Application of pluripotent stem cells derived nanovesicles for the treatment of cardiovascular diseases

Abstract

In one aspect, the disclosure relates to human induced pluripotent stem cells comprising a deletion from exon 2 of β2-microglobulin, nanovesicles made from the same, methods of making the nanovesicles, cardiomyocytes comprising the nanovesicles, and methods of treating and / or promoting recovery from myocardial injury, such as, for example, heart attack, using the nanovesicles.

Description

ATTORNEY DOCKET NO. 222119-2300APPLICATION OF PLURIPOTENT STEM CELLS DERIVED NANOVESICLES FOR THE TREATMENT OF CARDIOVASCULAR DISEASESCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority upon U.S. Provisional Application No. 63 / 789,568, filed on April 16, 2025, which is incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support from Grant Nos. U01HL134764, P01 HL160476, R01HL131017, and R01HL149137, awarded by the National Institutes of Health. The government has certain rights in the invention.CROSS REFERENCE TO SEQUENCE LISTING

[0003] The genetic components described herein are referred to by sequence identifier numbers (SEQ ID NO). The sequence listing in written computer readable format (CRF) as an xml file named “222119-8911_Sequence_Listing. xml” created on April 15, 2025, and having a size of 35,848 bytes, is incorporated by reference in its entirety.BACKGROUND

[0004] Mammalian cardiomyocytes (CMs) exit the cell cycle shortly after birth; therefore, the CMs of adult mammalian hearts cannot proliferate to repair the damage caused by myocardial infarction (Ml). Thus, it remains a significant challenge to reactivate adult mammalian CM cell cycle activity. Human induced pluripotent stem cells (hiPSCs) are robustly proliferative and capable of differentiating into cells of any lineage, but they are also strongly tumorigenic. The cells that exit the site of administration can produce tumors in other organs and tissues. hiPSCs must be fully differentiated into somatic cell lineages before administration, and several efficient protocols for differentiating hiPSCs into CMs have been established. Nevertheless, the proportion of transplanted cells that become stably engrafted at the site of administration is exceedingly low, regardless of cell type, so much of the benefit associated with cell therapy is likely mediated by paracrine factors or extracellular vehicles (EVs) secreted by the engrafted cells. hiPSCs derived EVs (hiPSC-EVs) have been shown to reduce cell death, inflammatory response, and oxidative stress in mouse renal injury models, as well as exert anti-fibrotic effects in mouse liver injury models. EVs derived from mouse induced pluripotent stem cells (iPSCs), which are enriched inATTORNEY DOCKET NO. 222119-2300miRNAs and proteins with proangiogenic and cytoprotective properties, have been demonstrated to reduce myocardial apoptosis, increase left ventricular mass, and improved perfusion in the infarct zone in a mouse model of ischemia / reperfusion (l / R). In addition, EVs are acellular, eliminating the need for cell engraftment, and are unlikely to possess the oncogenic properties associated with direct iPSC administration.

[0005] However, EVs are generated by living cells and secreted into the culture medium, so yields are low, and the collection and purification procedures are both time- and labor-intensive. EVs also present the same antigens expressed by their parental cells, and at least one study has indicated that even autologous hiPSC-derived cells may be rejected by the recipient’s immune system, suggesting that EVs could also stimulate an undesirable immune response after administration.

[0006] Despite advances in cardiac repair research, there is still a scarcity of methods that are effective in reducing cell death, inflammatory response, and oxidative stress while also not being tumorigenic. An ideal method would have anti-fibrotic effects, could increase left ventricular mass, and could improve perfusion in an infarct zone for Ml patients. Such a method would involve components having high yields collected by simple methods and would be subject to simple purification procedures. Furthermore, the method would not stimulate an undesirable immune response. These needs and other needs are satisfied by the present disclosure.SUMMARY

[0007] In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, the disclosure, in one aspect, relates to human induced pluripotent stem cells comprising a deletion from exon 2 of [32-microglobulin, nanovesicles made from the same, methods of making the nanovesicles, cardiomyocytes comprising the nanovesicles, and methods of treating and / or promoting recovery from myocardial injury, such as, for example, heart attack, using the nanovesicles.

[0008] Other systems, methods, features, and advantages of the present disclosure will be or become apparent to one with skill in the art upon examination of the following drawings and detailed description. It is intended that all such additional systems, methods, features, and advantages be included within this description, be within the scope of the present disclosure, and be protected by the accompanying claims. In addition, all optional and preferred features and modifications of the described embodiments are usable in all aspects of the disclosure taught herein. Furthermore, the individual features of the dependent claims, as well as all optional andATTORNEY DOCKET NO. 222119-2300preferred features and modifications of the described embodiments are combinable and interchangeable with one another.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Many aspects of the present disclosure can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the principles of the present disclosure. Moreover, in the drawings, like reference numerals designate corresponding parts throughout the several views.

[0010] FIGs. 1A-1T show characterization ofB2MKOhiPSC-NVs. (FIG. 1A) Schematic illustration of the manufacturing ofB2MKOhiPSC-N Vs for cardiomyocyte protection and regeneration. (FIG. 1B) hiPSC-NV size was measured via nanoparticle tracking analysis. (FIG. 1C) hiPSC-NV morphology was evaluated via a transmission electron microscopy. (FIG. 1 D) The number of NVs or extracellular vesicles (EVs) generated per oneB2MKOhiPSC was calculated (n = 8 or 5 biological replicates). (FIGs. 1E-1P) hiPSC-CMs were incubated with PKH67-labeledB2MKOhiPSC-NVs for 4 h (FIGs. 1E-1G), 12 h (FIGs. 1H-1J), 24 h (FIGs. 1K-1M), and 96 h (FIGs. 1N-1P).B2MKOhiPSC-NVs were visualized by green fluorescence (FIGs. 1E, 1H, 1K, and 1N), hiPSC-CMs were visualized via phase-contrast (FIGs. 1F, 11, 1L, and 10), and the two images were merged to identifyB2MKOhiPSC-NVs that were internalized by the cells (FIGs. 1G, 1J. 1M, and 1P). hiPSC-CMs were incubated with PKH67-labeledB2MKOhiPSC-NVs for 24 hours, and lysosomes were labeled with LysoView™ 550. (FIG. 1Q)B2MKOhiPSC-NVs were visualized via green fluorescence, (FIG. 1R) hiPSC-CM lysosomes were visualized via red fluorescence, and (FIG. 1S) the merged images were used to determine the overlap between green and red fluorescences. (FIG. 1T) Quantification of the fractions (percentages) of green fluorescence (B2MKOhiPSC-NVs) overlapping red fluorescence (lysosome) and red fluorescence overlapping green fluorescence, respectively, using image J. Values were presented as mean ± SD. Independent t-test: *** p<0.001.

[0011] FIGs. 2A-2I show proteomic analyses revealed thatB2MKOhiPSC-NVs contained abundant proteins involved in biological processes related to ROS, the mitotic spindle, chromosomes, and the cell cycle. Proteomic analyses were performed onB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG.2A) Schematic representation of data-independent acquisition (DIA) quantitative proteomics and data analysis. (FIG. 2B) Principal component analysis (PCA) for the detected proteins inB2MKOhi pscsanC|B2MKOhiPSC-NVs. (FIG. 2C) Volcano plots comparing protein levels in B2MKO|-lipgQS anc| B2MKO|-ljp3Q_N\ / swith significantly upregulated proteins shown in red andATTORNEY DOCKET NO. 222119-2300downregulated proteins shown in green. (FIG. 2D) Venn diagram illustrating the number of proteins expressed inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 2E) Spearman correlation analysis of co-expressed proteins inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 2F) Biological processes (BP) enrichment analysis of co-expressed proteins inB2MKOhiPSCs andB2MKOhiPSC-NVs, with GO terms related to ROS, the mitotic spindle, chromosomes, and the cell cycle. (FIG.2G) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for co-expressed proteins inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 2H) Heatmap illustrating the magnitudes of co-expressed proteins related to ROS, the mitotic spindle, chromosomes, and the cell cycle in B2MKO|iipscs andB2MKOhiPSC-NVs. (FIG. 21) Protein-protein interaction network for proteins related to ROS, based on three independent analyses ofB2MKOhiPSCs andB2MKOhiPSC-NVs. (n = 3 biological replicates).

[0012] FIGs. 3A-3H showB2MKOhiPSC-NVs improvedB2MKOhiPSC-CM survival under hypoxia and in the presence of H2O2. (FIG. 3A)B2MKOhiPSC-CMs were cultured under hypoxia in the Hanks’ balance salt solution (HBSS) supplemented with the indicated concentrations ofB2MKOhiPSC-NVs for 24 hours. (FIG. 3B) Medium LDH levels were measured, normalized to the measurements in the absence ofB2MKOhiPSC-N s, and presented as a percentage (n=6 biological replicates). (FIG.3C) CCK-8 assay was performed to measure the viability ofB2MKOhiPSC-CMs cultured under hypoxia in HBSS alone or in HBSS with the indicated concentrations ofB2MKOhiPSC-NVs for 24 hours. The results were normalized to the measurements in the absence ofB2MKOhiPSC-NVs and presented as a percentage (n = 6 biological replicates). (FIG. 3D) Representative images of TUNEL-stainedB2MKOhiPSC-CMs cultured under hypoxia in HBSS alone or HBSS + 5 x 109B2MKOhiPSC-NVs / mL for 24 hours. (FIG. 3E) The proportion of cTnT+B2MKOhiPSC-CMs that were positive for TUNEL was calculated and presented as a percentage (n = 6 biological replicates).(FIG. 3F)B2MKOhiPSC-CMs were cultured with 200 pM H2O2, which was premixed with the indicated concentrations of B2MKOhiPSC-NVs, for 30 min. (FIG. 3G) Medium LDH levels were measured, normalized to the measurements in the medium with 200 pM H2O2 in the absence ofB2MKOhiPSC-NVs, and presented as a percentage (n=6 biological replicates). (FIG. 3H) The concentrations of H2O2 in HBSS after incubation with the indicated concentrations ofB2MKO|-ljpgQ. NVs were measured (n = 5 biological replicates). Values are presented as mean ± SD. FIGs. 3B, 3C. 3G, and 3H: one-way ANOVA followed by the Tukey test and FIG. 3D: independent T-Test; *P < 0.05, **P < 0.01 , and ***P < 0.001.

[0013] FIGs.4A-4F show AKT signaling pathway is involved in the cytoprotection ofB2MKOhiPSC-NVs from hypoxia. (FIG. 4A) Representative Western Blot images of hiPSC-CMs treated with orATTORNEY DOCKET NO. 222119-2300without 5 x 109 B2MKOhiPSC-NVs for protein expressions of pAKT and AKT. (FIG. 4B) Quantification of pAKT / AKT ratios (n = 4 biological replicates). Protein expression level of GAPDH was used as an internal control. (FIG. 4C) Representative images of hiPSC-CMs cultured in HBSS supplemented with DMSO, AKT inhibitor (iAKT), 5 x 1Q9 B2MKOhiPSC-NVs / mL, or iAKT + 5 x 109 B2MKOhiPSC-NVs / mL under hypoxic conditions for 24 hours. (FIG. 4D) Supernatants were collected to assess LDH levels LDH levels in supernatants after iAKT, 5 x 1O9 B2MKOhiPSC-NVs, or iAKT + 5 x 109 B2MKOhiPSC-NVs treatment were expressed as a percentage, normalized to the values from DMSO only, which were considered 100% (n = 4 biological replicates). (FIG. 4E) Representative TUNEL-stained images of hiPSC-CMs cultured in HBSS supplemented with DMSO, iAKT, 5 x 109 B2MKOhiPSC-NVs / mL, or iAKT + 5 x 109 B2MKOhiPSC-NVs / mL under hypoxia for 24 hours. (FIG.4F) Quantification of TUNEL+ hiPSC-CMs (n = 7 biological replicates). Values are presented as mean ± SD. FIG. 4B: independent T-Test at each time point and FIGs. 4D and 4F: one-way ANOVA followed by the Tukey test; *P < 0.05, **P < 0.01, and ***P < 0.001.

[0014] FIGs. 5A-5G showB2MKOhiPSC-NVs increase proliferation of cultured hiPSC-CMs. (FIG.5A) hiPSC-CMs were treated with the indicated concentrations ofB2MKOhiPSC-NVs and stained for phosphorylated histone 3 (pH3), cardiac troponin T (cTnT), and DAPI by immunofluorescence.(FIG. 5B) The proportion of hiPSC-CMs that were positive for pH3 was determined (n = 4 biological replicates). (FIG. 5C) hiPSC-CMs were treated with the indicated concentrations of B2MKO|-lipgQ.|\|s anc| stained for the presence of Aurora B Kinase (ABK), cTnT, and DAPI by immunofluorescence. (FIG. 5D) The proportion of ABK+ hiPSC-CMs under cytokinesis was determined (n = 5 biological replicates). (FIG. 5E) hiPSC-CMs were cultured with the indicated concentrations ofB2MKOhiPSC-NVs for 6 days, then harvested, fixed, stained with propidium iodide, and analyzed for cell cycle analysis using flow cytometry. The proportion of hiPSC-CMs in G2 / M phase was calculated (n = 5 biological replicates). (FIG. 5F) hiPSC-CMs were cultured with or without 5 x 109 B2MKOhiPSC-NVs / mL for 6 days and then counted (n = 4 biological replicates).(FIG. 5G) CCK-8 assay was performed to measure the proliferation of hiPSC-CMs after culturing with or without 5 x 109 B2MKOhiPSC-NVs / mL for 6 days. The results for hiPSC-CMs cultured with 5 x 109 B2MKOhiPSC-NVs / mL were normalized to the measurements from the absence ofB2MKOhiPSC-N Vs and presented as a percentage (n = 5 biological replicates). Values were presented as mean ± SD. FIGs. 5B, 5D, and 5E: one-way ANOVA followed by the Tukey test;FIGs. 5F-5G: independent T-Test; *P < 0.05, **P < 0.01, and ***P < 0.001.

