Composition for preventing or treating nosema disease

Abstract

The present application relates to a composition for preventing or treating Nosema disease. Specifically, the present application relates to a composition for preventing or treating Nosema disease, comprising an inhibitor against the swp25, metap2, or spp gene of Vairimorpha sp.

Description

Composition for the prevention or treatment of Nosema disease

[0001] This application relates to a composition for the prevention or treatment of Nosema disease. The present result was researched with funding from the Ministry of Agriculture, Food and Rural Affairs and supported by the Korea Institute of Planning and Evaluation for Agricultural and Food Technology (Technology Commercialization Support Project) (No. RS-2024-00400501).

[0002] In 2008, Colony Collapse Disorder (CCD) occurred in the United States, resulting in the death of over 50% of all bee colonies, and CCD continues to occur globally. Recently in Korea, the total number of beekeeping colonies plummeted from 2.69 million in 2021 to 2.47 million in 2022 due to the disappearance of honeybees of unknown cause, emerging as a nationwide issue. Nosema Type C, caused by *Vairimorpha ceranae*, is one of the major causes of these incidents; the Ministry of Agriculture, Food and Rural Affairs has annually invested funds for Nosema control through livestock disease control programs (2.2 billion won in 2025), and the only targets for honeybee control under these programs are honeybee mites, sacbrood, and Nosema. However, for over 50 years, the world has relied on the antibiotic fumagilin derived from Aspergillus fumigatus for the treatment of Nosema disease. But since 2010, its use has been banned in accordance with the EU Veterinary Medicines Directive (2001 / 82 / EC) (Commission RegμLation No. 37 / 2010). Currently, Fumidilbi (or Fumagilin-B), which is fumagilin with added dicyclohexylamine salt (DCH), is the only drug being used. However, as problems regarding the formation of resistance to antibiotics in Nosema and the in vivo toxicity of not only fumagilin but also DCH are emerging, there is a need for the introduction of an eco-friendly drug to overcome these issues.

[0003] Research is underway to develop eco-friendly drugs for the treatment of Nosema disease using plant extracts or probiotics, but they have not been commercialized due to their minimal efficacy and the unclear impact on non-target organisms.

[0004] RNA interference (RNAi) technology is a biological process that enables the silencing of specific genes by suppressing the expression of target genes using double-stranded RNA (dsRNA), opening new avenues for new drug development, functional genomics, and personalized medicine. As RNAi technology is a process that does not involve genome modification and is free from the controversy surrounding GMOs, research in the agricultural sector is currently being conducted primarily in developed countries, including the United States, Canada, and Europe. In April 2019, approximately 60 experts and stakeholders discussed the current status of development and regulation regarding agricultural products utilizing RNAi at an OECD meeting, and the U.S. Environmental Protection Agency (EPA) is currently establishing regulations for RNAi-based agricultural products.

[0005] [Prior Art Literature]

[0006] (Patent Document 1) Published Patent Application No. 10-2019-0027991

[0007] One example of the present application is to provide a composition having a preventive or therapeutic effect for Nosema disease that can replace conventional Nosema disease drugs, comprising an inhibitor of the swp25, metap2, or spp gene as an active ingredient.

[0008] Another example of the present application is to provide a feed having a preventive or therapeutic effect against Nosema disease, comprising an inhibitor of the swp25, metap2, or spp gene as an active ingredient.

[0009] Another example of the present application is to provide a method for preventing or treating Nosema disease by inhibiting the swp25, metap2, or spp gene as an active ingredient, thereby providing a preventive or therapeutic effect for Nosema disease.

[0010] One example of the present application relates to a composition for the prevention or treatment of Nosema disease comprising an inhibitor of the swp25, metap2, or spp genes of the genus Vairimorphasp.

[0011] Another example of the present application relates to a feed comprising an inhibitor for the swp25, metap2, or spp genes of the genus Vairimorphasp.

