.5 hours. Proteins were extracted from the reacted cells by treating them with RIPA buffer containing protease inhibitor and phosphatase inhibitor cocktails, respectively. Each extracted protein was quantified using a BCA protein assay kit, mixed with sample loading buffer, and incubated at 95°C for 5 minutes.

[0137] Western blot was performed on the protein samples prepared as described above. Specifically, each protein was separated by size after performing SDS-PAGE on a 10% acrylamide gel. After SDS-PAGE, the proteins were transferred to a PVDF membrane, and the membrane was treated with 5% BSA (bovine serum albumin) and incubated at room temperature for 1 hour. Subsequently, the membrane was washed with TBS-T buffer, and the primary antibody was applied and incubated at 4°C for 16 hours.

[0138] Subsequently, the membrane was washed three times with TBS-T buffer solution, and then treated with secondary antibodies. The secondary antibodies were reacted at room temperature for one hour. At this time, the primary antibodies used were the anti-phospho-NF-κB antibody (3033S, Cell Signaling), the anti-NF-κB antibody (8242S, Cell Signaling), and the anti-β-actin antibody (sc-47778, Santa Cruz), respectively. The secondary antibodies used were the anti-mouse IgG, HRP-conjugated antibody (7076, Cell Signaling) and the anti-rabbit IgG, HRP-conjugated antibody (7074, Cell Signaling), respectively. After the secondary antibody reaction, the membrane was washed three times with TBS-T buffer solution, treated with ECL solution, and the protein expression level was analyzed using Chemidoc.

[0139] As a result, as shown in Fig. 2, when HUVEC cells (Fig. 1 A) and HGF-1 cells (Fig. 1 B) were treated with PgLPS (200 ng / mL) alone, an increase in phospho-NF-κB / Total NF-κB (p-NF-κB / T-NF-κB ratio) was observed. On the other hand, when PgLPS and EFL-601 (50 uM) were treated simultaneously, a decrease in the p-NF-κB / T-NF-κB ratio was observed (*p<0.05 vsPgLPS).

[0140] Through the above results, it was confirmed that EFL-601 inhibits NF-κB phosphorylation increased by PgLPS.

[0141] Example 2.2. Protein expression inhibitory effect of ICAM-1 and VCAM-1

[0142] HUVEC cells were treated with PgLPS (200 ng / mL) alone or with PgLPS and EFL-601 (test substance, concentration 50 uM) simultaneously, and reacted for 6 hours. After the reacted cells were treated simultaneously for 6 hours, a Western blot was performed in the same manner as in Example 2.1. At this time, the primary antibodies used were anti-ICAM-1 antibody (4915S, Cell signaling), anti-VACM-1 antibody (13662S, Cell signaling), and anti-β-actin antibody (sc-47778, Santa Cruz), respectively. The secondary antibodies used were anti-mouse IgG, HRP-conjugated antibody (7076, Cell Signaling) and anti-rabbit IgG, HRP-conjugated antibody (7074, Cell Signaling), respectively.

[0143] As a result, as shown in Figure 3, it was confirmed that the expression of ICAM-1 (intercellular adhesion molecule 1) and VCAM-1 (vascular cell adhesion molecule 1), important adhesion molecules involved in inflammation, was increased in the group treated with PgLPS (200 ng / mL) alone. On the other hand, the expression of ICAM-1 and VCAM-1 was suppressed in the group treated with PgLPS and EFL-601 (50 uM) (*p <0.05 vs PgLPS).