[0015] FIGs. 6A-6F showB2MKOhiPSC-NVs promoted CM proliferation through the YAP signaling pathway. (FIG. 6A) Representative Western Blot images of hiPSC-CMs treated with or without 5ATTORNEY DOCKET NO. 222119-2300x 109 B2MKOhiPSC-NVs for the protein expression of pYAP and YAP. (FIG. 6B) Quantification of pYAP / GAPDH, YAP / GAPDH, and non-phosphorylated YAP (non-pYAP)ZGAPDH ratios (n = 5 biological replicates). Protein expression levels of GAPDH were used as an internal control. (FIG.6C) Representative images of hiPSC-CMs cultured in RPMI / B27 medium supplemented with DMSO, YAP inhibitor (iYAP), 5 x 109 B2MKOhiPSC-NVs / mL, or iYAP + 5 x 109 B2MKOhiPSC-NVs / mL for 24 hours. Cells were then immunofluorescently stained for YAP and cardiac troponin T (cTnT) protein. (FIG. 6D) Quantification of hiPSC-CMs with YAP protein expressed in the nuclei. The number of hiPSC-CMs with nuclear YAP expression was normalized to the number in the DMSO treatment, which was considered as the baseline (100%) (n = 5 biological replicates). (FIG. 6E) Representative images of hiPSC-CMs cultured in RPMI / B27 supplemented with DMSO, iYAP, 5X109 B2MKOhiPSC-NVs / mL, or iYAP + 5 x 109 B2MKOhiPSC-NVs / ml_ for 48 hours. Cells were then immunofluorescently stained for aurora B kinase (ABK) and cTnT expression. (FIG. 6F) Quantification of ABK-expressing hiPSC-CMs under cytokinesis (n = 5 biological replicates). Values were presented as mean ± SD. FIG. 6B: independent T-Test at each time point; FIGs. 6D and 6F: one-way ANOVA followed by the Tukey test; *P < 0.05, **P < 0.01, and ***P < 0.001.

[0016] FIGs. 7A-7G showB2MKOhiPSC-NV administration improved cardiac function measurements and reduced infarct size in mouse heart models of l / R injury. (FIG. 7A) Representative echocardiographic images collected 1 and 4 weeks after l / R induction and treatment, showing measurements of (FIG. 7B) left ventricular end-diastolic volume (LVEDV), (FIG. 7C) left ventricular end-systolic volume (LVESV), and (FIG. 7D) ejection fraction (EF). (FIG.7E) Sections of cardiac tissue from mice sacrificed at Week 4 were Masson-trichrome-stained.(FIG. 7F) Infarct size was calculated as the ratio of the lengths of the fibrotic region to the total circumference of the left ventricle (LV) and presented as a percentage. (FIG. 7G) The thickness of the LV wall was measured in the infarcted region of the hearts from l / R and l / R+NVs animals, as well as in the corresponding region of hearts from the Sham group. N=9 animals in each group, and values were presented as mean ± SD. FIGs. 7B-7D and 7G: one-way ANOVA followed by the Tukey test; FIG. 7F: unpaired T-Test; *P < 0.05, **P < 0.01, and ***P < 0.001.

[0017] FIGs. 8A-8N showB2MKOhiPSC-NV administration induces recipient CM proliferation after l / R induction in mouse hearts. Representative images of pH3 immunofluorescence were displayed for sections from the corresponding region of the Sham hearts (FIG. 8A), infarct border zone (BZ) of the l / R hearts (FIG. 8B), infarct zone (IZ) (FIG. 8C) and BZ (FIG. 8D) of the l / R + NVs hearts. (FIG. 8E) The density of pH3+ CMs was calculated for each animal group. Representative images of ABK immunofluorescence were shown for sections from the IZ (FIG.ATTORNEY DOCKET NO. 222119-23008F) and BZ (FIG. 8G) of the l / R + N Vs mice hearts. (FIG. 8H) The density of CMs positive for ABK was calculated for each animal group. Representative images of pH3 immunofluorescence were displayed for sections from the corresponding region of the Sham hearts (FIG. 81), BZ of the l / R (FIG. 8J) and the l / R + NVs (FIG. 8K) hearts. (FIG. 8L) The density of pH3+ CMs was calculated for each animal group. Representative images of ABK immunofluorescence were displayed for sections from BZ (FIG. 8M) of the l / R + NVs mice hearts. (FIG. 8N) The density of ABK+ dividing CMs was calculated for each animal group. Boxed regions in FIGs. 8A-8D, 8F-8G, 8I-8K, and 8M were displayed at a higher magnification in insets (seen separately on right-hand side of figures), respectively. N = 5 animals in each group for FIGs. 8E and 8H; N = 9 animals in each group for FIGs. 8L and 8N. Values were presented as mean ± SD. One-way ANOVA followed by the Tukey test: *P < 0.05, **P < 0.01, and ***P < 0.001.

[0018] FIGs. 9A-9D show B2MKO mutation was induced via deletion of 198- or 209-bp in exon 2 of B2M. (FIG. 9A) The CRISPR / Cas9 deletion strategy is displayed as a schematic illustration; guide RNA (gRNA) binding sites are identified with red arrowheads and the corresponding sequences are displayed in red font. (FIG. 9B) Sequencing chromatograms are displayed for the wild-type (WT) B2M sequence and the sequence in clones 39, 59, 64, and 66 confirmed that the 198-bp deletion was successful. (FIG. 9C) Sequencing chromatograms are displayed for the WT B2M sequence and the sequence in clone 55 confirmed that the 209-bp deletion was successful.(FIG. 9D) The B2M protein sequences in clones 39, 59, 64, 66, and 55 were aligned with the WT B2M protein sequence.

[0019] FIGs. 10A-10H show expression of histocompatibility proteins was significantly reduced inB2MKOhiPSCs. Protein expressions of HLA-A / B / C, B2M, HLA-E, HLA-G, HLA-DR / DQ / DP, and CD47 in (FIG. 10A) WThiPSCs and (FIG. 10B)B2MKOhiPSCs were evaluated by flow cytometry. The proportion of cells expressing (FIG. 10C) HLA-A / B / C, (FIG. 10D) B2M, (FIG. 10E) HLA-E, (FIG. 10F) HLA-G, (FIG. 10G) HLA-DR / DQ / DP, and (FIG. 10H) CD47 was quantified and presented as a percentage. Data were presented as mean ± SD. N = 5 biological replicates. Unpaired T-Test, * P<0.05 and ***P < 0.001.

[0020] FIGs. 11A-11E showB2MKOhiPSCs were morphologically normal and pluripotent with a normal karyotype. (FIG. 11 A) A phase-contrast imaging and (FIGs. 11B-11C) immunofluorescence imaging of (FIG. 11B) OCT3 / 4 and (FIG. 11C) SSEA4 protein expression were performed withB2MKOhiPSCs colonies. Nuclei were counterstained with DAPI in FIGs. 11B-11 C. (FIG. 11D) Two months afterB2MKOhiPSCs were injected into NOD-SCID immunodeficientATTORNEY DOCKET NO. 222119-2300mice, a teratoma was explanted, paraffin-embedded, sectioned, and stained with hematoxylin and eosin to identify muscle (*, mesoderm), epidermal tissue (T, ectoderm), and gastrointestinal glands (#, endoderm). (FIG. 11E) The Chromosomal structure ofB2MKOhiPSCs during metaphase was evaluated via karyotype analysis.

[0021] FIGs. 12A-12C show [32-microglobin (B2M) knockout (B2MKO) suppressed the immune response to interferon y treatment in hiPSC-CMs. WThiPSCs andB2MKOhiPSCs were differentiated intoCMs and cultured with or without 25 ng / mL interferon y (IFNy) for 48 hours. (FIG. 12A) Protein expression levels of B2M and Class II transactivator (CIITA) were evaluated by Western Blot. Quantification of (FIG. 12B) B2M and (FIG. 12C) CIITA protein levels via Western Blot. Each experiment conducted with 4 biological replicates. Data were presented as mean ± SD. One-way ANOVA followed by Tukey’s test: ***P < 0.001 vs all other sample.

[0022] FIG. 13 showsB2MKOhiPSC-NVs did not induce teratoma formation. NOD-SCID received subcutaneous injections of 3 x 1011 B2MKOhiPSC-NVs into the left flank and 2 x 106 B2MKOhiPSCs into the right flank. One and a half months later, a teratoma (*) formed in the right flank, while no tumor was detected in the left flank.

[0023] FIGs. 14A-14C showB2MKOhiPSC-NVs were less immunogenic than WThiPSC-NVs. (FIG.14A) In vitro, the proportions of CD8+ T cells that expressed either CD38, CD69 or co-expressed both CD38 and CD69 were determined by flow cytometry and expressed as a percentage (n = 5 biological replicates). (FIGs. 14B-14C) In vivo, the proportions of T lymphocytes expressing CD4, CD8, CD69, or co-expressing both CD8 and CD69 on days 1 (FIG. 14B) and 3 (FIG. 14C) after i.p. injection in C57BL mice were determined via flow cytometry and expressed as a percentage (n = 4 animals per group). Data were presented as mean ± SD. One-way ANOVA followed by the Tukey test. P < 0.05, **P < 0.01, and ***P < 0.001.

[0024] FIGs. 15A-15D show proteomic atlas ofB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 15A) Indexed retention time values of the internal standard calibration peptide. (FIG. 15B) Histogram showing the count of identified proteins inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 15C) Spearman correlation of the identified proteins inB2MKOhiPSCs andB2MKOhiPSC-NVs were calculated to assess the robustness of label-free quantification. (FIG. 15D) Heatmap of identified proteins inB2MKOhiPSCs andB2MKOhiPSC-NVs. (n = 3 biological replicates).

[0025] FIGs. 16A-16D show Gene Ontology (GO) enrichment analysis. The figure represented the enrichment analysis of biological process (BP), cellular component (CC), and molecular function (MF) for co-expressed proteins related to ROS (FIG. 16A), spindle (FIG. 16B),ATTORNEY DOCKET NO. 222119-2300chromosome (FIG. 16C) and the cell cycle (FIG. 16D) inB2MK°hiPSCs andB2MKOhiPSC-N s. (n = 3 biological replicates).

[0026] FIGs. 17A-17D show Kyoto Encyclopedia of Gene and Genomes (KEGG) enrichment analysis. KEGG pathways for co-expressed proteins related to ROS (FIG. 17A), spindle (FIG.17B), chromosome (FIG. 17C), and the cell cycle (FIG. 17D) inB2MKOhiPSCs andB2MKOhiPSC-NVs. (n = 3 biological replicates).

[0027] FIGs. 18A-18B show co-expressed proteins associated with ROS inB2MKOhiPSCs and B2MKO|-lipgQ.|\|\s(FIG. 18A) Heatmap of co-expressed proteins associated with ROS inB2MKOhi pscs andB2MKOhiPSC-NVs. (FIG. 18B) Top 4 anti-ROS-related proteins were more abundant inB2MKOhiPSC-NVs than inB2MKOhiPSCs. Raw protein abundance data were Iog10-transformed and analyzed using a two-tailed unpaired T-Test followed by Benjamini-Hochberg correction. P values above the line corresponded to the two-tailed unpaired T-Test results, while P values below the line represented the results after Benjamini-Hochberg correction, (n = 3 biological replicates).

[0028] FIGs. 19A-19B show co-expressed proteins associated with the spindle inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 19A) Heatmap of co-expressed proteins associated with the spindle inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 19B) Top 16 spindle-related proteins that were more abundant inB2MKOhiPSC-NVs than inB2MKOhiPSCs. Raw protein abundance data were Iog10-transformed and analyzed using a two-tailed unpaired T-Test followed by Benjamini-Hochberg correction. P values above the line corresponded to the two-tailed unpaired T-Test results, while P values below the line represented results after Benjamini-Hochberg correction, (n = 3 biological replicates).

[0029] FIGs. 20A-20B show co-expressed proteins associated with chromosomes in B2MKO|1ip3QS anc| B2MKO|-lip3Q.|\|\s(p|Q. 20A) Heatmap of co-expressed proteins associated with chromosomes inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 20B) Top 17 chromosome-related proteins that were more abundant inB2MKOhiPSC-NVs than inB2MKOhiPSs . Raw protein abundance data were log -transformed and analyzed using a two-tailed unpaired T-Test followed by Benjamini-Hochberg correction. P values above the line corresponded to the two-tailed unpaired T-Test results, while P values below the line represented results after Benjamini-Hochberg correction, (n = 3 biological replicates).

[0030] FIGs. 21A-21B show co-expressed proteins associated with the cell cycle inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG. 21 A) Heatmap of co-expressed proteins associated with the cell cycleATTORNEY DOCKET NO. 222119-2300inB2MKOhiPSCs andB2MKOhiPSC-NVs. (FIG.21B) Top 24 cell cycle-related proteins that were more abundant inB2MKOhiPSC-NVs than inB2MKOhiPSCs. Raw protein abundance data were Iog10-transformed and analyzed using a two-tailed unpaired T-Test followed by Benjamini-Hochberg correction. P values above the line corresponded to the two-tailed unpaired T-Test results, while P values below the line represented results after Benjamini-Hochberg correction, (n = 3 biological replicates).

[0031] FIGs. 22A-22B show validation of proteins which are more abundant inB2MKOhiPSCs derived nanovesicles (hiPSC-NVs) than inB2MKOhiPSC. (FIG. 22A) Representative Western Blot images of proteins involved in biological processes related to anti-ROS (PRDX2, PRDX6, and GSR), spindle (TPR, SKA2, RIF1, INCENP), chromosome (SKA2, RIF1, Ki67, CBX5, and INCENP), and the cell cycle (RBBP4 / 7, CKS1 / 2, RIF1, and TPR). (FIG. 22B) Quantification of validated proteins, which were expressed as percentages after normalization to GAPDH protein levels, (n = 4 biological replicates). Two-tailed unpaired T-Test: *** p-value < 0.001. Arrows indicated the respective protein bands.

[0032] FIGs. 23A-23D show cryo- preservedB2MKOhiPSC-NVs, stored at -80 °C for 3 weeks, improvedB2MKOhiPSC-CM viability under hypoxic conditions and in the presence of H2O2. (FIG.23A)B2MKOhiPSC-CMs were cultured under hypoxic conditions in the HBSS supplemented with the indicated concentrations ofB2MKOhiPSC-NVs, which were stored at -80 °C for 3 weeks, for 24 hours. (FIG. 23B) LDH levels in the cultured medium were measured, normalized to the levels in the absence ofB2MKOhiPSC-NVs, and presented as a percentage (n=5-6 biological replicates).(FIG.23C)B2MKOhiPSC-CMs were cultured in 200 pM H2O2, which was premixed with the indicated concentrations ofB2MKOhiPSC-NVs, for 30 min. (FIG. 23D) Medium LDH levels were measured, normalized to the levels in the medium with 200 M H2O2 in the absence ofB2MKOhiPSC-NVs, and presented as a percentage (n=6 biological replicates). FIGs. 23A and 23C displayed representative images from each experiment, and values were presented as mean ± SD. Statistical analysis in FIGs. 23B and 23D was performed using one-way ANOVA followed by the Tukey’s test: *P < 0.05, **P < 0.01, and ***P < 0.001 vs 0 NV.

