oligonucleotides

Abstract

The present invention provides a splice-switching oligonucleotide (SSO) that binds to a site within exon 3 or exon 2 of a pre-mRNA transcript of a human GCN5L1 gene, wherein binding of the SSO to exon 3 of the pre-mRNA transcript induces the exclusion of exon 3 from a mature mRNA transcript of the GCN5L1 gene and wherein binding of the SSO to exon 2 of the pre- mRNA transcript induces the exclusion of exon 2 from a mature mRNA transcript of the GCN5L1 gene. There is also provided a method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within exon 3 or exon 2 of a pre- mRNA transcript of a human GCN5L1 gene, wherein the binding of the SSO to exon 3 of the pre-mRNA transcript induces the exclusion of exon 3 from a mature mRNA transcript of the GCN5L1 gene and wherein the binding of the SSO to exon 2 of the pre-mRNA transcript induces the exclusion of exon 2 from a mature mRNA transcript of the GCN5L1 gene.

Description

DESCRIPTIONTITLE OF THE INVENTION: OLIGONUCLEOTIDESFIELD OF THE INVENTION

[0001] The present invention generally relates to the field of RNA splicing, and more specifically relates to splice-switching oligonucleotides (SSOs) capable of altering the splicing of a pre-mRNA encoding the GCN5L1 gene. The invention also relates to the use of SSOs as therapeutic candidates for treating amyotrophic lateral sclerosis (ALS).BACKGROUND OF THE INVENTION

[0002] Amyotrophic lateral sclerosis (ALS) inflicts 450,000 people globally. It is an age-onset, rapidly progressing motor neuron (MN) disease for which there is no cure, with most patients not surviving five years from their inaugural manifestation of clinical symptoms.

[0003] There are currently 3 FDA-approved treatments for ALS, namely Riluzole, Edaravone and Tofersen. Riluzole inhibits excitotoxicity and remains the gold standard treatment even though it extends lifespan for only an average of 3 months. Edaravone is a potent antioxidant but it slows disease in only a small subset of patients and confers only 6 months of median survival benefits.

[0004] Tofersen is an antisense oligonucleotide (gapmer) drug against mutant forms of SOD1, which is expected to benefit approximately only 5% of all ALS patients. It is a RNA-based therapeutics (gapmer) that targets SOD1 transcripts for degradation via the RNaseH mechanism. The intrathecally-administered Tofersen led to reduced misfolded SOD1 proteins in the cerebrospinal fluid and decreased neurofilament light chains in plasma but did not improve clinical end points in the ALSFRS-R score. The clinical needs for the remaining 95% of the patients remains unmet. This is because the mutant SOD1 genotype occurs in about half of the total familial form of the disease (i.e. with family history), which constitutes 10% of total ALS cases. Most of the cases (-90%) falls under the sporadic ALS form wherein the diverse genetic heterogeneity prevents the precise identification of the causal pathogenic gene / mutation. For this reason, precision medicine and gene replacement therapeutic strategies are not viable for most of the patients. There is currently no effective treatment that selectively targets a common pathogenic pathway in ALS, including sporadic ALS where the underlying genetic mutations remain unknown.

[0005] There is thus a need for a therapeutic strategy for ALS that is invariant to the underlying genetic defects and which overcomes the drawbacks of the prior art.SUMMARY OF THE INVENTION

[0006] In one aspect, there is provided a splice-switching oligonucleotide (SSO) that binds to a site within exon 3 or exon 2 of a pre-mRNA transcript of a human GCN5L1 gene, wherein binding of the SSO to exon 3 of the pre-mRNA transcript induces the exclusion of exon 3 from a mature mRNA transcript of the GCN5L1 gene and wherein binding of the SSO to exon 2 of the pre-mRNA transcript induces the exclusion of exon 2 from a mature mRNA transcript of the GCN5L1 gene.

[0007] In one embodiment, the SSO binds to a site located within a target region in exon 3, the target region having the sequence of SEQ ID NO: 2.

[0008] In one embodiment, the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 4, 6 and 21 to 34.

[0009] In one embodiment, the SSO binds to a site located within a target region in exon 2, the target region having the sequence of SEQ ID NO: 1.

[0010] In one embodiment, the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 3, 5 and 7 to 20.

[0011] In one embodiment, the SSO is between 15 and 23 nucleotides in length.

[0012] In one embodiment, at least one of the nucleotides of the SSO as described herein is chemically modified and wherein the chemical modification is selected from the group consisting of 2’-O-methyl RNA modification, 2’-O-methoxyethyl RNA modification, locked nucleic acid substitution and phosphorothioate linkage.

[0013] In one embodiment, the SSO comprises phosphorothioate linkages between all nucleotides of the SSO.

[0014] In one embodiment, each nucleotide of the SSO comprises either a 2’-O-methyl RNA modification, a 2’-O-methoxyethyl RNA modification or a locked nucleic acid substitution.

[0015] In one aspect, there is provided an SSO as described herein for use in treating amyotrophic lateral sclerosis (ALS).

[0016] In one aspect, there is provided a use of an SSO as described herein the manufacture of a medicament for treating ALS.

[0017] In one aspect, there is provided a method of treating ALS comprising administering to a subject a composition comprising an SSO as described herein.

[0018] In one aspect, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents.

[0019] In another aspect, there is provided a method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within exon 3 or exon 2 of a pre-mRNA transcript of a human GCN5L1 gene, wherein the binding of the SSO to exon 3 of the pre-mRNA transcript induces the exclusion of exon 3 from a mature mRNA transcript of the GCN5L1 gene and wherein binding of the SSO to exon 2 of the pre-mRNA transcript induces the exclusion of exon 2 from a mature mRNA transcript of the GCN5L1 gene.

[0020] In one embodiment, the method as described herein comprises providing an SSO that binds to a site located within a target region in exon 3, the target region having the sequence of SEQ ID NO: 2.

[0021] In one embodiment, the method as described herein comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 4, 6 and 21 to 34.

[0022] In one embodiment, the method as described herein comprises providing an SSO that binds to a site located within a target region in exon 2, the target region having the sequence of SEQ ID NO: 1.

[0023] In one embodiment, the method as described herein comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 3, 5 and 7 to 20.

[0024] In one embodiment, the method as described herein comprises providing an SSO that is between 15 and 23 nucleotides in length.

[0025] In one embodiment, the method as described herein comprises providing an SSO with at least one of the nucleotides of the SSO being chemically modified and wherein the chemical modification is selected from the group consisting of 2’-O-methyl RNA modification, 2’-O-methoxyethyl RNA modification, locked nucleic acid substitution and phosphorothioate linkage.

[0026] In one embodiment, the method as described herein comprises providing an SSO having phosphorothioate linkages between all nucleotides of the SSO.

[0027] In one embodiment, the method as described herein comprises providing an SSO with each nucleotide having either a 2’-O-methyl RNA modification, a 2’-O-methoxyethyl RNA modification or a locked nucleic acid substitution.BRIEF DESCRIPTION OF THE DRAWINGS

[0028] FIG. 1 shows the genetic spectrum and variability in Chinese patients with ALS. This figure was adapted from Adapted from Aging and Disease, 10.14336 / AD.2019.0215.

[0029] FIG. 2 shows the validation of SSOs in neuronal cells and spinal organoid. 50nM of SSO 1628 or 2012, modified with full 2’OMe-PS (suffixed with -2OMe) or 2’MOE-PS (suffixed with -2MOE), was transfected in (A) RenVM and (B) NSC34 cells. Total RNA wasextracted after 24 hours of transfection and target transcript abundance were measured by qPCR and normalized to HPRT, as shown as deltaCt in the vertical axis. (C) iPSC-derived BJ-iPS spinal organoids were differentiated by the protocol (left, Hor et al. Cell Death Dis. 2018 9:1100). iPSCs culture were dissociated and seeded in 96-well low-attachment plates at 30,000 cells per well and were neurally induced with CHIR99021 and LDN193189. On day 3, retinonic acid was added to caudalize the culture. At day 10, the cells were encapsulated with Matrigel for 4 days and were ventralized with Purmorphamine. At day 14, the cell-Matrigel droplets were transferred into spinner flasks and was supplemented with growth factors, BDNF and GDNF from day 18 onwards. BLOC1S1 transcript levels were quantitated by quantitative PCR at 120 hours post transfection with SSO 1628 and normalized to ACTINB (right). UNT: untreated; Lipo Only: empty transfection; NC2: non-targeting scrambled SSO modified with full 2’OMe-PS or2’MOE-PS.

[0030] FIG. 3 shows functional analyses of iPSC-derived motor neurons (MNs). (A) Schematic diagram of iPSC-derived motor neuron differentiation. iPSCs were neuralised with Chir99021 and LDN-193189. On day 3, retinoic acid is added to direct the neural progenitor cells (NPCs) towards the spinal fate. On day 10, NPCs were ventralised with purmorphamine for 7 days. On day 18, motor neuron progenitor cells (MNPs) were matured into motor neurons with supplementation of BDNF, GDNF and Ascorbic acid. For downstream experiments / assay, motor neuron cultures were treated with 1 day of AraC before reseeding.(B) At day 27 after differentiation, MNs were seeded in 96-well plate and treated with 25nM of SSO on the following day (day 28). At day 29, the culture medium was changed and cells were cultured till day 31. (C) BLOC1S1 protein knockdown by SSO 1628. (Left) Western blot analysis of day 31 MNs derived from sALS1 iPSCs. (Right) Densitometric analyses of western blot bands.

[0031] FIG. 4 shows the rescue of ALS MN survival with SSO. MNs were differentiated from iPSC derived from both familial (labelled as 29d and 47a in Figure 4A) and sporadic (labelled as sALS1 and CS3EPRiALS in Figure 4B) ALS patients. (Left) ALS iPSC-derived MNs were treated with either lipofectamine (Lipo only), non-targeting scrambled SSO (NC2) or SSO 1628 from Day 28 to 31. Number of ISL1+MNs were quantified and normalized to number of ISL1+MNs in respective cell lines at day 28. SSO 1628 transfection prevents MN death in ALS MNs.0.0001, ns non-significant; one-way ANOVA, Tukey’s multiple comparisons post hoc test. (Right) Representative images of ISL1+SMI32+MNs, demonstrating that transfection of SSO 1628 prevents MN death at Day 31. Scale bars, 50 pm.

[0032] FIG. 5 shows the lead SSO optimization. Efficiency of various chemical versions of SSOs 2188 and 2232 were determined and compared with SSOs 1628 and 2012, respectivelyby transfection at either 25nM or 50nM, or by CEM mediated free uptake at 200nM or 500nM, in RenVM cells. (A) Relative BLOC1S1 expression level normalized to respective nontargeting controls (NTC) by transfection. (B) Relative cell viability normalized to respective non-targeting controls (NTC) by transfection. (C) Relative BLOC1S1 expression level normalized to respective non-targeting controls (NTC) by CEM mediated free uptake. (D) Dose response of SSOs 2232 (2OM), 2232.401 (2OML) and 2232.402 (2OML). In all experiments, 2OML mixmer is normalized to NTC (2OM) whereas 2MOL mixmer is normalized to NTC (2MOE).

[0033] FIG. 6 shows the rescue of ALS MN survival by 2232.401 (2OML). (A) MN survival. Relative cell viability normalized to MN at day 28. (B) BLOC1S1 transcript abundance. Relative BLOC1S1 expression level normalized to untreated MN. MNs were transfected with 25nM of 2232.401 (2OML), Tofersen, non-targeting SSO or gapmer controls (NC2). Note that Tofersen did not affect the abundance of BLOC1S1 transcripts. ALS MNs were SOD1 mutant (L144F) and sporadic sALS3 MNs.

[0034] FIG. 7 shows the location of the binding sites of exemplary SSOs with respect to the pre-mRNA transcript of GCN5L1.

