Prion protein (PRNP) IRNA compositions and methods of use thereof

Abstract

The disclosure relates to double stranded ribonucleic acid (dsRNAi) agents and compositions targeting a prion protein (PRNP) gene, as well as methods of inhibiting expression of a PRNP gene and methods of treating subjects having a PRNP-associated disease or disorder, e.g., Prion diseases, using such dsRNAi agents and compositions.

Description

[0001] 121301-24420

[0002] PRION PROTEIN (PRNP) IRNA COMPOSITIONS AND METHODS OF USE THEREOF

[0003] RELATED APPLICATIONS

[0004] This application claims the benefit of priority to U. S. Provisional Application No. 63 / 788,208, filed on April 14, 2025, the entire contents of which are incorporated herein by reference.

[0005] BACKGROUND OF THE INVENTION

[0006] Prion diseases, or transmissible spongiform encephalopathies (TSEs), are a group of neurodegenerative disorders that affect both humans and animals. Prion disease typically progresses quickly with rapid cognitive decline, and is fatal within a few months of symptoms onset. Prion disease is caused by misfolding of the cellular prion protein highly expressed in neuronal and glial cells, PrPc, into an autocatalytically self-propagating conformer called the scrapie prion protein, or PrPSc, which is insoluble and relatively resistant to degradation by proteases. The accumulation of PrPSclead to neurodegeration and / or neuronal injury and loss.

[0007] There are three different subtypes of prion disease categorized by how the disease is contracted: sporadic, genetic and acquired. Inherent mutations in the prion protein gene (PRNP) cause the genetic subtype of prion disease, such as, Creutzfeldt-Jakob Disease (CJD), Gers nann-Straussler-Scheinker Disease (GSS), and Fatal Familial Insomnia (FF1). More than 60 variants of PRNP have been identified. In pateints with genetic prion diseases, the mutations in the PRNP gene cause the cells to produce PrPSc. The acquired subtype of prion disease is casued by prion proteins and included Mad Cow Disease and Kuru. The sporadic subtype of prion disease is caused by unknown factors and accounts for approximately 85% of all prion disease.

[0008] Previous studies have shown that homozygous deletion of PrP prevents prion infection in mice and goats (Biieler H., Aguzzi A., et al. Cell. 1993; 73:1339-1347; Salvesen 0., et al. Vet. Res. 2020; 51:1), while heterozygous PrP knockout delays development of disease following prion infection (Salvesen 0., et al. Vet. Res. 2020; 51:1; Biieler H., etal. Mol. Med. 1994; 1:19-30; Prusiner S. B., et al. Proc. Natl. Acad. Sci. U. S. A. 1993; 90:10608-10612; Sakaguchi S., etal. J. Virol. 1995; 69:7586-7592) and transgenic PrP overexpression accelerates it (Fischer M., et al. EMBO J. 1996; 15: 1255-1264.), providing genetic evidence of a dose-response relationship between PrP dosage and disease susceptibility.

[0009] Conditional knockout systems have confirmed that post-natal depletion provides a significant survival benefit (Mallucci G., etal. Science. 2003; 302:871-874; Safar J. G., et al. J. Gen. Virol. 2005; 86:2913-2923.). Knockout animals are healthy (Biieler H., et al. Nature. 1992; 356:577-582; Richt J. A., et al. Nat. Biotechnol. 2007; 25:132-138; Benestad S. L., etal. Vet. Res. 2012; 43:87.). Furthermore, heterozygous inactivating mutations also appear to be tolerated in humans (Minikel E. V., et al. Sci. Transl. Med. 2016; 8:322ra9; Minikel E. V., et al. Nature. 2020; 581:459-464), minimizing any concern about on-target toxicity of pharmacologic PrP lowering.

[0010] Effective treatments for PRNP-associated diseases, such as prion diseases, are currently not available and any treatments that are available are palliative. Thus, there remains a need for agents that

[0011] MEI 52746940v.1 1121301-24420

[0012] can selectively and efficiently silence the PRNP gene using the cell's own RNAi machinery that have both high biological activity and in vivo stability, and that can effectively inhibit expression of a target PRNP gene.