[0012] Another example of the present application relates to a method for preventing or treating Nosema disease, comprising the step of inhibiting the swp25, metap2, or spp genes of the genus Vairimorphasp.

[0013] The present application will be described in more detail below.

[0014] Nosemosis is an infectious disease that occurs in various insects, including honeybees, and is caused by microcytomorpha of the genus Vairimorpha. The genus Vairimorpha causes symptoms such as decreased immunity, weight loss, and reduced activity, which have a serious impact on various insects, including honeybees. In the past, Nosema apis and Nosema ceranae were known as the causative agents of Nosemosis, but several pathogens that belonged to the genus Nosema have recently been reclassified into the genus Vairimorpha.

[0015] A composition for the prevention or treatment of Nosema disease according to one example of the present application comprises, as an active ingredient, an inhibitor of the swp25, metap2, or spp genes of the genus *Virimorpha*. The inhibitor may be administered to an individual at risk of infection with Nosema disease or to an individual suffering from Nosema disease to inhibit the swp25, metap2, or spp genes of the genus *Virimorpha*, thereby providing a preventive or therapeutic effect against Nosema disease.

[0016] The above genus Vairimorpha may be one or more selected from the group consisting of Vairimorpha ceranae, Vairimorpha apis, Vairimorpha bombi, Vairimorpha carpocapsae, and Vairimorpha chrysorrhoeae.

[0017] The inhibitor may be one or more selected from the group consisting of dsRNA, siRNA, smRNA, shRNA, miRNA, ribozyme, DNAzyme, antisense oligonucleotide, morpholino, peptide nucleosans (PNAs), and LNA (Locked nucleic acid). For example, the inhibitor may be dsRNA.

[0018] In the embodiments of the present invention, inhibitors were produced for various genes of the genus *Vairimorpha*, the pathogen of Nosema disease, and the inhibitory effect on the pathogen was verified by administering said inhibitors to subjects infected with Nosema disease. As a result, significant inhibitory effects on the Nosema disease pathogen were observed in the groups treated with inhibitors for the swp25, metap2, or spp genes. In particular, when treated with an inhibitor for the swp25 gene, a significantly superior inhibitory effect on the Nosema disease pathogen was observed. At this time, although the swp30 and swp-precursor (swp-pre.) genes are predicted to perform functions similar to the swp25 gene, no significant inhibitory effect on the Nosema disease pathogen was observed even when dsRNA targeting the swp30 or swp-precursor genes was treated. This suggests that, given the current state where the genetic functions of the Nosema disease pathogen have not been verified, it is difficult to derive effective control targets based solely on gene annotations. Therefore, this means that it is difficult to predict the effectiveness of controlling the Nosema disease pathogen until dsRNA targeting the gene is directly manufactured and its effects verified.

[0019] In addition, in the embodiments of the present invention, inhibitors were produced for various genes of the genus *Vairimorpha*, the pathogen of Nosema disease, and the level of post-transcriptional gene silencing (PTGS) was verified by administering said inhibitors to subjects infected with Nosema disease. As a result, the PTGS induction efficiency of each gene was found to be different, and in the case of some genes, although PTGS was strongly induced, the inhibitory effect on the proliferation of the Nosema disease pathogen was not significant. This suggests that even if PTGS is induced for a specific gene, it does not guarantee that the gene is essential for the survival or proliferation of the pathogen, and that in order to obtain an actual control effect, it is essential to directly produce inhibitors for each gene and experimentally verify their efficacy.

[0020] The above swp25 gene may include the nucleotide sequence of Sequence No. 1.

[0021] The above metap2 gene may include the nucleotide sequence of SEQ ID NO. 6.

[0022] The above spp gene may include the nucleotide sequence of SEQ ID NO. 9.

[0023] For example, the above-mentioned swp25 gene may consist of the nucleotide sequence of SEQ ID NO. 1.

[0024] For example, the metap2 gene may consist of the nucleotide sequence of SEQ ID NO. 6.

