Composition and methods of treating a hemoglobinopathy

Abstract

Disclosed are compositions and methods for increasing fetal hemoglobin levels in a mammal and treating, preventing, reducing, or ameliorating a hemoglobinopathy such as sickle cell anemia or [3 -thalassemia in a subj ect which comprise the use of an inhibitor of a BCL11A enhancer RNA including antisense compounds that inhibit the expression of the BCL11A enhancer RNA.

Description

SJ0124WO PATENT COMPOSITION AND METHODS OF TREATING A HEMOGLOBINOPATHYREFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority from U. S. Provisional Application Serial Numbers 63 / 914, 507, filed November 10, 2025, and 63 / 788, 234, filed April 14, 2025, the contents of which are incorporated herein by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (name: SJ0124WO_ST26. xml; size: 79, 156 bytes; and date of creation: March 26, 2026) is herein incorporated by reference in its entirety.FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0003] This invention was made with government support under grant nos. DK111430, CA230631, and CA259581 awarded by the National Institutes of Health. The government has certain rights in this invention.BACKGROUND OF THE INVENTION

[0004] The developmental transition from human fetal hemoglobin (HbF, a2y2) to adult hemoglobin (HbA, «2p2), known as the f etal-to-adult hemoglobin switch, is genetically controlled during ontogeny. Elevated levels of γ-globin (HBG1 and HBG2) can ameliorate the severity of major p-hemoglobinopathies, including sickle cell disease (SCD) and p- thalassemia, which result from mutations or deletions in the adult p -globin (HBB) gene. Identifying molecular targets and developing broadly applicable strategies to reactivate HbF remains a longstanding goal in the treatment of these disorders.SJ0124WO PATENT

[0005] The transcription factor BCL11A is a genetically and clinically validated regulator of the fetal-to-adult hemoglobin switch in erythroid cells. Initially identified through genome-wide association studies, common genetic variants within an erythroid-specific enhancer of BCL11A are associated with elevated HbF levels in the general population. BCL11A directly represses the transcription of γ-globin genes in adult erythroid cells. Notably, inactivation of BCL11A alone is sufficient to reactivate HbF to therapeutic levels, effectively ameliorating disease phenotypes in humanized SCD mouse models (Xu et al. (2011) Science (New York, NY) 334:993-996). Subsequent studies reveal that CRISPR / Cas9-mediated genome editing using a single guide RNA (sgRNA) targeting the +58 enhancer of BCL11A, located 58kb downstream of its transcriptional start site (TSS), profoundly suppresses BCL11A expression (Bauer et al. (2013) Science (New York, NY) 342:253-257; Canver et al. (2015) Nature 527:192-197; Wu et al. (2019) Nature Med.25:776-783). This strategy has since been translated into clinical trials (Frangoul et al. (2021) New Engl. J. Med.384:252-260), achieving transformative clinical outcomes (Frangoul et al. (2024) New Engl. J. Med. 390:1649-1662; Locatelli et al. (2024) New Engl. J. Med. 390:1663-1676; Yen et al. (2024) New Engl. J. Med. 390:1723-1725) and culminating in the recent regulatory approval of CasgevyTM, the first CRISPR-based gene therapy, for treating patients with SCD and β-thalassemia.

[0006] Despite its therapeutic benefits in treating hemoglobinopathies, the precise mechanism by which CRISPR editing of the +58 enhancer with a single sgRNA effectively silences BCL11A remains poorly understood. Moreover, the high costs, limited availability, and potential clinical risks associated with current gene therapies make them inaccessibleSJ0124WO PATENT to most patients. Hence, the development of alternative, more affordable approaches to reactivate HbF levels is needed to alleviate the overall disease burden. The present invention addresses this need in the art.SUMMARY OF THE INVENTION

[0007] This invention provides a composition comprising at least one inhibitor of BCL11A enhancer RNA (eRNA), e.g., BCL11A +58 eRNA and / or BCL11A +55 eRNA.

[0008] Also provided is a method for increasing fetal hemoglobin levels in a mammal in need thereof comprising contacting a hematopoietic stem and / or progenitor cell in said mammal with an effective amount of a composition comprising at least one inhibitor of BCL11A enhancer RNA (eRNA), whereby fetal hemoglobin expression is increased in said mammal, relative to expression prior to said contacting.

[0009] Further provided is method of treating, preventing, reducing, or ameliorating a hemoglobinopathy in a subj ect, comprising administering to the subj ect an effective amount of at least one inhibitor of a BCL11A enhancer RNA (eRNA), thereby treating, preventing, reducing, or ameliorating a hemoglobinopathy in the subj ect.BRIEF DESCRIPTION OF THE DRAWINGS

[0010] FIGS. 1A-1C show BCL11A (FIG. 1A) and HBG (FIG. IB) mRNA expression levels, along with the percentage (%) of HBG (FIG. 1C), in wild-type (WT) and CRISPR-edited single-cell HUDEP-2 clones. Each dot represents an independent singlecell -derived clone. Data are presented as mean ± SD and analyzed by one-way ANOVA. ****P < 0. 0001, **P < 0.01, *P < 0. 05, NS, not signif icant.

[0011] FIGS. 2A-2C show BCL11A (FIG. 2A) and HBG (FIG. 2B) expression levels, along with the percentage (%) of HBG (FIG.SJ0124WO PATENT 2C) as determined by qRT-PCR analysis of CD34+HSPCs from healthy donors and SCD patients edited with Cas9-RNP targeting E+58 (sgl617) or a control locus (sgAAVS). Samples were collected at differentiation day 8. Results are shown as mean ± SD (N > 3 replicates) and analyzed by an unpaired t-test. *** *P < 0.0001, ***P < 0. 001, **P < 0. 01.

[0012] FIG. 3 is a model depicting the 3D chromatin organization of the BCL11A locus in wild-type (normal) and enhancer-edited erythroid cells. In normal erythroid cells, cis-regulatory elements and CTCF-binding sites within the BCL11A locus form clusters, termed BCL11A enhancer-CTCF rosettes, which facilitate multi -way chromatin looping, enhancer-promoter interactions, and epigenetic insulation to maintain high- level BCL11A expression. Following enhancer editing via CRISPR-Cas9, epigenetic insulation and enhancerpromoter interactions are disrupted, accompanied by the loss of chromatin looping, leading to the epigenetic silencing of BCL11A.

[0013] FIG. 4 shows BCL11A eRNA production is disrupted by CRISPR editing in primary erythroblasts. qRT-PCR analysis of E+58 eRNAs shows a significant reduction in eRNA expression is observed following enhancer disruption. Results are shown as mean ± SD (N > 3 replicates) and analyzed by one-way ANOVA or t-test. **P < 0. 01.

[0014] FIGS. 5A- 5D show BCL11A eRNAs are required for epigenetic insulation and high-level BCL11A expression. qRT-PCR analysis of HUDEP-2 cells transduced with control or E+58 eRNA- targeting ASOs (ASO12 and ASO23 ) was performed. ASO treatment resulted in a significant reduction in E+58 eRNA (FIG.5A) and BCL11A mRNA expression (FIG. 5B), accompanied by increased HBG expression (FIGS. 5C-5D). Results are shown as mean + SD (N h 3 replicates) and analyzed by one-way ANOVA. ** **P < 0.0001, ***P < 0. 001, **P < 0. 01, *P < 0.05).SJ0124WO PATENT

[0015] FIGS. 6A-6C show qRT-PCR analysis of HUDEP-2 cells transduced with control or single E+58 eRNA- targeting ASOs or E+55 eRNA- targeting ASOs. ASO treatment resulted in a reduction in BCL11A mRNA expression (FIG. 6A) accompanied by increased HBG expression (FIGS. 6B-6C). Results are shown as mean + SD (N > 3 replicates) and analyzed by one-way ANOVA. (*P < 0. 05).

[0016] FIGS. 7A-7D show that combining E+58 and E+55 eRNA-targeting ASOs outperformed single ASOs in reducing BCL11A mRNA expression (FIG. 7A) and increasing HBG expression (FIGS. 7B-7D). Moreover, higher HBG induction was observed using a combination of ASOs targeting different enhancers compared to ASOs targeting the same enhancer. Results are shown as mean ± SD (N > 3 replicates) and analyzed by oneway ANOVA. ****P < 0. 0001.

[0017] FIGS. 8A-8B show ASO-mediated HBG induction in human primary erythroid cells at different stages of erythroid differentiation. In these experiments, human primary CD34+ hematopoietic stem and progenitor cells (HSPCs) from healthy donors were induced for erythroid lineage differentiation for 6, 8, 10, and 12 days, contacted with one or a combination of ASOs and analyzed for HBG expression 72 hours post -ASO administration. Results are shown as mean + SD (N > 3 replicates). The control in FIG. 8A was normalized to 1 for all timepoints. Days indicated above graph are days of differentiation + 72 hours post-ASO administration.DETAILED DESCRIPTION OF THE INVENTION

[0018] New insights into the transcriptional activation of BCL11A through enhancer-mediated epigenetic insulation have now been observed. BCL11A enhancers such as the +58 enhancer and +55 enhancer play an essential role in orchestrating high-order chromatin architecture and establishing the epigeneticSJ0124WO PATENT insulation necessary for BCL11A expression. Using antisense oligonucleotides (ASOs) it was demonstrated that ASO-mediated depletion of eRNA transcripts downregulates BCL11A in adult erythroid cells, leading to fetal hemoglobin (HbF) reactivation. These erythroid progenitor cells provide access to broader target cell types. Accordingly, ASOs targeting BCL11A +58 enhancer eRNA and / or BCL11A +55 enhancer eRNA provide a novel therapeutic strategy for increasing fetal hemoglobin levels and treating hemoglobinopathies such as SCD and p -thalassemia, which does not require altering genomic DNA sequences or complex procedures and clinical risks associated with bone marrow transplantation. In addition, ASOs provide tissue-specif ic effects since these eRNAs are expressed specifically in erythroid lineage cells. Thus, the present invention provides a safe, reliable, cost effective, and accessible alternative to the current CRISPR gene therapy used in the treatment of hemoglobinopathies.

[0019] Accordingly, compositions and methods for increasing fetal hemoglobin levels are provided. In one aspect, a method of increasing fetal hemoglobin levels in a cell is provided, which comprises contacting a hematopoietic stem and / or progenitor cell with an effective amount of a composition comprising at least one inhibitor of BCL11A eRNA, e. g., BCL11A +58 eRNA and / or BCL11A +55 eRNA, whereby fetal hemoglobin expression is increased in the cell, or its progeny, relative to the cell prior to such contacting. In another aspect, a method for increasing fetal hemoglobin levels in a mammal in need thereof is provided, which comprises contacting a hematopoietic stem and / or progenitor cell in said mammal with an effective amount of a composition comprising at least one inhibitor of BCL11A eRNA (e. g., one, two, three, four or more inhibitors), whereby fetal hemoglobin expression is increasedSJ0124WO PATENT in said mammal, relative to expression prior to said contacting.

[0020] The term "mammal" is intended to encompass a singular "mammal" and plural "mammals, " and includes, but is not limited to humans; primates such as apes, monkeys, orangutans, and chimpanzees; canids such as dogs and wolves; f elids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras; food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; and bears. In some aspects, a mammal is a human.

[0021] As used herein, an "enhancer" refers to a DNA sequence or region located at some distance away from a gene and capable of stimulating transcription of the gene. In some aspects, an enhancer is capable of binding to transcription factors and stimulating promoters (i. e., stimulating expression (e. g., transcription) of a coding sequence operably linked to or associated with the promoters). " Enhancer RNA" or "eRNA" refers to a ribonucleotide transcribed from a genomic enhancer nucleic acid sequence or region.

[0022] As used herein, a "hematopoietic stem cell" refers to an undifferentiated hematopoietic cell capable of self -replicating in vivo or capable of essentially unrestricted proliferation in vitro and capable of differentiating into other cell types, including cells of the erythroid lineage. Hematopoietic stem cells can be isolated from, for example, but not limited to, fetal liver, bone marrow and umbilical cord blood.

[0023] As used herein, a "hematopoietic progenitor cell" refers to a cell of a stem cell lineage that gives rise to all the blood cell types including the myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils,SJ0124WO PATENT erythrocytes, megakaryocytes / platelets, dendritic cells), and the lymphoid lineages (T-cells, B-cells, NK-cells). A "cell of the erythroid lineage" indicates that the cell being contacted is a cell that undergoes erythropoiesis such that upon final differentiation it forms an erythrocyte or red blood cell (RBC). Such cells belong to one of three lineages, erythroid, lymphoid, and myeloid, originating from bone marrow hematopoietic progenitor cells. Upon exposure to specific growth factors and other components of the haematopoietic microenvironment, haematopoietic progenitor cells can mature through a series of intermediate differentiation cellular types, all intermediates of the erythroid lineage, into RBCs. Thus, cells of the "erythroid lineage" may comprise hematopoietic progenitor cells, rubriblasts, prorubricytes, erythroblasts, metarubricytes, reticulocytes, and erythrocytes.

[0024] In some aspects, a haematopoietic stem and / or progenitor cell has at least one of the cell surface markers characteristic of haematopoietic stem and / or progenitor cells: CD34+, CD59+, Thyl / CD90+, CD38lo / -, and C-kit / CD117+. In some aspects, a haematopoietic stem and / or progenitor cell has two, three, four or more of these markers. In some aspects, a haematopoietic progenitor cell of the erythroid lineage has the cell surface markers CD71 and Terll9, which are characteristic of the erythroid lineage. In some embodiments, a haematopoietic stem and / or progenitor cell is a primary cell, i. e., a cell isolated directly from a mammal, e. g., a human primary cell.