[0144] Example 2.3. Inhibitory effect of MMP-2 and MMP-9 on mRNA expression

[0145] HUVEC cells were treated with PgLPS (200 ng / mL) alone or with PgLPS and EFL-601 (test substance, concentration 50 uM) simultaneously and incubated for 2 hours, after which RNA was extracted from each cell using a Total RNA prep kit. The extracted RNA was mixed with a reverse transcription premix, and cDNA was synthesized by incubating at 45°C for 60 minutes and 95°C for 5 minutes using a PCR cycler. Quantitative real-time PCR (RT-qPCR) was performed to amplify and verify specific genes from the synthesized cDNA. Specifically, the cDNA, primers matching the specific gene, and SYBR green premix were mixed and incubated at 95°C for 2 minutes, followed by a total of 40 amplification cycles consisting of 5 seconds at 95°C and 30 seconds at 62°C. The respective primers used are listed in Table 1 below. In this case, β-actin was used as the housekeeping gene. In addition, gene expression levels were relatively quantified based on the gene expression levels of the control group.

[0146] Primer Name Forward(5'-3')Reverse(5'-3')hMMP-2ATAACCTGGATGCCGTCGT(Sequence No. 1)AGGCACCCTTGAAGAAGTAGC(Sequence No. 2)hMMP-9GAACCAATCTCACCGACAGG(Sequence No. 3)GCCACCCGAGTGTAACCATA(Sequence No. 4)hIL-6AGACAGCCACTCACCTCTTCAG(Sequence No. 5)TTCTGCCAGTGCCTCTTTGCTG(Sequence No. 6)hTNF-αATGGGCTACAGGCTTGTCACTC(Sequence No. 7)CTCTTCTGCCTGCTGCACTTTG(Sequence No. 8)hβ-actinACAGGAAGTCCCTTGCCATC(Sequence No. 9)ACTGGTCTCAAGTCAGTGTACAGG(Sequence No. 10)mCtskGAAGAAGACTCACCAGAAGCAG(Sequence No. 11)TCCAGGTTATGGGCAGAGATT(Sequence No. 12)mAcp5GCGACCATTGTTAGCCACATACG(Sequence No. 13)CGTTGATGTCGCACAGAGGGAT(Sequence No. 14)mMMP-9CTGGACAGCCAGACACTAAAG(Sequence No. 15)CTCGCGGCAAGTCTTCAGAG(Sequence No. 16)mGAPDHGTTGTCTCCTGCGACTTCA(Sequence No. 17)GGTGGTCCAGGGTTTCTTA(Sequence No. 18)rIL-1βCACCTCTCAAGCAGAGCACAG(Sequence No. 19)GGGTTCCATGGTGAAGTCAAC(Sequence No. 20)rIL-6TCCTACCCCAACTTCCAATGCTC(Sequence No. 21)TTGGATGGTCTTGGTCCTTAGCC(Sequence No. 22)rGAPDHTGGCCTCCAAGGAGTAAGAAA(Sequence No. 23)CAGCAACTGAGGGCCTCTCT(Sequence No. 24)

[0147] As a result, as shown in Figure 4, it was confirmed that the mRNA expression of MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9), which play important roles in inflammatory cell infiltration and metastasis, was increased in the group treated with PgLPS (200 ng / mL) alone. On the other hand, it was confirmed that the mRNA expression of MMP-2 and MMP-9 was suppressed in the group treated with PgLPS and EFL-601 (50 uM) (*p<0.05 vs PgLPS).

[0148] Example 2.4. Inhibitory effect of mRNA expression of IL-6 and TNF-α

[0149] HUVEC cells were treated with PgLPS (200 ng / mL) alone or with PgLPS and EFL-601 (test substance, concentration 50 uM) simultaneously, and incubated for 2 hours. Subsequently, total RNA was extracted from each cell in the same manner as in Example 2.3, and the mRNA expression of the cytokines IL-6 (interleukin 6) and TNF-α (tumor necrosis factor α) was confirmed by RT-qPCR. The primers used for each cell are shown in Table 1 above.

[0150] As a result, as shown in Figure 5, it was confirmed that the mRNA expression of IL-6 and TNF-α, which play an important role in mediating and regulating inflammatory responses, was increased in the group treated with PgLPS (200 ng / mL) alone. On the other hand, it was confirmed that the mRNA expression of IL-6 and TNF-α was decreased in the group treated with PgLPS and EFL-601 (50 uM) (*p<0.05 vsPgLPS).