[0025] For example, the above-mentioned spp gene may consist of the nucleotide sequence of SEQ ID NO. 9.

[0026] The inhibitor for the above-mentioned swp25 gene may include a nucleotide sequence complementary to all or part of the nucleotide sequence of SEQ ID NO. 1.

[0027] The inhibitor for the metap2 gene may include a nucleotide sequence complementary to all or part of the nucleotide sequence of SEQ ID NO. 6.

[0028] The inhibitor for the above-mentioned spp gene may include a nucleotide sequence complementary to all or part of the nucleotide sequence of SEQ ID NO. 9.

[0029] Specifically, the inhibitor for the swp25, metap2, or spp gene is, respectively, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, 150 or more, 160 or more, 170 or more, 180 or more, 190 or more, 200 or more, 210 or more, 220 or more, 230 or more, 240 or more, 250 or more, 260 or more, 270 or more, 280 or more, 290 or more, 300 or more, It may include a base sequence complementary to a region containing 310 or more, 320 or more, 330 or more, 340 or more, 350 or more, 360 or more, 370 or more, 380 or more, 390 or more, 395 or more, 399 or more, 400 or more, 410 or more, 414 or more, 420 or more, 430 or more, 440 or more, 450 or more, 460 or more, 470 or more, 480 or more, or 488 or more nucleotides.

[0030] More specifically, the inhibitor for the swp25, metap2, or spp gene may be a dsRNA comprising all or part of the nucleotide sequence of SEQ ID NOs 12, 17, or 20, respectively.

[0031] More specifically, the inhibitor for the swp25, metap2, or spp gene is, respectively, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, 150 or more, 160 or more, 170 or more, 180 or more, 190 or more, 200 or more, 210 or more, 220 or more, 230 or more, 240 or more, 250 or more, 260 or more, 270 or more, 280 or more, 290 or more, 300 or more It may be a dsRNA containing 310 or more, 320 or more, 330 or more, 340 or more, 350 or more, 360 or more, 370 or more, 380 or more, 390 or more, 395 or more, 399 or more, 400 or more, 410 or more, 414 or more, 420 or more, 430 or more, 440 or more, 450 or more, 460 or more, 470 or more, 480 or more, or 488 or more nucleotides.

[0032] More specifically, the inhibitor for the swp25, metap2, or spp gene may be a dsRNA containing the nucleotide sequence of SEQ ID NOs 12, 17, or 20, respectively.

[0033] For example, an inhibitor for the above-mentioned swp25 gene may be a dsRNA consisting of the nucleotide sequence of SEQ ID NO. 12.

[0034] For example, an inhibitor of the metap2 gene may be a dsRNA consisting of the nucleotide sequence of SEQ ID NO. 17.

[0035] For example, an inhibitor for the above-mentioned spp gene may be a dsRNA consisting of the nucleotide sequence of SEQ ID NO. 20.

[0036] The nucleotide sequences of SEQ ID NOs 12 to 22 refer to the nucleotide sequences of the sense strand in dsRNA, and the antisense strand that binds to the target gene may be composed of a sequence complementary to the nucleotide sequences of SEQ ID NOs 12 to 22.

[0037] The above composition may be a liquid formulation, a powder formulation, a spray formulation, a micro / nanoparticle formulation, or a feed additive.

[0038] The above composition may further include a carrier. The carrier may be an agriculturally acceptable carrier and may be one or more selected from the group consisting of, for example, water, sugar, honey, cyclodextrin, porous silica, lipid nanoparticles, emulsifiers, natural gums, alginates, chitosan, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), dextrin, and maltodextrin.

[0039] Another example of the present application relates to a feed or feed additive comprising an inhibitor for the swp25, metap2, or spp genes of the genus Vairimorphasp.

[0040] The above feed may be feed for bees. Specifically, the above feed may be feed for Hymenoptera.

[0041] The above bee may be a honey bee or a bumblebee.