[0035] FIG. 8 shows that BLOC1S1 is over-expressed in multiple ALS models. (A) Schematic of differentiation protocol for deriving motor neurons (MNs) from human iPSCs. (B) Representative microscope images of MNs derived from control iPSCs and sporadic ALS iPSCs. MNs were stained with ISL1 (shown in darker grey) and SMI-32 (shown in lighter grey). Scale bar indicates 50 p.m. (C) Western blot of BLOC1S1 in control and sporadic ALS iPSC-derived MN cultures, with quantification of Western blot band intensities shown below, p-actin was used as a loading control. Quantification of p-value was performed by means of one-way ANOVA. (D) Western blot of MnSOD-K68ac and total MnSOD in control and sporadic ALS iPSC-derived MN cultures, with quantification of Western blot band intensities shown below. Quantification of p-value was performed by means of one-way ANOVA. (E) Western blot of BLOC1S1 in control and sporadic ALS post-mortem motor cortex samples, with quantification of Western blot band intensities shown below, p-actin was used as a loading control. Quantification of p-value was performed by means of a student’s t test. (F, G) Western blot of Bloc1s1 in spinal cords from wild-type and SOD1-G93A mice spinal cords or non-transgenic and TDP43-Q331K knock-in mice respectively, with quantification of Western blot band intensities shown below, p-actin was used as a loading control. Quantification of p-value was performed by means of a student’s t test.

[0036] FIG. 9 shows that over-expression of BLOC1S1 in healthy neurons lead to MN death. (A) Schematic showing the BLOC1S1 over-expression lentiviral construct and the timeline of the over-expression experiment. (B) After lentiviral transduction of MNs derived from the 3 control iPSC lines (Control #1 to #3), 1 pg / ml doxycycline was used to turn on the expression of BLOC1S1. Western blot of BLOC1S1, MnSOD-K68ac and total MnSOD was performed on MNs from the 3 cell lines transduced with lentivirus, with and without doxycycline, p-actin was used as a loading control. (C) MN counts were performed by counting number of ISL1 + MNs against total cell count in a well in -Dox and +Dox conditions, after transducing all three cell lines. The ratio of ISL1+ MNs: total cells in each condition were then normalized to the respective -Dox condition and computed as MN Survival Index. Quantification of p-value was performed by means of a student’s t test. (D) Representative microscope images of motor neurons from Control #1 after transduction. MNs were identified by immunostaining with ISL1 (shown in darker grey) and SMI-32 (shown in lighter grey) antibodies.

[0037] FIG.10 shows that siRNA-mediated knockdown of BLOC1S1 promote mitochondrial respiration and motor neuron survival in ALS iPSC-derived cultures. (A) Nontargeting (Control) or BLOC1S1 -specific siRNAs were transfected into sALS #3 motor neuron cultures. Gene expression analysis of BLOC1S1 levels were performed by qPCR, normalized to housekeeping genes ACTB and GAPDH. Quantification of p-value was performed by means of a student’s t test. (B) Western blot of BLOC1S1 was performed on 3 biological replicates of sALS #3 motor neuron cultures transfected with control siRNA (-) or BLOC1S1-specific siRNA (+). p-actin was used as a loading control. (C) Oxygen consumption rate (OCR) measurements using the MitoStress assay were performed and calculated for motor neurons from respective sporadic ALS iPSC lines treated with control siRNA (black lines) or BLOC1S1 siRNA (coloured lines). (D) Representative microscopy images of motor neurons marked by ISL1 and SMI32 at day 28, and at day 31, treated with control siRNA or BLOC1S1 siRNA. Scale bar indicates 50 |im. (E) MN survival index was calculated by quantifying ratio of ISL1 + MNs: total cells at day 31 after respective treatments and normalizing to the respective day 28 cultures. Quantification of p-value was performed by means of one-way ANOVA.

[0038] FIG. 11 shows that antisense oligonucleotide against BLOC1S1 (SSO 1628) improves mitochondrial respiration and motor neuron survival in ALS iPSC-derived cultures. (A) Schematic depicting the target regions of BLOC1S1 ASOs SSO 1628 and SSO 1631. (B) Levels of BLOC1S1 mRNA measured by qPCR after treatment in various control conditions (untreated, lipofectamine only control, control ASO) and with BLOC1S1 -targeting ASOs (SSO1628 and SSO 1631). (C) Western blot showing reduction in BLOC1S1 protein levels after treatment with SSO 1628. (D) MN survival index was calculated by quantifying ratio of ISL1 + MNs: total cells at day 31 after respective treatments and normalizing to the respective day 28 cultures. This revealed significant increase in MN survival in sALS #1 and sALS #2 after treatment with BLOC1S1 siRNA. There was improvement in sALS #3 MN survival, albeit insignificant compared to control ASO. Quantification of p-value was performed by means of one-way ANOVA. (E) Oxygen consumption rate (OCR) measurements using the MitoStress assay were performed and calculated for motor neurons derived from sALS #2 treated with control ASO (blue) or SSO 1628 (brown). (F) Quantifications of basal respiration, ATP production and maximal respiration in sALS #2 MNs treated with control ASO or SSO 1628. P-values were determined by means of a student’s t test.

[0039] FIG. 12 shows that Bloc1s1 -targeting SSO 2232.401 rescues disease phenotypes in SOD1-G93A mice. (A) Quantification of Bloc1s1 by qPCR in lumbar spinal cord across different time points (7, 14, 28 and 42 days) after single-dose intracerebroventricular (ICV) injection of 300 j.ig of non-targeting control (NTC) or SSO 2232.401. (B) Immunoblot of lumbar spinal cord for Bloc1s1 at 42 days after ICV injection of 300 pig of NTC or SSO 2232.401. Beta-actin serves as the loading control. Quantification of western blot bands is shown on the right (C) Measurements of body weight of mice over time, up to 42 days after single-dose ICV injection of 300 ig of NTC or SSO 2232.401, showing no significant changes. (D) Representative immunohistochemistry images of the SOD1-G93A mice spinal cord ventral horn neurons labeled with MnSOD-K68ac. Tissues were harvested at day 112 from mice treated with NTC (CTRL) or SSO 2232.401. (E-G) Mice were injected with of 300 fig twice by ICV at P56 and P98 and monitored weekly for survival, body weight and rotarod performance until end point at P176. (E) Survival, (F) disease-free survival, and (G) rotarod performance of mice were analyzed by Gehan-Breslow-Wilcoxon test for curve comparison and by log rank test to derive the hazard ratio between NTC and 2232.401. Disease-free survival is determined by the onset of phenotype, defined as the loss of body weight below 10% of peak body weight. Loss of rotarod performance is considered when mice are unable to stay on the rotarod for more than 30 seconds.

[0040] FIG. 13 is related to Figure 8 and shows (a) Western blot of BLOC1S1 using postmortem occipital cortex samples from 4 non-neurological controls and 10 sporadic ALS patients, p-actin was used as a loading control, (b) Quantification of the Western blot bands revealed a slight (50%) and significant increase in BLOC1S1 levels in ALS compared to control samples.

[0041] FIG. 14 is related to Figure 9 and shows BLOC1S1 overexpression in control MNs. (A, left) Quantification of BLOC1S1 protein in the three control lines in -Dox and +Dox conditions. BLOC1S1 levels were normalized to p-actin. (A, right) Quantification of MnSOD-K68ac levels in the three control lines in -Dox and +Dox conditions. These were normalized to total MnSOD protein. (B) Magnified microscopy images of Ctrl #1 MNs in -Dox and +Dox conditions after BLOC1S1-OE lentiviral transduction.

[0042] FIG. 15 is related to Figure 10 and shows measurements of oxygen consumption rate (OCR) in the three sporadic ALS iPSC-derived motor neurons treated with control siRNA or BLOC1S1-targeting siRNA.

[0043] FIG. 16 is related to Figures 11 and 12 and shows the validation of the mechanism of action of SSOs in human and mouse cell lines. SSOs 1628 and SSO 2232.401 modulate BLOC1S1 splicing in (a) human ReN-VM neuronal cell line and (b) mouse NSC34 motor neuron cell line. Cells were transfected with 50 nM of SSOs, treated with cycloheximide (CHX) to inhibit nonsense-mediated decay, and harvested 24 hours post-transfection for RNA analysis. DNA sequencing was performed for each of the labelled bands, and mapped back to human BLOC1S1 or mouse Bloc1s1 CDS respectively where exons are then identified.

[0044] FIG. 17 is related to Figure 11 and shows (a) Control (left) and sporadic ALS (right) motor neurons treated with increasing concentrations of SSO 1628, from 0 nM to 50 nM. Motor neuron survival and BLOC1S1 mRNA levels were measured accordingly. Motor neuron numbers and total cell count at 50 nM conditions were consistently lower, suggesting cytotoxicity beyond 40 nM. (b) Microscope images of sALS #1 motor neurons treated with SSO 1628 versus control conditions.

[0045] FIG. 18 is related to Figure 12 and shows SSO 2232.401 targets BLOC1S1 in human cells and promote ALS motor neuron survival, (a) A screen for various chemical modifications of SSO 2232 revealed that SSO 2232.401 and SSO 2232.402 were effective in downregulating human BLOC1S1 mRNA under a CaCl2-enriched medium that mimics free uptake conditions in vivo (without transfection reagents). All SSOs are fully modified at the ribose with 2’-O-methyl (2’OMe), 2’-O-methoxyethyl (2’-MOE), 2’OMe with LNAs (locked nucleic acids) (2OML) or2’-MOEwith LNAs (2MOL), and at the inter-nucleoside linkages with phosphorothioate bonds. Nomenclature for 2OML and 2MOL:,101:1xLNA at 5’;.201: 1xLNA each at 5’ and 3’;.202: 2xLNA at 5’;.301: 2xLNA at 5’ and 1xLNA at 3’;.302: 3xLNA at 5’;.401: 2xLNA at 5’ and 3’;.402: 3xLNA at 5’ and 1xLNA at 3’. (b) Both SSO 2232.401 and 2232.402 downregulate the target human BLOC1S1 exon in a dose-dependent manner. Control #2 MNs (c), SOD1-L144F MNs (d) and sALS #3 MNs (e) were treated with SSO2232.401 and its control (NC2 SSO), Tofersen and its control (NC2 Gapmer) as well as Lipofectamine only control for 3 days, from day 28 to day 31. Normalized survival index was calculated based on number of MNs at day 31 after each treatment, normalized to MN count at day 28. An index of 1.0 indicates no selective MN death during this 3-day period.

[0046] FIG. 19 is related to Figure 12 and shows that SSO 2232.401 has good on-target window. Off-target analysis of SSO 2232.401 in human and mouse cells, (a) List of human and mouse genes that exhibit at least 75% sequence identity (or up to 5 mismatches) on the minus strand with SSO 2232.401 and are expressed in neuronal cells, (b, c) Human ReN-VM cells or (d, e) NSC34 cells were (b, d) treated with 200nM of SSOs by CaCl2-enriched medium for 72 hours or (c, e) with 1nM to 100nM of SSOs by transfection for 24 hours, during which cells were also treated with CHX. Fragment length analysis was performed by PCR and gel or capillary electrophoresis. Efficacy is calculated as the percentage of transcripts lacking the predicted on-target or off-target exon (spliced-out band; bottom band) over the sum of spliced-out band and spliced-in band (top band). The data shows that while SSO 2232.401 has an impact on some of the predicted off-targets, BLOC1S1 remains the primary target with an EC50of at least 4-fold lower than the next most efficient off-target.