[0033] FIGs. 24A-24G showB2MKOhiPSC-NV administration reduced CM apoptosis in mouse hearts with l / R injury. (FIGs. 24A-24C) Cardiac tissues were collected from the BZ region of the hearts from animals in the l / R group that were sacrificed 3 days after l / R induction. (FIG. 24A) TUNEL staining was performed, and nuclei were counterstained with DAPI. (FIG. 24B) CMs were visualized by staining for cardiac troponin I (cTnl). (FIG. 24C) The images were merged to identifyATTORNEY DOCKET NO. 222119-2300TUNEL-positive CMs. (FIGs. 24D-24F) Cardiac tissues were collected from the BZ region of the hearts from animals in the l / R+NV group that were sacrificed 3 days after l / R induction and (FIG.24D) TUNEL staining was performed, and nuclei were counterstained with DAPI. (FIG. 24E) CMs were visualized by staining for cTnl. (FIG. 24F) The images were merged to identify TUNEL-positive CMs. (FIG. 24G) The proportion of CMs that were positive for TUNEL staining was calculated and presented as a percentage. The boxed regions in FIGs. 24A-24F were displayed at higher magnification in insets shown magnified at the right of the images, respectively. n=4 animals per group and values were presented as mean ± SD. Independent t-test: **P < 0.01.

[0034] FIGs. 25A-25B showB2MKOhiPSC-NVs were internalized by mouse CMs one week after l / R induction. To assess the internalization ofB2MKOhiPSC-NVs by mouse CMs,B2MKOhiPSC-NVs were labelled with PKH67 (PKH67-NVs), a green fluorescent cell-binding dye, and injected into the hearts of mice after l / R induction. One week later, cryosections of mouse heart were stained with cardiac troponin I (cTnl) to identify mouse CMs. A representative image of PKH67-NVs (FIG.25A) located in the mouse myocardium, with cTnl staining (FIG. 25B) used to identify mouse CMs. The selected areas were further magnified in insets shown magnified at the right of the images, respectively.

[0035] FIGs. 26A-26F show corresponding Z-stack images from FIGs. 6A-6F for week-1 heart tissues. The Z-stack images showed pH3 protein expression in the sham group (FIG. 26A), the l / R group (FIG. 26B), and the l / R+NV group (FIGs. 26C-26D). Additionally, Z-stack images of ABK protein expression in the infarct zone (FIG. 26E) and border zone (FIG. 26F) were shown for the l / R+NV group.

[0036] FIGs. 27A-27D show corresponding Z-stack images from FIGs. 6A-6F for week-4 heart tissues. The Z-stack images showed pH3 protein expression in the sham group (FIG. 27A), the l / R group (FIG. 27B), and the l / R+NV group (FIG. 27C). Additionally, Z-stack images of ABK protein expression in the border zone (FIG. 27D) were shown for the l / R+NV group.

[0037] Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or can be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.DETAILED DESCRIPTIONATTORNEY DOCKET NO. 222119-2300

[0038] In one aspect, unlike EVs, nanovesicles (NVs) are manufactured products generated by extruding whole cells through nano-sized channels. In a further aspect, this process allows to produce NVs in clinically relevant quantities, with their contents consisting of the same proteins and nucleic acids that are present in their parental cells. In an aspect, NVs manufactured from MDA-MB-231 tumor cells, mesenchymal stem cells (MSCs), or hiPSCs have been reported in various studies. Further in this aspect, these studies typically characterized the profiles of NV cargo and assessed the function of NVs both in vitro and in vivo. MSCs derived NVs (MSC-NVs) have been shown to promote angiogenesis and neuroprotection in vitro, attenuate TNF-a induced inflammation in human coronary artery endothelial cells, and improve recovery from monocrotaline-induced pulmonary hypertension in rats. In one aspect, MSC-NV administration also promoted CM protection and mitosis in mouse hearts after l / R injury, while NVs derived from iron oxide nanoparticles-incorporated MSCs reduced apoptosis and fibrosis, and enhanced angiogenesis and cardiac function recovery in rat hearts after Ml.

[0039] In a further aspect, recognizing that hiPSCs have unlimited capacity for self-renewal and replication, and contain abundant cell cycle molecules and proteins involved in cell function and viability, herein hiPSC-NVs were used for cardiac protection and regeneration in a mouse model of l / R injury. In one aspect, the anoxia and reperfusion induced oxidative stress damages CMs, often leading to heart failure, as CMs in adult mammalian hearts do not proliferate. In still another aspect, the current study explored the potency and underlying mechanism of hiPSC-NVs for CM protection and cell cycle induction (i.e. cytokinesis) in cultured hiPSCs derived CMs (hiPSC-CMs) in vitro and in the hearts of mice after l / R injury in vivo, which has not yet been investigated.

[0040] In one aspect, although autologous hiPSC-NVs administration is preferred, ischemic heart disease often occurs alongside comorbid conditions (e g., diabetes, hypertension, and hypercholesterolemia) that may reduce the efficacy of autologous hiPSC-NVs for myocardial repair and regeneration. In a further aspect, to overcome this limitation, the immunogenicity of hiPSC-NVs was mitigated by knocking out the expression of [32-microglobulin (B2M) in hiPSCs (B2MKOhiPSCs) before manufacturing the NVs. In an aspect, this modification enabledB2MKOhiPSCs derived NVs (B2MKOhiPSC-NVs) to evade clearance by cytotoxic CD8 T lymphocytes after administration.Human Induced Pluripotent Stem Cell Line

[0041] In one aspect, disclosed herein is a human induced pluripotent stem cell (hiPSC) line having a deletion of from about 195 base pairs to about 215 base pairs from exon 2 of [32-ATTORNEY DOCKET NO. 222119-2300microglobulin. In some aspects, in the hiPSC line, the deletion is 198 base pairs and exon 2 of |32-microglobulin has SEQ ID NO. 8 after transcription. In other aspects, in the hiPSC line, the deletion is 209 base pairs and exon 2 of [32-microglobulin has SEQ ID NO. 9 after transcription.Nanovesicles and Method of Making

[0042] In another aspect, disclosed herein is a plurality of nanovesicles (NVs) manufactured from the hiPSC line. In an aspect, the NVs have average diameters of from about 70 nm to about 160 nm, or from about 90 nm to about 140 nm, or from about 110 nm to about 120 nm, or the NVs have an average diameter of about 115.9 nm. In another aspect, the NVs have lipid bilayer membranes. In a further aspect, the NVs have a zeta potential of from about -16 mV to about -9 mV, from about -15 mV to about -10 mV, or from about -14 mV to about -11 mV, or the NVs have a zeta potential of about -13.29 mV. In any of these aspects, an extruder can be used to manufacture the NVs. Further in this aspect, the extruder produces at least about 8000, about 8500, about 9000, or about 9500 NVs from a single hiPSC. In any of these aspects, the plurality of NVs are stable after prolonged cryopreservation.Cardiomyocytes

[0043] In another aspect, disclosed herein is a cardiomyocyte derived from an hiPSC line, wherein the cardiomyocyte includes one or more NVs of the plurality as described above. In still another aspect, a majority of the one or more NVs are not degraded in lysosomes of the cardiomyocyte. In a further aspect, the one or more NVs are not immunogenic.Method for Treating and / or Promoting Recovery from Myocardial Injury

[0044] In an aspect, disclosed herein is a method for protecting a cardiomyocyte from damage, the method including at least the step of administering a plurality of NVs as disclosed herein to the cardiomyocyte. In a further aspect, the damage can be hypoxia-induced damage, damage caused by a reactive oxygen species (ROS), or any combination thereof.

[0045] In another aspect, disclosed herein is a method for promoting cardiomyocyte proliferation, the method including at least the step of administering a plurality of NVs as disclosed herein to a cardiomyocyte or precursor thereof. In an aspect, the cardiomyocyte can be in an adult mammalian heart, or a juvenile, neonate, or fetal heart, a cell culture or tissue culture system, or the like. In another aspect, the cardiomyocyte precursor can be a stem cell in a cell culture or tissue culture system or can be administered to a subject in need thereof.ATTORNEY DOCKET NO. 222119-2300

[0046] In still another aspect, disclosed herein is a method for promoting recovery from myocardial injury in a subject, the method including at least the step of administering a plurality of NVs as disclosed herein to one or more cardiomyocytes in the subject. In one aspect, the myocardial injury can be an injury caused by myocardial infarction. In another aspect, administering the plurality of NVs improves cardiac function, reduces infarct size, or both. In one aspect, the plurality of NVs can be administered by injection. In still another aspect, the subject can be a human, non-human primate, mouse, rat, hamster, rabbit, guinea pig, dog, cat, horse, cattle, sheep, or goat.

[0047] Many modifications and other embodiments disclosed herein will come to mind to one skilled in the art to which the disclosed compositions and methods pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the disclosures are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. The skilled artisan will recognize many variants and adaptations of the aspects described herein. These variants and adaptations are intended to be included in the teachings of this disclosure and to be encompassed by the claims herein.

[0048] Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

[0049] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure.

[0050] Any recited method can be carried out in the order of events recited or in any other order that is logically possible. That is, unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.ATTORNEY DOCKET NO. 222119-2300

[0051] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein can be different from the actual publication dates, which can require independent confirmation.

[0052] While aspects of the present disclosure can be described and claimed in a particular statutory class, such as the system statutory class, this is for convenience only and one of skill in the art will understand that each aspect of the present disclosure can be described and claimed in any statutory class.

[0053] It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed compositions and methods belong. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the specification and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly defined herein.

[0054] Prior to describing the various aspects of the present disclosure, the following definitions are provided and should be used unless otherwise indicated. Additional terms may be defined elsewhere in the present disclosure.Definitions

[0055] As used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by”, “comprising,” “comprises”, “comprised of,” “including,” “includes,” “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, non-limiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of” and “consisting of.” Similarly, the term “consisting essentially of” is intended to include examples encompassed by the term “consisting of.ATTORNEY DOCKET NO. 222119-2300

[0056] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cardiomyocyte,” “a nanovesicle,” or “a myocardial injury,” include, but are not limited to, combinations, mixtures, or collections of two or more such cardiomyocytes, nanovesicles, or myocardial injuries, and the like.

[0057] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0058] When a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g. the phrase “x to y” includes the range from ‘x’ to ‘y’ as well as the range greater than ‘x’ and less than ‘y’. The range can also be expressed as an upper limit, e.g. 'about x, y, z, or less’ and should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘less than x’, less than y’, and ‘less than z’. Likewise, the phrase ‘about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x’, greater than y’, and ‘greater than z’. In addition, the phrase “about x’ to ‘y’”, where x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’”.

[0059] It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or subranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “about 0.1% to 5%” should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the sub-ranges (e.g., about 0.5% toATTORNEY DOCKET NO. 222119-2300about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.

[0060] As used herein, the terms “about,” “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about,” “approximate,” or “at or about” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0061] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0062] Unless otherwise specified, temperatures referred to herein are based on atmospheric pressure (i.e. one atmosphere).

[0063] Now having described the aspects of the present disclosure, in general, the following Examples describe some additional aspects of the present disclosure. While aspects of the present disclosure are described in connection with the following examples and the corresponding text and figures, there is no intent to limit aspects of the present disclosure to this description. On the contrary, the intent is to cover all alternatives, modifications, and equivalents included within the spirit and scope of the present disclosure.EXAMPLES

[0064] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and / or methods claimed herein are made and evaluated, and are intended to be purely exemplaryATTORNEY DOCKET NO. 222119-2300of the disclosure and are not intended to limit the scope of what the inventors regard as their disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric.Example 1: Materials and MethodsGeneration and characterization ofB2MKOhiPSCs

[0065] B2MKOhiPSCs were generated from an established hiPSC line via CRISPR / Cas9 gene editing. The original hiPSC line was reprogrammed from commercial neonatal human dermal fibroblasts (ATCC, USA) using the non-integrating Sendai virus carrying four reprogramming factors: OCT4, SOX2, KLF4, and C-MYC. hiPSCs were cultured in Matrigel-coated culture dishes with mTeSR Plus medium (Stemcell Technologies, Canada) until 70% confluence, then dissociated with TrypLE solution (Gibco, USA). For CRISPR editing, cells were incubated with 37.5 pM total sgRNA (Integrated DNA Technologies, Singapore), 1 pg spCas9 protein (TrueCut™ Cas9 Protein v2; Invitrogen, USA), and 1.25 pL R buffer (Neon transfection kit, Invitrogen, USA) for 20 minutes at room temperature to form ribonucleoprotein complexes. These complexes were electroporated into cells using the Neon transfection system (Invitrogen, USA) as directed by the manufacturer’s instructions. The 198- or209-bp sequences were excised from exon 2 of the B2M gene using sgRNA spacer sequences (ACAAAGTCACATGGTTCACA and TCACGTCATCCAGCAGAGAA). After electroporation, cells (500 to 5,000 cells / cm2) were seeded onto Matrigel-coated 6-well plates and cultured in mTeSR Plus for 5 days. Individual colonies were then transferred into separate wells of a 24-well plate and expanded for one week before genomic sequencing. Genomic DNA was isolated using Quickextract™ DNA extraction solution (QE09050, Lucigen, UK), and PCR and Sanger sequencing of the region of interest were performed with appropriate primers (Tables 1 and 2) to identify clones of B2MKohiPSCs. Potential off-target sites, as predicted by Benchling, were also sequenced to confirm the absence of any off-target edits. Sequencing data were analyzed using ICE Analysis v2.0 (<ice.synthego.com / # / >). Both B2MKohiPSCs and wild-type hiPSCs (^hiPSCs) were maintained in a feeder-free system with mTeSR and passaged every 4-5 days.Table 1 : Primers to Check Off-Target Sites for Proximal Guided RNAaSite Sequencing Primer PCR Forward Primer PCR ReversePrimerATTORNEY DOCKET NO.222119-23001 TGTCTCTATCTGGACAGC AACTCCTGGCCTCA AGTAGAGTCTGGG CCAC AGTGATCC CAACTGCAG2 TTCCCCAGTTACCCCATG AGCAGAGAAGGAAA GGTTTCACCATGTT ACAC GGTGGGTC AGCCAGGC3 AGGAGAAACAGAGGGGA TTCTCTCCCAGACA TAGCCAGGCTGGT AGACC AGCTCACC CTCAAACTC4 ACATGGAAGGGATTTCA ACCCAGGAAATTGG AAGGTCAAGCAAT GGCTG ACCCTCAG GTGCCAAGG5 TTCACTTCAGGACCTAAA TGTCCTTGAGTGCC AACATTGCAGCCA GTGC CAGTGTAG CAGGTGATGaSEQ ID NOs. 0-24Table 2: Primers to Check Off-Target Sites for Distal Guided RNAaSite Sequencing Primer PCR Forward Primer PCR Reverse Primer1 TGCCTACATCAAGGAAAC AAGAGACCTGCCAC TCCCCAAGTCTCCT ATGCAC AGCTACAG TTCACACC2 AGCCTAACAC I I I I I ATT AAGTGAACCCTTCC TGGGTGGAGTGTA CGGCC CTGTGGAG AGTGGTGTG3 TGGGACTTCTGAGGTAC ACACAGAGCTCTGA GAGTGTTGCTCAG ACTTGC TCCCTTGG TTGCATCCC4 CCACCCATTCGTTCATTC AGC I l l i CACTGCA TGCAGCTCCATTCA AACAAG ATGCTGTC CTAGGACC5 TGAGTCCTTGACTGTAGC CACGGAATGGCACC TTCCATCCTTCAGA TGCC AGTCAAAG CCAGGCTGaSEQ ID NOs. 25-39