[0025] In some aspects, the hematopoietic stem and / or progenitor cell is contacted ex vivo or in vitro. In some aspects, the hematopoietic stem and / or progenitor cell is contacted ex vivo or in vitro and said cell or its progeny is administered to a mammal. In some aspects, theSJ0124WO PATENT hematopoietic stem and / or progenitor cell is contacted in vivo.

[0026] In connection with contacting a cell with an inhibitor of BCL11A eRNA, "increasing the fetal hemoglobin levels" in a cell indicates that fetal hemoglobin is at least 5% higher in the cell treated with a BCL11A eRNA inhibitor relative to the cell prior to such contacting. In some aspects, expression of fetal hemoglobin in a BCL11A eRNA inhibitor-treated cell is at least 10% higher, at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 1. 1 -fold higher, at least 2 -fold higher, at least 5-fold higher, at least 10-fold higher, at least 100-fold higher, at least 1000-fold higher, or more compared to the cell prior to being contacted with the BCL11A eRNA inhibitor. In some aspects, "increasing the fetal hemoglobin levels" in a cell indicates that fetal hemoglobin is at least 5% higher (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% higher) in the cell treated with a BCL11A eRNA inhibitor compared to a comparable, control cell, wherein no BCL11A eRNA inhibitor is present. An increase in fetal hemoglobin levels is particularly useful in a mammal that has been diagnosed with a hemoglobinopathy such as sickle cell disease or p-thalassemia.

[0027] In one aspect, a composition comprising at least one inhibitor of BCL11A eRNA is provided. An "inhibitor" of BCL11A eRNA, as used herein, may function in a competitive or noncompetitive manner, and may function by interfering with the expression or activity of the BCL11A eRNA. Any of a number of different approaches may be taken to inhibit BCL11A eRNA expression or activity. In some aspects, an inhibitor of BCL11A eRNA inhibits expression BCL11A eRNA. In some aspects, an inhibitor of BCL11A eRNA expression is a small moleculeSJ0124WO PATENT or an oligomeric compound. In some aspects, an inhibitor of BCL11A eRNA inhibits expression of BCL11A +58 eRNA, BCL11A +55 eRNA, and / or BCL11A +62 eRNA. In some aspects, an inhibitor of BCL11A eRNA expression is a small molecule or an oligomeric compound that inhibits expression of BCL11A +58 eRNA and / or BCL11A +55 eRNA.

[0028] As used herein, the term "small molecule" refers to a chemical agent including, but not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, aptamers, nucleotides, nucleotide analogs, organic or inorganic compounds ( i. e., including heteroorganic and organometallic compounds) having a molecular weight less than about 10, 000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5, 000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1, 000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.

[0029] An "oligomeric compound, " as described herein, may be RNA or DNA, and may be single -stranded or double -stranded, and may be selected, for example, from a group including oligonucleotides, oligonucleosides, oligonucleotide analogs (e. g., peptide-nucleic acid (PNA), pseudo -complementary PNA (pc-PNA), locked nucleic acid (LNA) ), oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, ribozymes, and small inhibitory nucleic acids such as RNAi, shRNAi, siRNA, or micro RNAi (mRNAi).

[0030] In some aspects, an inhibitor of BCL11A eRNA expression provides for at least a 5% decrease, e. g., at least a 10% decrease, at least 20% decrease, at least 30% decrease, at least 40% decrease, at least 50% decrease, at least 60%SJ0124WO PATENT decrease, at least 70% decrease, at least 80% decrease, at least 90% decrease, at least 1. 1 - fold decrease, at least 2 -fold decrease, at least 5 - fold decrease, at least 10 - fold decrease, or at least 100 - fold decrease in BCL11A eRNA express ion in a treated cell as compared to a cell not contacted with the inhibitor of BCL11A eRNA express ion.

[0031] In one aspect, an inhibitor of BCL11A eRNA expression is a BCL11A eRNA- speci f ic antisense compound, e. g., antisense ol igonucleotide. An oligomeric compound may be "antisense" to a target nucleic acid, meaning that it is capable of undergoing hybridi zation with a target nucleic acid through hydrogen bonding. In some aspects, an anti sense compound has a nucleobase sequence that, when written in the 5 ' to 3 ' direction, compri ses the reverse complement of the target segment of a target nucleic acid to which it is targeted.

[0032] In some aspects, an antisense compound i s about 10 bases to about 30 bases in length, e. g., about 12 to 30 bases in length, about 12 to about 22 bases in length, about 14 to about 30 bases in length, about 14 to about 20 bases in length, about 15 to about 30 bases in length, about 15 to about 20 bases in length, about 16 to about 30 bases in length, about 16 to about 20 bases in length, about 17 to about 30 bases in length, about 17 to 20 bases in length, about 18 to about 30 bases in length, about 18 to about 20 bases in length, about 20 to about 30 bases in length. In some aspects, an antisense compound is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked bases in length, or a range def ined by any two of the above values. In some aspects, the antisense compound is an antisense oligonucleotide, and the linked bases are nucleotides.

[0033] In some aspects, an anti sense compound may be shortened or truncated. For example, a s ingle base may beSJ0124WO PATENT deleted from the 5 ' end (5 ' truncation), or alternatively from the 3 ' end (3 ' truncation). A shortened or truncated antisense compound targeted to an eRNA nucleic acid may have two bases deleted from the 5 ' end, or alternatively may have two bases deleted from the 3 ' end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5 ' end and one nucleoside deleted from the 3 ' end.

[0034] When a single additional base is present in a lengthened antisense compound, the additional base may be located at the 5 ' or 3 ' end of the antisense compound. When two or more additional bases are present, the added bases may be adjacent to each other, for example, in an antisense compound having two bases added to the 5 ' end ( 5 ' addition), or alternatively to the 3 ' end (3 ' addition), of the antisense compound. Alternatively, the added bases may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5 ' end and one subunit added to the 3 ' end.

[0035] It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and / or introduce mismatch bases without eliminating activity. For example, in Woolf et al. ( ( 1992 ) Proc. Natl. Acad. Sci. USA 89: 7305-7309), a series of antisense oligonucleotides 13 -25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte inj ection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobaseSJ0124WO PATENT antisense oligonucleotides, including those with 1 or 3 mismatches. Similarly, Gautschi et al. ( (2001) J. Natl. Cancer Inst. 93: 463 -471) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti tumor activity in vivo.

[0036] In some aspects, an inhibitor of BCL11A eRNA expression is an antisense compound. In some aspects, an inhibitor of BCL11A eRNA expression is an antisense compound that inhibits the expression of BCL11A +58 eRNA, e. g., an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID N0: l (GTAGTGAGATGGCTGA), SEQ ID NO: 2 (AAGGCAGCTAGACAGG), SEQ ID NO: 3 (TCCAGTGCAAAGTCCATACA), SEQ ID NO: 4 (TCAATACAACTTTGAAGC), SEQ ID NO: 5 (GGTCAATACAACTTTGAA), SEQ ID NO: 6 (AGGGTCAATACAACTTTG), SEQ ID NO: 7 (CACACCAGGGTCAATAC), SEQ ID NO: 8 ( ATAACACACCCAGGGTC), SEQ ID NO: 9 (TTAGACATAACACACCAG), SEQ ID NO: 10 (CTTAGACATAACACACCA), SEQ ID NO: 11 (CTCTTAGACATAACACAC), SEQ ID NO: 12 (CTACTCTTAGACATAACA), SEQ ID NO: 13 (ATCTACTCTTAGACATAA), SEQ ID NO: 14 (GGCATCTACTCTTAGACA), SEQ ID NO: 15 (CTACTCTTAGACATAA), SEQ ID NO: 16 ( TCTGTAGTGAGATGGC ), SEQ ID NO: 17 (CTAGACAGGACTTGGGAGTT), SEQ ID NO: 18 (TGATGGACCTTGGGTGCTAT), SEQ ID NO: 19 (TGGTCGGCACTGATAG) and / or SEQ ID NO: 20 ( AGAGGTGGCTAA TAA). In some aspects, a composition comprising an inhibitor of BCL11A eRNA comprises one or more antisense compounds and a pharmaceutically acceptable carrier, wherein the antisense compounds comprise the nucleotide sequence one or more of SEQ ID NOs: l-20. In some aspects, an inhibitor of BCL11A eRNA expression is an antisense compound that inhibits the expression of BCL11A +55 eRNA. In some aspects, a composition comprising an inhibitorSJ0124WO PATENT of BCL11A +55 eRNA comprises one or more antisense compounds and a pharmaceutically acceptable carrier. In some aspects, an inhibitor of BCL11A eRNA expression is an antisense compound that inhibits the expression of BCL11A +58 eRNA. In some aspects, a composition comprising an inhibitor of BCL11A + 58 eRNA comprises one or more antisense compounds and a pharmaceutically acceptable carrier. In some aspects, a composition herein comprises a combination of antisense compounds. In some embodiments, a composition herein comprises ( i) at least one inhibitor of BCL11A +58 eRNA, ( ii) at least one inhibitor of BCL11A +55 eRNA, or (iii) a combination of (i) and (ii). In some embodiments, a composition herein comprises at least one antisense compound that inhibits the expression of BCL11A +58 eRNA and at least one antisense compound that inhibits the expression of BCL11A BCL11A +55 eRNA, the combination of which has been shown to markedly increase HBG induction.

[0037] In some aspects, an antisense compound may include chemically modified bases arranged in patterns, or motifs, to confer to the antisense compound properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases. Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of a chimeric antisense compound may confer another desired property, e. g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA: DNA duplex.

[0038] Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e. g.,SJ0124WO PATENT oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect. In some aspects, the amount and / or activity of the target nucleic acid is modulated. In some aspects, the amount and / or activity of the target nucleic acid is reduced. In some aspects, hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation. In some aspects, hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation. In some aspects, the presence of the antisense compound hybridized with the target nucleic acid (occupancy) results in a modulation of antisense activity. In some aspects, antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms. In some aspects, antisense compounds function through more than one mechanism and / or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by particular mechanism.

[0039] Antisense mechanisms include, without limitation, RNase H-mediated antisense; RNAi mechanisms, which use the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy-based mechanisms. Certain antisense compounds may act through more than one such mechanism and / or through additional mechanisms.

[0040] In some aspects, antisense compounds may comprise one or more types of modified sugar moieties and / or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a def ined pattern or sugar modification motif. Such motifs may include sugar modifications such as β-D-ribonucleosides, β-D-deoxyribonucleosides, 2 ' -modified nucleosides (such 2 ' -modified nucleosides may include 2 ' -methoxyethyl (2 ' -MOE or 2MOE) and 2 ' -O-ethyl (cEt), amongSJ0124WO PATENT others), and bicyclic sugar modif ied nucleosides (such bicyclic sugar modif ied nucleosides may include those having a constrained ethyl, LNA or ethylene -bridged nucleic acid (ENA) ). Other useful modifications include, e. g., halogenated bases, such as 5 -bromouracil and 5-iodouracil. The bases may also be alkylated, for example, 7 -methylguanosine or 5 -methylcytosine may be incorporated in place of a guanosine or cytosine residue, respectively. Such modifications are known to one skilled in the art and are described, for example, in Braasch et al. (2003 ) Biochemistry 42: 7967-7975, 2003. Most of the useful modifications to antisense compounds may be introduced using chemistries established for antisense compound technology.

[0041] In some aspects, an antisense compound may comprise or consist of a region having uniform sugar modifications. In some aspects, each nucleoside of the region comprises the same RNA-like sugar modification. In some aspects, each nucleoside of the region is a 2 ' -F nucleoside. In some aspects, each nucleoside of the region is a 2 ' -OME nucleoside. In some aspects, each nucleoside of the region is a 2 ' -MOE nucleoside. In some aspects, each nucleoside of the region is a cEt nucleoside. In some aspects, each nucleoside of the region is an LNA nucleoside. In some aspects, each nucleoside of the region is an ENA nucleoside. In some aspects, the uniform region constitutes all or essentially all of the oligonucleotide. In some aspects, the region constitutes the entire oligonucleotide except for 1-4 terminal nucleosides.

[0042] In some aspects, antisense compounds may comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In some aspects, nucleosides of both types are RNA-like nucleosides. In some aspects theSJ0124WO PATENT alternating nucleosides are selected from: 2 ' -OMe, 2 ' -F, 2 ' -MOE, LNA, ENA, and cEt. In some aspects, the alternating modifications are 2 ' -F and 2 ' -OMe. Such regions may be contiguous or may be interrupted by differently modified nucleosides or conjugated nucleosides.

[0043] In some aspects, the alternating region of alternating modifications each consist of a single nucleoside (i. e., the pattern is (AB)xAy, wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In some aspects, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs: AABBAA; ABBABB; AABAAB; ABBABAABB; ABABAA; AABABAB; ABABAA; ABBAABBABABAA; BABBAABBABABAA; or ABABBAABBABABAA; wherein A is a nucleoside of a f irst type and B is a nucleoside of a second type. In some aspects, A and B are each selected from 2 ' -F, 2 ' -OMe, and 2 ' -MOE.