[0047] FIG. 20 is related to Figure 12 and shows toxicology analysis of SSO2232.401 in mice. Mice were administered with 300ug of SSO 2232.401 or vehicle control by subcutaneous route, (a) Body weight was monitored at 7 days and 14 days post-administration after which mice were euthanized and organs were collected for histopathology analysis, (b) Liver to body weight ratio were similar, suggesting no liver disease or damage that typically causes hepatomegaly. Plasma and whole blood were also collected 7 days postadministration for (c) clinical chemistry and (d) hematology analysis, respectively. Plasma was analyze for (c-i) alanine transaminase, (c-ii) aspartate transaminase and (c-iii) creatinine and confirm the lack of hepato- and nephrotoxicity. Whole blood was checked for (d-i) white blood cell count, (d-ii) red blood cell count, (d-iii) hemoglobin content, (d-iv) hematocrit percentage, (d-v) platelet count, (d-vi) nucleated red blood cell percentage, (d-vii) reticulocyte percentage, (d-viii) neutrophil percentage, (d-ix) lymphocyte count, (d-x) monocyte count, (d-xi) eosinophil count, and (d-xii) basophil count. The (e-i) liver and (e-ii) kidney were investigated for markers of immune infiltration and the (e-iii) spleen for markers of immune activation. No significant differences were observed, supporting the lack of toxicity or immunogenicity of the SSO. (f) the BJAB assay was performed where 5 x 105BJAB leukemia cells were treated with positive control known to trigger immune response in humans (2 LIM ISIS 353512), negative control (2 iM ISIS 104838) and 2 j.iM SSO 2232.401 for 24 hours in a final incubation volume of 100 pil,after which cells were harvested and RNA extracted for analysis of two robust markers of immunogenic response, FCRL3 and CCL22. (g) H& E images of the liver, spleen and kidney of mice treated with 300 pg NTC control or SSO 2232.401 injected subcutaneously. No histopathological changes were seen in the SSO-treated samples, (h) H& E images of the brain and spinal cord of mice treated with 300 j g NTC control or SSO 2232.401 injected intracerebroventricularly. No histopathological changes were seen in the SSO-treated samples.DETAILED DESCRIPTION OF THE INVENTION

[0048] The present disclosure provides splice-switching oligonucleotides (SSOs) as therapeutic candidates for amyotrophic lateral sclerosis (ALS). Full composition of exemplary splice-switching oligonucleotides (SSOs) are disclosed here. They were each validated to be highly efficacious in reducing the expression of a novel gene target GCN5L1 (also known as BLOC1S1 and BLOS1) (Ensembl ID: ENSG00000135441), which the present inventors proposed to play a role in inducing metabolic defects in motor neurons as one of the key hallmarks of ALS.

[0049] SSOs are single-stranded RNAs whose sugar moieties and backbone linkages are fully chemically modified, which bind sequences in nascent transcripts to effect steric blockage to specific RNA-BP (RNA binding proteins). In this context, they were designed to induce specific exon skipping that disrupts the codon reading frame and resulted in the generation of multiple premature termination codons in the mature transcripts, which are predisposed for degradation via the NMD pathway.

[0050] The present inventors’ therapeutic strategy is to reverse the metabolic defects that converged in both familial and sporadic ALS motor neurons to restore their viability. This is achieved through the selective and efficient GCN5L1 suppression by SSO-induced NMD of GCN5L1 transcripts. Therefore, besides addressing unmet clinical needs in ALS, the lead SSO does not require the causal gene and / or pathogenic mutations to be identified. This will be a gamechanger given that up to 90% of cohorts belongs to the sporadic form with unknown genetic causes. The diverse genetic heterogeneity is shown in Figure 1.

[0051] In one aspect, the present disclosure provides a splice-switching oligonucleotide (SSO) that binds to a site within exon 3 or exon 2 of a pre-mRNA transcript of a human GCN5L1 gene, wherein binding of the SSO to exon 3 of the pre-mRNA transcript induces the exclusion of exon 3 from a mature mRNA transcript of the GCN5L1 gene and wherein bindingof the SSO to exon 2 of the pre-mRNA transcript induces the exclusion of exon 2 from a mature mRNA transcript of the GCN5L1 gene.

[0052] In one embodiment, the SSO binds to a site located within a target region in exon 3, the target region having the sequence of SEQ ID NO: 2.

[0053] In one embodiment, the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 4, 6 and 21 to 34.

[0054] In one embodiment, the SSO binds to a site located within a target region in exon 2, the target region having the sequence of SEQ ID NO: 1.

[0055] In one embodiment, the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 3, 5 and 7 to 20.

[0056] In one embodiment, the SSO is between 15 and 23 nucleotides in length.

[0057] By “oligonucleotide”, it is meant to refer to any polynucleotide. A "polynucleotide" is an oligomer comprised of nucleotides. A polynucleotide may be comprised of DNA, RNA modified forms thereof, or a combination thereof. The term "nucleotide" or its plural as used herein is interchangeable with modified forms as discussed herein and otherwise known in the art. In certain instances, the art uses the term "nucleobase" which embraces naturally occurring nucleotides as well as modifications of nucleotides that can be polymerized. Thus, nucleotide or nucleobase means the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturally occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N6- methyladenine, 7-deazaxanthine, 7-deazaguanine, N4, N4-ethanocytosin, N', N'-ethano-2,6- diaminopurine, 5-methylcytosine (mC), 5-(C[3]- C6)-alkynyl-cytosine, 5-fluorouracil, 5- bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-tr- iazolopyridin, isocytosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al, U. S. Pat. No. 5,432,272. The term "nucleobase" also includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non-naturally occurring nucleobases include those disclosed in U. S. Pat. No. 3,687,808 (Merigan, et al), which is hereby incorporated by reference in its entirety. In various embodiments, polynucleotides also include one or more "nucleosidic bases" or "base units" which include compounds such as heterocyclic compounds that can serve like nucleobases, including certain "universal bases" that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Universal bases include 3-nitropyrrole, optionally substituted indoles (e.g., 5-nitroindole), and optionally substituted hypoxanthine. Other desirable universal bases include pyrrole, and diazole or triazole derivatives, including those universal bases known in the art.

[0058] Polynucleotides may also include modified nucleobases. A "modified base" is understood in the art to be one that can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and / or thymine) and / or can pair with a non-naturally occurring base. Exemplary modified bases are described in EP 1 072679 and WO 97 / 12896, the disclosures of which are incorporated herein by reference. Modified nucleobases include, without limitation, 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7- methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified bases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b] [1,4]benzoxazin-2(3H)- one), phenothiazine cytidine (1H-pyrimido[5,4-b] [1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b] [1,4]benzox- azin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H- pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified bases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleobases include those disclosed in U. S. Pat. No. 3,687,808. Certain of these bases are useful for increasing the binding affinity of the polynucleotide and include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2. deg. C and are, in certain embodiments, combined with 2'- O-methoxyethyl sugar modifications. See, U. S. Pat. Nos. 3,687,808, U. S. Pat. Nos. 4,845,205; 5,130,302; 5, 134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502, 177; 5,525,711 ; 5,552,540; 5,587,469; 5,594, 121, 5,596,091 ; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,750,692 and 5,681,941, the disclosures of which are incorporated herein by reference.

[0059] As used herein, the term “splice switching oligonucleotides” (SSOs) or “splice switching oligomers” is meant to include synthetic antisense nucleic acids that base-pair with a pre-mRNA and disrupt the splicing process by sterically blocking the RNA-RNA base-pairingor protein-RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA. The SSOs may also be known as “antisense nucleotides”, “steric blockers” or “steric hindrance antisense nucleotides" which can modulate splicing. SSOs may modulate splicing via steric blocking. In some embodiments, SSOs may be mixmers. The term “mixmer” includes an oligomer on which different types of chemical modifications are applied on its sugar moieties, or on its backbone linkages, or both. Examples of chemical modifications include phosphorothioate linkages, 2’-O-methyl RNA modifications, 2’-O-methoxyethyl RNA modifications and locked nucleic acid substitutions. The terms “phosphorothioate bond” and “phosphorothioate linkage” are used interchangeably. The chemical modifications may increase the efficacy, selectivity and stability while manifesting superior toxicity profile of SSOs.

[0060] The term “splicing” refers to an RNA processing mechanism in which a pre-mRNA is made into a mature mRNA. During splicing, introns are removed and exons are connected. Splicing is catalysed by the spliceosome complex. As used herein, the term “alternative splicing” is meant to include a process by which a gene can encode for multiple mRNA and protein products by differentially selecting which exons are to be included in a mature mRNA transcript. For example, alternative splicing can take the form of one or more skipped exons, variable position of intron splicing, or intron retention.

[0061] As used herein, the term “intron” refers to a segment of non-coding nucleic acid sequence that is transcribed and is present in the pre-mRNA but is excised by the splicing machinery and therefore not present in the mature mRNA transcript.

[0062] As used herein, the term “exon” refers to a segment of a nucleic acid sequence that is transcribed into mRNA and that is present in mature mRNA after splicing. The term “exon skipping” is meant to include the process by which an entire exon, or a portion thereof, is removed from a given pre-mRNA and is thereby excluded from being present in the mature mRNA. For example, the portion of the protein that is otherwise encoded by the skipped exon is not present in the expressed form of the protein.

[0063] In one embodiment, the target region has at least 95% sequence identity to SEQ ID NO: 1 or 2. In various embodiments, the target region may include a variant sequence of SEQ ID NO: 1 or 2. The target region may comprise, consist or consist substantially or essentially of a sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto.

[0064] As used herein, the term “splice site” is meant to include specific nucleic acid sequences that can be recognized by the splicing machinery as being suitable for excision and / or ligation with the corresponding splice site. The splice site defines the precise exon-intron boundary that allows the excision of introns present in pre-mRNA transcripts. As used herein, the term “5’ splice site” (also known as donor splice site) refers to a nucleic acid sequence surrounding the exon-intron boundary at the 5’ end of an intron that marks the start of the intron and its boundary with the preceding exon sequence. The term “3’ splice site” (also known as acceptor splice site) as used herein refers to a nucleic acid sequence surrounding the intron-exon boundary at the 3’ end of an intron that marks the end of the intron and its boundary with the following exon sequence.

[0065] As used herein, the term “pre-mRNA” or “precursor mRNA” refers to a strand of messenger ribonucleic acid (mRNA), synthesized from a DNA template by transcription. Pre-mRNA is composed of exons, introns and untranslated sequences (before the first and after the last exons respectively). Generally, eukaryotic pre-mRNA exists only briefly before it is fully processed into mature mRNA.

[0066] The term “binding” as used in the context of an SSO is meant to include the hybridization of the SSO to a site within a target region on a pre-mRNA transcript. The term “hybridize” or “hybridization” may include the binding of a single-stranded nucleic acid or a locally single-stranded region of a double-stranded nucleic acid to another single-stranded nucleic acid or a locally single-stranded region of a double-stranded nucleic acid having a complementary sequence through the pairing of complementary nucleic acids. It is generally known to a person skilled in the art that binding or hybridization of one sequence to another does not require total complementarity of the sequences. For example, the sequence of the SSO may be fully complementary or partially complementary to the site to which it binds. For example, SSOs #2012 and #2232 bind with full complementarity to their respective binding sites on the human and mouse GCN5L1 pre-mRNA transcripts. However, it would be generally appreciated in the art that an SSO will be able to bind to its binding site even if the SSO is not fully complementary to the binding site, such as if there are 1 or 2 mismatches between the SSO and its binding site. For example, SSOs #1628 and #2188 are fully complementary to their respective binding sites on the human GCN5L1 pre-mRNA transcript but each have 1 mismatch to their respective binding sites on the mouse GCN5L1 pre-mRNA transcript, but yet are able to bind to their respective binding sites on both human and mouse pre-mRNA transcripts.

[0067] The term “site” refers to a location that the SSO is substantially or fully complementary to. The SSO may bind to this site. In the context of “a site within a target region in exon 3”, the site lies within the target region, and the target region lies within exon 3 which forms a part of the pre-mRNA transcript.