[0066] Karyotyping was assessed as described previously. The pluripotency ofB2MKOhiPSCs was characterized via fluorescence immunostaining and teratoma formation assays. For fluorescence immunostaining, hiPSCs were fixed with 4% paraformaldehyde for 20 minutes at room temperature, permeabilized with 0.1% Triton X-100, and blocked with Ultra- block (Thermo Fisher, USA). The cells were then incubated overnight with primary antibodies (1: 100 dilution) of mouse anti-Oct3 / 4 or anti-SSEA-4 (SC-365509 or SC-21704; Santa Cruz, USA) in PBS containing 10% goat serum (10% PBS) overnight at 4 °C. On the second day, samples were incubated with PE-conjugated donkey anti-mouse IgG antibody (Jackson ImmunoResearch, USA) in 10% PBS for 1 hour at room temperature. The cells were labeled with 4',6-diamidino-2-phenylindole (DAPI), washed, and viewed under an Olympus fluorescence microscope. Teratoma formation was assessed by injecting 2 x 106 B2MKOhiPSCs into the flanks of NOD-SCID mice. The teratomas were explanted two months later, embedded in paraffin, sectioned, stained with hematoxylin and eosin, and examined under an Olympus microscope to identify endodermal, mesodermal, and ectodermal cells.ATTORNEY DOCKET NO. 222119-2300

[0067] Human leukocyte antigen class-1 (i.e., HLA-I-A / B / C, HLA-I-E, and HL -I-G), -II (i.e., HLA-ll-DR / DQ / DP), and CD47 (Table 3) expressions on hiPSCs were evaluated by flow cytometry.Generation and characterization ofB2MKOhiPSC-NVs

[0068] B2MKOhiPSCs were cultured to approximately 80% confluence, harvested with Versene, washed with DPBS, frozen in CryoStor (Stem Cell technologies, Canada), and stored at -80 °C. ForB2MKOhiPSC-NV production,B2MKOhiPSCs were washed three times with DPBS, resuspended in 5 mL DPBS, and passed through a mini-extruder (610000, Avanti Polar Lipids, USA) with a 0.2-pm filter membrane. The NV-containing supernatants were centrifuged at 1,200 RPM at 4 °C for 5 minutes to remove cellular debris. The supernatants were then diluted with DPBS to a final volume of 35 mL and ultracentrifuged at 24,000 RPM (55,768 g, 50 V39 rotor) using the Sorvall WX+ Ultra Centrifuge (Thermo Scientific, USA) and 4 °C for 2 hours. NV pellets were resuspended in 1 mL DPBS or 0.9% NaCI, passed through a 0.22-pm syringe filter, and stored at -80 °C. NV size and concentration were measured using the Nanosight NTA3.0 sub-micro particle imaging system (Malvern, USA), and NV morphology was imaged using a Technia T12 Spirit electron microscope. The zeta potential of theB2MKOhiPSC-NVs was measured using the ZETASIZER Nano series (Malvern, England).

[0069] To compare the efficiency of hiPSC-NV production yield with that of hiPSCs secreted EVs (hiPSC-EVs),B2MKOhiPSCs at 80% confluence were washed with DPBS and cultured in TeSR-E8 for 24 h. The cell number was counted, and the supernatant was collected and ultracentrifuged at 24,000 RPM at 4 °C for 2 hours. EV pellets were resuspended in 1 mL DPBS, passed through a 0.22-pm syringe filter, and stored at -80 °C. EV size and concentration were measured using a Nanosight.

[0070] To determine the tumorigenic risk of hiPSC-NVs, 3 x 1011 B2MKOhiPSC-NVs and 2 x 106B2MKOhi pscs Were injected into the left and right flanks of NOD-SCID mice, respectively. The mice were observed for up to 2 months.Uptake ofB2MKOhiPSC-NVs by hiPSC-CMs

[0071] To visualize the uptake ofB2MKOhiPSC-NVs, NVs in the supernatant were mixed with 1 mL of dilute C containing 4 pLof the PKH67 (MINI67, Sigma-Aldrich, USA) dye for5 minutes, followed by the addition of 2 mL of fetal bovine serum to stop the reaction. Then NVs were harvested as described above. hiPSC-CMs were cultured with PKH67-labeledB2MKOhiPSC-NVs for 24 h, and images were captured using an Olympus IX83 fluorescence microscope.ATTORNEY DOCKET NO. 222119-2300

[0072] To determine whetherB2MKOhiPSC-NVs would be directly internalized into lysosomes by the cells, hiPSC-CMs were incubated with PKH67 labeled B2MKOhiPSC-NVs for 24 hours, followed by incubation with LysoView™ 550 (Biotium, USA) as directed by the manufacturer’s instructions. Images of LysoView and PKH67-labeledB2MKOhiPSC-NVs in hiPSC-CMs were captured using an Olympus confocal fluorescence microscope and analyzed using JACoP Plugin of Imaged software. The results from the Manders' Coefficients (using thresholds) were used to calculate the percentages ofB2MKOhiPSC-NVs overlapping lysosomes or lysosomes overlapping withB2MKOhiPSC-NVs.hiPSC-NV immunogenicity

[0073] To determine whether B2M knockout could reduce the immunogenicity of N s, ^hiPSC derived NVs (mhiPSC-NVs) andB2MKOhiPSC-NVs were either co-cultured with human CD8+ T cells in vitro or injected into C56BL mice in vivo. Human CD8+ T lymphocytes (200-0164, Stem Cell Technologies) were cultured in blood cell growth medium (615-250, Sigma-Aldrich), either alone or supplemented with 5 * 109^hiPSC-NVs orB2MKOhiPSC-NVs for 24 hours at 37 °C. Afterward, CD8+ T cells were harvested and stained with anti-CD38 and anti-CD69 antibodies for 30 mins at 4 °C (Table 3). The proportion of CD8+ T cells expressing either CD38, CD69, or coexpressing both CD38 / CD69 was determined using a BD LSR Fortessa flow cytometer.Table 3: Antibodies Used for Flow CytometryPrimary antibody Volume Category number Company Mouse anti-|32 microglobulin-FITC 5 pL 395706 Biolegend Mouse anti-HLA-A / B / C-PE 5 pL 311406 Biolegend Mouse anti-HLA-E-APC 5 pL 342606 Biolegend Mouse anti-HLA-G-APC 5 pL 335909 Biolegend Mouse anti-HLA-DR / DQ / DP-FITC 5 pL 361706 Biolegend Mouse anti CD47-FITC 5 pL 323106 Biolegend Mouse anti-CD38-APC 5 pL 303510 Biolegend Mouse anti-CD69-PE 5 pL 310906 BiolegendRat anti-mouse CD3-PE 5 pL 100206 BiolegendRat anti-mouse CD4-FITC 5 pL 100406 BiolegendRat anti-mouse CD8a-FITC 5 pL 35-0081 Tonbo BiosciencesHamster anti-mouse CD69-PE 5 pL 104510 Biolegend

[0074] In vivo, C57BL mice were anesthetized with 2-2.5% isoflurane, and the site of intraperitoneal abdominal injection was disinfected. A total of 0.2 mLof 0.9% NaCI, with or without 3.2 x io11 B2MKOhiPSC-NVs orWThiPSC-NVs, was injected. One and three days later, mice were anesthetized with isoflurane, and 100 pL of blood was drawn from the retro-orbital plexus. TheATTORNEY DOCKET NO. 222119-2300blood was mixed with 9 x volume ACK lysing buffer (A10492-01, Gibco, USA) to remove red blood cells, and the remaining mononuclear cells were washed three times with 2% PBS, then resuspended in 2% PBS. The cells were stained with anti-CD3, anti-CD4, anti-CD8, and anti-CD69 primary antibodies (Table 3) for 30 mins at 4 °C. After washing with 2% PBS, the cells were resuspended in 2% PBS and analyzed using a BD LSR Fortessa flow cytometer.Proteomic analysis ofB2MKOhiPSCs andB2MKOhiPSC-NVs

[0075] B2MKOhiPSCs were cultured until 80% confluence, harvested, and washed with DPBS. The cells were then either lysed in 6 M Urea buffer or used to produceB2MKOhiPSC-NVs, which were also lysed in 6 M Urea buffer. Protein concentrations were determined using the Bradford Quantification method for lysates fromB2MKOhiPSCs, and the proteomic profiles were analyzed by Novogene Corporation Inc., (USA).

[0076] Trypsin treatment: Each protein sample was digested with trypsin, mixed with formic acid, and the pH was adjusted to below 3. The samples were then centrifuged at 12,000 g for 5 mins. The supernatant was loaded onto a C18 desalting column, washed with washing buffer (0.1% formic acid, 3% acetonitrile), and eluted with elution buffer (0.1% formic acid, 70% acetonitrile). The eluates from each sample were collected and lyophilized.

[0077] Data-dependent acquisition spectrum library construction: Data-dependent acquisition (DDA) spectrum library construction and data-independent acquisition (DIA) mode identification using UHPLC-MS / MS were performed by Novogene Corporation Inc., (USA).

[0078] Separation of fractions: Mobile phases A (2% acetonitrile, pH adjusted to 10.0 using ammonium hydroxide) and B (98% acetonitrile, pH adjusted to 10.0 using ammonium hydroxide) were used to develop a gradient elution. The lyophilized powder was dissolved in mobile phase A and centrifuged at 12,000 g for 10 mins at room temperature. Each sample was fractionated using a C18 column (Waters BEH C18, 4.6 x 250 mm, 5 pm) on a Rigol L3000 HPLC system, with the column oven set to 45°C. The eluate was monitored at UV 214 nm, collected at one tube per minute, and then combined into 4 or 6 fractions. All fractions were dried under vacuum and reconstituted in 0.1% (v / v) formic acid (FA) in water.LC-MS / MS Analysis in DDA mode

[0079] EASY-nLCTM-HFX: Mobile phases A (0.1% FA in H2O) and B (0.1% FA in 80% ACN) were used to develop a gradient elution. For transition library construction, shotgun proteomics analyses were performed using an EASY-nLCTM 1200 UHPLC system (Thermo Fisher,ATTORNEY DOCKET NO. 222119-2300Germany) coupled with a Q Exactive™ HF-X mass spectrometer (Thermo Fisher, Germany) operating in DDA mode. A half sample, containing 4 pg of fraction supernatant and 0.8 pl of reagent, was injected into a homemade C18 Nano-Trap column (4.5 cm x 75 pm, 3 pm). Peptides were separated using a homemade analytical column (15 cm x 150 pm, 1.9 pm), and a linear gradient elution method. The separated peptides were analyzed using the Q Exactive™ HF-X mass spectrometer (Thermo Fisher), with a Nanospray Flex™ ion source. The spray voltage was set to 2.1 kV, and the ion transport capillary temperature was set to 320 °C. Full scans were performed with a range of m / z 350 to 1500, a resolution of 120,000 (at m / z 200), an automatic gain control (AGC) target value of 3 * 106, and a maximum ion injection time of 80 ms. The top 40 precursors with the highest abundance in the full scan were selected and fragmented by higher energy collisional dissociation and analyzed in MS / MS mode with a resolution of 15,000 (at m / z 200), an AGC target value of 5 x 1 o4, a maximum ion injection time of 45 ms, a normalized collision energy of 27%, an intensity threshold of 1.1 x 104, and a dynamic exclusion of 20 s. The raw MS data o files were saved as “.raw” and used to construct the DDA spectrum library.

[0080] nanoElute-timsTOF Pro2: Mobile phase A (100% water, 0.1% formic acid) and B (80% acetonitrile, 0.1% formic acid) were prepared. The lyophilized powder was dissolved in 10 pL mobile phase A and centrifuged at 14,000 g for 20 mins. Shotgun proteomics analysis was performed using a nanoElute UHPLC system (Bruker, Germany) coupled with a timsTOF Pro2 mass spectrometer (Bruker, Germany) operating in DDA mode. Peptides were separated using a homemade analytical column (25 cm x 75 pm, 1.6 pm) with linear gradient elution. The separated peptides were analyzed by the timsTOF Pro2, with a Captive Spray ion source and a spray voltage of 1.5 kV. Full scans were performed with a range of m / z 100 to 1700. The ramp time was 100 ms, and Lock Duty Cycle was set to 100%. PASEF settings were as follows: 10 MS / MS scans during 1.17 sec, ion intensity cutoff was set to 2,500, and the scheduling target was set to 10,000. The raw MS data files were saved as “.d”.LC-MS / MS Analysis in DIA mode

[0081] EASY-nLCTM-HFX: Mobile phases A (0.1% FA in H2O) and B (0.1% FA in 80% ACN) were used to develop a gradient eluant. A half sample, containing 4 pg fraction supernatant and 0.8 pl reagent, was injected into the EASY-nLCTM 1200 UHPLC system, which was coupled with an Q ExactiveTM HF-X mass spectrometer operating in DIA mode. The system used a spray voltage of 2.1 kV, Nanospray Flex™ ion source, and a capillary temperature of 320°C. For DIA acquisition, the m / z range was set from 350 to 1500. The MS1 resolution was set to 60,000 (atATTORNEY DOCKET NO. 222119-2300m / z200), with an AGC target value of 5 * 105and a maximum ion injection time of 20 ms. Peptides were fragmented by higher energy collisional dissociation in MS2, in which the resolution was set to 30,000 (at 200 m / z), with an AGC target value of 1 x 1 o6, and a normalized collision energy of 27%. The raw data from the MS detection was saved as “.raw”.