[0151] Example 2.5. Inhibitory effect on the secretion of IL-6 and TNF-α

[0152] HUVEC cells were treated with PgLPS (200 ng / mL) alone or with PgLPS and EFL-601 (test substance, concentration 50 μM) simultaneously and incubated for 6 hours. Cell culture medium was then collected, and the protein amounts of IL-6 and TNF-α secreted into the culture medium were measured. The obtained culture medium was stored at -80°C until use, and IL-6 and TNF-α in the medium were measured using commercial ELISA kits (human IL-6; QK206, R&D system) and (TNF-α; DTA00D, R&D systems), respectively. The content of each cytokine was calculated using a standard curve obtained from the reaction of the standard substance.

[0153] As a result, as shown in Figure 6, the amounts of IL-6 and TNF-α proteins in the cell culture medium of the group treated with PgLPS (200 ng / mL) alone increased. On the other hand, it was confirmed that IL-6 and TNF-α proteins decreased in the cell culture medium of the group treated with PgLPS and EFL-601 (50 uM).

[0154] From the above results, it was confirmed that EFL-601, a GPR40 agonist, has the effect of suppressing the inflammatory response increased by PgLPS treatment.

[0155] Example 3. Confirmation of the inhibitory effect of EFL-601 on osteoclast differentiation

[0156] The effect of the GPR40 agonist EFL-601 on the inhibition of osteoclast differentiation, which causes bone damage in inflammatory diseases such as periodontitis, was evaluated.

[0157] Example 3.1. Evaluation of the inhibitory effect of EFL-601 on osteoclast differentiation

[0158] The inhibitory effect of EFL-601 on osteoclast differentiation was confirmed using TRAP (tartrate-resistant acid phosphatase) staining with RAW 264.7 cells.

[0159] Specifically, 6×10⁶ RAW 264.7 cells in a 96-well plate 3 Cells were prepared by inoculating at the cell / well concentration and incubating for 16 hours. Differentiation was induced in the cells by treating them with RANKL (35 ng / mL) alone, or with the test drug (EFL-601, Fasiglifam) and RANKL under specific conditions. The cell medium used was αMEM containing 10% FBS and 1% penicillin-streptomycin. Forty-eight hours after treatment with the test drug and RANKL, the medium was replaced with one under identical conditions and incubated for an additional 48 hours. Subsequently, TRAP staining was performed using the TaKaRa TRACP & ALP double-stain kit (MK300) according to the manufacturer's protocol. The experimental results were confirmed by obtaining microscopic images of the staining results from three individual wells under identical conditions.

[0160] As a result, as shown in Figure 7, in the group treated with RANKL alone, it was confirmed that the cells became multinucleated and differentiated into osteoclasts, staining purple. In the group treated with RANKL and EFL-601 (10 uM), it was confirmed that the size of the multinucleated cells decreased and differentiation decreased. On the other hand, in the group treated with Fasiglifam (TAK-875, 10 uM), known as a GPR40 agonist, and RANKL, no significant difference was observed compared to the group treated with RANKL alone.

[0161] Example 3.2. Evaluation of osteoclast-specific gene expression

[0162] 1×10⁶ RAW 264.7 cells in a 12-well plate 5Cells were inoculated at a concentration of cells / well and cultured for 16 hours. On the day of drug treatment, differentiation was induced by treating the cell culture medium (αMEM, 10% FBS, 1% penicillin streptomycin) with RANKL (35 ng / mL) alone or with drugs (EFL-601, Fasiglifam) and RANKL (35 ng / mL) under specific conditions. 72 hours after treatment, RNA was extracted from the cells, and the mRNA expression of osteoclast-specific genes Acp5 (acid phosphatase 5, TRAP), Ctsk (cathepsin K), and MMP-9 was confirmed via RT-qPCR. At this time, RNA extraction and RT-qPCR were performed in the same manner as in Example 2.3 above, and the primers used are shown in Table 1 above.