[0068] Advantageously, the SSOs of the present embodiments are able to bind to the respective binding sites on the target region competitively due to favourable binding thermodynamics and extent of co-transcriptional locally single-stranded binding site on the target region identified. Selection of the target region involves considering the presence of RNA-binding protein motifs on the target region. The SSOs of the present embodiments are able to induce the desired splicing modulation by competitive binding to target sites that encompass or overlap sequence motifs used by the appropriate RNA-binding protein(s), snRNPs (small nuclear ribonucleoproteins), or both. Advantageously, shortened SSOs reduce propensity of immune response and may have superior uptake kinetics by cells.

[0069] Advantageously, unlike other antisense oligonucleotides such as gapmers and siRNAs, SSOs do not require cellular machinery to effect its activity, and hence the ribose, backbones and bases in SSOs can be chemically modified entirely and to the largest class of chemistries.

[0070] In one embodiment, at least one of the nucleotides of the SSO as described herein is chemically modified and wherein the chemical modification is selected from the group consisting of 2’-O-methyl RNA modification, 2’-O-methoxyethyl RNA modification, locked nucleic acid substitution and phosphorothioate linkage. The term “locked nucleic acid” (LNA) generally refers to a modified RNA nucleotide where the ribose ring is “locked” with a methylene bridge connecting the 2 -0 atom with the 4'-C atom.

[0071] Modified polynucleotides are contemplated for use wherein both one or more sugar and / or one or more internucleotide linkage of the nucleotide units in the polynucleotide is replaced with “non-naturally occurring” sugars (i.e., sugars other than ribose or deoxyribose) or internucleotide linkages, respectively. In one embodiment, this embodiment contemplates a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of a polynucleotide is replaced with an amide-containing (e.g., peptide bonds between N-(2-aminoethyl)-glycine units) backbone. See, for example U. S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the disclosures of which are herein incorporated by reference. Modified polynucleotides may also contain one or more substituted sugar groups. In one embodiment, a modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2’- hydroxyl group is linked to the 3’ or 4’ carbon atom of the sugar ring, thereby forming a bicyclic sugar group. The linkage is in certain embodiments a methylene (- CHpj- )[nj group bridging the 2’ oxygen atom and the 4’ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98 / 39352 and WO 99 / 14226, the disclosures of which are incorporated herein by reference. In the present invention, preferably, the antisense oligonucleotide comprises a modified polynucleotide backbone. The modified polynucleotide backbone may comprise a modifiedmoiety substituted for the sugar of at least one of the polynucleotides. The modified moiety may be selected from the group comprising of phosphorodiamidate morpholino oligomer (PMO), peptide-conjugated phosphorodiamidate morpholino oligomer (PPMO), and nonpeptide dendrimeric octaguanidine moiety-tagged morpholino oligomer.

[0072] In various embodiments, the modified polynucleotide backbone comprises at least one modified internucleotide linkage. The modified internucleotide linkage comprises a modified phosphate. More preferably, the modified phosphate is any one selected from the group comprising of a non-bridging oxygen atom substituting a sulfur atom, a phosphonate, a phosphorothioate, a phosphodiester, a phosphoromorpholidate, a phosphoropiperazidate and a phosphoroamidate.

[0073] In various embodiments of the invention, the SSO comprises a backbone selected from the group comprising of ribonucleic acid, deoxyribonucleic acid, DNA phosphorothioate, RNA phosphorothioate, 2’-O-methyl-oligoribonucleotide and 2’-O-methyl-oligodeoxyribonucleotide, 2’-O-hydrocarbyl ribonucleic acid, 2'-O-hydrocarbyl DNA, 2’-O-hydrocarbyl RNA phosphorothioate, 2’-O-hydrocarbyl DNA phosphorothioate, 2’-F-phosphorothioate, 2’-F-phosphodiester, 2’-methoxyethyl phosphorothioate, 2-methoxyethyl phosphodiester, deoxy methylene(methylamino) (deoxy MMI), 2’-O-hydrocarby MMI, deoxy-methylphos-phonate, 2’-O-hydrocarbyl methylphosphonate, morpholino, 4’-thio DNA, 4’-thio RNA, peptide nucleic acid, 3’-amidate, deoxy 3’-amidate, 2’-O- hydrocarbyl 3’-amidate, locked nucleic acid, cyclohexane nucleic acid, tricycle-DNA, 2’-fluoro-arabino nucleic acid, N3’-P5’ phosphoroamidate, carbamate linked, phosphotriester linked, a nylon backbone modification and mixtures of the aforementioned backbones.

[0074] In various embodiments, the oligonucleotide is chemically linked to one or more conjugates that enhance the activity, cellular distribution, or cellular uptake of the SSO.

[0075] In one embodiment, the SSO comprises phosphorothioate linkages between all nucleotides of the SSO.

[0076] In one embodiment, each nucleotide of the SSO comprises either a 2’-O-methyl RNA modification, a 2’-O-methoxyethyl RNA modification or a locked nucleic acid substitution.

[0077] In another aspect of the invention, there is provided the SSOs of this invention for use in medicine or in treating ALS. As used herein, the term “treat” or “treating” in the context of treating a disease such as ALS is meant to include improving clinical outcomes of patients having the disease. This includes improving the survival rates of patients having the disease. The term “treat” or “treatment” may refer to prophylactic and / or therapeutic treatment.

[0078] In one aspect, there is provided a use of an SSO as described herein the manufacture of a medicament for treating ALS. In another aspect, there is provided a methodof treating ALS comprising administering to a subject a composition comprising an SSO as described herein. These SSOs may be used in compositions that can be used for treatment, e.g. as a pharmaceutical composition comprising the SSO of the invention and a pharmaceutically acceptable carrier.

[0079] In one aspect of the present invention, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents.

[0080] The composition is suitable for parenteral administration either naked or complexed with a delivery agent to a patient. The carrier is selected from the group consisting of a nanoparticle, such as a polymeric nanoparticle; a liposome, such as pH-sensitive liposome, an antibody conjugated liposome; a viral vector, a cationic lipid, a polymer, a UsnRNA, such as U7 snRNA and a cell penetrating peptide. The SSO is administered orally, or rectal, or transmucosal, or intestinal, or intramuscular, or subcutaneous, or intramedullary, or intrathecal, or direct intraventricular, or intravenous, or intravitreal, or intraperitoneal, or intranasal, or intraocular.

[0081] A pharmaceutically acceptable carrier refers, generally, to materials that are suitable for administration to a subject wherein the carrier is not biologically harmful, or otherwise, causes undesirable effects. Such carriers are typically inert ingredients of a medicament. Typically a carrier is administered to a subject along with an active ingredient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of a pharmaceutical composition in which it is contained. Suitable pharmaceutical carriers are described in Martin, Remington’s Pharmaceutical Sciences, 18thEd., Mack Publishing Co., Easton, Pa., (1990), incorporated by reference herein in its entirety.

[0082] In a more specific form of the disclosure there are provided pharmaceutical compositions comprising therapeutically effective amounts of an SSO together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and / or carriers. Such compositions include diluents of various buffer content (e.g., phosphate, Tris-HCI, acetate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as, for example and without limitation, polylactic acid or polyglycolic acid, or into liposomes. Hylauronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the disclosedcompositions. The compositions may be prepared in liquid form, or may be in dried powder, such as lyophilized form.

[0083] It will be appreciated that pharmaceutical compositions provided according to the disclosure may be administered by any means known in the art. Preferably, the pharmaceutical compositions for administration are administered by injection, orally, or by the pulmonary, or nasal route. The antisense polynucleotides are, in various embodiments, delivered by intrathecal or intracerebroventricular injection routes of administration.

[0084] The oligonucleotides of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such pro-drugs, and other bioequivalents.

[0085] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0086] For polynucleotides, preferred examples of pharmaceutically acceptable salts include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. The pharmaceutical compositions of the disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including rectal delivery), pulmonary, e.g., by inhalation of powders or aerosols, (including by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.

[0087] The pharmaceutical formulations of the disclosure, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0088] Combination therapy with an additional therapeutic agent may also be contemplated by the disclosure. The term “combination” or “combination therapy” as used throughout the specification, is meant to encompass the administration of the referred therapeutic agents to a subject suffering from a disease, disorder or pathological condition, in the same or separate pharmaceutical formulations, and at the same time or at different times. If the therapeutic agents are administered at different times they should be administered sufficiently close in time to provide for the potentiating or synergistic response to occur. In such instances, it is contemplated that one would typically administer both therapeutic agents within about 12-24 hours of each other and, more preferably, within about 6-12 hours of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations. In other situations, it might be desirable to reduce the time between administration, administering both therapeutic agents within seconds or minutes to hours, preferably within about 6 hours from each other, more preferably within about 1 or 3 hours.

[0089] The term "therapeutically effective amount" refers to the amount of the SSO that is required to confer the intended therapeutic effect in the subject, which amount will vary depending on the route of administration, status of disease, age, gender, body weight, and possible inclusion of other therapeutics or excipients. The method and uses of the invention are for a patient in need thereof. The compositions and methods of this invention are for a subject or patient in need thereof. The term “patient in need thereof” refers to a person who has or is suspected of having or developing ALS, as well as a person who is predisposed to but yet to develop ALS.

[0090] To practice the methods of this invention, the SSO may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. The term “parenteral” as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. A sterileinjectable composition, e g., a sterile injectable aqueous or oleaginous suspension, can be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as Tween 80) and suspending agents. The sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluents or solvent for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are mannitol, water, Ringer's Solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium (eg. Synthetic mono-or dyglycerides). Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions can also contain a long-chain alcohol diluents or dispersant, or carboxymethyl cellulose or similar dispersing agents. Other commonly used surfactants such as Tweens or Spans or other similar emulsifying agents or bioavailablity enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms can also be used for the purposes of formulation.

[0091] A composition for oral administration can be any orally acceptable dosage form including, but not limited to, capsules, tablets, emulsions and aqueous suspensions, dispersions and solutions. In the case of tablets for oral use, carriers that are commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions or emulsions are administered orally, the active ingredient can be suspended or dissolved in an oily phase combined with emulsifying or suspending agents. If desired, certain sweetening, flavouring, or colouring agents can be added. A nasal aerosol or inhalation composition can be prepared according to techniques well known in the art of pharmaceutical formulation. A SSO-containing composition can also be administered in the form of suppositories for rectal administration. The carrier in the pharmaceutical composition must be “acceptable” in the sense of being compatible with the active ingredient of the formulation (and preferable, capable of stabilising it) and not deleterious to the subject to be treated. For example, one or more solubilising agents, which form more soluble complexes with the SSOs, or more solubilising agents, can be utilised as pharmaceutical carriers for delivery of the active compounds. Examples of other carriers include colloidal silicon dioxide, magnesium stearate, sodium lauryl sulphate, and D& C Yellow #10.

[0092] In another aspect, there is provided a method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within exon 3 or exon 2 of a pre-mRNA transcript of a human GCN5L1 gene, wherein the binding of the SSO to exon 3 of the pre-mRNA transcript induces the exclusion of exon 3 from a mature mRNA transcript of the GCN5L1 gene and wherein binding of the SSO to exon 2 of the pre-mRNA transcript induces the exclusion of exon 2 from a mature mRNA transcript of the GCN5L1 gene.

[0093] In one embodiment, the method as described herein comprises providing an SSO that binds to a site located within a target region in exon 3, the target region having the sequence of SEQ ID NO: 2.

[0094] In one embodiment, the method as described herein comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 4, 6 and 21 to 34.

[0095] In one embodiment, the method as described herein comprises providing an SSO that binds to a site located within a target region in exon 2, the target region having the sequence of SEQ ID NO: 1.

[0096] In one embodiment, the method as described herein comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 3, 5 and 7 to 20.

[0097] In one embodiment, the method as described herein comprises providing an SSO that is between 15 and 23 nucleotides in length.