[0044] In some aspects, antisense compounds may comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In some aspects, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In some aspects, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In some aspects, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages and / or phosphorodiamidate morpholino linkages. In some aspects, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In some aspects, the oligonucleotide may comprise at least 6 phosphorothioateSJ0124WO PATENT internucleoside linkages ( e. g., at least 6, 8, 10 or 12 phosphorothioate internucleoside l inkages ). In some aspects, the oligonucleotide may comprise at least one block of at least 6 consecutive phosphorothioate internucleoside linkages ( e. g., at least 6, 8, 10 or 12 consecutive phosphorothioate internucleoside linkages ). In some aspects, at least one such block is located at the 3 ' end of the oligonucleotide. In some aspects, at least one such block is located within 3 nucleos ides of the 3 ' end of the oligonucleotide.

[0045] In some aspects, the 5 ' -terminal end of an anti sense compound may comprise a modif ied phosphate moiety. In some aspects, such modif ied phosphate is stabi lized ( e. g., resistant to degradation / cleavage compared to unmodif ied 5 ' -phosphate ). In some aspects, such 5 ' - terminal nucleosides stabili ze the 5 ' -phosphorous moiety. Certain modif ied 5 ' -terminal nucleosides may be found in the art, for example in WO 2011 / 139702.

[0046] In some aspects, an inhibitor of BCL11A eRNA express ion i s an antisense compound that inhibits the express ion of BCL11A +58 eRNA, e. g., an antisense ol igonucleotide compri sing the nucleotide sequence of SEQ ID NO: 21 ( +G*+T* +A*G*T*G*A*G*A*T*G*G*C* +T* +G* +A), SEQ ID NO: 22 (+A* +A* +G*G*C*A*G*C*T*A*G*A*C* +A* +G*+G), SEQ ID NO: 23 ( / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* C*A* A*A*G*T*C*C* / i2MOErA / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / 32MOEr A / ), SEQ ID NO: 24 (+T* +C* +A* +A*T*mA*C*A*A* C*T*T*T*G* +A* +A*+G* +C), SEQ ID NO: 25 (+G* +G* +T* +C*A*mA*T*A*C*A*A*C*T*T* +T* +G*+A* +A), SEQ ID NO: 26 (+A*+G* +G*+G*T*mC*A*A*T*A*C*A*A*C*+T*+T*+T*+G), SEQ ID NO: 27 ( +C* +A* +C* +A*mC*C*A*G*G*G*T*C*A*+A* +T* +A* +C), SEQ ID NO: 28 (+A* +T* +A* +A*mC*A*C*A*C* C*C*A*G*+G* +G* +T* +C), SEQ ID NO: 29 (+T* +T* +A* +G*A*mC*A*T*A*A*C*A*C*A* +C* +C*+A* +G), SEQ ID NO: 30 (+C* +T* +T* +A*G*mA*C*A*T*A*A*C*A*C* +A* +C*+C* +A), SEQ ID NO: 31SJ0124WO PATENT (+C*+T*+C*+T*T*mA*G*A*C*A*T*A*A*C*+A*+C*+A*+C), SEQ ID NO: 32 (+C*+T*+A*+C*T*mC*T*T*A*G*A*C*A*T*+A*+A*+C*+A), SEQ ID NO: 33 (+A*+T*+C*+T*A*mC*T*C*T*T*A*G*A*C*+A*+T*+A*+A), SEQ ID NO: 34 (+G*+G*+C*+A*T*mC*T*A*C*T*C*T*T*A*+G*+A*+C*+A), SEQ ID NO: 35 (+C*+T*+A*C*mT*C*T*T*A*G*A*C*A*+T*+A*+A), SEQ ID NO: 36 (+T*+C*+T*G*T*A*G*T*G*A*G*A*T*+G*+G*+C), SEQ ID NO: 37 ( / 52MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErA / *C*A*G*G*A*C*T*T*G*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOEr T / ), SEQ ID NO: 38 ( / 52MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / *G*A*C*C* T*T*G*G*G*T* / i2MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOEr T / ), SEQ ID NO: 39 (*T*G*G*T*C*G*G*C*A*C*T*G*A*T*A*G), and / or SEQ ID NO: 40 ( *A*G*A*G*G*T*G*G*C*T*A*A*A*T*A*A), wherein "*" represents a phosphorothioate (PS) backbone, "m" represents a ribose sugar modification, " + " represents that the next base is a LNA, and "2MOE" represents a 2 ' -methoxyethyl base. In some aspects, a composition comprising an inhibitor of BCL11A eRNA comprises one or more antisense compounds and a pharmaceutically acceptable carrier, wherein the antisense compounds comprise the nucleotide sequence one or more of SEQ ID NOs: 21-40.

[0047] In some aspects, an inhibitor of BCL11A eRNA expression is an antisense compound that inhibits the expression of BCL11A +55 eRNA. In some aspects, an inhibitor of BCL11A eRNA expression is an antisense compound that inhibits the expression of BCL11A +58 eRNA.

[0048] In another aspect herein is provided a method of treating, preventing, reducing, or ameliorating a hemoglobinopathy in a subject, comprising administering to the subj ect an effective amount of at least one inhibitor of a BCL11A eRNA (e. g., a BCL11A +58 eRNA and / or a BCL11A +55 eRNA) thereby treating, preventing, reducing, or ameliorating a hemoglobinopathy in the subj ect. As used herein, the termSJ0124WO PATENT "hemoglobinopathy" means any defect in the structure or function of any hemoglobin of an individual, and includes defects in the primary, secondary, tertiary, or quaternary structure of hemoglobin caused by any mutation, such as deletion mutations or substitution mutations in the coding regions of the p-globin gene, or mutations in, or deletions of, the promoters or enhancers of such genes that cause a reduction in the amount of hemoglobin produced as compared to a normal or standard condition. The term further includes any decrease in the amount or effectiveness of hemoglobin, whether normal or abnormal, caused by external factors such as disease, chemotherapy, toxins, poisons, or the like.

[0049] In some aspects, the hemoglobinopathy is a p-hemoglobinopathy. In some aspects, the hemoglobinopathy is a p- thalassemia. In some aspects, the hemoglobinopathy is a sickle cell disease. As used herein, the term "sickle cell disease" or " SCD" refers to a group of inherited red blood cell disorders in which affected persons have an abnormal protein in their red blood cells. More common types of sickle cell disease include Hemoglobin SS, (HbSS; also called sickle cell anemia, is usually the most severe type of this disorder); Hemoglobin SC (HbSC; usually mild); Hemoglobin Sp thalassemia (of which there are two types: "0" and; HbS beta 0-thalassemia is usually more severe; HbS beta+-thalassemia is usually less severe). Some other types of sickle cell disease include Hemoglobin SD, Hemoglobin SE, Hemoglobin SO, etc.

[0050] In some aspects, the subj ect being treated may be a pediatric patient or pediatric subject. In some aspects, the pediatric patient is under 18 years old. In some aspects, the pediatric patient may be an adolescent of between 12 and 18 years. In some aspects, the pediatric patient may be a child of under 12 years. In some aspects, the subj ect may be anSJ0124WO PATENT adult patient. In some aspects, the adult patient is 18 years old or older. In some aspects, the adult patient is 21 years old or older.

[0051] In some aspects, treatment herein ameliorates one or more symptoms associated with the disorder by increasing the amount of fetal hemoglobin in the individual. Symptoms typically associated with a hemoglobinopathy, include for example, anemia, tissue hypoxia, organ dysfunction, abnormal hematocrit values, ineffective erythropoiesis, abnormal reticulocyte (erythrocyte) count, abnormal iron load, the presence of ring sideroblasts, splenomegaly, hepatomegaly, impaired peripheral blood f low, dyspnea, increased hemolysis, j aundice, anemic pain crises, acute chest syndrome, splenic sequestration, priapism, stroke, hand-foot syndrome, and pain such as angina pectoris.

[0052] The term "effective amount, " as used herein, refers to the amount that is safe and sufficient to treat, lesson the likelihood of, or delay the development of a hemoglobinopathy. The amount may thus cure or result in amelioration of the symptoms of the hemoglobinopathy, slow the course of hemoglobinopathy disease progression, slow or inhibit a symptom of a hemoglobinopathy, slow or inhibit the establishment of secondary symptoms of a hemoglobinopathy or inhibit the development of a secondary symptom of a hemoglobinopathy. The effective amount for the treatment of the hemoglobinopathy depends on the type of hemoglobinopathy to be treated, the severity of the symptoms, the subj ect being treated, the age and general condition of the subject, the mode of administration and so forth. Thus, for any given case, an appropriate "effective amount" may be determined by one of ordinary skill in the art using only routine experimentation.SJ0124WO PATENT

[0053] In embodiments comprising the administration of more than one inhibitor of BCL11A eRNA, the inhibitors may be administered simultaneously or consecutively. In some embodiments, a composition comprising more than one inhibitor may include each inhibitor in equimolar amounts. Alternatively, a composition comprising more than one inhibitor may include 1. 1-fold, 1.5-fold, 2. 0-fold, 2.5-fold, 3. 0-fold, 4. 0-fold, 5. 0-fold, 10-fold, or more of a first inhibitor compared to a second inhibitor.

[0054] To facilitate administration, an inhibitor of BCL11A eRNA (e. g., one or a combination of inhibitors) may be provided in a composition, e.g., a pharmaceutical composition comprising the inhibitor and a pharmaceutically acceptable carrier or excipient. The pharmaceutically acceptable carrier or excipient may be a diluent, a binder, a filler, a buffering agent, a pH modifying agent, a disintegrant, a dispersant, a preservative, a lubricant, taste-masking agent, a flavoring agent, or a coloring agent. The amount and types of carriers or excipients used to form the pharmaceutical composition may be selected according to known principles of pharmaceutical science.

[0055] In aspects comprising an antisense compound, a composition may comprise a pharmaceutically acceptable carrier or excipient and the antisense compound { e. g., one or more antisense compounds) may optionally be contained in a plasmid, retrovirus, adenovirus, adeno-associated virus, or lentivirus and expressed from, for example, a pol III U6 promoter, or another promoter (see, e. g., Stewart, et al. (2003 ) RNA 9 ( ): 493 - 501).

[0056] In one aspect, a carrier or excipient may be a diluent. The diluent may be compressible (i. e., plastically deformable) or abrasively brittle. Non-limiting examples of suitable compressible diluents include microcrystallineSJ0124WO PATENT cellulose (MCC), cellulose derivatives, cellulose powder, cellulose esters (i. e., acetate and butyrate mixed esters), ethyl cellulose, methyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, corn starch, phosphated corn starch, pregelatinized corn starch, rice starch, potato starch, tapioca starch, starch-lactose, starch-calcium carbonate, sodium starch glycolate, glucose, fructose, lactose, lactose monohydrate, sucrose, xylose, lactitol, mannitol, malitol, sorbitol, xylitol, maltodextrin, and trehalose. Non-limiting examples of suitable abrasively brittle diluents include dibasic calcium phosphate (anhydrous or dihydrate), calcium phosphate tribasic, calcium carbonate, and magnesium carbonate.

[0057] In another aspect, the carrier or excipient may be a binder. Suitable binders include, but are not limited to, starches, pregelatinized starches, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, Ci2-Ci8fatty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, polypeptides, oligopeptides, and combinations thereof.

[0058] In another aspect, the carrier or excipient may be a filler. Suitable f illers include, but are not limited to, carbohydrates, inorganic compounds, and polyvinylpyrrolidone. By way of non-limiting example, the filler may be calcium sulfate, both di - and tri-basic, starch, calcium carbonate, magnesium carbonate, microcrystalline cellulose, dibasic calcium phosphate, magnesium carbonate, magnesium oxide, calcium silicate, talc, modif ied starches, lactose, sucrose, mannitol, or sorbitol.SJ0124WO PATENT

[0059] In still another aspect, the carrier or excipient may be a buffering agent. Representative examples of suitable buffering agents include, but are not limited to, phosphates, carbonates, citrates, tris buffers, and buffered saline salts (e.g., Tris -buff ered saline or phosphate-buff ered saline).

[0060] In various aspects, the carrier or excipient may be a pH modifier. By way of non-limiting example, the pH modifying agent may be sodium carbonate, sodium bicarbonate, sodium citrate, citric acid, or phosphoric acid.

[0061] In a further aspect, the carrier or excipient may be a disintegrant. The disintegrant may be non-ef fervescent or effervescent. Suitable examples of non-ef fervescent disintegrants include, but are not limited to, starches such as corn starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, micro-crystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, locust bean, karaya, pectin, and tragacanth. Non-limiting examples of suitable effervescent disintegrants include sodium bicarbonate in combination with citric acid and sodium bicarbonate in combination with tartaric acid.

[0062] In yet another aspect, the carrier or excipient may be a dispersant or dispersing enhancing agent. Suitable dispersants may include, but are not limited to, starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose.

[0063] In another aspect, the carrier or excipient may be a preservative. Non-limiting examples of suitable preservatives include antioxidants, such as BHA, BHT, vitamin A, vitamin C, vitamin E, or retinyl palmitate, citric acid, sodium citrate; chelators such as EDTA or EGTA; and antimicrobials, such as parabens, chlorobutanol, or phenol.SJ0124WO PATENT

[0064] In a further aspect, the carrier or excipient may be a lubricant. Non- limiting examples of suitable lubricants include minerals such as talc or si l ica; and fats such as vegetable stearin, magnesium stearate or stearic acid.

[0065] In yet another aspect, the carrier or excipient may be a taste -masking agent. Taste -masking materials include cellulose ethers; polyethylene glycols; polyvinyl alcohol; polyvinyl alcohol and polyethylene glycol copolymers; monoglycerides or triglycerides; acrylic polymers; mixtures of acrylic polymers with cel lulose ethers; cel lulose acetate phthalate; and combinations thereof.