[0082] nanoElute-timsTOF Pro2: Mobile phase A (100% water, 0.1% formic acid) and mobile phase B (80% acetonitrile, 0.1% formic acid) were prepared. The lyophilized powder was dissolved in 10 pL mobile phase A and centrifuged at 14,000 g for 20 mins. Shotgun proteomics analysis was performed using the nanoElute UHPLC system, which was coupled with a timsTOF Pro2 mass spectrometer operating in the DIA mode. Peptides were separated using a homemade analytical column (25 cm x 75 pm, 1.6 pm) with linear gradient elution. The separated peptides were analyzed by the timsTOF Pro2, with a Captive Spray ion source and a spray voltage of 1.5 kV. The full scan range was set from m / z 100 to 1700. The ramp time was 100 ms, and the Lock Duty Cycle was set to 100%. The window size was 25 Da, and the number of mobility windows was 2. The raw data from the MS detection was saved as “.d”.Proteomic data analysis

[0083] Raw DDA data were analyzed using Spectronaut-Pulsar (Biognosys AG, Switzerland) with default settings for initial peptide identification. A total of 87,682 peptides and 9,385 proteins were identified after searching the homo_sapiens_uniprot_2021_7_15.fasta.fasta (202160 sequences) database with trypsin designated as the digestion enzyme. The mass tolerance of the precursor ion was 10 ppm and mass tolerance of the product ion was 0.02 Da. Carbamidomethylated cysteine residues were specified as the fixed modification, acetylation was specified as the N-Terminal modification, and oxidation of methionine was specified as a dynamic modification. A maximum of 2 missed cleavage sites was allowed, and peptide-spectrum matches (PSMs) with a reliability >99% were designated as valid. Each identified protein contained at least one unique peptide. PSMs and protein levels with false discovery rates (FDR) not exceeding 1.0 % were retained. Mixed peptides were processed in DDA mode to generate the proteomic library and produce the ion-pair chromatographic peaks.

[0084] Raw DIA data were analyzed using Spectronaut-Pulsar (Biognosys AG, Switzerland), employing ion-matching and peak-area calculations for both qualitative and quantitative identification. A total of 81,108 peptides and 8,304 proteins were identified. Item response theory was applied to the sample to correct for retention time, and the precursor ion Q-value cutoff was set to 0.01. Identified PSMs and protein levels with false discovery rates not exceeding 1.0% wereATTORNEY DOCKET NO. 222119-2300retained. Decoy generation was performed using a mutation-based strategy, similar to scrambling, which randomly swaps amino acid positions (minimum = 2, maximum = half of the peptide length). The standardization strategy was set to global normalization. Statistical analysis of protein quantification was performed using the T-test.

[0085] Heatmap analysis was performed using the pheatmap package (<CRAN.R-project.org / package = pheatmap>). Functional annotation was carried out using blast2G0 version 5, and gene ontology (GO) enrichment analysis was performed with GOATOOLS. The Kyoto Encyclopedia of Genes and Genomes (KEGG) signaling pathway analysis was conducted using the KEGG mapper (<www.kegg.jp>). The Voronoi overview of signaling pathways was analyzed using Reactome (<reactome.org>). Protein-protein interaction (PPI) networks were generated using STRING (<cn.string-db.org>) and visualized in Cytoscape (<cytoscape.org / >). The proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner: PXD062056.Western Blot analysis to validate proteins which are more abundant inB2MKOhiPSC-NVs than inB2MKOhiPSCs

[0086] B2MKOhiPSCs andB2MKOhiPSC-NVs were lysed using M-PER Mammalian Protein Extraction Reagent. Total protein concentrations were determined using the Bradford Quantification method. Proteins were separated on a 4-20% Mini-PROTEAN® TGX Precast Protein Gels (Bio-Rad, USA) and subsequently transferred to a polyvinylidene difluoride (PVDF) membrane. After blocking with 5% non-fat milk in Tris-buffered saline with Tween-20 (TBST), the blots were incubated with primary antibodies (Table 4) overnight at 4 °C: PRDX2, PRDX6, GSR, TPR, SKA2, CBX5, INCENP, RBBP4 / 7, CKS1 / 2, Ki67, and RIF1. Detection was performed using goat anti-rabbit or anti-mouse IgG conjugated with horseradish peroxidase (HRP). The binding of antibodies was visualized using the SuperSignal West Femto Maximum Sensitivity Substrate (34095, Thermo Scientific) and captured with the ChemiDoc™ MP System (Bio-Rad, USA). Protein expression levels were normalized to GAPDH and expressed as percentages of GAPDH.Table 4: Antibodies Used in Western Blot AnalysisPrimary Antibody Dilution Category Company Second Dilution Company No. AntibodyRabbit anti 1 :1000 4370S Cell Goat anti- 1 :4000 Cell phosphorylated ERK1 / 2 Signaling rabbit-IgG-HRP Signaling (Thr202 / Tyr204)Rabbit anti ERK1 / 2 1 :1000 9102S Cell Goat anti- 1 :4000 CellSignaling rabbit-IgG-HRP SignalingATTORNEY DOCKET NO. 222119-2300Rabbit anti 1 :1000 4511S Cell Goat anti- 1 :4000 Cell phosphorylated Signaling rabbit-IgG-HRP Signaling P38MAPK(Thr180 / Tyr182)Rabbit anti P38MAPK 1 :1000 9212S Cell Goat anti- 1 :4000 Cell Signaling rabbit-IgG-HRP Signaling Rabbit 1 :1000 4060S Cell Goat anti- 1 :4000 Cell antiphosphorylated Signaling rabbit-IgG-HRP Signaling AKT(S473)Rabbit anti AKT 1 :1000 9272S Cell Goat anti- 1 :4000 Cell Signaling rabbit-IgG-HRP Signaling Rabbit anti GAPDH 1 :5000 2118S Cell Goat anti- 1 :10000 Cell Signaling rabbit-IgG-HRP Signaling Rabbit anti-B2M 1 :1000 ab218230 Abeam Goat anti- 1 :4000 Cell rabbit-IgG-HRP Signaling Rabbit anti-CIITA 1 :400 ab7541 Abeam Goat anti- 1 :1000 Cell rabbit-IgG-HRP Signaling Rabbit anti1 :500 13008S Cell Goat anti- 1 :2000 Cell phosphorylated YAP Signaling rabbit-IgG-HRP Signaling (ser127)Rabbit anti-YAP 1 :500 14074S Cell Goat anti- 1 :2000 Cell Signaling rabbit-IgG-HRP Signaling Mouse anti-PRDX2 1 :500 SC- Santa Goat anti- 1 :2000 Perkin 515428 Cruz mouse-IgG- Elmer HRPMouse anti-PRDX6 1 :100 SC- Santa Goat anti- 1 :500 Perkin 166454 Cruz mouse-IgG- Elmer HRPMouse anti-GSR 1 :500 SC- Santa Goat anti- 1 :2000 Perkin 133245 Cruz mouse-IgG- Elmer HRPMouse anti-TPR 1 :100 SC- Santa Goat anti- 1 :500 Perkin 101294 Cruz mouse-IgG- Elmer HRPMouse anti-SKA2 1 :500 SC- Santa Goat anti- 1 :2000 Perkin 514495 Cruz mouse-IgG- Elmer HRPMouse anti-HP1a 1 :100 SC- Santa Goat anti- 1 :500 Perkin (CBX5) 130446 Cruz mouse-IgG- Elmer HRPMouse anti-INCENP 1 :100 SC- Santa Goat anti- 1 :500 Perkin 376514 Cruz mouse-IgG- Elmer HRPMouse anti-CKS1 / 2 1 :100 SC- Santa Goat anti- 1 :500 Perkin 376663 Cruz mouse-IgG- Elmer HRPRabbit anti-Ki67 1 :100 ab16667 Abeam Goat anti- 1 :500 Perkin rabbit-IgG-HRP Elmer Mouse anti-RI F1 1 :100 SC- Santa Goat anti- 1 :500 Perkin 515573 Cruz mouse-IgG- Elmer HRPMouse anti-RBBP4 / 7 1 :500 SC- Santa Goat anti- 1 :1000 Perkin 373873 Cruz mouse-IgG- ElmerHRPATTORNEY DOCKET NO. 222119-2300Cytoprotection ofB2MKOhiPSC-NVs on hiPSC-CMs under hypoxia

[0087] The lactate dehydrogenase (LDH) assay: the cy to protective effect of freshly prepared and cryo-preserved (stored at -80 °C for 3 weeks)B2MKOhiPSC-NVs was assessed. hiPSC-CMs were cultured in 12-well plates and washed three times with DPBS. Cells were, then, cultured in 500 pL Hanks balanced salt solution (HBSS), supplemented with or without 6.25 x 107to 10 x 109B2MKOhiPSC-NVs / mL, and incubated under hypoxic conditions (4.5% O2, 5% CO2, and 90.5% N2) for 24 hours 8, 9. The supernatant was collected to determine LDH intensity using the Cytotoxicity Detection Kit (Roche, USA), following the manufacturer’s instructions.

[0088] The cell counting Kit-8 (CCK-8) assay: to assess cell viability after hypoxia and treatment withB2MKOhiPSC-NV, hiPSC-CMs were cultured in 48-well plates with 200 pL HBSS, supplemented with or without 6.25 x 107to 10 x 109 B2MKOhiPSC-NVs / mL, and incubated under hypoxic conditions (4.5% O2, 5% CO2, and 90.5% N2) for 24 hours 8, 9. After incubation, 20 pL CCK-8 buffer (AR1160, Boster Bio) was added to each well, and cells were incubated at 37 °C for 4 h. The absorbance of the supernatant was measured at 450 nm using a TECAN microplate reader. Results were presented as percentages, after normalized to the measurement in the supernatant withoutB2MKOhiPSC-NV treatment, which was considered 100%.

[0089] Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assessment of apoptosis: to visualize apoptotic cells, hiPSC-CMs subjected to hypoxia were assessed using the In situ Cell Death Detection Kit (Roche, Germany). Briefly, cells were fixed, permeabilized, and incubated with 10% PBS containing a 1:100 dilution of rabbit anti-cardiac troponin T (cTnT, ab91605, Abeam, USA) overnight at 4 °C. On the second day, samples were incubated with 1:200 donkey anti-rabbit IgG conjugated with either tetramethylrhodamine (TRITC) or fluorescein isothiocyanate (FITC) for 1 h. After washing, the samples were incubated with the TUNEL reaction mixture (Fluorescein orTMR Red) for 1 h at 37 °C in the dark. Nuclei were then counterstained with DAPI, and apoptosis was evaluated by counting the number of TUNEL+ CM nuclei relative to the total number of CM nuclei in each field.

[0090] Western Blot: to determine which signaling pathways were involved in the cytoprotection of hiPSC-CMs treatment withB2MKOhiPSC-NVs, three key pathways, including ERK1 / 2, p38MAPK, and AKT, were assessed. hiPSC-CMs treated with DPBS or 5 x 109 B2MKOhiPSC-NVs / mL were harvested at various time points (0, 0.5, 1.5, 3, 6, and 24 hours), and total proteins were isolated using M-PER Mammalian Protein Extraction Reagent (78501, Thermo Scientific). Proteins wereATTORNEY DOCKET NO. 222119-2300separated on a 10% Mini-PROTEAN TGX Precast Gel (4561036, Bio-Rad), transferred to nitrocellulose membrane, and blocked with 5% non-fat milk in TBST. Blots were incubated overnight at 4 °C with primary antibodies (Table 4): rabbit anti-phosphorylated ERK1 / 2, ERK1 / 2, phosphorylated P38MAPK, P38MAPK, phosphorylated AKT (pAKT), AKT, and GAPDH. The next day, goat anti-rabbit IgG conjugated with HRP was used to detect the binding of antibodies. The binding of antibodies was visualized using the SuperSignal West Femto Maximum Sensitivity Substrate and captured using ChemiDoc™ MP System. Protein expression levels were normalized to GAPDH and expressed as percentages of GAPDH.

[0091] Inhibitor treatment: to assess whether blocking the upregulated pathway could inhibit the cytoprotective effect byB2MKOhiPSC-NVs, hiPSC-CMs were pre-treated 5 pM MK-2206 (HY-108232, MedChem Express), an AKT inhibitor, for 30 mins before the addition of 5 x 109B2MKOhiPSC-NVs / mL. Cells were then cultured under hypoxic conditions for 24 hours. The supernatants were collected to measure LDH intensity, and apoptotic hiPSC-CMs were visualized using an In situ Cell Death Detection Kit, as described above.H2O2 scavenging effect ofB2MKOhiPSC-NVs

[0092] To assess whetherB2MKOhiPSC-NVs can protect hiPSC-CMs from ROS-induced injury, HBSS containing 200 pM H2O2 was mixed with 6.25 x 107to 10 x 109 B2MKOhiPSC-NVs / ml_ or without NVs for 10 mins at room temperature. The mixtures were then used to culture hiPSC-CMs for 30 min in an incubator at 37 °C. The supernatants were collected to determine the LDH intensity as described.

[0093] After incubation with 6.25 x 107to 10 x 109 B2MKOhiPSC-NVs / mL for 10 mins, the concentrations of H2O2 in HBSS, which originally contained 200 pM H2O2, were measured using the Hydrogen Peroxide Assay Kit (ab138886, Abeam).Differentiation, purification, and characterization ofB2MKOhiPSC-CMs

[0094] hiPSCs were differentiated into hiPSC-CMs as described previously. hiPSC-CMs were purified for 6 days as described previously.

[0095] Interferon-y (I FNy) stimulation: ^hiPSC-CMs andB2MKOhiPSC-CMs were cultured in RPMI medium supplemented with a 100x dilution of B27 (B27 / RPMI) with or without 25 ng / mL IFNy for 48 h. Proteins were extracted with PhosphoSafe™ Extraction Reagent (Merck, Germany) for Western Blot. Briefly, proteins were separated on an SDS-polyacrylamide gel, transferred onto nitrocellulose membranes, and blocked with 5% non-fat milk in TBST. The membranes were thenATTORNEY DOCKET NO. 222119-2300incubated with rabbit anti-B2M or rabbit anti-Class II transactivator (CIITA) (Table 4) primary antibodies at 4 °C overnight. Goat anti-rabbit IgG conjugated with HRP was used to detect the binding of antibodies. Imaging the specifically targeted proteins was performed as described above.Proliferation of cultured hiPSC-CMs

[0096] Immunofluorescence staining: hiPSC-CMs (1.5 x 104cells / well) were seeded into the wells of 4-well chamber slides and cultured in 1 mL B27 / RPMI medium with or without 2.5 x 109, 5 x 109, or 10 x 109 B2MKOhiPSC-NVs / ml_ for 48 hours. The cells were fixed, permeabilized, blocked, and incubated with 10% PBS containing either a 1:200 dilution of rabbit anti-phospho-Histone H3 (Ser10) (pH3, 06-570, Millipore-Sigma, USA) or a 1: 50 dilution of rabbit anti-Aurora B kinase (ABK, ab2254, Abeam, USA) at 4 °C overnight. On the second day, donkey anti-rabbit IgG conjugated with FITC was applied to visualize pH3 or ABK protein expression. hiPSC-CMs were visualized using a 1:20 dilution of mouse anti-cardiac troponin T (cTnT, 564767, BD) antibody conjugated with phycoerythrin (PE). hiPSC-CMs (i.e., cTnT-positive cells) that expressed pH3 or ABK with disassembled sarcomeres and cleavage furrows were counted and reported as a fraction of 10,000 hiPSC-CMs.