[0098] In one embodiment, the method as described herein comprises providing an SSO with at least one of the nucleotides of the SSO being chemically modified and wherein the chemical modification is selected from the group consisting of 2’-O-methyl RNA modification, 2’-O-methoxyethyl RNA modification, locked nucleic acid substitution and phosphorothioate linkage.

[0099] In one embodiment, the method as described herein comprises providing an SSO having phosphorothioate linkages between all nucleotides of the SSO.

[0100] In one embodiment, the method as described herein comprises providing an SSO with each nucleotide having either a 2’-O-methyl RNA modification, a 2’-O-methoxyethyl RNA modification or a locked nucleic acid substitution.

[0101] The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.

[0102] Any document referred to herein is hereby incorporated by reference in its entirety.

[0103] The invention is described in greater detail below.

[0104] MATERIALS AND METHODS

[0105] Spinal organoids were differentiated from iPSCs using the protocol shown in Figure 2C. Organoids derived from BJ-iPS (healthy) line were transfected with either 25 nM NC2 nontargeting SSO or 1628 SSO against BLOC1S1. Control motor neurons were untreated (UNT) or treated with Lipofectamine RNAiMax only (Lipo only). mRNA levels of BLOC1S1 were measured by qPCR using specific primers against BLOC1S1, and normalized to ACTINB houskeeping gene. The primers used are BLOC1S1 -forward: 5’-TTGGGGATGTGGAGAACTGG (SEQ ID NO: 35); BLOC1S1 -reverse: 5’-GTAGGAGGGATAGGGTTGGG (SEQ ID NO: 36); ACTB-forward: 5’-CCAACCGCGAGAAGATGA (SEQ ID NO: 37); ACTB-reverse: 5’-CCAGAGGCGTACAGGGATAG (SEQ ID NO: 38).

[0106] Motor neurons were differentiated from iPSCs using the protocol shown in Figure 3A.

[0107] Experimental details of SSO treatment with IPSC-derived motor neurons (Figure 3B). Briefly, cells were seeded at 100,000 cells per well of a 96-well plate at day 27, then treated with 25 nM respective SSO one day later (at day 28). After 24 hours of SSO incubation, cell culture media is refreshed. Cell lysates were harvested for RNA or protein analyses 72 hours post SSO transfection.

[0108] For Figure 3C, the sporadic ALS cell line (sALS 1) was differentiated into motor neurons, and treated with control SSO (NC2), 1628 SSO, Lipo only or untreated. Western blot analysis using a specific antibody against BLOC1S1 (Proteintech 19687-1-AP) and alpha tubulin (loading control) was performed, and this was quantified by means of FIJI image analysis.

[0109] For Figure 4A, familial ALS motor neurons harboring mutations in SOD1 (29d line) and TDP43 (47a line) were similarly exposed to the following treatment conditions from day 28-31: untreated, Lipo only, 25 nM SSO NC2 or 25 nM SSO 1628. Motor neuron survival was measured at the end of the treatment, normalized to the baseline motor neuron count at day 28. Motor neurons were identified by ISL1 nuclear expression, as well as SMI-32 neurite staining, and representative images of each condition were shown.

[0110] For Figure 4B, sporadic ALS motor neurons (sALS1 and CS3EPRIALS) were similarly exposed to the following treatment conditions from day 28-31: untreated, Lipo only, 25 nM SSO NC2 or 25 nM SSO 1628. Motor neuron survival was measured at the end of the treatment, normalized to the baseline motor neuron count at day 28. Motor neurons were identified by ISL1 nuclear expression, as well as SMI-32 neurite staining, and representative images of each condition were shown.

[0111] For Figure 6A, BJ-iPS (control), BJ-SOD1L144F(SOD1L144F) and sALS1 (Sporadic ALS) motor neurons were exposed to the following treatment conditions from day 28-31: untreated, Lipo only, 25 nM NC2 SSO, 25 nM 2232.401 SSO, 25 nM control Gapmer and 25 nM Tofersen. Motor neuron survival was measured at the end of the treatment, by counting number of ISL1+ cells, and normalized to the baseline motor neuron count at day 28.

[0112] For Figure 6B, BJ-iPS (control), BJ-SOD1L144F(SOD1L144F) and sALS1 (Sporadic ALS) motor neurons were exposed to the following treatment conditions from day 28-31: untreated, Lipo only, 25 nM NC2 SSO, 25 nM 2232.401 SSO, 25 nM control Gapmer and 25 nM Tofersen. mRNA levels of BLOC1S1 were measured by qPCR using specific primers against BLOC1S1, and normalized to ACTINB houskeeping gene. The primers used are BLOC1S1 -forward-. 5’-TTGGGGATGTGGAGAACTGG (SEQ ID NO: 35); BLOC1S1-reverse: 5’-GTAGGAGGGATAGGGTTGGG (SEQ ID NO: 36); ACTB-forward'. 5’-CCAACCGCGAGAAGATGA (SEQ ID NO: 37); ACTB-reverse: 5’-CCAGAGGCGTACAGGGATAG (SEQ ID NO: 38).

[0113] Culture and differentiation of human iPSC lines

[0114] The following age-matched human iPSC lines were used: 18a (Ctrl #1), GM23720 (Ctrl #2), CS3RXPiCTR (Ctrl #3), CS14isALS-Tn16 (sALS #1), CS51isALS-Tn3 (sALS #2) and CS89isALS-Tn16 (sALS #3). Human iPSCs were cultured on dishes coated with Matrigel (Corning #356234), and maintained in iPS-Brew XF (Miltenyi Biotec). Routine passaging was performed every 6-7 days using ReLeSR (Stem Cell Technologies). Human iPSCs were differentiated towards spinal MNs by following a small molecule-based protocol that was previously established. Briefly, iPSCs were neuralized in N2B27 media containing 4.25 uM CHIR99021 and 0.5 p. M LDN-193189 from day 1 to day 10 (both from Miltenyi Biotec). 1 uM Retinoic acid (Sigma Aldrich) was introduced to the culture media from days 3 to 17. 1 LIM Purmorphamine (Miltenyi Biotec) was added from day 11 to day 17. To promote neuronal maturation, 10 ng / ml BDNF and 10 ng / ml GDNF (both from Miltenyi Biotec) were supplemented to the N2B27 media from day 18 to day 31. N2B27 media consisted of 47% DMEM / F12 media (Gibco), 48% Neuro media (Miltenyi Biotec), 1% L-GlutaMax (Gibco), 1% MEM Non-essential amino acids (Gibco), 1% N2 supplement and 2% NeuroBrew-21 (Miltenyi Biotec).

[0115] Human post-mortem brain tissues and mouse spinal cord tissues

[0116] De-identified, frozen motor cortex samples from 10 sporadic ALS patients and 4 non-neurological controls were obtained from the Target ALS Human Postmortem TissueCore. Brain tissues were further dissected and homogenized before reconstituting in RIPA buffer for gel electrophoresis and Western blot analysis.

[0117] TDP-43Q331Kmice were available from Jackson Laboratory (stock number 017933). Studies were carried out under protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the National University of Singapore and were in compliance with the Association for Assessment of Laboratory Animal Care (AAALAC) guidelines for animal use. TDP-43Q331Kmice were back crossed with C57BL / 6J mice for more than ten generations and maintained on a C57BL / 6J background. Animals were housed in ventilated cages with up to five animals in a specific pathogen-free environment, with ad libitum access to food and water, on a 12-hour light / dark cycle (lights on at 0700). Both female and male mice were included and allocated to the experimental groups according to age and genotype. For genotyping, genomic DNA was isolated from tail biopsies using salt extraction methods and subjected to routine PCR methods using the following primers: TDP-43 transgene: forward primer 5’-tctgcccacttggagctagt-3’ (SEQ ID NO: 46) and reverse primer 5’-aggggtcaaacgatcctctc-3’ (SEQ ID NO: 47). Spinal cords were harvested from animals at 16 months of age for Western blot analysis.

[0118] SOD1-G93A studies were approved by the University of Queensland Animal Ethics Committee and conducted in accordance with the Queensland Government Animal Care and Protection Act 2001 and the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes (2004). Transgenic male mice were sourced from the Jackson Laboratory (Bar Harbor, ME, USA; stock number 004435) and bred on a C57BL / 6J background. Animals were housed in ventilated cages with up to four animals in a specific pathogen-free environment on a 12-hour light / dark cycle (lights on at 0600). All animals had ad libitum access to food and water. Spinal cords from male wild-type and SOD1-G93A mice (n=4 per group) were collected ages that corresponded to pre-defined stages of disease progression (presymptomatic: 30-36 days, onset: 63-75 days, mid-stage: 110-130 days, and end stage: 150-175 days), frozen on dry ice, and stored at -80 °C for subsequent Western blot analysis.

[0119] O ver-expression of BLOC1S1

[0120] The full-length BLOC1S1 cDNA (OriGene RC224412) was cloned into pLVX-UbC-rtTA plasmid backbone (Addgene #127288 with Ngn2:2A: EGFP excised out). Lentiviral particles were made by transfection of the pLVX plasmid containing BLOC1S1 with packaging plasmids into 293T cells. Lentivirus were then concentrated, titrated and used to treat MN cultures in the presence of 8 |ig / ml polybrene. 6 hours after infection, fresh media was changed. 24 hours after infection, 0.5 pg / ml puromycin was added to eliminate uninfected cellsand 1 pg / ml doxycycline was simultaneously added to turn on BLOC1S1 expression. Cultures were then analyzed 72 hours post-infection.

[0121] Small-interfering RNA (siRNA)-mediated knockdown ofBLOC1S1

[0122] MN cultures at day 27 were dissociated with Accutase and seeded at 2 million cells per well in a 6-well plate. At day 28, non-targeting siRNA or BLOC1S1 siRNA (Dharmacon J-012580-09-0020) were individually complexed with Lipofectamine RNAiMax (ThermoFisher) following the manufacturer’s instructions and added to the MN cultures. For each well, 10 pmol of siRNAs and 8 pl of Lipofectamine RNAiMAX were used. Cells were harvested for RNA and protein analyses or metabolic flux analysis 3 days after siRNA transfection, at day 31.

[0123] Transfection of antisense oligonucleotides

[0124] MN cultures at day 27 were dissociated with Accutase and seeded at 125,000 cells per well of a 96-well plate. At day 28, control SSO or SSO targeting BLOC1S1 (SSO 1628 and SSO 1631) were individually complexed with Lipofectamine RNAiMax (ThermoFisher) following the manufacturer’s instructions and added to the MN cultures. For each well, up to 50 nM of SSOs and 0.5 pl of Lipofectamine RNAiMAX were used. Cells were harvested for RNA and protein analyses or metabolic flux analysis 3 days after siRNA transfection, at day 31.

[0125] RNA extraction and quantitative polymerase chain reaction (PCR)

[0126] Cells were harvested in TRIzol reagent (ThermoFisher) and chloroform following the manufacturer’s instructions, and the aqueous solution were transferred into Qiagen’s RNeasy Mini Kit for RNA extraction. Purified RNA was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (ThermoFisher). Quantitative PCR was performed using the QuantStudio 5 Real-Time PCR System using PowerUp SYBR Green Master Mix (all from Applied Biosystems). Gene expression levels were normalized to ACTB for human samples and Eef2 for mouse samples. Technical triplicates were performed for each of the three biological replicates. The following primers were used for qPCR. BLOC1S1 -forward: 5’-TTGGGGATGTGGAGAACTGG (SEQ ID NO: 35); BLOC1S1 -reverse: 5’-GTAGGAGGGATAGGGTTGGG (SEQ ID NO: 36); ACTB-forward: 5’-CCAACCGCGAGAAGATGA (SEQ ID NO: 37); ACTB-reverse: 5’-CCAGAGGCGTACAGGGATAG (SEQ ID NO: 38); mBIodsl-fonward: 5’- TCCCGCCTGCTCAAAGAAC (SEQ ID NO: 39); mBIodsl-reverse: 5’-TCTGGTTCATGTAGGCCTGG (SEQ ID NO: 40); mEef2-forward: 5’- CACTTACCATCCCCCGTCAC (SEQ ID NO: 41); mEef2-reverse: 5’- CTTTGGGGTCGCAGCTCTTA (SEQ ID NO: 42).