[0066] In another aspect, the carrier or excipient may be a f lavoring agent. Flavoring agents may be chosen f rom synthet ic f lavor oi ls and f lavoring aromatics and / or natural oi ls, extracts from plants, leaves, f lowers, fruits, and combinations thereof.

[0067] In sti ll a further aspect, the carrier or excipient may be a coloring agent. Suitable color addit ives include, but are not limited to, food, drug, and cosmetic colors (FD& C), drug and cosmetic colors (D& C), or external drug and cosmetic colors (Ext. D& C).

[0068] The weight fraction of the carrier or excipient or combination of carriers or excipients in the pharmaceut ical composition may be about 99 % or less, about 97% or less, about 95 % or less, about 90% or less, about 85% or less, about 80 % or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40 % or less, about 35% or less, about 30 % or less, about 25% or less, about 20% or less, about 15 % or less, about 10% or less, about 5% or less, about 2 %, or about 1% or less of the total weight of the pharmaceutical composition.SJ0124WO PATENT

[0069] The pharmaceutical composition may be formulated into various dosage forms and administered by a number of different means that will deliver a therapeutically effective amount of the active ingredient. Such pharmaceutical compositions may be administered orally (e.g., by mouth or inhalation), parenterally, or topically in dosage unit formulations containing conventional nontoxic pharmaceutically acceptable carriers, adjuvants, and vehicles as desired. Topical administration may also involve the use of transdermal administration such as transdermal patches or iontophoresis devices. The term parenteral as used herein includes subcutaneous, intravenous, intramuscular, intra-osseous, intra-articular, or intrasternal inj ection, or infusion techniques.

[0070] Solid dosage forms for oral administration may include capsules, tablets, caplets, pills, powders, pellets, and granules. In such solid dosage forms, the active ingredient is ordinarily combined with one or more pharmaceutically acceptable excipients, examples of which are detailed above. Oral preparations may also be administered as aqueous suspensions, elixirs, or syrups. For these, the active ingredient may be combined with various sweetening or flavoring agents, coloring agents, and, if so desired, emulsifying and / or suspending agents, as well as diluents such as water, ethanol, glycerin, and combinations thereof. For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e. g., a gas such as carbon dioxide, or a nebulizer.

[0071] For parenteral administration (including subcutaneous, intradermal, intravenous, intramuscular, intra-osseous, intra-articular and intraperitoneal), the preparation may be an aqueous or an oil -based solution.SJ0124WO PATENT Aqueous solutions may include a sterile diluent such as water, saline solution, a pharmaceutically acceptable polyol such as glycerol, propylene glycol, or other synthetic solvents; an antibacterial and / or antifungal agent such as benzyl alcohol, methyl paraben, chlorobutanol, phenol, thimerosal, and the like; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating agent such as ethylenediaminetetraacetic acid; a buffer such as acetate, citrate, or phosphate; and / or an agent for the adjustment of tonicity such as sodium chloride, dextrose, or a polyalcohol such as mannitol or sorbitol. The pH of the aqueous solution may be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Oil-based solutions or suspensions may further comprise sesame, peanut, olive oil, or mineral oil. The compositions may be presented in unit-dose or multi -dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carried, for example water for inj ections, immediately prior to use. Extemporaneous inj ection solutions and suspensions may be prepared from sterile powders, granules, and tablets.

[0072] For topical (e.g., transdermal or transmucosal) administration, penetrants appropriate to the barrier to be permeated are generally included in the preparation. Pharmaceutical compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. In some aspects, the pharmaceutical composition is applied as a topical ointment or cream. When formulated in an ointment, the active ingredient may be employed with either a paraffinic or a water-miscible ointment base. Alternatively, the active ingredient may be formulated in a cream with an oil -in-waterSJ0124WO PATENT cream base or a water-in-oil base. Pharmaceutical compositions adapted for topical administration to the eye include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier, especially an aqueous solvent. Pharmaceutical compositions adapted for topical administration in the mouth include lozenges, pastilles, and mouth washes. Transmucosal administration may be accomplished through the use of nasal sprays, aerosol sprays, tablets, or suppositories, and transdermal administration may be via ointments, salves, gels, patches, or creams as generally known in the art.

[0073] In some aspects, a pharmaceutical composition including at least one BCL11A eRNA inhibitor (e. g., one, two, three, four or more inhibitors) is encapsulated in a suitable vehicle to either aid in the delivery of the compound to target cells, to increase the stability of the composition, or to minimize potential toxicity of the composition. As will be appreciated by a skilled artisan, a variety of vehicles are suitable for delivering a composition herein. Nonlimiting examples of suitable structured fluid delivery systems may include nanoparticles, liposomes, microemulsions, micelles, dendrimers, and other phospholipid-containing systems. Methods of incorporating compositions into delivery vehicles are known in the art.

[0074] In one aspect, a liposome delivery vehicle may be utilized. Liposomes are spherical vesicles with a phospholipid bilayer membrane. The lipid bilayer of a liposome may fuse with other bilayers (e. g., the cell membrane), thus delivering the contents of the liposome to cells. In this manner, at least one BCL11A eRNA inhibitor may be selectively delivered to a cell by encapsulation in a liposome that fuses with the targeted cell ' s membrane.SJ0124WO PATENT

[0075] Liposomes may be composed of a variety of different types of phospholipids having varying hydrocarbon chain lengths. Phospholipids generally comprise two fatty acids linked through glycerol phosphate to one of a variety of polar groups. Suitable phospholipids include phosphatidic acid (PA), phosphatidylserine (PS), phosphatidylinositol (PI), phosphatidylglycerol (PG), diphosphatidylglycerol (DPG), phosphatidylcholine (PC), and phosphatidylethanolamine (PE). The fatty acid chains comprising the phospholipids may range from about 6 to about 26 carbon atoms in length, and the lipid chains may be saturated or unsaturated. Suitable fatty acid chains include (common name presented in parentheses) n-dodecanoate (laurate), n-tretradecanoate (myristate), n-hexadecanoate (palmitate), n-octadecanoate (stearate), n-eicosanoate (arachidate), n-docosanoate (behenate), n-tetracosanoate ( lignocerate), cis-9 -hexadecenoate (palmitoleate), cis-9-octadecanoate (oleate), cis, cis- 9, 12 -octadecadienoate (linoleate), all cis-9, 12, 15-octadecatrienoate (linolenate), and all cis- 5, 8, 11, 14 -eicosatetraenoate (arachidonate). The two fatty acid chains of a phospholipid may be identical or different. Acceptable phospholipids include dioleoyl PS, dioleoyl PC, distearoyl PS, distearoyl PC, dimyristoyl PS, dimyristoyl PC, dipalmitoyl PG, stearoyl, oleoyl PS, palmitoyl, linolenyl PS, and the like.

[0076] The phospholipids may come from any natural source, and, as such, may include a mixture of phospholipids. For example, egg yolk is rich in PC, PG, and PE; soybeans contain PC, PE, PI, and PA; and animal brain or spinal cord is enriched in PS. Phospholipids may come from synthetic sources too. Mixtures of phospholipids having a varied ratio of individual phospholipids may be used. Mixtures of different phospholipids may result in liposome compositions havingSJ0124WO PATENT advantageous act ivity or stabi lity of activity properties. The above ment ioned phospholipids may be mixed, in optimal ratios with cationic lipids, such as N- ( l- (2, 3 -dioleolyoxy) propyl ) -N, N, N-trimethyl ammonium chloride, 1, 1 ' -dioctadecyl -3, 3, 3 ', 3 ' -tetramethyl indocarbocyanine perchlorate, 3, 3 ' -deheptyloxacarbocyanine iodide, 1, 1 ' -dedodecyl -3, 3, 3 ', 3 ' - tetramethylindocarbocyanine perchlorate, 1, 1 ' -dioleyl -3, 3, 3 ', 3 ' -tetramethylindo carbocyanine methanesulfonate, N-4 - (del inoleylaminostyryl ) -N-methylpyridinium iodide, or 1, 1, -di linoleyl - 3, 3, 3 ', 3 ' -tetramethyl indocarbocyanine perchlorate.

[0077] Liposomes may optionally include sphingolipids, in which spinosine is the structural counterpart of glycerol and one of the one fatty acids of a phosphoglyceride, or cholesterol, a maj or component of animal cel l membranes. Liposomes may optionally contain pegylated l ipids, which are lipids covalently linked to polymers of polyethylene glycol (PEG). PEGS may range in size from about 500 to about 10, 000 daltons.

[0078] Liposomes may further include a suitable solvent. The solvent may be an organic solvent or an inorganic solvent. Suitable solvents include, but are not limited to, dimethylsulfoxide (DMSO), methylpyrrol idone, N-methylpyrrolidone, acetronitrile, alcohols, dimethylformamide, tetrahydrofuran, or combinat ions thereof.

[0079] Liposomes carrying at least one BCL11A eRNA inhibitor may be prepared by any known method of preparing liposomes for drug delivery, such as, for example, detai led in US 4, 241, 046, US 4, 394, 448, US 4, 529, 561, US 4, 755, 388, US 4, 828, 837, US 4, 925, 661, US 4, 954, 345, US 4, 957, 735, US 5, 043, 164, US 5, 064, 655, US 5, 077, 211 and US 5, 264, 618, the di sclosures of which are hereby incorporated by reference in their ent irety. For example, liposomes may be prepared bySJ0124WO PATENT sonicating lipids in an aqueous solution, solvent injection, lipid hydration, reverse evaporation, or freeze drying by repeated freezing and thawing. In one aspect, the liposomes may be formed by sonication. The liposomes may be multilamellar, which have many layers like an onion, or unilamellar. The liposomes may be large or small. Continued high-shear sonication tends to form smaller unilamellar liposomes.

[0080] As would be apparent to one of ordinary skill, all of the parameters that govern liposome formation may be varied. These parameters include, but are not limited to, temperature, pH, concentration of methionine compound, concentration and composition of lipid, concentration of multivalent cations, rate of mixing, presence of and concentration of solvent.

[0081] In another aspect, a pharmaceutical composition of the invention may be delivered to a cell as a microemulsion. Microemulsions are generally clear, thermodynamically stable solutions comprising an aqueous solution, a surfactant, and "oil." The "oil" in this case, is the supercritical fluid phase. The surfactant rests at the oil-water interface. Any of a variety of surfactants are suitable for use in microemulsion formulations including those described herein or otherwise known in the art. The aqueous microdomains suitable for use in the invention generally will have characteristic structural dimensions from about 5 nm to about 100 nm. Aggregates of this size are poor scatterers of visible light and hence, these solutions are optically clear. As will be appreciated by a skilled artisan, microemulsions can and will have a multitude of different microscopic structures including sphere, rod, or disc shaped aggregates. In one embodiment, the structure may be micelles, which are the simplest microemulsion structures that are generallySJ0124WO PATENT spherical or cylindrical objects. Micelles are like drops of oil in water, and reverse micelles are like drops of water in oil. In some aspects, the microemulsion structure is the lamellae. It may include consecutive layers of water and oil separated by layers of surfactant. The "oil" of microemulsions optimally includes phospholipids. Any of the phospholipids detailed above for liposomes are suitable for embodiments directed to microemulsions. At least one BCL11A eRNA inhibitor may be encapsulated in a microemulsion by any method generally known in the art.

[0082] In some aspects, an inhibitor of BCL11A eRNA ( e.g., an antisense compound) may be conjugated to an antibody that targets a specific cell type, such as a hematopoietic stem / progenitor cell and / or an erythroid precursor cell. In some aspects, an antisense compound that inhibits the expression of BCL11A +58 eRNA may be conjugated to an antibody that targets a specific cell type, such as a hematopoietic stem / progenitor cell and / or an erythroid precursor cell. In some aspects, an antisense compound that inhibits the expression of BCL11A +55 eRNA may be conjugated to an antibody that targets a specific cell type, such as a hematopoietic stem / progenitor cell and / or an erythroid precursor cell. In aspects where an antisense compound that inhibits the expression of BCL11A +55 eRNA is used in combination with an antisense compound that inhibits the expression of BCL11A +58 eRNA, both antisense compounds may be conjugated to the same antibody or to different antibodies.

[0083] The treatment described herein may be combined with other treatment partners or therapeutic agents such as the current standard of care for a hemoglobinopathy. For example, one or more BCL11A eRNA inhibitors may be combined with one or more of an IL- 18 inhibitor and / or other inflammasome pathway inhibitor ( e. g., inhibitors of NLRP3, gasdermin D,SJ0124WO PATENT or other inflammasome pathway members), an agent preventing red cell alterations (e.g., Hb polymerization, dehydration, microparticle generation, or mobilization of Weibel-Palade bodies), an ATP or ATP receptor inhibitor, a Bachl inhibitor, a CD40 pathway inhibitor, a P-selectin pathway inhibitor, an inhibitors of an adhesion molecule (e. g., ICAM or VCAM), a compound preventing platelet activation, a platelet stabilizing compound (e. g., multimerized IgGlFc or IVIG), a TLR antagonist ( e. g., an antagonist of TLR4, TLR7, TLR8, and / or TRL9), a ROS inhibitor, an agent for regulation of oxygen regulated genes ( e.g., HIF2a), an agent that prevents or disrupts NET formation, a complement inhibitor, a heme oxygenase -1 / HO- 1 pathway modulator, a CXCR4 pathway modulator, a phosphodiesterase inhibitor, and agent that acts in an anti -angiogenic manner, EPO, a leukotriene inhibitor (e. g., Leukotriene A-4 hydrolase), or combinations thereof.