[0163] As a result, as shown in Figure 8, compared to the RANKL-alone treatment group, the mRNA expression levels of the Ctsk, Acp5 (TRAP), and MMP-9 genes were all significantly reduced in the RANKL and EFL-601 (10 uM) treatment group.

[0164] Through the TRAP staining and gene expression results above, it was confirmed that EFL-601 can inhibit osteoclast differentiation more effectively compared to Fasiglifam (TAK-875), a GPR40 agonist used as a positive control.

[0165] II. Evaluation of Periodontitis Inhibitory Activity in an Invivo-Periodontitis Model

[0166] Example 4. Evaluation of periodontitis inhibitory activity in a periodontitis model

[0167] Example 4.1. Preparation of periodontitis model and drug administration

[0168] A total of 32 female Sprague-Dawley rats were divided into four groups of eight rats each. In three groups, excluding the normal control group, the cervical region of the right maxillary second molar was ligated with 4-0 silk sutures. Subsequently, periodontitis was induced by injecting 5 µL of PgLPS (Invivogen), diluted to a concentration of 1 mg / mL, into the lingual gingiva of the ligation site once a week. Simultaneously with the induction of periodontitis, the test drug EFL-601 was prepared at a concentration of 5 mg / mL or 15 mg / mL and administered to the lateral gingiva of the periodontitis-induced site at a dose of 5 µL (per rat) three times a week for four weeks (Table 2).

[0169] The rat periodontitis model induced by the above PgLPS is widely used as a periodontitis model because it is known that the CEJ-ABC distance increases due to alveolar bone loss, bone volume and BMD (bone mineral density) decrease when evaluating bone parameters via Micro-CT, and inflammatory cytokines (IL-6, TNF-α) increase (Kuo et al., Front. Pharmacol. 2022; Nessa et al., Pharmacol. 2021; Nakajima et al., Biomaterials 2021; Mustafa et al., Pol. J. Vet. Sci. 2021). In particular, the above PgLPS (lipopolysaccharide derived from Porphyromonas gingivalis) is known to play an essential role in the development of periodontitis by inducing gingival inflammation that increases osteoclast differentiation and subsequent alveolar bone resorption.

[0170] Test Group Administered Concentration (mg / mL) Administered Volume (uL / head) Ligation +PgLPS Normal Group (vehicle) 05 - Induced Group (vehicle) 05 +EFL-60155 +EFL-601155 +

[0171] This study aimed to confirm the inhibitory effect of the GPR40 agonist EFL-601 on alveolar bone loss and increased inflammatory cytokines induced by ligation and PgLPS administration.

[0172] Example 4.2. Confirmation of changes in mRNA expression of inflammatory cytokines in gingival tissue

[0173] Total RNA was extracted using the AcuuPrep Universal RNA Extraction Kit (Bionner). Total RNA (1 µg) was synthesized using the Laborpass cDNA SynTHESIS Kit (Cosmogenetech). Gene expression analysis for the inflammatory cytokines IL-1β and IL-6 was performed via qPCR using QuantStudio 1 (ThermoFisher). 100 ng of each cDNA was reacted against the template using TB green premix EX Taq II (Syber Green) in a total reaction volume of 20 µL. qPCR was performed 40 times under conditions of denaturation at 94°C for 30 seconds, annealing at 62°C for 15 seconds, and extension at 72°C for 15 seconds. The primers used are listed in Table 1 above. Results were analyzed using the ddCT method based on CT values, and fold change was finally calculated.