[0097] Cell number count: The proliferation of hiPSC-CMs was evaluated by culturing the cells with or without 5 x 109 B2MKOhiPSC-NVs / ml_ in 6-well plates (2 x 1O5cells / well in 2 mL B27 / RPMI). The medium was changed every 2 days for 6 days, after which the cells were counted. The results were expressed as percentages after normalized to the starting cell number (2 x 105cells / well). Additionally, on day 6, 100 pL of CCK-8 buffer was added to each well, and the cells were incubated at 37°C for 4 h. Supernatants were collected, and absorbance was measured at 450 nm using a TECAN microplate reader. The results were presented as percentages, normalized to the measurement from the supernatant withoutB2MKOhiPSC-NV treatment, which was considered as 100%.

[0098] Flow cytometry for cell cycle analysis: for cell cycle analysis, 5 x 105hiPSC-CMs were cultured in B27 / RPMI supplemented with 5 x 109or 10 x 109 B2MKOhiPSC-NVs / mL or withoutB2MKOhiPSC-NVs in 6-well plates. The medium was changed every 2 days for 6 days. On day 6, cells were harvested, fixed with ice-cold 70% ethanol for at least 30 mins, and stained with a staining-buffer containing 0.1% Triton X-100, 200 pg / mL RNase A, 20 pg / mL propidium iodide in PBS for 30 mins at room temperature. Cell cycles were analyzed using a BD LSR Fortessa flow cytometer.ATTORNEY DOCKET NO. 222119-2300

[0099] Western Blot analysis: to determine whether YAP signaling is involved in hiPSC-CM proliferation afterB2MKOhiPSC-NV treatment, hiPSC-CMs were seeded into 12-well plates and treated with DPBS or 5 * 109 / mLB2MKOhiPSC-NVs. Cells were then harvested at 0, 0.5, 1.5, 3, 6 and 24 hours after treatment using M-PER Mammalian Extraction Reagent. Briefly, proteins were separated on a 10% Mini-PROTEAN TGX Precast Gel and transferred onto a nitrocellulose membrane. The blots were incubated with primary antibodies (Table 4): rabbit antiphosphorylated YAP (ser127) (pYAP), YAP, or GAPDH, at 4 °C overnight. Goat anti-rabbit IgG conjugated with HRP was used to detect the binding of antibodies. The imaging of the specifically targeted proteins was described above.

[0100] Inhibitor treatment: to further determine whether YAP signaling is responsible forB2MKOhiPSC-NV-induced hiPSC-CM proliferation, cells were pretreated with 1 pM Verteporfin (HY-B0146, MedChem Express), a YAP inhibitor, for 30 mins before addingB2MKOhiPSC-NVs to the cell culture medium. Twenty-four hours later, hiPSC-CMs were fixed, permeabilized, blocked, and incubated with 10% PBS containing rabbit anti-YAP (14074S) or rabbit anti-ABK along with mouse anti-cTnT conjugated with PE at 4 °C overnight. On the following day, samples were incubated with 10% PBS containing donkey anti-rabbit IgG conjugated with FITC for 1 hour at room temperature. Finally, cells were stained with DAPI, washed, and mounted in Vectashield, and visualized using a confocal laser scanning microscope. hiPSC-CMs that exhibited nuclear YAP protein expression or ABK with disassembled sarcomeres and cleavage furrows were counted and reported as a fraction of 10,000 hiPSC-CMs.Mouse heart models of l / R and treatment

[0101] All animal procedures and protocols involved were approved by the Institutional Animal Care and Use Committee and performed according to the guidelines of the National Institutes of Health (NIH publication No 85-23). Mice were housed at 25°C with a 12 h light-dark cycle and had free access to food and water. Cardiac l / R injury was induced in C57BL / 6 mice (25-30 grams, 12-14 weeks of age, both male and female) as described previously. Briefly, mice were anesthetized with 2-2.5% isoflurane, and the left anterior coronary artery was occluded with an 8-0 suture for one hour. The suture was then removed to allow reperfusion. Mice were randomly assigned to two groups: 30 pL 0.9% NaCI (the l / R group, n = 18) or 30 pL 0.9% NaCI containing 2xio10 B2MKOhiPSC-NVs (the l / R+NV group, n = 18), using insulin syringes with 29G needles. Treatments were injected into the infarcted left ventricular (LV) anterior wall. A third group of age-matched animals (the Sham group, n = 14) underwent open-chest surgery without arterial ligationATTORNEY DOCKET NO. 222119-2300or subsequent treatment. Buprenorphine (0.01-0.02 mg / kg, i.m.) and Carprofen (5 mg / kg, s.c.) were administered before surgery and for 3 days after surgery. Euthanasia was performed in anesthetized animals (2-2.5% isoflurane) via direct intracardial injection of 100 mg / mL / kg KCI.Echocardiography

[0102] Transthoracic echocardiography was conducted using a Vevo 2100 echocardiographic system (VisualSonics, VSI, Toronto, Canada) with an MS400 transducer as described. All measurements were carried out in a blinded manner. Mice were anaesthetized with isoflurane (1-2%), and their chests were shaved. The animals were then positioned in a dorsal decubitus position. B-mode parasternal long axis images were collected, ensuring well-visualized aortic valves and the apex at maximum dimension for 10 cardiac cycles, and stored for offline analysis. The endocardium of the LV was traced manually at peak systole and peak diastole to measure left ventricular end diastolic volume (LVEDV) and left ventricular end systolic volume (LVESV). LV ejection fraction (LVEF) was then calculated using the following formula: LVEF = (LVEDV-LVESV) / LVEDV x 100%.Histological and immunochemical assessments

[0103] Apoptosis (TUNEL assay): Cryosections of cardiac tissue were evaluated using an In-situ Cell-death Detection Kit, as described previously. Sections were stained with rabbit anti-cTnl (ab47003, Abeam) to visualize CMs. Both the total number of CM nuclei and the number of apoptotic CM nuclei were counted in each tissue section under 20x magnification, and analysis was conducted on four animal hearts per group. Infarct size and LV wall thickness measurements: heart tissue sections were paraffin-embedded and stained using an Accustain Trichrome Stains (Masson) kit (Sigma-Aldrich, USA) to differentiate healthy myocardium from fibrotic tissue. Infarct size was calculated as the ratio of the length of the fibrous scar to the circumference of the LV free wall. Measurements were conducted at the mid-injury site in nine animals per group.

[0104] Mouse CM proliferation: Paraffin-embedded heart sections were stained with primary mouse IgM anti-a-sarcomeric actin antibodies (a-SA, A2172, MilliporeSigma) and primary rabbit anti-pH3 (06-570, MilliporeSigma) or rabbit anti-ABK (ab2254, Abeam) antibodies. Primary antibodies were visualized with donkey anti-rabbit IgG conjugated with FITC, and the sections were imaged using a FV3000 confocal laser scanning microscope (Olympus). Total CMs, pH3-positive CMs, and ABK-positive CMs were counted in 5 animals per group at week 1 and in 9 animals per group at week 4. A total of 6-7 slides per animal and 2-3 sections per slide were analyzed.ATTORNEY DOCKET NO. 222119-2300Statistical analysis

[0105] Results were presented as mean ± standard deviation (SD), and statistical analyses were performed using SPSS (version 28.0) software. Differences between two groups were assessed using two-tailed unpaired T-Tests, and overall differences among groups were analyzed using one-way analysis of variance (ANOVA). When significant differences were identified by ANOVA, post-hoc analysis was performed with the Tukey test. To identify proteins that were significantly more abundant inB2MKOhiPSC-NVs than inB2MKOhiPSCs, raw protein abundance data were Iog10-transformed and analyzed using a two-tailed unpaired T-Test, followed by Benjamini-Hochberg correction. The P value of <0.05 was considered statistically significant.Example 2: Results and DiscussionB2MKOhiPSC-N Vs are nano-sized vesicles and internalized by cultured hiPSC-CMs.

[0106] TwoB2MKOhiPSC lines were generated using CRISPR / Cas9 genome editing to delete 198-bp or 209-bp from human [32-microglobulin exon 2 (NM_004048.4) (FIGs. 9A-9D). Four clones (C39, C59, C64, and C66) were obtained with the 198-bp deletion, and one clone (C55) was obtained with the 209-bp deletion. All subsequent experiments were conducted with B2MKO|-lipscsfromclone C66. Flow cytometry analyses (FIGs. 10A-10G) confirmed that B2M, HLA-A / B / C, and HLA-DR / DQ / DP proteins were nearly undetectable inB2MKOhiPSCs, while HI_A-E and HLA-G proteins were significantly less abundant inB2MKOhiPSCs compared to ^hiPSCs. Approximately 84% of both ^hiPSCs andB2MKOhiPSCs expressed CD47, which inhibits natural killer cells. TheB2MKOhiPSCs formed colonies in culture, expressed the pluripotency markers OCT3 / 4 and SSEA4, and formed teratomas containing mesodermal (muscle), ectodermal (epidermis), and endodermal (gastrointestinal gland) cells. Karyotype analysis appeared normal (FIGs. 11A-11E). When hiPSCs were differentiated into hiPSC-CMs and treated with I NFy, B2M protein expression increased significantly in ^hiPSC-CMs, but not inB2MKOhiPSC-CMs (FIGs.12A-12B). The expression of CIITA remained unchanged in both hiPSC-CM populations (FIGs.12A and 12C).

[0107] The manufacturing process ofB2MKOhiPSC-NVs fromB2MKOhiPSCs was illustrated in FIG.1A. TheB2MKOhiPSC-NVs had diameters of approximately 115.9 ± 40.7 nm with bilayer-lipid membranes (FIGs. 1B-1C), and the zeta potential was -13.29 ± 2.15 mV. Using an extruder, approximately 9,500 NVs could be manufactured from a single hiPSC, which was about 52 times the number of EVs (approximately 184) produced by one hiPSC every 24 h (FIG. 1D), WhenB2MKOhiPSC-NVs |abe|ec|wjth PKH67 were cultured with hiPSC-CMs, green fluorescence wasATTORNEY DOCKET NO. 222119-2300observed in the hiPSC-CMs starting 4 hours after co-culture (FIGs. 1E-1G). The intensity of the green fluorescence continued to increase in the hiPSC-CMs after 12 and 24 h (FIGs. 1H-1M), confirming thatB2MKOhiPSC-NVs were internalized by the cells. Green fluorescence remained visible in the hiPSC-CMs up to day 4 after co-culture with PKH67-labeledB2MKOhiPSC-NVs (FIGs.1N-1P), indicating that intactB2MKOhiPSC-NVs persisted within the cells for at least 4 days.

[0108] Furthermore, when lysosomes in hiPSC-CMs were labeled with a red-fluorescent dye and the cells were cultured with PKH67-labeledB2MKOhiPSC-NVs (FIGs. 1Q-1S), less than 40% of the green and red fluorescence overlapped (FIG. 1T). This suggested that most of the internalizedB2MKOhiPSC-NVs did not directly undergo lysosomal degradation.

[0109] WhenB2MKOhiPSC-NVs andB2MKOhiPSCs were injected into the flanks of NOD-SCID mice, teratomas were only observed in the right flanks that received theB2MKOhiPS injection 1.5 months after treatment (FIG. 13). No tumors were observed when the mice were euthanized at 2 months after theB2MKOhiPSC-NV injection.B2MKO reduced the immunogenicity ofB2MKOhiPSC-NVs.

[0110] After culturing human CD8+ T cells with either 0.9% NaCI, ^hiPSC-NVs, orB2MKOhiPSC-NVs, the proportions of CD69+ / CD8+, CD38+ / CD69+ / CD8+, and total CD38+ / CD8+ plus CD69 / CD8+ T cells were the highest in the ^hiPSC-NVs group, which were significantly higher than those in the 0.9% NaCI orB2MKOhiPSC-NVs treated CD8+ T cells (FIG. 14A). No significant differences were observed between the 0.9% NaCI andB2MKOhiPSC-NV-treated CD8+ T cell profiles.

[0111] Furthermore, when 0.9% NaCI, orWThiPSC-NVs, orB2MKOhiPSC-NVs were intraperitoneally injected into C57BL / 6 mice, CD4, CD8, CD69, and CD8 / CD69-positive lymphocytes were similarly abundant in all three treatment groups on Day 1 (FIG. 14B).However, by Day 3, CD8+ T cells were significantly more frequently found in animals treated with ^hiPSC-NVs than those treated with 0.9% NaCI orB2MKOhiPSC-NVs. The CD8+ T cell measurements in the 0.9% NaCI andB2MKOhiPSC-NV groups were similar. Interestingly, both wThiPSC-NV andB2MKOhiPSC-NV administrations were associated with significant declines in CD69+ T lymphocytes (FIG. 14C).Proteomic characteristics ofB2MKOhiPSCs andB2MKOhiPSC-NVs.

[0112] A label-free proteomic analysis was conducted to systematically investigate the molecular alterations betweenB2MKOhiPSCs andB2MKOhiPSC-NVs. BothB2MKOhiPSCs (n = 3) andB2MKOhiPSC-ATTORNEY DOCKET NO. 222119-2300NVs (n = 3) were subjected to protein extraction, peptide digestion, and liquid chromatographymass spectrometry / mass spectrometry (LC-MS / MS) detection analysis (FIG. 2A). Principal component analysis demonstrated clear separation between the clusters ofB2MKOhiPSCs andB2MKOhiPSC-NVs (FIG. 2B). The volcano plot highlighted significant differences in protein expression between the two groups (FIG. 2C). Peptides and proteins with an FDR not exceeding 1.0% were retained. In total, 4923 were identified inB2MKOhiPSCs, and 4922 proteins were identified inB2MKOhiPSC-NVs, with 4474 proteins co-expressed in both (FIGs. 2D and 15A-15D).Among these, 283 membrane proteins, 872 nuclear proteins, and 890 cytoplasmic proteins were identified inB2MKOhiPSC-NVs. Correlation analysis of co-expressed proteins (FIG. 2E) and all identified proteins (FIG. 15C) showed correlations were greater than or equal to 0.90, indicating the high quality of the mass spectrometry analysis. Further analysis focused on the co-expressed proteins to explore those related to cardioprotection and cell proliferation inB2MKOhiPSC-NVs. The GO enrichment analysis revealed that significant enrichment was found in biological processes associated with reactive oxygen species (ROS) metabolism, cellular responses to ROS, chromosome dynamics, spindle function, and the cell cycle inB2MKOhiPSC-NVs (FIGs. 2F and 16A-16D). Additionally, KEGG pathway enrichment analysis showed significant enrichment in signaling pathways related to cellular responses to stimuli, DNA repair, RNA metabolism, gene expression, autophagy, and cell cycle regulation (FIGs. 2G and 17D).