[0042] The above honeybee may be of the genus Apis and may be one or more selected from the group consisting of, for example, Apis mellifera, Apis cerana, Apis dorsata, Apis florea, Apis laboriosa, Apis nigrocincta, Apis andreniformis, Apis breviligula, and Apis binghami.

[0043] The bee may be of the genus Bombus, for example Bombus terrestris, Bombus impatiens, Bombus lapidarius, Bombus pascuorum, Bombus hortorum, Bombus lucorum, Bombus pratorum, Bombus hypnorum, Bombus ruderatus, Bombus distinguendus, Bombus armeniacus, Bombus polaris, Bombus jonellus, Bombus cryptarum, Bombus sylvarum, Bombus soroeensis, Bombus fragrans, Bombus monticola, Bombus confusus, and Bombus sporadicus.

[0044] The above feed may be a feed for the prevention or improvement of Nosema disease.

[0045] The above feed additive may be a feed additive for the prevention or improvement of Nosema disease.

[0046] Another example of the present application relates to a method for preventing or treating Nosema disease, comprising the step of inhibiting the swp25, metap2, or spp genes of the genus Vairimorphasp.

[0047] The above-mentioned inhibiting step may include the step of administering an inhibitor to the swp25, metap2, or spp gene. The inhibitor is as described above.

[0048] The above-mentioned Nosema disease may be Nosema disease in animals other than humans. Specifically, the above-mentioned Nosema disease may be Nosema disease in bees. The above-mentioned bee is as described above.

[0049] In order to improve the efficacy of a composition for controlling Nosema disease, the present application identified an effective target gene and, through a comparison of efficacy with prior art, determined that an inhibitor thereof has excellent preventive and therapeutic effects against Nosema disease.

[0050] Figure 1 is a diagram confirming the synthesized dsRNA by electrophoresis.

[0051] Figure 2a is a diagram showing the artificial infection of honeybees by individually inoculating them with the Nosema disease pathogen.

[0052] Figure 2b is a diagram showing the artificial infection of honeybees by mass inoculating them with the Nosema disease pathogen.

[0053] Figure 3 is a figure showing the results of comparative verification of the efficacy of dsRNA according to an example of the present application, in which the number of molecules of 16S rRNA absolutely quantified by qPCR was analyzed for each experimental group and normalized based on the Mock group to show relative values.

[0054] FIGS. 4a and 4b are results of comparing the efficacy of dsRNA according to one example of the present application with that of dsRNA of the prior art.

[0055] Figure 5 is the result of gene expression analysis using qPCR, which compares the expression levels of the fnr1, fnr2, swp12, and swp25 genes after dsRNA treatment with those of the mock treatment group.

[0056] Figure 6a is a diagram visualizing the infection pattern of the Nosema disease pathogen.

[0057] Figure 6b shows the results of quantifying the infection rate of the Nosema disease pathogen, with the bar graph representing the mean ± standard error (Mean ± SEM), and the numbers inside the bars represent the number of biological replicates (n) for each experimental group.

[0058] Figures 7a and 7b are the results of verifying the efficacy of dsRNA according to one example of the present application through a spore counting method.

[0059] The present application will be explained in more detail below by means of the following examples. However, these examples are merely illustrative of the present application, and the scope of the present application is not limited by these examples.

[0060] Example 1. Discovery of Candidate Genes

[0061] Using effective dsRNA target genes from closely related species and transcriptome analysis data, 11 candidate genes were selected as target genes to inhibit virimorpha and are shown in Table 1. Based on the gene sequence information in Table 1, dsRNA sequences were designed as inhibitors for the candidate genes and are shown in Table 2. The dsRNAs in Table 2 were synthesized on a lab-scale basis using the HighYield T7 RNAi Kit (Jena Bioscience). Figure 1 shows the results of electrophoresis on the synthesized dsRNAs.