[0127] Western blot analyses

[0128] Protein lysates were resolved in 10% or 12% SDS-PAGE gels before transferring to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were blocked with 5% non-fat milk in TBST buffer (blocking buffer). Primary antibodies were diluted in blocking buffer and incubated with the membranes overnight at 4 °C. The list of primary antibodies and the dilutions are as follows: rabbit anti-BLOC1S1 (Proteintech 19687-1-AP, 1:500), rabbit anti-SOD2 / MnSOD K68ac(Abcam ab137037, 1:250), rabbit anti-SOD2 / MnSOD (Abeam ab13533, 1:500), mouse anti-beta actin (Cell Signaling Technology 3700S, 1:1000). Membranes were then washed thrice in TBST buffer. Secondary antibodies conjugated with horseradish peroxidase were diluted 1:5000 in blocking buffer and incubated with washed membranes for 90 minutes at room temperature. Blots were washed thrice before exposing to ECL Western Blotting Substrate (Pierce) for chemiluminescence imaging. Quantification of Western blot bands were performed using FIJI using a minimum of three biological controls.

[0129] Immunostaining of cultured cells and image acquisition

[0130] Cells were fixed in 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100 for 15 min, and blocked in buffer containing 5% FBS and 1% BSA for one hour at room temperature. Primary antibodies (rabbit anti-ISL1; Abeam ab109517 and mouse anti-SMI-32; Biolegend #801701) were diluted in blocking buffer and incubated overnight at 4 °C. Prior to addition of secondary antibodies, cells were washed thrice in PBS. The respective secondary antibodies were diluted 1:1500 in blocking buffer and incubated at room temperature, in the dark, for 90 min. DAPI was used at 0.1 pg / ml to counterstain cellular nuclei.

[0131] Microscopy images were acquired using the high content microscope Phenix (Perkin Elmer) using the x20 air objective. Image analyses, including cell counts and measurements, were performed using Columbus (Perkin Elmer).

[0132] Metabolic flux analyses

[0133] Mitochondrial Oxygen Consumption Rate (OCR) was measured using the Mito Stress Test Kit on the XFe96 Seahorse Biosciences Extracellular Flux Analyzer (both from Agilent Technologies). Briefly, 125,000 PSA-NCAM+neurons were seeded onto a Matrigel-coated Seahorse 96-well plate. Culture media was aspirated and changed with 175 pl fresh Seahorse DMEM basal medium and the OCR measurements were performed according to the manufacturer’s instructions. Biological triplicates were performed with at least 10 technical replicates each.

[0134] Intracerebroventricular administration of antisense oligonucleotides

[0135] SOD1-G93A mice at P56 and P84 were anesthesized by ketamine-xylazine, shaved and fixed onto a stereotaxic apparatus, after which the skin was sliced apart with a scapel blade and the brain was drilled. A Hamilton microlitre syringe was inserted slowly (0.3mm anterior / 1mm right / 3mm ventral) and 8 pl of NTC SSO, SSO 2232.401 or Tofersen, amounting to 300 pg, was administered at a rate of 75 nl_ per second. The Hamilton syringe was slowly removed over a period of 1.5 minutes. Afterwards, the skin was sutured together, and Buprenorphine and Enrofloxacin were injected subcutaneously. All animal experiments were performed as per the protocol (#211619) approved by the A*STAR Institutional Animal Care and Use Committee in accordance with the National Advisory Committee for Laboratory Animal Research (NACLAR) guidelines.

[0136] Immunohistological analysis of mice spinal cords

[0137] Mice spinal cords were harvested and fixed in 10% neutral-buffered formalin for at least 48 hours before storing in 70% ethanol for 24 hours. Tissue samples were processed at the Advanced Molecular Pathology Laboratory (A*STAR IMCB). Tissue sections were cut at a thickness of 5 pm. Immunohistochemistry staining was performed using a specific antibody against MnSOD-K68ac (Abeam ab13533) in a Leica Bond™ Automated Immunohistochemistry Staining System (Leica Microsystems GmbH, Germany). Deparaffinization was carried out manually, and antigen retrieval was performed with Target Retrieval Solution Citrate pH6 (Dako, S2369) using a pressure cooker. Endogenous peroxidase activity was blocked with 3% H2O2for 15 minutes. Non-specific binding was blocked with 10% goat serum for 30 minutes. Tissues were then incubated overnight at 4 °C with the MnSOD-K68ac antibody at 1:100 dilution, followed by secondary antibody conjugated with HRP. Liquid DAB-Chromogen detection (Bond™ Refine Detection Kit, Leica Microsystems) and Substrate Chromogen System (Dako, K3468) was applied for 5 minutes. Slides were then rehydrated and mounted with synthetic mounting media. Negative controls used Bond™ Antibody Diluent instead of the primary antibody. All images were acquired using Zeiss Axioscan 7.

[0138] Rotarod assessment of motor function in mice

[0139] Mice were trained on the rotarod three days before the test by placing them on a rod rotating at 2 rpm for a duration of 5 minutes. For motor assessment, mice were tested weekly by placing them on the rod at a speed increasing from 2 rpm to 40 rpm over a span of 180 seconds, followed by 40 rpm for an additional 60 seconds. Mice were assessed five times, after which the middle three values were recorded.

[0140] Fragment length analysis

[0141] RNA from ReN-VM or NSC34 cells that were treated with SSOs by CaCl2-enriched medium or transfection with Lipofectamine RNAiMAX were extracted and converted to cDNA as described in the Materials & Methods section. PCR was then performed on the cDNA using the following on-target primers - ftBLOCISf-FLA-forward: 5’-CTGTCCCGCCTCCTAAAAGA-3’ (SEQ ID NO: 43); human BLOC1S1-FLA-reverse: 5’-CCAGTTCTCCACATCCCCAA-3’ (SEQ ID NO: 44); mBIoc 1s 7-F LA-forward: 5’- TCCCGCCTGCTCAAAGAAC-3’ (SEQ ID NO: 39); mB / oc1s1-FLA-reverse: 5’- CTCCTAGCCCAGTTCTCCAC-3’ (SEQ ID NO: 45). PCR products were then resolved using agarose gel electrophoresis using the Bio-Rad Sub-Cell system or capillary electrophoresis using the Qsep100 fragment analyzer (BiOptic). Primers for amplifying off-targets are provided in Table 1.

[0142] To sequence the PCR products, bands on the agarose gel were excised and extracted using the QIAquick Gel Extraction Kit (QIAgen) and sent to Bio Basic Asia Pte Ltd for sequencing.

[0143] Table 1: Potential human and mouse off-target genes for SSO 2232.401, numbers of nucleotide mismatches and primers used to amplify off-targets for analyses in Figure 19.Table 1.

[0144] Toxicity analysis and immunohistochemistry

[0145] Whole blood was collected using K3-EDTA tubes (Sarstedt). For plasma extraction, a portion of the blood was centrifuged at 2000g for 10 minutes at 4°C and the supernatant transferred to a fresh tube. Clinical chemistry and hematology analysis were outsourced to the IMCB Advanced Molecular Pathology Lab (AMPL).

[0146] For histopathology and immunohistochemistry analysis, liver, spleen, kidney, brain and spinal cord were fixed for 24 hours in 10% neutral buffered formalin before being transferred to 70% ethanol and transferred to the IMCB AMPL for further processing, embedding into paraffin blocks, sectioning. Hematoxylin and eosin staining of liver, spleen, kidney, brain and spinal cord sections were performed for the histopathology analysis. For immunohistochemistry, heat-induced epitope retrieval was performed on spinal cord sections at pH9 using BOND Epitope Retrieval Solution (AR9640, Leica Biosystems) and stained with anti-MnSOD-K68ac antibody (1:150; ab137037, Abeam). Histopathology analysis was performed by Dr. Ravisankar Rajarethinam (IMCB AMPL).

[0147] EXAMPLES

[0148] Example 1: BLOC1S1 is overexpressed in ALS

[0149] The present inventors were motivated to exploit the metabolic defects that converges in ALS that is not biased towards a particular genetic mutation (Acta Neuropathol 2018;135:489). The present inventors found that the suppression of GCN5L1 in cell lines, patient iPSC-derived motor neurons, and 3D spinal organoids, derived from different familial and sporadic backgrounds, reversed metabolic defects and rescued the ALS phenotype, and restored motor neuron viability. GCN5L1 or BLOC1S1 plays a key role in the acetylation of mitochondrial proteins, which are hyper-acetylated in ALS motor neurons and is a hallmark of ALS. The present inventors characterized the BLOC1S1 protein levels in postmortem ALS motor cortex samples and observed that they were overexpressed as compared to healthy samples (Figure 1A). This was also corroborated in both isogenic and sporadic ALS patient lines (Figure 1B). The trend was also observed in both the brains and spinal cords of SOD1 mice, an ALS mouse model that carries a gain-of-function G93A mutation in the SOD1 gene (Figure 1D). Through spatial transcriptomics of ALS mice brain tissues and protein analyses of lumbar spinal cords at various ages each corresponding to a distinct progression stage at30 (pre-symptomatic), 70 (onset), 100 (symptomatic) and 120 (end-stage) days, it was observed that BLOC1S1 expression was significantly overexpressed at the end-stage that was up to 10-fold higher than in normal mice (Figure 1C).

[0150] Example 2: SSO lead identification

[0151] In the present disclosure, the inventors have identified two effective SSOs that respectively decreases the abundance of human and mouse BLOC1S1 transcripts (Figure 2). SSO 1628 was designed to skip exon 2 of the human transcript whereas SSO 2012 was designed to skip exon 3 of the mouse counterpart. Both SSOs were synthesized in two chemical versions, 2’OMe-PS and 2’MOE-PS, and transfected in human and mouse neuronal cell lines, RenVM (Figure 2A), and NSC34 and 661w (Figure 2B), at 50nM for 24 hours. SSO 1628 was also validated to decrease human BLOC1S1 transcripts in iPSC-derived BJ-iPS spinal organoids (Figure 2C), at 120 hours post transfection. Gene expression was normalized to ACTINB.

[0152] Example 3: Lead SSO rescues ALS motor neurons

[0153] Subsequent downstream functional analyses were performed on motor neurons (MNs) that were differentiated from patient-derived iPSCs (Figure 3A). iPSCs were neuralised with Chir99021 and LDN-193189. On day 3, retinoic acid is added to direct the neural progenitor cells (NPCs) towards the spinal fate. On day 10, NPCs were ventralised with purmorphamine for 7 days. On day 18, motor neuron progenitor cells (MNPs) were matured into motor neurons with supplementation of BDNF, GDNF and Ascorbic acid. For downstream experiments / assay, motor neuron cultures were treated with 1 day of AraC before reseeding. Upon transfected with SSO on day 28 post-differentiation, MNs’ viability and BLOC1S1 expression were determined at day 31 (Figure 3B). In MNs from a sporadic ALS case, sALS1, SSO 1628 was observed to reduce BLOC1S1 protein level by 40% (Figure 3C), by densitometric analyses of western blot bands. Notably, SSO 1628 prevents MN death from both sporadic and familial backgrounds (Figure 4), and there was no significant difference in MN survival between days 28 and 31 post-differentiation when treated with SSO 1628 (Figure 4). By contrast, MNs that were untreated or treated with control-SSO were observed to lose significant viability at day 31. MNs were quantified and normalized to number of MNs in respective cell lines at day 28; ****p< 0.0001, ns non-significant; one-way ANOVA, Tukey’s multiple comparisons post hoc test. Scale bars, 50 pm.