[0084] The following examples are provided for illustrative purposes only and not intended to limit the scope of the claims.EXAMPLESExample 1: Materials and Methods

[0085] Cells and cell cul ture. HUDEP-2 (Human Umbilical Cord Blood-Derived Erythroid Progenitor-2) cells were cultured in StemSpan™ Serum-Free Expansion Medium (StemCell Technologies) supplemented with 0.1 mM dexamethasone (Sigma), 100 ng / ml recombinant human stem cell factor (SCF) (PeproTech), 3 international units (IU) / ml erythropoietin (Amgen, Epogen), 1 pg / ml doxycycline (Sigma) and 1% penicillin-streptomycin (Gibco), following established protocols (Kurita et al. (2013 ) PLoS one 8: e59890; Masuda et al. (2016) Science (New York, NY) 351: 285-289).

[0086] Erythroid differentiation of CD34+ HSPCs. Human CD34+ hematopoietic stem and progenitor cells (HSPCs) from healthySJ0124WO PATENT donors or sickle cell disease (SCD) patients were cultured and induced for erythroid differentiation using a three-phase culture system as previously described (Feng et al. (2022) Nature 610: 783 -790). For phase 1 (days 0-7), cells were maintained at a density of 0.1-0.4×106 / ml in IMDM supplemented with 2% human AB plasma (Sera Care), 3 % human AB serum (GemminBio), 1% penicillin-streptomycin, 3 IU / ml heparin, 200 pg / ml holo- transferrin (Sigma), 1 IU erythropoietin, 10 ng / ml SCF and 1 ng / ml interleukin-3 (IL-3 ) (PeproTech). For phase 2 (days 8-12), IL-3 was withdrawn from the medium and the cells were maintained at a density of 0.2-0.8×106 / ml. The deidentified SCD CD34+ HSPCs were obtained from discarded specimens after phlebotomy or RBC exchange transfusions using a Clini MACS Plus instrument.

[0087] Plasmids. The sgRNAs for CTCF binding site (CBS) knockout (KO) and enhancer knockout were designed using Benchling and cloned into the pSpCas9 (BB) -2A-GFP (pX458 ) vector (Addgene). The vectors were electroporated into HUDEP-2 cells using Neon electroporation system, followed by GFP sorting and single cell cloning. HUDEP-2 cells were transduced with lentiviruses expressing LentiCas9-Blast (Addgene) and selected with 10 pg / mL blasticidin (Gibco). sgRNAs were cloned into LentiGuide-zsGreen plasmid, which was modified from the LentiGuide-Puro vector (Addgene) by replacing puromycin with zsGreen.

[0088] Lentivirus. HEK293FT cells were maintained in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin. Approximately 12 hours before transfection, cells were seeded in a 10-cm dish with 70% confluence in antibiotic-free medium. Cells were co- transfected with 2 pg pVSVG, 5 pg psPAX2, 13 pg lentivirus vector of interest using Polyjet™ in vitro DNA transfection reagents (SignaGen). After 6 hours, the mediumSJ0124WO PATENT was replaced with fresh lentivirus packaging medium (1 mM sodium pyruvate, 2. 5% FBS in Opti -MEM™ reduced serum medium). Virus-containing supernatant was collected at 48 hours and 72 hours post -transfection, respectively, and filtered through the 0.45-pm filter. Lentiviruses were used for infection or concentrated with PEG- it virus precipitation solution (SBI) before storage at -80°C. For transduction with lentiviruses, 0. 5 million HUDEP-2 cells were transduced in 6-well plates by centrifugation at 1200 X g for 1. 5 hours at 32 °C, followed by the replacement of fresh medium after 3 hours.

[0089] RNA isolation and quantitative real -time PCR (qRT-PCR). Total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen) or the RNeasy Plus Micro Kit (Qiagen) following the manufacturer' s protocols. Reverse transcription was performed using the iScript™ cDNA Synthesis Kit (Bio-Rad). qRT-PCR was performed using the 2X Universal SYBR™ Green Fast qPCR Mix (ABclonal) on a CFX384 Touch Real -Time PCR Detection System (Bio-Rad). The PCR cycling conditions were as follows: an initial denaturation step at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds.

[0090] Western blot analysis. Cells were collected and lysed with RIPA buffer (Boston bioproducts). Protein concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) following the manufacturer' s instructions. Equal amounts of protein lysates were prepared and supplied with 4X XT Sample buffer (Bio-Rad) and boiled at 95°C for 10 min. Protein samples were separated on Mini -PROTEAN TGX Precast Gels (Bio-Rad) and transferred onto 0.2 -pm nitrocellulose membranes. Membranes were blocked with 5% nonfat milk in TBST (Tris -buff ered saline with 0. 1% polysorbateSJ0124WO PATENT 20) for 1 hour at room temperature, followed by overnight incubation at 4°C with primary antibodies against [3-actin (Cell Signaling Technology), CTCF (Diagenode), GAPDH (Cell Signaling Technology) or BCL11A (Abeam). After primary antibody incubation, membranes were washed three times with TBST and incubated with horseradish peroxidase (HRP) -conjugated secondary antibodies for 1 hour at room temperature. Blots were washed three additional times with TBST and developed using Western Lighting Plus-ECL (PerkinElmer). Protein bands were visualized and analyzed on ChemiDoc Imaging System (Bio-Rad).

[0091] CRISPR / Cas9 editing in CD34+ HSPCs. Human CD34+ HPSCs were thawed and cultured for 24 hours prior to electroporation with Cas9 -sgRNA ribonucleoprotein (RNP) complex. The RNP complexes were assembled by incubating 40 pmol 3X nuclear location signal (NLS) -tagged Cas9 protein and 120 pmol sgRNA at room temperature for 20 minutes. Electroporation was performed using the Lonza 4D-nucleofector system. Specifically, 2 pl of the RNP complex was mixed with 18 pl P3 buffer and 0.5 million cells. After electroporation, cells were transferred to erythroid differentiation medium without antibiotics.

[0092] Target amplicon sequencing of CRISPR / Cas9 -edited cells. Cell pellets were lysed and genomic DNA was isolated to generate locus-specific amplicons by PCR. The amplicon sequencing data analysis was performed using CRIS.py (Connelly & Pruett -Miller (2019) Sci. Rep. 9: 4194 ) to identify CRISPR / Cas9 -mediated edits and their frequencies.

[0093] AID-mediated CTCF degradation in HUDEP-2 cells. HUDEP-2 cells engineered with the auxin-inducible degron for CTCF (CTCF-AID) were established as previously described (Hyle et al. (2019) Nucleic Acids Res. 47: 6699-6713 ). Cells were treated with 0. 5 pM of 5 -Phenyl- IH-indole -3 -acetic acidSJ0124WO PATENT (5-ph-IAA) (Sigma) for 1, 2, 4, and 7 hours. Following treatment, cells were collected and lysed for western blot and gene expression analyses.

[0094] CUT& RUN and data analysis. CUT& RUN assay was performed as previously described with modifications (Meers et al. (2019) eLife 8: e46314). Briefly, cells were collected, and dead cells were removed using the EasySep Dead Cell Removal Kit (Stem Cell Technologies). Approximately 5×105cells were analyzed per reaction. Concanavalin A beads (APExBIO) were activated by beads activation buffer (20 mM HEPES pH 7. 5, 10 mM KC1, 1mM CaCl2, 1mM MnCl2). Permeabilized cells conjugated with Concanavalin A beads were incubated with primary antibodies for 2 hours at 4°C, followed by two washes with wash buffer (20 mM HEPES pH 7. 5, 300 mM NaCl, 0. 5 mM spermidine, 0.2% digitonin). Subsequently, pA-MNase was added, and the samples were incubated for 1 hour at 4 °C, followed by three washes with the same wash buffer. The beads were resuspended with wash buffer and calcium chloride was added to final concentration 1 pM. The samples were incubated for 1 hour with gentle resuspension of the beads every 10 minutes. The reaction was stopped by adding 2X STOP buffer (20 mM EDTA, 4 mM EGTA) and incubated at 37°C for 10 minutes. DNA was extracted using the DNA Clean & Concentrator- 5 Kit (Zymo Research). Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit (NEB). The libraries were sequenced on an Illumina NextSeq 2000 platform using the 100-cycle kit. Sequencing reads were processed by removing empty reads and adapter sequences using Cutadapt (v4.4 ) (Martin (2011) EMBnet.journal 17(1):10-12). Processed FASTQ files were aligned to the human genome (hg38) using bowtie2 (v2.4.2) (Langmead & Salzberg (2012) Nature Methods 9: 357-359). Bam file was converted to BED file using BEDTools (v2.25. 0) (Quinlan & Hall (2010) Bioinformatics (Oxford,SJ0124WO PATENT England) 26: 841-842). Peaks calling was performed using MACS2 (v2.1. 1) (Zhang et al. (2008) Genome Biology 9: R137) from BED files. The resulting BED files were converted to WIG format, followed by conversion to BigWig format using the wigToBigWig command from the UCSC Kent Utilities. CTCF motif prediction was conducted using the gimme scan tool from the GimmeMotifs suite (v0. 18. 0) (van Heeringen & Veenstra (2011) Bioinformatics (Oxford, England) 27: 270 -271) with the human CTCF motif (MA0139.1) obtained from the JASPAR database (Sandelin et al. (2004) Nucleic Acids Res. 32: D91-94). BigWig files were plotted in WashU Epigenome Browser.

[0095] CUT& Tag and data analysis. Approximately 1×105cells were collected after removing dead cells using the EasySep Dead Cell Removal Kit (Stem Cell Technologies). Nuclei were extracted using nuclear extraction buffer (20 mM HEPES, pH 7. 9, 10 mM KC1, 0.1% Triton™ X-100, and 20% glycerol) on ice for 10 minutes. The extracted nuclei were then conjugated to activated Concanavalin A beads and incubated overnight with an anti -H3K27ac antibody (Abeam). After incubation, the nuclei were washed with wash Buffer 1 (20 mM HEPES, pH 7.9, 150 mM NaCl). Subsequently, a secondary antibody was added, followed by pAG-Tn5, which bound to the primary antibody. After each binding step, the nuclei were washed with wash Buffer 2 (20 mM HEPES, pH 7. 9, 150 mM NaCl ). The pAG-Tn5 complex was then activated with 10 mM MgCl2at 37°C for 1 hour. Following supernatant removal, 5 pl of SDS release buffer (0.1% SDS, 10 mM TAPS, pH 8.5) was added, and the sample was incubated at 55°C for 1 hour. This was followed by the addition of 15 pl SDS quench buffer (0.67% Triton™ X-100). The resulting products were amplified using Q5 High-Fidelity DNA Polymerase (NEB) and purified with SPRIselect beads (Beckman). Sequencing and data analysis were performed following the same protocol as the CUT& RUN assay.SJ0124WO PATENT

[0096] ATAC-seq and data analysis. ATAC-seq were performed using Zymo-Seq ATAC Library Kit (Zymo) following manufacturer' s instruction. Adaptor sequence were trimmed from raw reads with Trim_Galore (vO.6.6) with the -nextera parameter. The processed reads were mapped to human genome (hg38) with bowtie (vl. 1.2) (Langmead et al. (2009) Genome Biology 10: R25) with parameter -k 1 and -m 1. Duplicates were removed using MarkDuplicates with parameter REMOVE_DUPLICATES true. The coverage tracks were generated by converting BED files to BigWig format, as described in the methods for CUT& RUN data analysis.

[0097] Nascent RNA-seq and data analysis. Approximately 1 million cells were treated with 0. 5 pM 5-ph-IAA for the specified duration. Prior to cell harvest, 5 pl 200 mM EU from Click-iT™ Nascent RNA Capture Kit (Thermo Fisher Scientific) was added, followed by a 40-minute incubation. Cells were then collected for RNA extraction using the RNeasy Plus Mini Kit. For nascent RNA labeling, 2 pg of total RNA was subjected to a click reaction with biotin azide and CuSO4. RNA was precipitated using 2. 5X ethanol precipitation, and biotin- labeled RNA was enriched with Dynabeads MyOne Streptavidin T1 (Thermo Fisher Scientific), followed by washing according to the manufacturer' s instructions. Ribosomal RNA was depleted using the NEBNext rRNA Depletion Kit (NEB), and RNA library preparation was performed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB). Sequencing reads were trimmed using Cutadapt (v4.4) (Martin (2011) EMBnet.journal 17(1):10-12) and aligned to the hg38 reference genome with STAR (v2.5.2b) (Dobin et al. (2013 ) Bioinformatics (Oxford, England) 29: 15 -21) using the following parameters: - -outSAMtype BAM SortedByCoordinate - -outFilterMultimapNmax 1 - -quantMode TranscriptomeSAM. The resulting BAM files were converted to BED format using theSJ0124WO PATENT bamtobed command from BEDtools (v2.30. 0) (Quinlan & Hall (2010) Bioinformatics (Oxford, England) 26: 841-842). BED files were then normalized and transformed into wiggle format using a custom Python script. Finally, the normalized wiggle files were converted to bigWig format using wigToBigWig.