[0062]

[0063]

[0064] Example 2. Inhibitory effect of candidate gene on Nosema disease pathogen

[0065] Newly hatched honeybees from capped brood combs were acclimatized in vitro by being fed pollen patties and 1.5M sugar water in plastic cups for 3 days before being used in the experiment. Midguts were extracted from Nosema-infected honeybees and Percoll ® (Sigma-Aldrich) The infectious agent was secured by purification via density gradient centrifugation, and honeybees were artificially infected with the Nosema disease pathogen (Vairimorpha ceranae). To compare efficacy, artificial infection was performed using two methods: individual inoculation (Fig. 2a) and mass inoculation (Fig. 2b). For individual inoculation, a 24-well plate was prepared by making a hole of approximately 1 mm in the lid to match the well position, and 50,000 Vairimorpha ceranae spores were mixed with 20 μL of 1.5 M sugar solution and inoculated through the lid hole per honeybee (Fig. 2a). For mass inoculation, 1,000,000 Vairimorpha ceranae spores mixed with 350 μL of 1.5 M sugar solution were randomly supplied to 20 honeybees for one day (Fig. 2b).

[0066] Immediately after the infection of Vairimorpha ceranae ended, 32 μg of dsRNA synthesized in Example 1 was mixed with 1 mL of 1.5 M sugar water and fed, and 1 mL was supplied at daily intervals for 13 days. After 14 days of infection, an analysis of the efficacy of dsRNA according to one example of the present application was performed using the ‘absolute quantification method using nucleic acid extraction and qPCR from the abdomen of the sample’ and the ‘spore counting method using a hemocytometer’.

[0067] To perform absolute quantification using qPCR, a TaqMan probe-based primer set for 16S rRNA was obtained. To verify the qPCR efficiency of the primers for each gene, they were cloned using pGEM-T Easy Vector Systems (Promega). Subsequently, the size and sequence of the obtained standard DNA were verified, and qRT-PCR validation was performed by calculating the number of molecules based on the size and concentration of the standard DNA. Both primers demonstrated high PCR efficiency and reliability, confirming their suitability for molecular biological analysis techniques, and were therefore utilized for validation (16S rRNA: PCR efficiency 93.43%, coefficient of determination (R²). 2 ) 0.9864, detection limit Ct 34.2).

[0068] Fourteen days after infection, the abdomens of honeybees were used as samples for molecular quantitative analysis. Homogenization of the samples was performed by placing one abdomen and four 2.4 mm beads into a 2 mL screw-cap micro tube without any additives, using a Homogenizer-Bioprep-24R (Allsheng) (4°C, linear speed of 5.0 m / s, for 30 seconds per cycle, repeated for 5 cycles). Total nucleic acids were extracted from the homogenized samples using an automated nucleic acid extraction instrument, Nextractor 32N (Genolution), and used for qRT-PCR analysis. Additionally, some of the obtained honeybee samples had their midguts separated, homogenized with distilled water, and used for spore counting analysis using a hemocytometer in Example 5.

[0069] Figure 3 shows the results of a comparative analysis of the efficacy of the dsRNA prepared in Example 1 using absolute quantitative analysis via qPCR. As shown in Figure 3, among the 11 candidate genes, significant inhibitory effects were confirmed in the swp25, metap2, and spp-targeted dsRNA treatment groups compared to the mock (DW treatment group), and the inhibitory effect of dsRNA-swp25 was particularly high (Student's t-test: swp25- t=4.039, p<0.0001; metap2- t=3.167, p=0.0019; spp- t=2.491, p=0.0140). In Figure 3, the bar graph is displayed as mean ± standard error (Mean ± SEM), and the number inside each bar represents the number of biological replicates (n) of the corresponding experimental group.

[0070] In particular, despite the fact that the swp30 and swp-precursor (swp-pre.) genes were annotated similarly to the swp25 gene, no significant control effect against the Nosema disease pathogen was observed even when dsRNA targeting the swp30 or swp-precursor genes was applied. This implies that, given that the functions of most genes of the Nosema disease pathogen have not been verified to date, it is difficult to identify effective control targets based on gene annotation, and it is difficult to predict the control effect against the Nosema disease pathogen until dsRNA targeting those genes is directly manufactured and its effectiveness verified.