[0154] Example 4: Lead SSO optimization

[0155] The molecular weight of SSOs 1628 and 2012 were reduced by shortening their nucleobase sequences to SSOs 2188 and 2232, respectively. Every ribose was chemically modified with either LNA and 2’-OMe (2OML for short) or with LNA and 2’-MOE (2MOL forshort) at specific positions. The efficiency of each mixmer, by transfection (Figure 5A) or by calcium-enriched medium (CEM) mediated free uptake (Figure 5C), in reducing BLOC1S1 expression was validated and benchmarked against its parent SSO. SSOs 2232.401 (2OML) and 2232.402 (2OML) were identified as the top candidates based on their consistently high efficiency under both transfection and CEM conditions with no significant cellular toxicity (Figure 5B). Dose response curves for the two SSOs were determined over a range of concentrations and were found to be similar (Figure 5D). As expected, SSO 2232.401 (2OML) rescues the survival of MNs from both sporadic and familial ALS backgrounds (Figure 6A), but has no effect on wildtype MN when BLOC1S1 was downregulated (Figure 6B).

[0156] Finally, SSO 2232.401 (2OML) was benchmarked with Tofersen, the FDA-approved gapmer that degrades SOD1 but does not target BLOC1S1 (Figure 6B). Tofersen prevents MN death from mtSODI but not sporadic backgrounds (Figure 6A). Remarkably, SSO 2232.401 (2OML) rescues the survival of mtSODI MNs as well as Tofersen. SSO 2232.401 (2OML) is therefore advantageous over Tofersen for its wider indication for ALS.

[0157] Example 5: BLOC1S1 is over-expressed in multiple ALS models, including postmortem tissues

[0158] It has been established that mitochondrial hyper-acetylation is a molecular feature of familial and sporadic ALS MNs. Acetylation of mitochondrial proteins is a dynamic post-translational modification process that responds rapidly to metabolic cues and regulates mitochondrial respiration. Mitochondrial acetylation is largely controlled by SIRT3, an NAD+-dependent mitochondrial deacetylase, as well as BLOC1S1, a small protein that has been previously shown to promote mitochondrial protein acetylation. Also known as GCN5-like Protein 1 (GCN5L1), it expresses two isoforms: a smaller 15 kDa isoform that is found in the mitochondria, and a larger ~17 kDa isoform that is localized in the cytosol of limited tissues such as the liver and kidney.

[0159] The role of BLOC1S1 in neural tissues and healthy controls was investigated using MNs generated from patient-derived induced pluripotent stem cells (iPSCs). Briefly, iPSCs from three healthy donors (control #1, control #2 and control #3) and three sporadic ALS patients (sALS #1, sALS #2 and sALS #3) were differentiated towards spinal MNs (Figures 8A, B), which were harvested at day 28 for expression analyses by qPCR and Western blot respectively. Itwas found that BLOC1S1 protein levels were significantly increased in sporadic ALS MNs compared to control MNs (Figure 8C). Notably, the ~17-kDa longer BLOC1S1 isoform was barely detectable in human ALS MNs by Western blot, indicating a mitochondrial-specific increase of the 15 kDa isoform. Next, increased levels of MnSOD acetylated on lysine 68 (MnSOD-K68ac) were observed in all three sporadic ALS MN cultures (Figure 8D). This isconsistent with the present inventors’ previous observation that MnSOD-K68ac levels correlate with global mitochondrial protein acetylation, thereby reinforcing the findings that BLOC1S1 promotes mitochondrial protein acetylation.

[0160] To provide additional evidence that elevated BLOC1S1 levels are associated with ALS, spinal cord samples were collected from two distinct mice models of ALS: SOD1-G93A mice as well as TDP43-Q331K knock-in mice. Western blot analysis revealed significantly higher levels of Bloc1s1 in both SOD1-G93A and TDP43-Q331K spinal cords compared to control non-transgenic mice (Figures 8F, G), confirming that high Bloc1s1 expression is associated with ALS in mouse models of the disease.

[0161] Finally, to validate that elevated BLOC1S1 expression in ALS MNs and mice is a disease-relevant finding, human post-mortem motor cortex samples were similarly analyzed by Western blot, which confirmed more than 4-fold higher levels of BLOC1S1 in sporadic ALS patients compared with non-ALS controls (p = 0.013; Figure 8E). Brain regions that are not affected by ALS were also analysed, such as the occipital cortex. By contrast, occipital cortex samples from the same patients showed only a modest 0.5-fold increase in BLOC1S1 levels (p = 0.0453; Figure 13).

[0162] Example 6: BLOC1S1 overexpression results in motor neuron death

[0163] To evaluate the potential contribution of high BLOC1S1 levels to ALS pathogenesis, BLOC1S1 was over-expressed in human iPSC-derived motor neurons to study ALS-associated phenotypes. A doxycycline-inducible lentivirus harboring the full-length BLOC1S1 cDNA was used to induce BLOC1S1 expression in a temporal manner. Day 28 MN cultures from control #1, control #2 and control #3 were transduced with BLOC1S1 lentivirus and treated with 0.5 |ig / ml puromycin 24 hours later to remove uninfected cells. 1 pig / ml doxycycline was simultaneously added to induce BLOC1S1 overexpression (BLOC1S1-OE) in the infected neurons. Thereafter, cultures were harvested 72 hours post-infection for analysis (Figure 9A) and a 2.9-fold upregulation of the ~15 kDa BLOC1S1 isoform under doxycycline was confirmed by Western blot analysis (Figure 9B, Figure 14a). It was observed that BLOC1S1-OE in the healthy MNs led to elevated MnSOD-K68ac levels, normalized to total MnSOD protein (Figure 9B, Figure 14a). This suggests that BLOC1S1 overexpression contributes to the hallmark of mitochondrial hyper-acetylation that is reminiscent of the phenotype in ALS MNs.

[0164] Following BLOC1S1-OE lentivirus infection, MN survival was quantified for samples treated with doxycycline (+ Dox) versus DMSO control (- Dox). MN cultures treated with doxycycline from all three lines consistently showed poorer MN survival. MN survivaldecreased by 29.4% in Ctrl #1 (p = 0.0002), 52.1% in Ctrl #2 (p < 0.0001) and 40.9% in Ctrl #3 (p < 0.0001). (Figures 9C, D and Figure 14b). Thus, BLOC1S1 overexpression impairs MN survival and contributes to ALS pathology.

[0165] Example 7: BLOC1S1 depletion in ALS motor neurons reverses mitochondrial hyperacetylation and disease phenotypes

[0166] It was investigated if depletion of BLOC1S1 would alleviate ALS phenotypes by transfecting sporadic ALS MNs with small interfering RNAs (siRNAs) targeting human BLOC1S1 (BLOC1S1 siRNA) or a non-targeting control (control siRNA). Three days of BLOC1S1 siRNA treatment resulted in 58.3% knockdown of BLOC1S1 mRNA (Figure 10A), which corresponds to approximately 50% protein downregulation (Figure 10B). It was then investigated whether BLOC1S1 knockdown can rescue mitochondrial respiration, as BLOC1S1-mediated hyper-acetylation of mitochondrial proteins in ALS impairs respiratory complex assembly due to changes in electrostatic and steric hindrance effects, and that deacetylation of mitochondrial proteins could improve mitochondrial respiration. To evaluate this, Metabolic flux was measured over time using the Seahorse MitoStress test and it was found that ALS MNs treated with BLOC1S1 siRNA demonstrated improvements in basal respiration, ATP-linked respiration as well as spare respiratory capacity (Figure 10C; Figure 15). This was associated with the maintenance of MN viability at day 31, as assessed by enumerating ISL1+MNs against total cell count in the culture (Figures 10D, E). Taken together, knockdown of BLOC1S1 in ALS MNs ameliorates disease-associated phenotypes.

[0167] Example 8: BLOC1S1-tarqetinq splice-switching antisense oligonucleotide (SSO) alleviates cellular ALS phenotypes

[0168] BLOC1S1 depletion is a viable therapeutic strategy for ALS. This is supported by the present study’s corroborative results demonstrating that knockdown of BLOC1S1 can restore ALS MN metabolic function and survival (Figure 10) that was impaired due to hyperacetylation of mitochondrial proteins (Figure 9). Moreover, upregulated BLOC1S1 levels were observed in various ALS disease models (Figure 8). Motivated by the safety profile and efficacy of intrathecally administered Nusinersen for the treatment of Spinal Muscular Atrophy20’21, the use of SSOs as a therapeutic modality against BLOC1S1 was explored. It was previously demonstrated that SSOs can disrupt the reading frame of mature transcripts that predispose them to undergo nonsense-mediated decay. Accordingly, the SSOs were designed to induce the exclusion of BLOC1S1 exon 2 or 3 (Figure 11 A) and synthesized with full 2’-MOE ribose and phosphorothioate backbones (2OMePS). The abundance of BLOC1S1 transcripts were quantified at 24 hours after transfecting each SSO into sALS #3 iPSC-derived MN cultures (at day 28). The highest knockdown achieved 62.8% depletion of transcripts at25 nM concentration of SSO 1628 that targets exon 2, and also resulted in protein knockdown (Figure 11C). It was also confirmed that SSO 1628 mediates exon 2 splicing (Figure 16a).Similar knockdown efficiencies were also observed in both sALS #1 and control iPSC-derived MN cultures under a defined dose-response curve up to 50 nM at which cell cytotoxicity was observed (Figure 17a).

[0169] SSO 1628 was evaluated in rescuing survival and mitochondrial respiration of three sporadic MN lines, namely sALS #1, sALS #2 and sALS #3. Each MN culture at day 28 was similarly transfected with 25 nM of SSO 1628 or control SSO and then maintained to day 31. The inventors previously reported that ALS MNs lost significant viability from day 28 to day 31; for instance, day 31 sALS #1 MNs were approximately 45% less viable compared to day 28 cultures. Notably, after treatment with SSO 1628, sALS #1 MNs maintained their viability to day 31 (Figure 11D). The rescue in MN survival by SSO 1628 was also observed for sALS #2 and sALS #3 (Figure 11D, Figure 17b). To evaluate mitochondrial respiration in the day 31 ALS MNs after treatment with 25 nM SSO at day 28, Seahorse MitoStress assay was performed. As expected, SSO 1628 treatment led to significantly higher basal respiration, ATP production and maximal respiratory capacity (Figures 11 E, F). The results thus validated SSO 1628 as an effective therapeutic candidate for ALS.

[0170] Example 9: BLOC1S1 SSO extends disease-free survival in SOD1 mice

[0171] As the target sequence of SSO 1628 is not fully complementary to mouse Blodsl sequence, and demonstrated weak splice modulating activity against Blodsl (Figure 16b), the process was iterated to design a mouse-specific SSO for mice studies. We identified SSO 2232, which induces exon 3 skipping and whose target sequence is incidentally conserved in human, as an effective candidate in a mouse cell line. We next performed Chemical optimization was next performed on SSO 2232 by substituting ribose at specific lateral positions with locked nucleic acids (LNA) to augment SSO on-target potency when used in combination with either 2’-O-methyl (2’OMe) or 2’-O-methoxyethyl (2’-MOE) modifications for the remaining ribose. Seven permutations each in 2’-OMe+LNA (2OML) and 2’-MOE+LNA (2MOL) mixmers were synthesized and their efficiency in skipping exon 3 were evaluated in human neural cells under a CaCL-enriched medium that mimics free uptake conditions in vivo (without transfection). All 2OML mixmers were found to be more efficient than the 2 MOL counterparts. 2232.401_2OML and 2232.402_2OML are best performers with similar dose response curves, which outperform not only the parent SSO 2232 but also SSO 1628 (Figure 18a, b). Both 2232.401_2OML and 2232.402_2OML have four LNAs with.401 placed at each flank equally whereas.402 carries three 5’LNAs and one at 3’. SSO 2232.401 was selected as the lead candidate for its ability to achieve the highest exon 3 skipping (Figure 16, 18b).Expectedly, it rescued survival of day 31 MNs derived from sALS #2 and a familial ALS line with SOD1-L144F mutation, while having no effects on control MNs (Figure 18c-e). Notably, the extent of rescue of SOD1-L144F MNs by SSO2232.401 is equivalent to Tofersen, which targets SOD1 and thus did not rescue the viability of sALS #2 MNs.