[0174] As a result, as shown in Figure 9, the mRNA expression of IL-1β and IL-6 increased by more than 3-fold and 2-fold, respectively, due to the induction of periodontitis (P<0.05). On the other hand, in the experimental group administered EFL-601 (25 µg, 75 µg) simultaneously with the induction of periodontitis, it was confirmed that the mRNA expression of IL-1β and IL-6 was significantly reduced to a level similar to that of the normal control group (p<0.05 vs vehicle control).

[0175] Example 4.3. Confirmation of changes in bone parameters using Micro-CT

[0176] Changes in bone parameters of the experimental animals in Example 4.1 were analyzed using a micro-computed tomography (CT) scan device, Skyscan1276 (Bruker). Scan conditions applied included a 1x1 binning setting, a source voltage of 50 kV, a source current of 200 uA, and a 0.25 mm aluminum filter. Data analysis was performed using the CTAnalyser (Ver 1.20.80) program. During the analysis process, the trabecular bone region was segmented based on the multilevel (Otsu) 3-level algorithm, thereby setting the threshold value to a range of 75 to 255. The analysis subjects were limited to the cortical bone and the trabecular bone surrounded by teeth. In particular, the trabecular bone located beneath the roots of the first and second molars was set as the region of interest (ROI). During the analysis process, the structural characteristics of the alveolar bone were quantified based on data acquired via Micro-CT, and parameters such as 3D structure, bone mineral density (BMD), and bone volume were evaluated in the set ROI.

[0177] As a result, as shown in Fig. 10, micro-CT images confirmed alveolar bone loss below the second molar in the ligation and PgLPS administration group (periodontitis induction group) compared to the normal control group. On the other hand, in the experimental group administered EFL-601 simultaneously with periodontitis induction, bone parameter results showed bone volume fraction [BV / TV (%)] and bone mineral density [BMD (mg / cm²)]. 3It was confirmed that the decrease in )] was inhibited and the increase in trabecular separation [Tb.Sp(mm)] was inhibited (*p<0.05). In addition, a tendency to inhibit the decrease in trabecular thickness [Tb.Th(mm)] was also confirmed.

[0178] Example 4.4. CEJ-ABC distance analysis

[0179] After Micro-CT imaging, maxillary bone tissue was treated with a 30% H2O2 solution for 16 hours and then dried at room temperature. The dried bone tissue was stained with 3% methylene blue for 30 minutes. After removing excess methylene blue with gauze and distilled water and drying, the CEJ (cementum-enamel junction to alveolar bone crest)-ABC distance of each individual was measured using a vernier caliper to determine the degree of alveolar bone loss.

[0180] As a result, as shown in Figure 11, it was confirmed that the CEJ-ABC distance was significantly increased in the periodontitis-induced group induced by ligation and PgLPS administration (p<0.05 vs normal). On the other hand, in the experimental group administered EFL-601 simultaneously with the induction of periodontitis, it was confirmed that the CEJ-ABC distance was decreased compared to the periodontitis-induced group. Based on the above results, it was determined that EFL-601 can effectively inhibit alveolar bone loss caused by periodontitis.

[0181] III. Pharmaceutical Preparations

[0182] Example 5. Preparation of a temperature-sensitive gel-type injectable

[0183] Example 5.1. Excipient composition

[0184] A temperature-sensitive gel-type injectable formulation as a treatment for periodontitis was established through screening various excipients. The composition of the formulation is shown in Table 3 below.

[0185] Purpose of Formulation Ingredient Name Quantity Active Ingredient: EFL-601 (mg) 5 ~ 15°C Temperature-sensitive polymer: Poloxamer 407 (mg) 165 ~ 250°C Stabilizer: HP-β-CD (mg) 100 mg Acidifying agent: HCl (mg) Titrated amount Alkaline agent: NaOH (mg) Titrated amount Solution: Sterile water (mL) 1 mL pH - 7.5

[0186] Example 5.2. Test for suitability of administration according to poloxamer 407 content

[0187] In addition to the formulation composition of Example 5.1 above, the content of poloxamer 407 was adjusted to evaluate the changes in appearance and viscosity according to temperature, and the administration temperature and gel formation were confirmed.