[0113] A heatmap illustrating the magnitude of co-expressed proteins related to ROS, the mitotic spindle, chromosomes, and the cell cycle inB2MKOhiPSCs andB2MKOhiPSC-NVs was shown in FIG.2H. A total of 20 ROS-related proteins, 59 mitotic spindle proteins, 93 chromosomes-related proteins, and 121 cell cycle-related proteins were co-expressed in bothB2MKOhiPSCs andB2MKOhiPSC-NVs (FIGs. 18A-21B). Additionally, quantitative analysis (fold change > 1.5) confirmed the enrichment of specific proteins inB2MKOhiPSC-NVs: 4 ROS scavengers (NUDT2, PRDX2, PRDX6, and GSR) (FIGs. 18A-18B), 32 spindle-related proteins (FIGs. 19A-19B), 46 chromosome-associated proteins (FIGs. 20A-20B), and 55 cell cycle proteins (FIGs. 21A-21B).

[0114] Further statistical analysis using an unpaired T-Test followed by Benjamini-Hochberg correction revealed that 4 ROS-related proteins, 16 mitotic spindle proteins, 17 chromosome- associated proteins, and 24 cell cycle-related proteins were significantly more abundant inB2MKOhiPSC-NVs compared toB2MKOhiPSCs (FIGs. 18A-21B). Notably, the inner centromere protein (INCENP), which participates in cytokinesis, and the proliferation marker Ki-67 (MKI67), which regulates mitotic nuclear division, were 37% and 887.6% more abundant, respectively, in B2MKO|-lip3Q.|\|ysjnB2MKO|-lip3QSwestern blot analysis of 11 proteins involved in anti-ROSATTORNEY DOCKET NO. 222119-2300(i.e. PRDX2, PRDX6, and GSR), spindle (i.e. TPR, SKA2, RIF1, INCENP), chromosome (i.e. SKA2, RIF1, Ki67, CBX5, and INCENP), and the cell cycle (i.e. RBBP4 / 7, CKS1 / 2, RIF1, and TPR) confirmed that these proteins were significantly more abundant inB2MKOhiPSC-NVs than in B2MKO|1ipgQS(FIGS. 22A-22B). Thus, while the protein cargo ofB2MKOhiPSC-NVs shared similarities with the protein expression profile ofB2MKOhiPSCs,B2MKOhiPSC-NVs appear to be enriched in proteins associated with anti-ROS activity, the mitotic spindles, chromosome, and cell cycle regulation.

[0115] To further elucidate the functional interactions of the enriched proteins, a PPI network analysis of the co-expressed proteins was conducted. The network analysis revealed strong interactions among ROS-related, spindle-associated, chromosome-related, and cell cycle-related proteins. This suggested thatB2MKOhiPSC-NVs exerted cardioprotective functions through multiple signaling pathways (FIG. 2I).B2MKOhiPSC-NVs protected hiPSC-CMs from hypoxia or H^-induced injury.

[0116] Given that the cargos ofB2MKOhiPSC-NVs contained a higher abundance of proteins involved in cardioprotection, including ROS scavengers, it was assessed whetherB2MKOhiPSC-NVs could protectB2MKOhiPSC-CMs from hypoxia or H2O2 induced injury. WhenB2MKOhiPSC-CMs were cultured under hypoxic conditions, the LDH concentration in the supernatant was significantly lower in cells cultured withB2MKOhiPSC-NVs, starting at a concentration of 6.25 x 108NVs / mL, compared to those withoutB2MKOhiPSC-NVs (FIGs. 3A-3B). The CCK-8 assay further confirmed that a higher number of viableB2MKOhiPSC-CMs survived after treatment with B2MKOhipsc-NVs, beginning at 6.25 x 108NVs / mL (FIG. 3C). Additionally, treatment with 5 x 109 B2MKOhiPSC-NVs / mL significantly reduced the proportion of TUNEL-positive hiPSC-CMs under hypoxic conditions (FIGs. 3D-3E).

[0117] When 200 M H2O2 was pre-incubated withB2MKOhiPSC-NVs for 10 mins and then applied to hiPSC-CMs for 30 mins, the level of LDH in the supernatant was significantly lower in hiPSC-CMs co-cultured with H2O2 andB2MKOhiPSC-NVs, starting at a concentration of 6.25 x 108NVs / mL, compared to those treated with H2O2 alone (FIGs. 3F-3G). The concentrations of H2O2 in HBSS significantly decreased after incubation withB2MKOhiPSC-NVs, starting from 6.25 x 108NVs / mL concentration (FIG. 3H).

[0118] Additionally, cryo- preservedB2MKOhiPSC-NVs, starting from 6.25 x 108NVs / mL, significantly reduced LDH abundance in cells compared to those withoutB2MKOhiPSC-NVs (FIGs.23A-23B). However, a higher concentration of cryo-preservedB2MKOhiPSC-NVs (2.5 x 109ATTORNEY DOCKET NO. 222119-2300B2MKO|-1ip3c.|\|\ / s / mQwasrequired to protect hiPSC-CMs from FhOz-induced damage (FIGs.23C-23D). These data suggest that both freshly prepared and cryo-preservedB2MKOhiPSC-NVs protected cultured hiPSC-CMs from cytotoxicity associated with hypoxia and H2O2, as well as from hypoxia-induced apoptosis.B2MKOhiPSC-NVs protected hiPSC-CMs from hypoxia through AKT signaling pathway

[0119] Western Blot analysis showed that only the AKT signaling pathway was significantly upregulated at 0.5, 1.5, 3, and 6 hours after co-culturing hiPSC-CMs withB2MKOhiPSC-NVs (FIGs.4A-4B). When hiPSC-CMs were pre-treated with MK-2206, an AKT inhibitor (iAKT), the cytoprotective effect ofB2MKOhiPSC-NVs was blocked, as shown by both LDH and TUNEL assays, which indicated significant increases in hiPSC-CM injury (FIGs. 4C-4D) and apoptosis (FIGs.4E-4F). These results indicated thatB2MKOhiPSC-NVs promoted hiPSC-CM viability under hypoxic conditions by targeting the AKT signaling pathway.B2MKOhiPSC-NVs promoted hiPSC-CM proliferation through upregulation of YAP protein expression in vitro.

[0120] B2MKOhiPSC-CMs were cultured under normal oxygen conditions with serial concentrations ofB2MKOhiPSC-NVs. Treatment with 2.5 x 109, 5 x 109, or 10 x 109 B2MKOhiPSC-NVs / ml_ dose-dependently increased the proportion of cells expressing pH3 (FIGs. 5A-5B) and ABK (FIGs. 5C-5D) by up to 6.9- and 5.7-fold, respectively. Cell cycle analysis revealed that treatment with 5 x 109or 10 x 109 B2MKOhiPSC-NVs / ml_ significantly increased the proportion ofB2MKOhiPSC-CMs in the G2 / M phase (FIG. 5E). Additionally, cell counts ofB2MKOhiPSC-CMs were 40.3% higher after 6 days of culture with 5 x 109BM2K0hiPSC-NVs / ml_ compared to those cultured without BM2KOhiPSC-NVs (FIG. 5F), which was further confirmed by the CCK-8 assay (FIG. 5G).

[0121] When pYAP and YAP protein expression were assessed via Western Blot (FIG. 6A), pYAP levels remained relatively unchanged; however, YAP protein expression was significantly upregulated at 6 and 24 hours after BM2KOhiPSC-NV treatment, leading to a higher proportion of non-phosphorylated YAP (non-pYAP) in hiPSC-CMs (FIG. 6B). Since non-pYAP can translocate into the cell nucleus and interact with transcriptional cofactors to activate pro-proliferative genes associated with cell proliferation, immunofluorescence staining was performed. This revealed thatB2MKOhiPSC-NV treatment significantly increased the proportion of hiPSC-CMs with abundant YAP protein in the nucleus (FIGs. 6C-6D). However, Verteporfin, a YAP inhibitor (iYAP), blocked YAP protein translocation into the nucleus. Additionally, hiPSC-CMs treated with Verteporfin showed a significant reduction in the number of ABK positive hiPSC-ATTORNEY DOCKET NO. 222119-2300CMs undergoing cytokinesis (FIGs. 6E-6F). These results suggested thatB2MKOhiPSC-NVs target YAP signaling pathway to promote hiPSC-CM proliferation.B2MKOhiPSC-NVs improved recovery from myocardial injury in mice.

[0122] At week 1, echocardiographic analysis (FIG. 7A) showed that LVESV was significantly greater, and LVEF was significantly smaller in both the l / R and l / R+NV groups compared to the Sham group. LVEDV was also greater in the l / R and l / R+NV groups than in the Sham group, with no significant difference observed between the l / R and / R+NV groups (FIGs. 7B-7D). By week 4, all three parameters were significantly improved in the l / R+NV animals compared to the l / R group. Notably, no significant differences were found in LVESV or LVEDV between the Sham and l / R+NV animals.

[0123] Histological analysis showed that infarct size (FIGs. 7E-7F) and the thickness of the infarcted wall (FIGs. 7E and 7G) were significantly improved in the l / R+NV group compared to the l / R group at week 4. However, the infarct wall thickness remained significantly thinner in both groups that underwent l / R induction compared to the corresponding regions of the hearts from the Sham group. Additionally, treatment withB2MKOhiPSC-NVs significantly reduced the proportion of TUNEL-positive CMs in mouse hearts on day 3 following l / R injury (FIGs. 24A-24G).Collectively, these observations indicated that treatment withB2MKOhiPSC-NVs significantly improved cardiac function and reduced infarct size in the mouse hearts after l / R induction.Internalization ofB2MKOhiPSC-NVs by recipient mouse CMs and induction of proliferation.

[0124] InjectedB2MKOhiPSC-NVs, labeled with PKH67, were not only found in the mouse myocardium but also internalized by the recipient mouse CMs (FIGs. 25A-25B) at Week 1 after l / R and NV injection. At week 1, recipient mouse CMs expressing pH3 or ABK were present in both the infarcted and the border zones of the l / R+NV-treated hearts (FIGs.8A-8H and 26A-26F).At week 4, these markers were detected in the border-zone sections of the l / R+NV-treated hearts (FIGs. 8I-8N and 27A-27D). In contrast, both markers were nearly undetectable in CMs from the Sham or l / R mouse hearts, regardless of the zone or location. Consequently, the density of CMs exhibiting cell cycle activity was significantly greater in the l / R+NV-treated hearts compared to Sham or l / R hearts. These findings collectively indicated that hiPSC-NVs were internalized by mouse CMs and induced cell cycle activity in recipient CMs.DiscussionATTORNEY DOCKET NO. 222119-2300

[0125] The cardiogenic potential of hiPSCs is well-recognized, but their direct clinical application is limited by their pluripotency and the risk of tumor formation due to their unlimited capacity for self-renewal. As a result, hiPSCs have traditionally been used to generate CMs, smooth muscle cells, and endothelial cells for cardiac regenerative therapies. However, the clinical translation of hiPSC-derived cell therapy has been constrained by poor rates of cell engraftment. Thus, acellular products that replicate the regenerative potential of hiPSCs may offer a more viable option for clinical application.

[0126] Due to the low engraftment of transplanted cells, much of the therapeutic benefit of cell therapy is likely attributed to paracrine factors or EVs secreted by the cells. EVs have a well-established role in tissue regeneration. However, since EVs are naturally produced acellular product secreted into the culture medium of cells, the isolation of these vesicles can be both time-and labor-intensive. Additionally, the yield of EVs from this process is low, making it a challenge to produce large quantities for therapeutic applications. More recently, intracellular vesicles (IVs), a subtype of artificial cell-derived vesicles, have been isolated using physical measurements and have shown efficacy in skin tissue regeneration. The yield of NVs was found to be 16 times greater than that of EVs isolated using the traditional ultracentrifuge method. In contrast, NVs can be produced using an extruder with hydrophilic, micro-sized pores, allowing for a production scale that exceeds the yield of EVs by 52 -fold (FIG. 1D). Compared to EVs or IVs, which contain celltype specific molecules, NVs are more comprehensive, containing nearly all the signaling molecules found in the parental cells. This is evident in the subsequent analysis, where -83% of the 4923 proteins identified inB2MKOhiPSCs were also found inB2MKOhiPSC-NVs. Notably, many molecules that were more prevalent inB2MKOhiPSC-NVs than inB2MKOhiPSCs, including ROS scavengers, cell-cycle regulators, spindle proteins, and chromosomal proteins. This underscores the potential of hiPSC-NVs for tissue protection and regeneration.

[0127] The H2O2scavenging properties ofB2MKOhiPSC-NVs are largely attributed to the presence of NUDT2, PRDX2, PRDX6, and GSR proteins in theB2MKOhiPSC-NVs. These proteins play a key role in directly scavenging H2O2, which helps to mitigate oxidative damage in hiPSC-CMs. Upon internalization by target cells, the proteins inB2MKOhiPSC-NVs act in concert to enhance cell survival under hypoxic conditions and promote cellular proliferation, both in cultured hiPSC-CMs and in recipient CMs within infarcted mouse hearts. Both in vitro and in vivo experiments demonstrated thatB2MKOhiPSC-NVs can protect hiPSC-CMs from hypoxia-induced cell injury and apoptosis, as well as from l / R injury in mouse CMs. The protective effect of these NVs isATTORNEY DOCKET NO. 222119-2300significantly diminished when AKT activity is inhibited, further supporting the role of AKT signaling in mediating the cytoprotective effects ofB2MKOhiPSC-NV.

[0128] In addition to the 16 spindle proteins, 17 chromosomal proteins, and 24 cell-cycle proteins that were significantly enriched inB2MKOhiPSC-NVs and may directly or indirectly contribute to CM proliferation, a synergistic effect from the proteins in theB2MKOhiPSC-NV cargo not only upregulated YAP protein expression, but also facilitated the translocation of YAP into the nuclei of hiPSC-CMs. Inhibition of YAP function resulted in a significant reduction in YAP protein abundance in the nuclei of hiPSC-CMs, as well as a marked decreased in the proportion of hiPSC-CMs undergoing cytokinesis. Given that YAP is well-known to play a key role in cell proliferation,B2MKOhiPSC-NVs likely target YAP signaling to promote CM proliferation.