[0071] Example 3. Comparison of inhibitory effects on Nosema disease pathogens

[0072] The efficacy of dsRNA-swp25, which targets the swp25 gene and exhibits the most superior inhibitory effect against the Nosema disease pathogen among the dsRNAs prepared in Example 1, was compared with dsRNA-fnr1 and dsRNA-fnr22 disclosed in Korean Patent Publication No. 10-2019-0027991. dsRNA targeting the swp12 gene (dsRNA-swp12) was used as a positive control, and dsRNA-gfp was used as a negative control. For the comparative verification of the inhibitory efficacy against the Nosema disease pathogen, the absolute quantification number of 16S rRNA molecules via qPCR was analyzed for each experimental group using the 'individual inoculation' and 'mass inoculation' methods performed in Example 2. The relative values ​​were normalized based on the mock group and are shown in Figures 4a and 4b.

[0073] As a result of evaluating efficacy using molecular quantification methods, no significant inhibitory effect was observed in either the dsRNA treatment group targeting fnr1 and fnr2, the target genes of the prior art, in the 'individual inoculation' experiment (Fig. 4a) (Fig. 4a; inhibition rate: fnr1- 15.71±15.49%, t=0.5398, p=0.5950; fnr2- 3.45±21.57%, t=0.1022, p=0.9196). In addition, the dsRNA-swp12 treatment group showed an inhibitory effect of 55.71±13.31% compared to the mock, but the significance was negligible (t=2.015, p=0.0569). A significant inhibitory effect of 58.94±13.01% was confirmed in the dsRNA-swp25 treatment group compared to the mock (t=2.146, p=0.0437). A similar pattern was confirmed in the 'population inoculation' experiment (Fig. 4b). In the dsRNA-swp25 treatment group, a significant inhibitory effect of 64.84±8.43% compared to the mock was confirmed (t=3.941, p<0.0001), but no significant inhibitory effect compared to the mock was observed in other dsRNA treatment groups (Fig. 4b; inhibition rate: fnr1- 26.90±18.47%, t=1.311, p=0.1917; fnr2- 27.13±18.45%, t=1.324, p=0.1874; swp12- 33.38±13.99%, t=1.785, p=0.0761). Therefore, the dsRNA according to one example of the present application showed a significantly superior effect in controlling Nosema disease pathogens compared to conventional dsRNA.

[0074] In Figures 4a and 4b, the bar graphs are displayed as mean ± standard error (Mean ± SEM), and the number in each bar represents the number of biological replicates (n) of the corresponding experimental group.

[0075] In addition, in all of the above experiments, the dsRNA-gfp treatment group and the mock showed almost similar results, confirming that naked dsRNA has no effect on the inhibition of the Nosema disease pathogen.

[0076] Example 4. Effect of inducing post-transcriptional gene silencing (PTGS)

[0077] We verified whether the control effect of the Nosema disease pathogen was related to post-transcriptional gene silencing (PTGS) by dsRNA. Specifically, after performing reverse transcription from the total nucleic acid extracted from the sample obtained by the mass inoculation method of Example 3, qRT-PCR was performed on each gene and the reference gene (23S rRNA) using the primer set presented in Table 3, and the results were relatively quantified using the 2-ΔΔCt method.