[0098] PRO-seq and data analysis. PRO-seq was performed as previously described (Mahat et al. (2016 ) Nature Protocols 11: 1455 -1476) with modifications. All steps were performed in RNase-free environment and all buffers were supplemented with SUPERase-In RNase inhibitor (Thermo Fisher Scientific). Briefly, 5×106cells were collected and permeabilized, with a permeabilization efficiency of over 95% assessed by trypan blue staining. The nuclei were subjected to nuclear run-on reactions with 40 pM biotin- 11 -CTP (PerkinElmer), biotin-11 -UTP (PerkinElmer), ATP (Thermo Fisher Scientific), and GTP (Thermo Fisher Scientific) for 5 minutes at 750 rpm on a thermomixer. RNA was extracted using the Total RNA Purification Kit (Norgen Biotek), fragmented by NaOH on ice for 10 minutes, and neutralized with Tris-HCl (pH 6.8 ). The RNA was precipitated with ethanol and resuspended in nuclease-free water. Next, the 3 ' RNA adapter ( / 5Phos / rUrNrNrNrNrNNGATCGTCGGACTGTAGAACTCTGAAC / 3 InvdT / ; SEQ ID NO: 41) was ligated using T4 RNA ligase 1 (NEB) at 25°C for 1 hour. Biotinylated RNA fragments were captured on Dynabeads Streptavidin Cl (Thermo Fisher Scientific) and subjected to on-bead 5 ' hydroxyl repair using T4 polynucleotide kinase at 37 °C for 30 minutes. The 5 ' RNA adapter ( / 5InvddT / CCTTGGCACCCGAGAATTCCANrNrNrNrNrNrC; SEQ ID NO: 42 ) was then ligated using T4 RNA ligase, followed by high-salt washing (50 mM Tris-HCl, pH 7.4, 2 M NaCl, 0.5% Triton™ X-100, 1 mM EDTA) and low-salt washing (5 mM Tris -HCl, pH 7.4, 0. 1% Triton™ X-100, 1 mM EDTA). Purified RNA was reverse transcribed using Maxima H Minus Reverse TranscriptaseSJ0124WO PATENT (Thermo Fisher Scientif ic) with the reverse primer AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA ( SEQ ID NO: 3 ). cDNA l ibraries were ampl if ied using a two - step PCR protocol: an initial denaturation at 95 °C for 2 minutes, followed by 5 cycles of 95 ° C for 30 seconds, 56 ° C for 30 seconds, and 72 °C for 30 seconds. This was followed by 7 additional cycles of 95 ° C for 30 seconds, 65 ° C for 30 seconds, and 72 °C for 30 seconds. Libraries were sequenced on an Il lumina NextSeq 2000 platform. Raw sequencing reads were al igned to the human genome (hg38 ) us ing BWA-MEM (v0. 7. 16a). Duplicate reads were removed using the MarkDuplicates tool from the Picard suite with parameter - -REMOVE_DUPLICATES true. Strand-specif ic coverage f iles were generated by separat ing forward and reverse strand reads using SAMtools (v1.17) (Li et al. (2009) Bioinformatics (Oxford, England) 25:2078-2079) and deepTools (v3. 5. 4 ) (Ramirez et al. (2014 ) Nucleic Acids Res. 42: W187 - 191), followed by conversion to BigWig format using wigToBigWig (v4 ). Forward and reverse strand reads were separated using the following SAMtools parameters: forward strand ( -f 128 - F 16 and - f 80 ) and reverse strand ( - f 144, - f 64 - F 16 ) using SAMtools (v1.17) (Li et al. (2009) Bioinformatics (Oxford, England) 25:2078-2079). BigWig f i les were generated with a 1 bp bin si ze normali zed with CPM (Counts Per Mi llion) using deepTools (v3. 5. 4 ) ( (Ramirez et al. (2014 ) Nucleic Acids Res. 42: W187 -191 ) ) for visuali zat ion and downstream analysis.

[0099] PRO-cap and data analysis. PRO-cap was performed as previously described (Mahat et al. ( 2016 ) Nature Protocols 11: 1455 - 1476 ) with additional optimi zation steps. Brief ly, 1x107cells were collected and permeabilized with an efficiency of over 95%, then subj ected to nuclear run-on reactions with 40 pM biot in- ll -CTP, biotin- ll -UTP, biotin-11 -ATP (Revvity), and biotin- l l -GTP (Jena Bioscience ) for 5SJ0124WO PATENT minutes on a thermomixer. RNA was extracted using TRIzol™ reagent and resuspended in DEPC-treated water without fragmentation. The 3 ' RNA adapter was ligated using T4 RNA ligase 1, following the same procedure as in PRO-seq. Biotin-labeled RNAs were then captured on Dynabeads Streptavidin Cl and subj ected to on-bead degradation of RNA containing 5 ' -monophosphate using 5 ' -phosphate -dependent exonucleases (Biosearch Technologies). To remove 5 ' -triphosphates and residual 5 ' -monophosphates, RNA was sequentially treated with alkaline phosphatase (Thermo Fisher Scientific), followed by RNA 5 ' pyrophosphohydrolase (RppH) (NEB) for further RNA end modification. The processed RNA was then subj ected to on-bead 5 ' adapter ligation, followed by RNA purification, reverse transcription, and library construction as described for the PRO-seq assay. To identify transcriptional start site (TSS) from PRO-seq and PRO-cap data, the 5 ' ends from bam files were separated into forward and reverse strands using SAMtools (v1.17) (Li et al. (2009) Bioinformatics (Oxford, England) 25: 2078 -2079) with the parameters -F 16 and -bg 5, and converted to BEDgraph files. TSS was then identified using the TSScall tool with default parameters (Nechaev et al. (2010) Science (New York, NY) 327: 335-338).

[0100] Capture-Pore-C (CPC) and data analysis. A total of 1x107cells were crosslinked with 1% formaldehyde for 10 minutes at room temperature, and the reaction was quenched with glycine. Nuclei were isolated using cell lysis buffer (25 mM Tris-HCl, 85 mM KC1, 0. 1% Triton™ X-100) and digested overnight at 37°C with the Nlalll restriction enzyme. The reaction was then quenched at 65°C for 20 minutes, and nuclei were collected for ligation using T4 DNA ligase (NEB) at 16°C overnight. Following ligation, proteins and peptide residues were sequentially digested using proteinase K and pronase. Initially, DNA was treated with proteinase K in a bufferSJ0124WO PATENT containing 1% SDS, 10 mM EDTA, and 50 mM Tris-HCl (pH 8. 0), followed by purification via phenol: chloroform: isoamyl alcohol (25: 24: 1, v / v) extraction. Residual peptides were further removed by digestion with self -activated pronase, followed by an additional phenol: chloroform: isoamyl alcohol purification step. For library preparation, 1 pg of purified DNA (processed in triplicate) was end-repaired and adapter-ligated using the NEBNext Ultra DNA Library Prep Kit (NEB). DNA samples were combined with human Cot-1 DNA, dried using a SpeedVac concentrator, and resuspended in hybridization buffer. A mixture of biotin- labeled probes was then added, and hybridization was carried out at 55°C for 24 hours. Streptavidin beads from Dynabeads kilobaseBINDER kit (Thermo Fisher Scientific) were used to capture biotin- labeled DNA fragments following the manufacturer' s instructions, while unbound fragments were washed away according to the manufacturer ' s protocol for the KAPA HyperCapture Reagent Kit (Takara). The eluted DNA was amplified using PrimeSTAR® GXL DNA Polymerase (Takara), and a second round of hybridization and amplification was performed to further enrich for targeted DNA fragments, following by purification and size selection using homemade SPRI beads solution for 3 -4 kb DNA prepared by replacing the stock buffer. The size distribution of the amplified DNA was assessed using the Genomic DNA ScreenTape on a TapeStation 4200 system (Agilent). The DNA libraries were then end-repaired, and motor proteins were ligated using the Ligation Sequencing Kit V14 (Oxford Nanopore Technologies). Finally, the prepared DNA libraries were loaded onto a pre-rinsed PromethION® flow cell (Oxford Nanopore Technologies ) following the manufacturer' s instructions.

[0101] The sequenced POD5 files were base called using Dorado (v0.5.1) on a GPU node with the DNA super accuracy model,SJ0124WO PATENT generat ing FASTQ f i les. Raw sequencing reads were trimmed us ing Cutadapt (v4. 4 ) (Mart in (2011 ) EMBnet. journal 17 ( 1 ): 10 -12 ) with the parameters -m 200 -q 20 -u 30 -M 150000. Trimmed reads were then mapped to the human genome (hg38 ) and analyzed for chromatin interactions using the Nextf low Pore -C pipeline (v23. 10. 0) (Deshpande et al. (2022 ) Nature Biotechnol.40: 1488 - 1499 ) with parameters - -mcool - -cool_bin_s i ze 1000 --cutter Nlalll - - f i lter_pairs. Sample correlat ions were assessed using the hicCorrelate command from HiCExplorer (v3. 7. 2 ) (Wolf f et al. (2020 ). Nucl eic Acids Res. 48: W177-W18). Pairwise interact ions were identif ied us ing CHICANE (v0. 1. 8 ) with a signif icance threshold of P < 0. 05 (Holgersen et al. (2021 ) Nature Protocols 16: 2257 -2285 ). Mult i -way interaction reads were def ined as read fragments overlapping dif ferent probe regions. Specif ically, pairtools (v0. 3. 0 ) (Abdennur et al. (2024 ) PLoS Comp. Biol. 20: el012164 ) was used to select reads uniquely mapped to the genome, followed by pairToBed to identify reads overlapping probe regions us ing parameter -type both. Reads were further categori zed into pairwise and multi -way interactions based on the number of probe regions covered. Multi -way interactions were vi suali zed using R (v4. 2. 3 ). For virtual 4C analysi s, raw interaction f requencies were extracted for anchor regions spanning ±500 kb at a 1 kb bin si ze using Cooler (v0. 8. 11 ) (Alavattam et al. (2019 ) Nature Struct. Mol. Biol. 26: 175 -184 ).

[0102] Hi - C data analysis. Raw Hi -C data were trimmed using Cutadapt (v4. 4 ) (Martin (2011 ) EMBnet. j ournal 17 ( 1 ): 10 - 12 ) with the parameters -q 20 -m 20 - -pair- f ilter=any. The processed FASTQ f i les were analyzed with HiC-Pro (v3. 1. 0 ) (Servant et al. (2015 ) Genome Biol. 16: 259 ) using the corresponding restriction enzyme cut s ites and default parameters. The resulting paired-end data were converted intoSJ0124WO PATENT, hic files using Juicebox (v1.13.02) (Durand et al. (2016) Cell Systems 3: 99 -101) and then transformed to cool format files with various resolution using hicConvertFormat command from (v3. 7.2) (Wolff et al. (2020). Nucleic Acids Res.48: W177 -W184 ). Contact matrices were generated from cool format files using the plotHicTriangle function from plotgardener (vl.12.0) (Kramer et al. (2022) Bioinformatics (Oxford, England) 38: 2042 -2045).

[0103] Micro Capture-C (MCC) and data analysis. The MCC assay was performed as previously described with modifications (Hamley et al. (2023 ) Nature Protocols 18: 1687-1711). Briefly, 1x107cells were crosslinked with 2% formaldehyde, and the reaction was quenched with glycine. Cells were then permeabilized with digitonin for 5 minutes at room temperature, and chromatin was digested with micrococcal nuclease at 37°C for 1 hour, followed by quenching with 5 mM DTGA at 65°C for 20 minutes. Next, T4 polynucleotide kinase (PNK) was added, and ligation was performed in the presence of dNTPs using high-concentration T4 DNA ligase (Thermo Scientific) at 37°C overnight. The chromatin was subsequently de-crosslinked, and proteins were digested using proteinase K, followed by phenol -chloroform extraction. For the capture experiment, the 3C library was sonicated using a Covaris S220 to achieve an average fragment size of 200 bp. One pg of DNA was end-repaired using the NEBNext Ultra II Library Prep Kit, ligated with adaptors, and amplified for 10 cycles using Herculase® II Fusion DNA Polymerase. The pre-amplified DNA underwent two rounds of hybridization with biotin-labeled probes targeting CTCF binding sites. Hybridization and wash steps were carried out according to the manufacturer ' s protocol for the KAPA HyperCapture Reagent Kit. Finally, the enriched DNA was amplified, size-selected, and prepared for Illumina sequencing. Adaptor sequences were trimmed from rawSJ0124WO PATENT sequencing data using Cutadapt (v4.4) (Martin (2011) EMBnet. j ournal 17 ( 1): 10 -12). The trimmed reads were then processed with HiC-Pro (v 3.1. 0) (Servant et al. (2015) Genome Biol. 16: 259) without specifying the GENOME_FRAGMENT parameter. The interaction loops were subsequently called using hichipper (v0.7.7) (Lareau et al. (2018) Nature Methods 15: 155- 156) and converted into longrange file format for visualization.

[0104] Sequence -based analysis of transcriptional initiation by Puffin-D. The sequence -based analysis of transcription start sites (TSS) was performed using the deep learning sequence model Puff in-D trained with the HUDEP-2 PRO-cap data as described previously Dudnyk et al. (2024) Science (New York, NY) 384: eadj 0116 ) with the following modifications. In brief, Puffin-D model captures sequence dependencies up to 100 kb and predicts the transcription initiation signal at base-pair resolution. The Puffin-D architecture iteratively propagates information across the entire sequence through two upward- downward passes. The HUDEP-2 PRO-cap Puffin-D model, using the Puffin-D architecture, was re-trained with HUDEP-2 PRO-cap data on the whole genome, with all chromosomes except for chr8, 9, and 10 as the training set, chrlO as the validation set, and chr8 and chr9 as the test set. The mutant sequences with CRISPR- induced INDELs were reconstructed, and the model was used to predict both wild-type and mutant transcription initiation signals. The difference in the predicted signal between the wild-type and mutant sequences was computed as the difference in the summed signal on a count scale over the region from - 100 bp to +200 bp relative to the GATA site.