[0172] The on-target efficiency of SSO 2232.401 was first evaluated in wild-type mice by administering a dose of 300 jig or non-targeting control (NTC) was administered via intracerebroventricular (ICV) injections. Lumbar spinal cords were harvested 42 days later for qPCR and Western blot analysis, which revealed significant downregulation of Bloc1s1 mRNA and protein by 32.9% and 54.4% respectively (Figures 12A, B). Body weights of mice were measured throughout the 42 days, which revealed no significant changes between mice treated with SSO 2232.401 and NTC (Figure 12C). The SOD1-G93A genotype background was chosen as the ALS disease model for two reasons. Firstly, the disease pathology and progression in the SOD1-G93A mice are well-characterized. Secondly, Bloc1s1 levels were elevated as disease progressed (Figure 8F), suggesting that Bloc1s1 is a relevant target in this model. Two ICV injections of SSO 2232.401 or NTC were administered on day 56 and day 98 at 300 pig per dose. To determine if acetylation levels of mitochondrial proteins were reduced in mice treated with SSO 2232.401, a small number of mice were sacrificed at day 112 for immunohistochemistry analysis of MnSOD-K68ac, and observed diminished levels of MnSOD-K68ac within the ventral horn neurons in mice treated with SSO 2232.401 (Figure 12D). The remaining mice were monitored weekly for survival and rotarod performance until the endpoint at day 176. Compared to NTC, mice treated with SSO 2232.401 demonstrated a slight but significant increase in survival and disease-free survival (hazard ratios = 0.49 and 0.50; p - 0.040 and 0.018 respectively) (Figures 12E, F). In a similar trend, mice treated with SSO 2232.401 also display a significant increase in rotarod performance (hazard ratio = 0.56; p - 0.036) (Figure 12G). Taken together, in vivo data suggests that depletion of Bloc1s1 by SSO 2232.401 promotes survival and motor function in SOD1-G93A mice.

[0173] Next, to examine plausible off-target effects for SSO 2232.401, genes were identified that (i) have at least 15 (out of 20 possible) matches to the SSO, (ii) are antisense to the off-target coding sequence and (iii) expressed in the brain (Figure 19). This resulted in a list of 4 mouse genes, namely Plxndl, Clstn3, Taf6l and Rps6ka5, of which SSO 2232.401 was found to have negligible splice switching activity against Taf6l (Figure 19d). EC50 values for Plxndl, Clstn3 and Rps6ka5 were experimentally determined and found to be at least 2.4-fold higher than EC50value for Bloc1s1 (Figure 19e). To evaluate plausible toxicity, 300 jig of SSO 2232.401 was administered subcutaneously. Histopathology, clinical chemistry andhematology analyses revealed no significant changes between treated and control groups (Figure 20), supporting the lack of toxicity or immunogenicity of the SSO.

[0174] Example 10: Discussion

[0175] ALS is a highly complex and heterogeneous disease, characterized by MN loss, progressive paralysis, and ultimately death. Particularly in sporadic cases which constitute the majority of patients, insufficient understanding of ALS pathophysiology critically limits the development of effective therapies, and it presents a pressing need for an alternative therapeutic strategy that is invariant to the diverse background.

[0176] In this study, it was established that BLOC1S1 is a novel target for diverse forms of ALS. Specifically, BLOC1S1 abundance was reported to be elevated in ALS transgenic mice, as well as post-mortem brain tissues and iPSC-derived MN cultures from sporadic ALS patients (Figure 8), and it was established that BLOC1S1 overexpression in healthy MNs results in hyper-acetylation of mitochondrial proteins and MN death (Figure 9), therefore indicating that high BLOC1S1 levels in ALS contribute directly to MN dysfunction and death. Meanwhile, BLOC1S1 depletion reduces mitochondrial protein acetylation and promotes survival and improves mitochondrial respiration in ALS MNs, which we demonstrated with BLOC1S1-targeting siRNA (Figure 10) and SSO (Figure 11).

[0177] BLOC1S1 therapeutic value was validated in the SOD1-G93A ALS mouse model. The model was chosen for our proof-of-principle study because of the well-characterized disease pathology and progression as well as the elevation of Bloc1s1 levels as disease progressed (Figure 8F). It was observed that the chemically optimized lead candidate SSO 2232.401 is able to extend both disease-free and overall survival significantly, and is associated with improved rotarod performance compared to the non-targeting SSO (Figure 12). Notably, as its target sequence is fully complementary to both human and mouse, it can greatly facilitate future studies on other ALS mouse models mimicking various forms of ALS.

[0178] In conclusion, the findings support BLOC1S1 as a novel therapeutic target for ALS that can be efficiently modulated with the SSO candidate of the present embodiments. This is crucial given the small percentage of ALS patients who are suitable for Tofersen and with the recent failure of C9ORF72 antisense oligonucleotide in clinical trials.

[0179] Example 11: List of SSO names, SEQ ID NOs and compositions

[0180] Table 2: Sequences of exemplary SSOsTable 2

[0181] The sequence of SSO#2188 is a subset of SSO#1628. The sequence of SSO#2232 overlaps with that of SSO#2012. SSO#2012, SSO#2232 and SSOs#2232.101 - 2232.402 can target exon 3 of both the human and mouse GCN5L1 pre-mRNA transcripts and can cause skipping of exon 3 of both the human and mouse transcripts.

[0182] Nucleotides with a 2’-O-Methyl RNA (2’OMe) are indicated with Nucleotides with a 2’-O-methoxyethyl (2’MOE) RNA are indicated with “ / MOEr / ”. 2’MOE-modified thymidine is used in place of 2JMOE-modified uridine. Nucleotides with a locked nucleic acid (LNA) are indicated withLNA-modified thymidine is used in place of LNA-modified uridine. Nucleotides joined by a phosphorothioate (PS) bond to the following nucleotide are indicated with “A”. It would be generally known to the person skilled in the art that the number of phosphorothioate bonds is one less than the number of bases. “2OM“ indicates that the SSO is modified with 2’-O-methyl RNA. “2MOE” indicates that the SSO is modified with 2’-O- methoxyethyl RNA. “2OML1’ indicates that the SSO includes 2 -O-rnethyl RNA and locked nucleic acid modifications. “2MOL” indicates that the SSO includes 2>-O-methoxyefhyl RNA and locked nucleic acid modifications,

[0183] SSO#1628 (SEQ ID NO: 3) and SSO#2188 (SEQ ID NO: 5) bind to exon 2 and cause the skipping of exon 2. The binding sites of SSO#1628 and SSO#2188 lie within a target region in exon 2 on the human pre-mRNA transcript, the target region having the sequence of SEQ ID NO:1 (aaaagaggaggcgagaggcuaucacugcagcgaccugccugacagaagcuuugguggaucaccucaauguggg).

[0184] SSQ#2012 (SEQ ID NO: 4) and SSO#2232 (SEQ ID NO: 6) bind to exon 3 and cause the skipping of exon 3. The binding sites of SSQ#2012 and SSO#2232 lie within a target region in exon 3 on the human pre-mRNA transcript, the target region having the sequence of SEQ ID NO: 2 (uguggcccaggccuacaugaaccagagaaagcuggaccaugaggugaagacccuacagguccaggcugcccaauu ugccaagcagacaggccaguggaucggaaugguggagaacuucaaccaggcacucaag).SSO#2188 (SEQ ID NO: 5) has the same target sequence (i.e. binding site within exon 2) as SSOs#2188.1 - 2188.402 (SEQ ID NOs 7-20). SSO#2232 (SEQ ID NO: 6) has the same target sequence (i.e. binding site within exon 3) as SSOs#2232.101 -2232.402 (SEQ ID NOs 21-34).

[0185] While embodiments of the invention have been particularly shown and described with reference to specific embodiments, it should be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims. The scope of the invention is thus indicated by the appended claims and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced.

Claims

CLAIMS1. A splice-switching oligonucleotide (SSO) that binds to a site within exon 3 or exon 2 of a pre-mRNA transcript of a human GCN5L1 gene, wherein binding of the SSO to exon 3 of the pre-mRNA transcript induces the exclusion of exon 3 from a mature mRNA transcript of the GCN5L1 gene and wherein binding of the SSO to exon 2 of the pre- mRNA transcript induces the exclusion of exon 2 from a mature mRNA transcript of the GCN5L1 gene.

2. The SSO according to claim 1, wherein the SSO binds to a site located within a target region in exon 3, the target region having the sequence of SEQ ID NO: 2.

3. The SSO according to claim 2, wherein the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 4, 6 and 21 to 34.

4. The SSO according to claim 1, wherein the SSO binds to a site located within a target region in exon 2, the target region having the sequence of SEQ ID NO: 1.

5. The SSO according to claim 4, wherein the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 3, 5 and 7 to 20.

6. The SSO according to any one of claims 1 to 5, wherein the SSO is between 15 and 23 nucleotides in length.

7. The SSO according to any one of claims 1, 2, 4 and 6, wherein at least one of the nucleotides of the SSO is chemically modified and wherein the chemical modification is selected from the group consisting of 2’-O-methyl RNA modification, 2'-O- methoxyethyl RNA modification, locked nucleic acid substitution and phosphorothioate linkage.

8. The SSO according to claim 7, wherein the SSO comprises phosphorothioate linkages between all nucleotides of the SSO.

9. The SSO according to claim 7 or 8, wherein each nucleotide of the SSO comprises either a 2’-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification or a locked nucleic acid substitution.

10. An SSO of any one of claims 1 to 9 for use in treating amyotrophic lateral sclerosis (ALS).

11. Use of an SSO of any one of claims 1 to 9 in the manufacture of a medicament for treating ALS.

12. A method of treating ALS comprising administering to a subject a composition comprising an SSO according to any one of claims 1 to 9.

13. A pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO according to any one of claims 1 to 9 and (b) one or more pharmaceutically acceptable carriers and / or diluents.

14. A method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within exon 3 or exon 2 of a pre-mRNA transcript of a human GCN5L1 gene, wherein the binding of the SSO to exon 3 of the pre-mRNA transcript induces the exclusion of exon 3 from a mature mRNA transcript of the GCN5L1 gene and wherein the binding of the SSO to exon 2 of the pre-mRNA transcript induces the exclusion of exon 2 from a mature mRNA transcript of the GCN5L1 gene.

15. The method according to claim 14, comprising providing an SSO that binds to a site located within a target region in exon 3, the target region having the sequence of SEQ ID NO: 2.

16. The method according to claim 15, comprising providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 4, 6 and 21 to 34.

17. The method according to claim 14, comprising providing an SSO that binds to a site located within a target region in exon 2, the target region having the sequence of SEQ ID NO: 1.

18. The method according to claim 17, comprising providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 3, 5 and 7 to 20.

19. The method according to any one of claims 14 to 18, comprising providing an SSO that is between 15 and 23 nucleotides in length.

20. The method according to any one of claims 14, 15, 17 and 19, comprising providing an SSO with at least one of the nucleotides of the SSO being chemically modified and wherein the chemical modification is selected from the group consisting of 2’-O-methyl RNA modification, 2'-O-methoxyethyl RNA modification, locked nucleic acid substitution and phosphorothioate linkage.

21. The method according to claim 20, comprising providing an SSO comprising phosphorothioate linkages between all nucleotides of the SSO.

22. The method according to claim 20 or 21, comprising providing an SSO with each nucleotide having either a 2’-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification or a locked nucleic acid substitution.

Images