[0078] Primer nameAccess IDSize (bp)F primerR primerVc23s_rRNA-qXR_002966747.178AGGTAGCTGTGCAATTTGTTTGTCCTCCAAGATCGGCTCATTTGTVcFnr1-qXM_0244 76036.1174TGGATTTAGAAATCAAGAAGATGATCGGTCGGCCACAAACATAAAVcFnr2-qXM_024474531.1200GGCTCCCAAACAGG AAATTCTATACATCCATTCCCATGAGTCGAACATACAAVcSwp12-qXM_024475810.1132ATTTTGATGAAAGTCAGAAGAATTGACATAAGTGAGGCTATACTTGAACCVcSwp25-qXM_024474166.1171CCTAGTACCTGTAAAGTAGTACGAAATGCGGTAAATAACGCATATTCC

[0079] According to the qRT-PCR results in Figure 5, all four dsRNA treatment groups used to compare the effects in Example 3 showed a significant difference in the expression levels of the target gene compared to the mock treatment group. However, the dsRNA-fnr1 treatment group showed a statistically significant inhibitory effect with a 19.70±6.34% decrease in gene expression compared to the mock treatment group (t=2.113, p=0.0461); however, since the decrease was relatively low, it is thought that the dsRNA did not sufficiently induce PTGS, and as a result, it is judged that the inhibitory effect on the proliferation of the Nosema disease pathogen was also insufficient. In addition, in the dsRNA-fnr2 treatment group, strong PTGS was confirmed with a 78.83±2.57% decrease in gene expression compared to the mock treatment group (t=8.528, p<0.0001), but the inhibitory effect on the proliferation of the Nosema disease pathogen was insufficient.

[0080] According to one example of the present application, the dsRNA-swp25 treatment group showed a 92.83±2.07% decrease in gene expression compared to the mock treatment group (t=10.170, p<0.0001), the strongest PTGS were induced, and the control effect against Nosema disease pathogens was also significantly superior. In Figure 6, the bar graph is represented as mean ± standard error (Mean ± SEM).

[0081] These results indicate that even if PTGS is induced in specific genes by treating with dsRNA targeting specific genes of the Nosema disease pathogen, the control effect against the Nosema disease pathogen is not guaranteed. Specifically, even when the same amount of dsRNA was applied, the PTGS induction efficiency of each dsRNA varied; the dsRNA-fnr2 treatment group induced strong PTGS, resulting in a high level of inhibition of the target gene, but the inhibitory effect on the proliferation of the Nosema disease pathogen was low. Furthermore, the dsRNA-swp12 treatment group showed insufficient PTGS efficiency and proliferation inhibitory effect compared to the dsRNA-swp25 treatment group. dsRNA-swp25 according to one example of this application induced strong PTGS, resulting in a high level of inhibition of the target gene, and also demonstrated a significantly superior control effect against the Nosema disease pathogen. These results imply that it is difficult to predict the control effect against the Nosema disease pathogen until the dsRNA targeting the relevant gene is directly manufactured and its efficacy verified.

[0082] Example 5. Visualization of Nosema inhibitory effect

[0083] Fluorescent Brightener 28 (=Calcofluor White M2R) is a staining reagent that emits fluorescence by binding to β-glucan and chitin, and is useful for staining the cell walls of Nosema pathogens. The midgut of a 14-day-infected sample obtained by the same method as in Example 2 was extracted, stained in 5% Fluorescent Brightener 28 (in 1X PBS) for 10 minutes, and then washed three times with 1X PBS. Subsequently, the tissue was transferred to a slide glass to obtain fluorescence microscope images, and the fluorescence intensity was visualized as pseudo-coloring based on fluorescence intensity by applying a Look-Up Table (LUT). Fluorescence images obtained under the same fluorescence settings after staining with Fluorescent Brightener 28 are shown in Fig. 6a. In addition, the intensity values ​​of each pixel in the image were counted to calculate the 'Nosema infection rate' as follows:

[0084] 1) Values ​​less than Intensity = 40 are discarded (Background).

[0085] 2) Count all pixels with Intensity = 40 or higher (= total medium length).

[0086] 3) Count all pixels with an Intensity of 100 or higher (=Nosema infection).

[0087] 4) Define 100 x (“3” / “2”) = “Nosema infection rate”.