[0105] Cross-linking immunoprecipitation (CLIP). The CLIP assay was performed as previously described (Blue et al. (2022) Nature Protocols 17: 1223 - 1265) under RNase-freeSJ0124WO PATENT conditions. All surfaces were treated with RNaseZap® RNase decontamination solution, and SUPERase-In RNase inhibitor was included in all buffers. A total of 1x107cells were harvested, washed with cold PBS, and transferred to a prechilled dish for UV crosslinking at 400 mJ / cm2. Crosslinked cells were then washed and lysed in lysis buffer (50 mM Tris -HC1, pH 7.4; 100 mM NaCl; 1% IGEPAL CA-630; 0.1% SDS; 0.5% sodium deoxycholate), followed by sonication using a Bioruptor (five cycles of 30 seconds on / 30 seconds off ). Genomic DNA was digested, and RNA was fragmented in the lysate using Turbo DNase (Thermo Fisher Scientific) and RNase I at 37°C. A 2% aliquot of the cleared chromatin was set aside as input, while the remaining lysate was incubated overnight at 4°C with Sheep Anti -Rabbit Dynabeads (Thermo Fisher Scientific) pre-bound to the NIPBL antibody. The Dynabeads were then washed three times with high-salt buffer (50 mM Tris-HCl, pH 7.4; 1 M NaCl; 1% IGEPAL CA-630; 1 mM EDTA; 0.1% SDS; 0. 5% sodium deoxycholate), followed by three washes with low-salt buffer (20 mM Tris-HCl, pH 7.4; 10 mM MgCl2; 0.2% polysorbate 20). Proteins were digested using proteinase K, followed by DNase treatment at 37°C for 30 minutes and an additional incubation at 50°C for 30 minutes. The supernatant was transferred to fresh tubes, and RNA was purified via phenol: chloroform: isoamyl alcohol (25: 24: 1, v / v) extraction and ethanol precipitation. Purified RNA was annealed with random hexamers and reverse transcribed using Maxima H Reverse Transcriptase at 25°C for 10 minutes, followed by 30 minutes at 50°C. Quantitative PCR was performed as described in the qRT-PCR section.

[0106] Antisense oligonucleotides (ASO). Antisense oligonucleotides (ASO) were designed and synthesized by Integrated DNA Technologies (IDT) with modif ications. ASOs were dissolved into 0. lx TE buffer to a final concentrationSJ0124WO PATENT of 100 pM. Electroporation was performed by mixing 2 pl with 18 pl P3 buffer containing 0. 5 million HUDEP-2 cells using the Lonza P3 primary cell 4D Nucleof ector-X kit. Cells were collected 48, 72, and 96 hours post -electroporation for downstream analyses (e.g., RT-qPCR analysis to measure gene expression). ASO sequences used in the analysis are provided in Table 1.TABLE 1represents a phosphorothioate (PS) backbone, "m" represents a ribose sugar modification, "+" represents that the next base is a LNA, and "2MOE" represents a 2 ' -methoxyethyl base.SJ0124WO PATENT

[0107] Quantification and statistical analysis. Statistical details, including sample size (N), mean values, and significance levels, are provided in the text, figure legends, or methods. Error bars represent either the standard error of the mean (SEM) or standard deviation (SD) from independent experiments or samples, unless otherwise specified. Statistical analyses were conducted using GraphPad Prism unless stated otherwise, with specific statistical methods detailed in the figure legends or methods section.Example 2: BCL11A is regulated by lineage-specific enhancers during hematopoiesis

[0108] To understand how BCL11A is transcriptionally regulated during development, its epigenetic state and mRNA expression in human and mouse hematopoietic lineages were analyzed. The lineage- and developmental stage-specific expression of BCL11A is associated with putative enhancer elements characterized by chromatin accessibility (ATAC-seq) and activating histone modifications, including H3K4mel (H3 -Lys4 monomethylation) and H3K27ac (H3 -Lys27 acetylation). This analysis further identified the +55, +58, and +62 enhancers of BCL11A (hereafter referred to as E+55, E+58, and E+62) (Bauer et al. (2013 ) Science (New York, NY) 342: 253 -257) as erythroid lineage- and developmental stage-specific, with ATAC-seq signals first appearing in lineage -committed colony forming unit -erythroid (CFU-E) cells and peaking in proerythroblasts (ProE).

[0109] Of note, despite the presence of active chromatin at the promoter and lineage-specif ic enhancers, the BCL11A locus is enriched with H3K27me3 (H3 -Lys27 trimethylation), a hallmark of Polycomb -mediated repressive chromatin Cao et al. (2002) Science (New York, NY) 298: 1039- 1043 ), in human erythroid, B- lymphoid, and myeloid lineage cells. In BCL11A-SJ0124WO PATENT expressing erythroid cells, a distinct H3K27me3 ChlP-seq peak is located at 13 - to 19-kb upstream of its TSS. However, in BCLllA-non-expressing cell types, such as T-lymphoid and NK cells, the H3K27me3 -marked repressive chromatin extends to encompass the promoter and gene body. The BCL11A locus contains seven distinct CTCF binding sites (CBS); however, the binding of CTCF remains largely consistent between BCL11A expressing and non-expressing cell types. Similar patterns are observed in mouse hematopoietic lineages. These findings indicate that, while BCL11A is regulated by lineage-specific enhancers in BCLllA-expressing hematopoietic lineages including erythroid cells, it undergoes developmentally regulated and evolutionarily conserved epigenetic silencing in BCLllA-negative lineages.Example 3: BCL11A enhancers are required for maintaining epigenetic insulation

[0110] To investigate how Casgevy™ CRISPR editing with a single guide RNA (sgl617) (Frangoul et al. (2021) New Engl. J. Med. 384: 252 -260; Frangoul et al. (2024) New Engl. J. Med.390: 1649-1662; Locatelli et al. (2024 ) New Engl. J. Med.390: 1663 -1676; Yen et al. (2024) New Engl. J. Med. 390: 1723 -1725) effectively disrupts BCL11A expression in relevant cellular contexts, the immortalized human erythroid progenitor cell line HUDEP-2 and primary erythroblasts derived from bone marrow CD34+ hematopoietic stem / progenitor cells (HSPCs) (Sankaran et al. (2008) Science (New York, NY) 322: 1839-1842; Kurita et al. (2013 ) PloS one 8: e59890) were employed. Both cell models exhibit active BCL11A transcription driven by intronic erythroid-specific enhancers, an adult -stage phenotype characterized by high p -globin and low y-globin expression, and H3K27me3 -marked repressive chromatin flanking the BCL11A locus.SJ0124WO PATENT

[0111] Using CRISPR / Cas9 and sgl617 ribonucleoproteins (RNPs), the same approach employed by Casgevy™ (Frangoul et al. (2021) New Engl. J. Med. 384: 252 -260), four independent single-cell -derived HUDEP-2 lines with homozygous 1bp insertion (+1bp) and 13bp or 15bp deletions (-13bp or -15bp) at the targeted E+58 enhancer, respectively, were generated. As controls, three single-cell-derived HUDEP-2 lines carrying homozygous deletions of a 10kb genomic region containing all three enhancers were also generated. In sgl617-edited or enhancer knockout (KO) HUDEP-2 cells, significant downregulation of BCL11A and reactivation of γ-globin (HBG) expression were confirmed (FIGS. 1A-1C). Strikingly, H3K27me3 -marked repressive chromatin extended to the BCL11A promoter and gene body in both sgl617-edited and enhancer KO HUDEP-2 cells. This was accompanied by decreased or loss of chromatin accessibility and diminished H3K27ac at the BCL11A promoter and enhancers. The marked increase in H3K27me3 was specific to the BCL11A locus, with no detectable changes observed at other genomic loci or across the genome.

[0112] To determine whether the effects on H3K27me3 were due to the disruption of enhancer function, two single-cell-derived HUDEP-2 lines with frameshift mutations in exon2 of the BCL11A coding sequence (hereafter Exon2 Mut) were generated. These mutations abolished BCL11A protein expression and reactivated HBG, but had no impact on BCL11A mRNA levels or enhancer activity (FIGS. 1A-1C). Importantly, no detectable changes in H3K27me3 levels or distribution were observed in BCL11A Exon2 Mut HUDEP-2 cells, indicating that enhancer inactivation drives the epigenetic silencing of BCL11A in erythroid cells.

[0113] To confirm these findings in human primary erythroblasts, RNPs containing CRISPR / Cas9 were introduced with sgl617 or control AAVS -targeting sgRNA (sgAAVS) intoSJ0124WO PATENT bone marrow CD34+ hematopoietic stem / progenitor cells (HSPCs) from healthy donors or SCD patients, followed by ex vivo erythroid lineage differentiation (Wu et al. (2019) Nature Med. 25: 776 -783; Newby et al. (2021) Nature 595: 295-302). This approach achieved INDEL frequencies of 96.5% and 96.0% at the sgl617-targeted E+58 enhancer in healthy and SCD HSPCs, respectively, resulting in significant BCL11A downregulation and HBG upregulation in primary erythroblasts (FIGS. 2A-2C). Notably, CRISPR editing of the E+58 enhancer in healthy or SCD HSPCs also markedly increased H3K27me3 levels at the BCL11A promoter and gene body in primary erythroblasts, with no detectable effects on other genomic loci or at genome-wide level.

[0114] Given the role of CTCF-mediated boundary function in regulating epigenetic spreading across chromatin domains (Bell et al. (1999) Cell 98: 387 -396 ), the contribution of CTCF-binding sites to BCL11A regulation in erythroid cells was investigated. Using CRISPR-mediated KO, single-cell-derived HUDEP-2 lines with homozygous deletions of each CTCF-binding site at the BCL11A locus were generated. Surprisingly, KO of individual CTCF-binding sites had no effect on BCL11A mRNA expression. Combined KO of two CTCF-binding sites, C-7 and C-12, located between the H3K27ac-marked active chromatin and H3K27me3 -marked repressive chromatin upstream of the BCL11A promoter, also did not affect BCL11A expression or H3K27me3 distribution. Similarly, combined KO of two CTCF-binding sites downstream of the BCL11A locus, C+114 and C+271, had no effect on BCL11A expression. Furthermore, acute CTCF protein degradation via the auxininducible degron (AID) system in HUDEP-2 cells (Hyle et al. (2023 ) Genome Biol. 24: 14) showed no impact on BCL11A transcription, as evidenced by unchanged levels of BCL11A primary transcripts and HBG mRNA.SJ0124WO PATENT

[0115] Together, these findings demonstrate the essential role of the E+58 enhancer in maintaining chromatin insulation, which facilitates transcription while preventing H3K27me3 -mediated epigenetic silencing of BCL11A in erythroid cells.Example 4: BCL11A locus is organized into enhancer-dependent chromatin structures

[0116] It was hypothesized that the E+58 enhancer orchestrates the formation of high-order chromatin architecture essential for chromatin insulation, thereby preventing BCL11A from undergoing epigenetic silencing. To test this, locus-specific 3D genome conformation was analyzed using short-read sequencing-based chromatin conformation capture (3C) assays in erythroid cells. Hi -C, which provides genome-wide chromatin interaction maps (Lieberman-Aiden et al. (2009) Science (New York, NY) 326: 289 -293 ), revealed that the topologically associated domain (TAD) and sub-TAD structures encompassing the BCL11A locus remain largely unchanged across BCL11A-expressing human HSPCs, primary erythroblasts, and B-lymphoid cells (GM12878), as well as BCL11A-negative T-lymphoid cells. However, due to its limited resolution, Hi -C is unable to resolve cell type-specific enhancer-promoter looping. To achieve higher resolution, Micro-Capture-C (MCC) (Hua et al. (2021) Nature 595: 125-129) was performed in HUDEP-2 cells targeting seven CTCF-binding sites at the BCL11A locus. MCC identified pairwise interactions among discrete CTCF sites, the BCL11A promoter, and erythroid enhancers. However, due to the use of small DNA fragments and short -read sequencing, MCC is unable to detect multi-way interactions, which are needed for resolving more complex high-order chromatin structures at the BCL11A locus.SJ0124WO PATENT

[0117] To this end, a new method was developed based on long-read Nanopore sequencing, which is referred to herein as Capture- Pore -C (CPC). The initial steps resemble those of conventional 3C-based assays, involving chromatin crosslinking, in situ digestion by restriction enzymes, proximity ligation, and de -crosslinking. However, instead of fragmenting the chromatin, large chromatin concatemers, averaging 10kb in length, were isolated that contain ligated DNA fragments representing chromatin interactions. Next, biotin- labeled probes targeting specific regions of interest were designed and two rounds of hybridization capture and size selection of the larger DNA fragments were performed, followed by library preparation and sequencing via the Nanopore PromethION® platform. The key advantages of CPC are its ability not only to capture pairwise interactions between different regions but also to detect bona fide multi -way interactions involving multiple regions simultaneously, providing a more comprehensive view of chromatin architecture.