[0188] As a result, as shown in Table 4, it was confirmed that the content of poloxamer 407 capable of gel formation at the final injectable temperature and 37°C was about 21.5% to 23%.

[0189] Poloxamer 407 Content 16.5% 19% 21% 21.5% 23% 25% Refrigerated injection possible Room temperature injection possible 15 minutes possible Not possible Not possible 30 minutes possible -- 60 minutes possible -- 37℃ Gel formation 30 seconds no gel formation no gel formation no gel formation no gel formation 60 seconds no gel formation no gel formation moldability 120 seconds no gel formation no gel formation 180 seconds no gel formation no gel formation

[0190] Example 5.3. Evaluation of the degree of drug release delay

[0191] The degree of drug release delay in temperature-sensitive formulations was evaluated using the following method.

[0192] The temperature-sensitive formulation was used with the drug at a final concentration of 0.5% (5 mg / mL) or 1.5% (15 mg / mL) under the formulation composition conditions of Table 3 above, and the poloxamer 407 content was used at a concentration of 21.5%.

[0193] Specifically, the formulation stored under refrigerated conditions was left at room temperature for 15 minutes to achieve temperature equilibrium, and then 14.5 mL of 10 mM PBS stored at 37°C was added to a 50 mL conical tube. Subsequently, the formulation (500 μL) was added dropwise, and the reaction was carried out at 37°C and 50 rpm to obtain elution solvent (500 μL) at time intervals. After adding the elution solvent (10 mM PBS, 500 μL) stored at 37°C to the elution solvent obtained as described above, the content of the eluted drug was analyzed by HPLC. The HPLC analysis conditions are shown in Table 5 below.

[0194] ColumnC18 UG120 (4.6*250 mm, 5 um) or similar columnColumn temperature30℃Mobile phaseA. Distilled water (0.1% TFA)B. Acetonitrile (0.1% TFA)UV230 nmDiluent90% AcetonitrileFlow rate1.0 mL / minInjection volume5 uLGradient elution (%)Time (min)Mobile phase A : Mobile phase B0 ~ 470 : 304 ~ 2060 : 4020 ~ 3350 : 5033 ~ 4540 : 6045 ~ 6570:30

[0195] As a result, as shown in Figure 12, initial release was confirmed during the time required for initial gel formation in the 0.5% drug concentration formulation (drug concentration: 5 mg / mL) and the 1.5% drug concentration formulation (drug concentration: 15 mg / mL), and gel form maintenance and drug persistence were secured for 24 hours.

Claims

1. A pharmaceutical composition for the prevention or treatment of periodontal disease comprising, as an active ingredient, at least one selected from the group consisting of a compound represented by the following chemical formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof: <Chemical Formula I> In the above chemical formula I, R 1 Silver halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 2 and R 3 Each independently consists of hydrogen, halogen, hydroxy, and C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 4 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 5 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 Alkylamino and di(C 1-6 Selected from the group consisting of alkyl)aminos; n is an integer from 0 to 2.

2. In Paragraph 1, A pharmaceutical composition for the prevention or treatment of periodontitis, wherein the above chemical formula I has the structure of the following chemical formula I-1: <Chemical Formula I-1> .

3. In Paragraph 1 or 2, A pharmaceutical composition for the prevention or treatment of periodontal disease, wherein the above compound activates GPR40 (G-protein coupled receptor 40).

4. In Paragraph 1, A pharmaceutical composition for the prevention or treatment of periodontal disease, wherein the periodontal disease is gingivitis or periodontitis. 5.i) At least one selected from the group consisting of a compound represented by the following chemical formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and isomers thereof; and ii) Pharmaceutical formulations containing temperature-sensitive polymers: <Chemical Formula I> In the above chemical formula I, R 1 to R 4 Each independently hydrogen, Halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 5 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 Alkylamino and di(C 1-6 Selected from the group consisting of alkyl)aminos; The above n is an integer from 0 to 2.