[0129] The study by Lozano et al, characterized the proteomic profile of hiPSC-NVs and identified key proteins involved in various biological processes, including wound tissue repair (GJA1, HSP20 / 27 / 70, and HMGB1), wound healing (FLNA, MYH9, ACTC1, and ILK), stress response / translation initiation (elF2S1 / S2 / S3 / B4), hypoxia response (HMOX2, HSP90, and GNB1), and extracellular matrix organization (ITGA6, MFGE8, and ITGB1). In vitro, these NVs promoted angiogenesis in endothelial cells, enhanced the survival of CMs exposed to hypoxia, and reduced cardiac fibroblast activation. The current study aligns with Lozano’s findings, demonstrating thatB2MKOhiPSC-NVs similarly promoted CM survival under hypoxic conditions. In addition to exploring the proteomic profile ofB2MKOhiPSC-NVs, the potential mechanisms and efficacy ofB2MKOhiPSC-NV administration for CM protection and cell cycle induction were also investigated, both in vitro and in a mouse model of l / R in vivo. Four ROS scavengers, as well as 16 spindle proteins, 17 chromosomal proteins, and 24 cell-cycle proteins that were highly enriched inB2MKOhiPSC-NVs were identified, all of which may contribute to CM protection and the promotion of cell cycle activity.

[0130] The results from the in vitro experiments with CD8+ T cell and in vivo injections of hiPSC-NVs confirmed that B2MKO reduced treatment-related immunogenicity compared to ^TiiPSC-NVs. Additionally,B2MKOhiPSC-NVs expressed CD47, which inhibits natural killer cells, further suggesting that bothB2MKOhiPSCs andB2MKOhiPSC-NVs are expected to be less immunogenic during clinical use. Give the time required for hiPSC reprogramming and NV manufacturing, autologous hiPSC-NVs may not be practical for emergency situations, such as acute Ml. However,B2MKOhiPSC-N s offer the advantage of hypoimmunogenic properties, allowing patients to receive allogeneic hiPSC-NVs that have been pre-manufactured. Furthermore,B2MKOhiPSC-ATTORNEY DOCKET NO. 222119-2300NVs maintain their cytoprotective properties even after prolonged cryopreservation, potentially enabling their use as a commercially viable product for long-term storage. ThisB2MKOhiPS line facilitates the large-scale production of hypoimmunogenic hiPSC-NVs, which could be suitable for allogeneic transplantation in patients with varying immune histocompatibility. These NVs could be used in clinical settings, such as open chest surgery or percutaneous transluminal coronary angioplasty, for cardiac protection and CM regeneration in patients with ischemic heart disease or Ml.

[0131] In conclusion, NVs derived fromB2MKOhiPSCs exhibited hypoimmunogenic properties, promoted proliferation of both hiPSC-CMs and mouse CMs, and enhanced resistance to hypoxia-and ROS-induced damage. These NVs also led to significant improvements in functional recovery and reduction in infarct size in a mouse heart model of l / R injury. Collectively, these findings support the potential of this emerging strategy for CM protection and regeneration in the treatment of Ml.

[0132] It should be emphasized that the above-described embodiments of the present disclosure are merely possible examples of implementations set forth for a clear understanding of the principles of the disclosure. Many variations and modifications may be made to the abovedescribed embodiment(s) without departing substantially from the spirit and principles of the disclosure. All such modifications and variations are intended to be included herein within the scope of this disclosure and protected by the following claims.REFERENCES1. Adamiak, M et al, Induced Pluripotent Stem Cell (iPSC)-Derived Extracellular Vesicles Are Safer and More Effective for Cardiac Repair Than iPSCs, Circ Res 122(2) (2018) 296-309.2. Bergmann, O et al, Dynamics of Cell Generation and Turnover in the Human Heart, Cell 161(7) (2015) 1566-75.3. Bishop, SP et al, Cardiomyocyte Proliferation from Fetal- to Adult- and from Normal- to Hypertrophy and Failing Hearts, Biology (Basel) 11(6) (2022).4. Bushkin, Y et al, Physical association between the CD8 and HLA class I molecules on the surface of activated human T lymphocytes, Proc Natl Acad Sci U S A 85(11) (1988) 3985-9.5. Collino, F et al, Extracellular Vesicles Derived from Induced Pluripotent Stem Cells Promote Renoprotection in Acute Kidney Injury Model, Cells 9(2) (2020).ATTORNEY DOCKET NO. 222119-2300Deuse, T et al, Hypoimmunogenic derivatives of induced pluripotent stem cells evade immune rejection in fully immunocompetent allogeneic recipients, Nat Biotechnol 37(3) (2019) 252-258.Duan, X et al, A new subtype of artificial cell-derived vesicles from dental pulp stem cells with the bioequivalence and higher acquisition efficiency compared to extracellular vesicles, J Extracell Vesicles 13(7) (2024) e12473.Gao, Y et al, Ascorbic acid induces MLC2v protein expression and promotes ventricular-like cardiomyocyte subtype in human induced pluripotent stem cells derived cardiomyocytes, Theranostics 13(11) (2023) 3872-3896.Herrmann, IK et al, Extracellular vesicles as a next-generation drug delivery platform, Nat Nanotechnol 16(7) (2021) 748-759.Hu, Let al, Mesenchymal Stem Cell-derived Nanovesicles as a Credible Agent for Therapy of Pulmonary Hypertension, Am J Respir Cell Mol Biol 67(1) (2022) 61-75.Jo, W et al, Large-scale generation of cell-derived nanovesicles, Nanoscale 6(20) (2014) 12056-64.Kim, HY etal, Stem Cell-Engineered Nanovesicles Exert Proangiogenic and Neuroprotective Effects, Materials (Basel) 14(5) (2021).Ko, KWetal, Attenuation of Tumor Necrosis Factor-alpha Induced Inflammation by Umbilical Cord-Mesenchymal Stem Cell Derived Exosome-Mimetic Nanovesicles in Endothelial Cells, Tissue Eng Regen Med 17(2) (2020) 155-163.Lee, JR et al, Nanovesicles derived from iron oxide nanoparticles-incorporated mesenchymal stem cells for cardiac repair, Sci Adv 6(18) (2020) eaaz0952.Lian, X et al, Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling, Proc Natl Acad Sci U S A 109(27) (2012) E1848-57.Liu, S et al, Highly Purified Human Extracellular Vesicles Produced by Stem Cells Alleviate Aging Cellular Phenotypes of Senescent Human Cells, Stem Cells 37(6) (2019) 779-790. Lozano, J etal, Scalable Generation of Nanovesicles from Human-Induced Pluripotent Stem Cells for Cardiac Repair, Int J Mol Sci 23(22) (2022).ATTORNEY DOCKET NO. 222119-2300Lu, M et al, Recent advances on extracellular vesicles in therapeutic delivery: Challenges, solutions, and opportunities, Eur J Pharm Biopharm 119 (2017) 381-395.Marban, E. The Secret Life of Exosomes: What Bees Can Teach Us About Next-Generation Therapeutics, J Am Coll Cardiol 71(2) (2018) 193-200.Perez-Riverol, Y et al, The PRIDE database at 20 years: 2025 update, Nucleic Acids Res 53(D1) (2025) D543-d553.Poh, KK et al, Transplantation of Endothelial Progenitor Cells in Obese Diabetic Rats Following Myocardial Infarction: Role of Thymosin Beta-4, Cells 9(4) (2020).Porrello, ER et al, Transient regenerative potential of the neonatal mouse heart, Science 331(6020) (2011) 1078-80.Povero, D et al, Human induced pluripotent stem cell-derived extracellular vesicles reduce hepatic stellate cell activation and liver fibrosis, JCI Insight 5(14) (2019).Ramis, JM. Extracellular Vesicles in Cell Biology and Medicine, Sci Rep 10(1) (2020) 8667. Ravichandran, R et al, Extracellular Vesicles Mediate Immune Responses to Tissue-Associated Self-Antigens: Role in Solid Organ Transplantations, Front Immunol 13 (2022) 861583.Su, L et al, Diabetic Endothelial Cells Differentiated From Patient iPSCs Show Dysregulated Glycine Homeostasis and Senescence Associated Phenotypes, Front Cell Dev Biol 9 (2021) 667252.Su, L et al, The prostaglandin H2 analog U-46619 improves the differentiation efficiency of human induced pluripotent stem cells into endothelial cells by activating both p38MAPK and ERK1 / 2 signaling pathways, Stem Cell Res Ther9(1) (2018) 313.Su, L et al, Thymosin beta-4 improves endothelial function and reparative potency of diabetic endothelial cells differentiated from patient induced pluripotent stem cells, Stem Cell Res Ther 13(1) (2022) 13.Tan, S et al, Non-viral vector based gene transfection with human induced pluripotent stem cells derived cardiomyocytes, Sci Rep 9(1) (2019) 14404.ATTORNEY DOCKET NO. 222119-2300Tan, SH et al, Thymosin beta4 increases cardiac cell proliferation, cell engraftment, and the reparative potency of human induced-pluripotent stem cell-derived cardiomyocytes in a porcine model of acute myocardial infarction, Theranostics 11(16) (2021) 7879-7895.Tao, Z et al, Angiopoietin-1 enhanced myocyte mitosis, engraftment, and the reparability of hiPSC-CMs for treatment of myocardial infarction, Cardiovasc Res 117(6) (2021) 1578-1591. Tohyama, Set al, Distinct metabolic flow enables large-scale purification of mouse and human pluripotent stem cell-derived cardiomyocytes, Cell Stem Cell 12(1) (2013) 127-37.Wang, X et al, Comparison of extruded cell nanovesicles and exosomes in their molecular cargos and regenerative potentials, Nano Res 16(5) (2023) 7248-7259.Wang, X et al, Extruded Mesenchymal Stem Cell Nanovesicles Are Equally Potent to Natural Extracellular Vesicles in Cardiac Repair, ACS Appl Mater Interfaces 13(47) (2021) 55767-55779.Wen, Y et al, Cell-derived nanovesicles prepared by membrane extrusion are good substitutes for natural extracellular vesicles, Extracell Vesicle 1 (2022).Xu, Z et al, A Murine Model of Myocardial Ischemia-Reperfusion Injury, Methods Mol Biol 1717 (2018) 145-153.Ye, L et al, Transplantation of nanoparticle transfected skeletal myoblasts overexpressing vascular endothelial growth factor-165 for cardiac repair, Circulation 116(11 Suppl) (2007) 1113-20.Ye, L et al, Angiopoietin-1 for myocardial angiogenesis: a comparison between delivery strategies, Eur J Heart Fail 9(5) (2007) 458-65.Ye, Let al, Early Regenerative Capacity in the Porcine Heart, Circulation 138(24) (2018) 2798-2808.Ye, L et al, Effective cardiac myocyte differentiation of human induced pluripotent stem cells requires VEGF, PLoS One 8(1) (2013) e53764.Ye, L et al, Nonviral vector-based gene transfection of primary human skeletal myoblasts, Exp Biol Med (Maywood) 232(11) (2007) 1477-87.ATTORNEY DOCKET NO. 222119-2300Ye, L et al, Skeletal myoblast transplantation for attenuation of hyperglycaemia, hyperinsulinaemia and glucose intolerance in a mouse model of type 2 diabetes mellitus, Diabetologia 52(9) (2009) 1925-34.Ye, L et al, Truncations of the titin Z-disc predispose to a heart failure with preserved ejection phenotype in the context of pressure overload, PLoS One 13(7) (2018) e0201498.Yu, FX et al, Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer, Cell 163(4) (2015) 811-28.Zhang, J et al, Extracellular matrix promotes highly efficient cardiac differentiation of human pluripotent stem cells: the matrix sandwich method, Circ Res 111(9) (2012) 1125-36.Zhang, Y et al, Intramyocardial transplantation of undifferentiated rat induced pluripotent stem cells causes tumorigenesis in the heart, PLoS One 6(4) (2011) e19012.Zhao, T et al, Immunogenicity of induced pluripotent stem cells, Nature 474(7350) (2011) 212-5.Zhen, N et al, A diastolic dysfunction model in non-human primates with transverse aortic constriction, Exp Anim 70(4) (2021) 498-507.

Claims

ATTORNEY DOCKET NO. 222119-2300CLAIMSWhat is claimed is:

1. A human induced pluripotent stem cell (hiPSC) line comprising a deletion of from about 195 base pairs to about 215 base pairs from exon 2 of |32-microglobulin.

2. The hiPSC line of claim 1, wherein the deletion is 198 base pairs.

3. The hiPSC line of claim 2, wherein exon 2 of p2-microglobulin has SEQ ID NO. 8 after transcription.

4. The hiPSC line of claim 1, wherein the deletion is 209 base pairs.

5. The hiPSC line of claim 4, wherein exon 2 of [32-microglobulin has SEQ ID NO. 9 after transcription.

6. A plurality of nanovesicles (NVs) manufactured from the hiPSC line of claim 1.

7. The plurality of NVs of claim 6, wherein the NVs have average diameters of from about 70 nm to about 160 nm.

8. The plurality of NVs of claim 7, wherein the NVs have an average diameter of about 115.9 nm.

9. The plurality of NVs of claim 6, wherein the NVs comprise lipid bilayer membranes.

10. The plurality of NVs of claim 6, wherein the NVs have a zeta potential of from about -16 mV to about -9 mV.

11. The plurality of NVs of claim 10, wherein the NVs have a zeta potential of about -13.29 mV.

12. The plurality of NVs of claim 6, wherein an extruder is used to manufacture the NVs.

13. The plurality of NVs of claim 12, wherein the extruder produces about 9500 NVs from a single hiPSC.

14. The plurality of NVs of claim 6, wherein the plurality of NVs are stable after prolonged cryopreservation.

15. A cardiomyocyte derived from an hiPSC line, wherein the cardiomyocyte comprises one or more NVs of the plurality of claim 6.

16. The cardiomyocyte of claim 15, wherein a majority of the one or more NVs are not degraded in lysosomes of the cardiomyocyte.

17. The cardiomyocyte of claim 15, wherein the one or more NVs are not immunogenic.ATTORNEY DOCKET NO. 222119-230018. A method for protecting a cardiomyocyte from damage, the method comprising administering the plurality of NVs of any one of claims 6-14 to the cardiomyocyte.

19. The method of claim 18, wherein the damage comprises hypoxia-induced damage, damage caused by a reactive oxygen species (ROS), or any combination thereof.

20. A method for promoting cardiomyocyte proliferation, the method comprising administering the plurality of NVs of any one of claims 6-14 to a cardiomyocyte or precursor thereof.

21. A method for promoting recovery from myocardial injury in a subject, the method comprising administering the plurality of NVs of any one of claims 6-14 to one or more cardiomyocytes in the subject.

22. The method of claim 21, wherein the myocardial injury comprises an injury caused by myocardial infarction.

23. The method of claim 22, wherein administering the plurality of NVs improves cardiac function, reduces infarct size, or both.

24. The method of claim 21, wherein the plurality of NVs are administered by injection.

25. The method of claim 21, wherein the subject is a human, non-human primate, mouse, rat, hamster, rabbit, guinea pig, dog, cat, horse, cattle, sheep, or goat.

Images