[0118] Using CTCF binding sites as bait regions, pairwise interactions between each CTCF site and other genomic regions were identif ied. Notably, BCL11A enhancer KO or editing with sgl617 decreased CTCF-mediated interactions. When using BCL11A enhancers as bait regions, pairwise interactions mediated by each enhancer were detected. E+58 enhancer editing with sgl617 disrupted not only enhancer-promoter looping and E+58 enhancer-mediated interactions but also interactions involving the neighboring E+55 and E+62 enhancers. Therefore, the analysis of pairwise interactions using CPC revealed the formation of highly interactive chromatin loops between critical cis-regulatory elements (CREs) at the BCL11A locus, which are impaired by enhancer KO or editing.SJ0124WO PATENTExample 5: Enhancer -dependent chromatin configuration is required for epigenetic insulation

[0119] Multi-way interactions identified by CPC were analyzed and represented as line-dot graphs, where each line corresponded to an independent Nanopore sequencing read and each dot represented one captured bait region. Using CTCF binding sites as bait regions, it was observed that most multi-way interactions involved both upstream and downstream CTCF sites. BCL11A enhancer KO or editing with sgl617 not only decreased the number of multi -way interactions but also reduced their complexity and distribution. Notably, the multi-way interactions involving the upstream promoter and CTCF binding sites were among the most significantly affected chromatin interactions following E+58 enhancer editing.

[0120] When using BCL11A enhancers as bait regions, it was found that they form multi -way interactions with either the upstream promoter and CTCF sites or the downstream CTCF sites. Following CRISPR editing of the E+58 enhancer, a nearcomplete loss of intra -enhancer interactions among the E+55, E+58, and E+62 enhancers was observed, particularly those involving the E+58 enhancer. Moreover, BCL11A enhancer-mediated multi -way interactions with other critical CREs, including the BCL11A promoter and CTCF binding sites, were markedly reduced or entirely lost. A reorganization of multi way interactions between the BCL11A enhancers and CTCF binding sites was also noted, with markedly decreased interactions involving the upstream C-28 and C-12 sites and the downstream C+114 site, whereas interactions among the E+55 and E+62 enhancers and the distal C+217 site were increased.

[0121] Together, these results reveal lineage-specific assemblies of high-order chromatin structures that involveSJ0124WO PATENT both pairwise and multi -way interactions among all critical ci s-regulatory elements, including the BCL11A promoter, enhancers, and CTCF binding sites. These interactions collectively segregate the BCL11A locus into chromatin domains associated with distinct epigenetic states (FIG. 3 ). This structure, which was termed the "enhancer -dependent chromatin rosette, " is essential for chromatin insulation, protecting the locus from epigenetic silencing. Disruption of enhancer function impairs this insulation, leading to epigenetic spreading and gene silencing.Example 6: BCL11A E+58 enhancer RNA transcription is disrupted by CRISPR editing

[0122] The analysis of high-order chromatin architecture raised an important question regarding how E+58 enhancer editing impacts epigenetic insulation. To address this, PRO-cap and PRO-seq were performed, which provide base-pair resolution of nascent transcripts by mapping the location of active RNA polymerases (Mahat et al. (2016) Nature Protocols 11: 1455 -1476). In wild-type HUDEP-2 cells, the reverse strand exhibits transcription of BCL11A mRNA, while the forward strand shows strong signals at the enhancers with the highest signals observed at the E+58 enhancer, consistent with the production of enhancer RNAs (eRNAs) (Kim et al. (2010) Nature 465: 182 -187). Editing the E+58 enhancer with sgl617 resulted in the near-complete loss of eRNA transcription, with no detectable effects on eRNA production at other loci across the genome (FIG. 4 ). Notably, PRO-seq identified a strong TSS signal at chr2:60,495,297 within the E+58 enhancer, just 13bp downstream of the sg1617-targeted DNA sequences (chr2:60,495,264-60,495,283).

[0123] CRISPR editing with sgl617 generates a diverse set of INDELs within the E+58 enhancer, including a lbp insertionSJ0124WO PATENT and 13bp or 15bp deletions, at various frequencies in CD34 + HSPCs from healthy donors and SCD patients. The sgl617-mediated INDELs overlap with a GATA1 binding site predicted to be essential for E+58 enhancer activity (Canver et al. (2015) Nature 527: 192 -197; Wu et al. (2019) Nature Med.25: 776 - 783); however, the precise mechanism by which these INDELs effectively disrupt E+58 enhancer function remains unclear.

[0124] To investigate this, Puffin-D, a deep learning-based model (Dudnyk et al. (2024) Science (New York, NY) 384: eadj 0116), was employed to characterize TSS strength and location based on sequence features. Notably, Puffin-D identif ied a strong TSS signal from the reference genome sequence at the A nucleotide (chr2:60,495,297), which precisely aligns with the PRO-cap-identif ied TSS within the E+58 enhancer. More importantly, sgl6 17 - induced INDELs substantially decreased the TSS signal or shifted its location, with the strongest effects observed for deletions that removed the GATA1 binding site, such as 37bp, 15bp, and 13bp deletions. Of note, the most frequent INDEL in both healthy and SCD HSPCs, characterized by a single A nucleotide insertion into the GATA1 binding site, results in a marked reduction of the TSS signal for the E+58 eRNAs. Therefore, CRISPR editing of the E+58 enhancer generates INDELs to impair eRNA production by disrupting the transcriptional initiation of eRNAs.Example 7: BCL11A E + 58 eRNA orchestrates NIPBL and cohesin binding for epigenetic insulation

[0125] The 3D organization of the genome requires the cohesin complex to be loaded onto chromatin by the cohesin- loading factor NIPBL, which initiates and propagates loop extrusion until it encounters convergent CTCF binding sites, therebySJ0124WO PATENT establishing chromatin loops (Dekker & Mirny (2024) Cell 187: 6424 -6450). To investigate the roles of NIPBL and cohesin in BCL11A enhancer regulation, CUT& RUN analyses of the cohesin subunit SMC1, NIPBL and CTCF were performed in wildtype and sgl617-edited HUDEP-2 cells. In wild-type HUDEP-2 cells, SMC1 binds strongly to the promoter-proximal CTCF sites, whereas NIPBL exhibits the highest binding affinity at the BCL11A enhancers, particularly at the E+58 enhancer, suggesting its role in facilitating cohesin loading at this site. Editing the E+58 enhancer by sgl617 abolished NIPBL binding at the BCL11A enhancers and diminished cohesin occupancy at the BCL11A promoter and enhancers, but not other genomic loci. Cross -linking immunoprecipitation (CLIP) analysis further revealed that NIPBL interacts strongly with eRNAs transcribed from the E+58 enhancer. These findings indicate that NIPBL physically associates with E+58 eRNAs in erythroid chromatin, highlighting a crucial role for eRNAs in NIPBL-mediated cohesin loading at lineage-specific transcriptional enhancers.

[0126] To assess the functional role of E+58 eRNAs in enhancer-mediated epigenetic insulation, E+58 eRNAs were depleted using antisense oligonucleotides (ASOs) in erythroid cells. Two independent ASO pools (ASO- 12 and ASO-23 ), each containing equal molar amounts of two independent E+58 eRNA-targeting ASOs (i. e., E58_ASO1 and E58_ASO2 for " ASO-12;" and E58_ASO2 and E58_ASO3 for " ASO-23" ), achieved 62% and 55% depletion of E+58 eRNAs, respectively (FIG. 5A). E + 58 eRNA depletion using combinations of ASOs (FIGS. 5B-5D) or individual ASOs (FIGS. 6A-6C) resulted in signif icant downregulation of BCL11A and reactivation of HBG in HUDEP-2 cells. Likewise, E+55 eRNA depletion resulted in downregulation of BCL11A (FIG. 6A) and reactivation of HBG in HUDEP-2 cells (FIGS. 6B-6C). Notably, ASO-mediated BCL11ASJ0124WO PATENT silencing was associated with an increase in H3K27me3 -marked repressive chromatin at the BCL11A promoter, highlighting the essential role of E+58 and E+55 eRNAs in maintaining enhancer-mediated epigenetic insulation for BCL11A transcription.

[0127] Additional multiplexing experiments were conducted, which included the use of ASOs targeting different eRNAs (E+55 and E+58) or the same eRNA. The results of this analysis indicated that combining specific E+58 and E+55 eRNA-targeting ASOs achieved a greater reduction in BCL11A expression (FIG. 7A) and a higher HBG induction than multiplexing ASOs targeting the same eRNA (FIGS. 7A-7D).

[0128] To evaluate the efficacy of BCL11A eRNA- targeting ASOs in human primary CD34+ hematopoietic stem and progenitor cells (HSPCs) from healthy donors, human primary CD34+ hematopoietic stem and HSPCs were differentiated for 6, 8, 10, and 12 days. The differentiated cells were transduced with one or a combination of ASOs and 72 hours post-transduction the cells were analyzed for HBG mRNA expression. This analysis showed that all differentiation stages had HBG induction after treatment with ASOs targeting E+55 and E+58 eRNA, with the highest HBG induction achieved at differentiation day 6 (FIGS. 8A-8B). These results show a broad therapeutic window of ASO-mediated HBG induction in human erythroid progenitor cells and that erythroid progenitor cells, which are more abundant than CD34+ HSPCs in human bone marrow, may be targeted by eRNA ASOs, offering key advantages compared to HSPC-based gene editing therapies.

[0129] Collectively, these findings demonstrate that the E+58 and E+55 enhancers maintain chromatin insulation and prevent epigenetic silencing through two key functions: (1) serving as a TSS for eRNA production and (2) acting as a NIPBL and cohesin landing site to initiate chromatin loop formation. CRISPR editing of BCL11A enhancer disrupts bothSJ0124WO PATENT functions, causing destabilized chromatin conf iguration, impaired chromatin insulation, and epigenetic silencing of BCL11A.

Claims

SJ0124WO PATENT What is claimed is:

1. A composition comprising at least one inhibitor of BCL11A enhancer RNA (eRNA).

2. The composition of claim 1, wherein the BCL11A eRNA is BCL11A +58 eRNA or BCL11A +55 eRNA.

3. The composition of claim 1, wherein the at least one inhibitor of BCL11A eRNA inhibits BCL11A eRNA expression or activity.

4. The composition of claim 3, wherein the at least one inhibitor of BCL11A eRNA expression is an antisense compound.

5. The composition of claim 4, wherein the antisense compound comprises the nucleotide sequence of any one or more of SEQ ID NOs:1-20.

6. The composition of claim 4, wherein the antisense compound comprises the nucleotide sequence of any one or more of SEQ ID NOs: 21-40.

7. The composition of claim 1, wherein the composition comprises ( i) at least one inhibitor of BCL11A +58 eRNA, ( ii) at least one inhibitor of BCL11A +55 eRNA, or (iii) a combination of (i) and ( ii).

8. A method for increasing fetal hemoglobin levels in a mammal in need thereof comprising contacting a hematopoietic stem and / or progenitor cell in said mammal with an effective amount of a composition comprising at least one inhibitor of BCL11A enhancer RNA (eRNA), whereby fetal hemoglobinSJ0124WO PATENT expression is increased in said mammal, relative to expression prior to said contacting.

9. The method of claim 8, wherein the BCL11A eRNA is BCL11A +58 eRNA or BCL11A +55 eRNA.

10. The method of claim 8, wherein said mammal has been diagnosed with a hemoglobinopathy.

11. The method of claim 10, wherein the hemoglobinopathy is sickle cell disease or p-thalassemia.

12. The method of claim 8, wherein the hematopoietic stem and / or progenitor cell is a cell of hematopoietic stem cell or a cell of the erythroid lineage.

13. The method of claim 8, wherein the composition comprising the at least one inhibitor of BCL11A eRNA inhibits BCL11A eRNA expression.

14. The method of claim 13, wherein the at least one inhibitor of BCL11A eRNA expression is an antisense compound.

15. The method of claim 14, wherein the antisense compound comprises the nucleotide sequence of any one or more of SEQ ID NOs: 1-20.

16. The method of claim 14, wherein the antisense compound comprises the nucleotide sequence of any one or more of SEQ ID NOs: 21-40.

17. The method of claim 8, wherein the composition comprises ( i) at least one inhibitor of BCL11A +58 eRNA, ( ii)SJ0124WO PATENT at least one inhibitor of BCL11A +55 eRNA, or (iii) a combination of (i) and ( ii).

18. A method of treating, preventing, reducing, or ameliorating a hemoglobinopathy in a subj ect, comprising administering to the subj ect an effective amount of at least one inhibitor of a BCL11A enhancer RNA (eRNA), thereby treating, preventing, reducing, or ameliorating a hemoglobinopathy in the subj ect.

19. The method of claim 18, wherein the BCL11A eRNA is BCL11A +58 eRNA or BCL11A +55 eRNA.

20. The method of claim 19, wherein the hemoglobinopathy is sickle cell disease or p-thalassemia.

21. The method of claim 18, wherein the at least one inhibitor of BCL11A eRNA inhibits BCL11A eRNA expression.

22. The method of claim 21, wherein the at least one inhibitor of BCL11A eRNA expression is an antisense compound.

23. The method of claim 22, wherein the antisense compound comprises the nucleotide sequence of any one or more of SEQ ID NOs: 1-20.

24. The method of claim 22, wherein the antisense compound comprises the nucleotide sequence of any one or more of SEQ ID NOs: 21-40.

25. The method of claim 18, wherein the at least one inhibitor of the BCL11A eRNA comprises (i ) at least oneSJ0124WO PATENT inhibitor of BCL11A +58 eRNA, (ii) at least one inhibitor of BCL11A +55 eRNA, or (iii ) a combination of (i) and (ii).

Images