[0088] As shown in Figure 6a, a clear difference was observed in the dsRNA-swp25 treatment group compared to the control group mock and dsRNA-gfp. Additionally, as shown in Figure 6b, the results of quantifying the “Nosema infection rate” showed that the average infection rate of the mock was 61.71±9.87% (n=3), the dsRNA-gfp treatment group was 59.66±6.60%, and the dsRNA-swp25 treatment group was 20.12±8.45% (n=3), with a significant difference observed only in the dsRNA-swp25 treatment group (Student's t-test: t=3.201, p=0.0329).

[0089] In addition, efficacy was evaluated using a spore counting method with a hemocytometer. As shown in Figure 7a, a significantly lower number of spores was observed in the dsRNA-swp25 group compared to the control group (mock) and the dsRNA-gfp treatment group. Furthermore, as shown in Figure 7b, the average number of Nosema spores per bee for the mock and dsRNA-gfp treatment groups was confirmed to be 6.24±0.62 and 6.51±0.93 x 10⁶ spores / bee, respectively. A significant inhibitory effect was confirmed in the dsRNA-swp25 treatment group with 2.57±0.36 x 10⁶ spores / bee compared to the mock group (Student's t-test: t=5.142, p<0.0001).

Claims

1. A composition for the prevention or treatment of Nosema disease comprising an inhibitor of the swp25, metap2, or spp genes of the genus Vairimorphasp.

2. A composition according to claim 1, wherein the genus Vairimorpha is one or more selected from the group consisting of Vairimorpha ceranae, Vairimorpha apis, Vairimorpha bombi, Vairimorpha carpocapsae, and Vairimorpha chrysorrhoeae.

3. A composition according to claim 1, wherein the inhibitor is one or more selected from the group consisting of dsRNA, siRNA, smRNA, shRNA, miRNA, ribozyme, DNAzyme, antisense oligonucleotide, morpholino, peptide nucleosans (PNAs), and LNA (Locked nucleic acid).

4. A composition according to claim 1, wherein the swp25 gene comprises the nucleotide sequence of SEQ ID NO. 1, the metap2 gene comprises the nucleotide sequence of SEQ ID NO. 6, or the spp gene comprises the nucleotide sequence of SEQ ID NO.

9.

5. A composition according to claim 1, wherein the inhibitor comprises a nucleotide sequence complementary to all or part of the nucleotide sequence of SEQ ID NO. 1, 6, or 9.

6. A composition according to claim 5, wherein the inhibitor comprises a base sequence complementary to a region containing 10 or more consecutive nucleotides among the base sequences of SEQ ID NO. 1, 6, or 9.

7. A composition according to claim 1, wherein the inhibitor for the swp25, metap2, or spp gene is a dsRNA comprising a nucleotide sequence complementary to all or part of the nucleotide sequence of SEQ ID NOs 1, 6, or 9, respectively.

8. A composition according to claim 7, wherein the inhibitor for the swp25, metap2, or spp gene is a dsRNA comprising a nucleotide sequence complementary to a region containing 10 or more consecutive nucleotides among the nucleotide sequences of SEQ ID NOs 1, 6, or 9, respectively.

9. A composition according to claim 1, wherein the inhibitor for the swp25, metap2, or spp gene is a dsRNA comprising the nucleotide sequence of SEQ ID NO. 12, 17, or 20, respectively.

10. Feed containing an inhibitor for the swp25, metap2, or spp genes of the genus Vairimorphasp.

11. In paragraph 10, the above feed is a composition that is feed for bees.

12. A feed additive comprising an inhibitor of the swp25, metap2, or spp genes of the genus Vairimorphasp.

13. A method for the prevention or treatment of Nosema disease comprising a step of inhibiting the swp25, metap2, or spp genes of the genus Vairimorphasp.

14. The method according to claim 14, wherein the inhibiting step is administering an inhibitor for the swp25, metap2, or spp gene.

15. In paragraph 13, the above Nosema disease is Nosema disease of animals other than humans.

Images