6. In Paragraph 5, A pharmaceutical preparation in which the above compound, its pharmaceutically acceptable salt, its prodrug, its solvate, or its isomer is a GPR40 agonist.

7. In Paragraph 5, A pharmaceutical formulation comprising the above temperature-sensitive polymer in an amount of 10% to 30% by weight based on the total weight.

8. In Paragraph 7, The above temperature-sensitive polymers are gelatin, cellulose, carboxymethyl cellulose (CMC), alginic acid, pectin, carrageenan, chondroitin (sulfate), dextran (sulfate), chitosan, polylysine, collagen, carboxymethyl chitin, fibrin, agarose, pullulan, polylactide, polyglycolide (PGA), polylactide-glycolide copolymer (PLGA), polyanhydride, polyorthoester, polyetherester, polycaprolactone, polyesteramide, poly(butyric acid), poly(valeric acid), polyurethane, polyacrylate, ethylene-vinyl acetate polymer, acrylic-substituted cellulose acetate, and non-degradable A pharmaceutical preparation comprising one or more selected from the group consisting of polyurethane, polystyrene, polyvinyl chloride, polyvinyl fluoride, poly(vinyl imidazole), chlorosulfonate polyolefins, polyethylene oxide (PEO), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), polymethacrylate, hydroxypropylmethylcellulose (HPMC), ethylcellulose (EC), hydroxypropylcellulose (HPC), cyclodextrin, poly(N-isopropylamide) (PNIPAam), poloxamer, polyacrylic acid copolymer, and derivatives thereof.

9. In Paragraph 5, The above-mentioned preparation is a pharmaceutical preparation that further comprises a stabilizer.

10. In Paragraph 9, A pharmaceutical preparation in which the above stabilizer is any one selected from the group consisting of cyclodextrin, carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxyethylmethylcellulose, polyvinyl alcohol, polyacrylic acid, and salts thereof.

11. In Paragraph 5, A pharmaceutical preparation that is in a sol state at 0°C to 25°C and in a gel state at 26°C to 40°C.

12. In Paragraph 5, The above-mentioned preparation is a pharmaceutical preparation having a pH of 6.0 to 8.

0.

13. In Paragraph 5, The above preparation is a pharmaceutical preparation intended for parenteral administration.

14. In Paragraph 13, The above preparation is a pharmaceutical preparation that is an injectable preparation.

15. A method for preventing or treating periodontal disease comprising the step of administering to an individual at least one selected from the group consisting of a compound represented by the following chemical formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and an isomer thereof: <Chemical Formula I> In the above chemical formula I, R 1 Silver halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 2 and R 3 Each independently consists of hydrogen, halogen, hydroxy, and C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 4 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 5 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 Alkylamino and di(C 1-6 Selected from the group consisting of alkyl)aminos; n is an integer from 0 to 2.

16. At least one use for the prevention or treatment of periodontal disease selected from the group consisting of a compound represented by the following chemical formula I, a pharmaceutically acceptable salt thereof, a prodrug thereof, a solvate thereof, and isomers thereof: <Chemical Formula I> In the above chemical formula I, R 1 Silver halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 2 and R 3 Each independently consists of hydrogen, halogen, hydroxy, and C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 4 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 alkylamino, di(C 1-6 Alkyl)amino, nitro, cyano, carboxy, C 1-6 Alkyl carbonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 Alkyl)carbamoyl, C 1-6 Alkyl, C 1-6 Haloalkyl and C 1-6 Selected from the group consisting of hydroxyalkyls; R 5 is hydrogen, halogen, hydroxy, C 1-6 Alkoxy, amino, C 1-6 Alkylamino and di(C 1-6 Selected from the group consisting of alkyl)aminos; n is an integer from 0 to 2.

Images