[0013] SUMMARY OF THE INVENTION

[0014] The present disclosure provides RNAi agent compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a prion protein (PRNP) gene. The PRNP gene may be within a cell, e.g., a cell within a subject, such as a human. The present disclosure also provides methods of using the RNAi agent compositions of the disclosure for inhibiting the expression of a PRNP gene or for treating a subject who would benefit from inhibiting or reducing the expression of a PRNP gene, e.g., a subject suffering or prone to suffering from a PRNP-associated disease, e.g., a prion disease, such as a genetic prion disease, e.g., familial Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1); a sporadic prion disease, e.g., sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase-Sensitive Prionopathy (VPSPr), or an acquired prion disease, e.g., Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).

[0015] Accordingly, in one aspect, the instant disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prion protein (PRNP) in a cell, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 17 contiguous nucleotides differing by no more than three nucleotides from the complement of the nucleotide sequence of nucleotides 843-872 of SEQ ID NO: 1, wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a nucleotide modification, and wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand are conjugated to one or more lipophilic moieties.

[0016] In one embodiment, wherein the antisense strand comprises at least 18 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’-UTGGAAAAAGATUAGAAAGAUGG -3’of SEQ ID NO:9208.

[0017] In another embodiment, the antisense strand comprises at least 19 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’-UTGGAAAAAGATUAGAAAGAUGG -3’ of SEQ ID NO:9208.

[0018] In one embodiment, the antisense strand comprises the nucleotide sequence 5’-UTGGAAAAAGATUAGAAAGAUGG -3’ of SEQ ID NO:9208.

[0019] In one embodiment, sense strand comprises at least 17 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188.

[0020] MEI 52746940v.1 2121301-24420

[0021] In another embodiment, the sense strand comprises at least 18 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188.

[0022] In one embodiment, the sense strand comprises at least 19 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188.

[0023] In one embodiment, the sense strand comprises the nucleotide sequence 5’-AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188.

[0024] In one embodiment, the sense strand comprises the nucleotide sequence 5’-AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188 and the antisense strand comprises the nucleotide sequence 5’- UTGGAAAAAGATUAGAAAGAUGG -3’ of SEQ ID NO:9208.

[0025] In one embodiment, the antisense strand comprises at least 17 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

[0026] In another embodiment, the antisense strand comprises at least 18 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’-UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

[0027] In one embodiment, the antisense strand comprises at least 19 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

[0028] In another embodiment, the antisense strand comprises the nucleotide sequence 5’-UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

[0029] In one embodiment, the sense strand comprises at least 17 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187.

[0030] In another embodiment, the sense strand comprises at least 18 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187.

[0031] In one embodiment, the sense strand comprises at least 19 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187.

[0032] In another embodiment, the sense strand comprises the nucleotide sequence 5’-UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187.

[0033] In one embodiment, the sense strand comprises the nucleotide sequence 5’-UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187 and the antisense strand comprises the nucleotide sequence 5’- UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

[0034] In one embodiment, the one or more lipophilic moieties are conjugated to one or more internal positions in the double stranded region of the dsRNA agent, or a pharmaceutically acceptable salt thereof.

[0035] MEI 52746940v.1 3121301-24420

[0036] In one embodiment, the one or more lipophilic moieties are conjugated to one or more internal positions on the antisense strand.

[0037] In one embodiment, one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand via a linker or carrier.

[0038] In one embodiment, the lipophilicity of the lipophilic moiety, measured by logKoW, exceeds 0. In one embodiment, the hydrophobicity of the dsRNA agent, or a pharmaceutically acceptable salt thereof, measured by the unbound fraction in a plasma protein binding assay of the dsRNA agent, exceeds 0.2. In one embodiment, the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein.

[0039] In one embodiment, the internal positions include all positions except the terminal two positions from each end of the sense strand or the antisense strand.

[0040] In another embodiment, wherein the internal positions include all positions except the terminal three positions from each end of the sense strand or the antisense strand.

[0041] In one embodiment, the internal positions exclude a cleavage site region of the sense strand. In one embodiment, the internal positions include all positions except positions 9-12, counting from the 5’-end of the sense strand. In another embodiment, the internal positions include all positions except positions 11-13, counting from the 3 ’-end of the sense strand.

[0042] In one embodiment, the internal positions exclude a cleavage site region of the antisense strand. In one embodiment, the internal positions include all positions except positions 12-14, counting from the 5 ’-end of the antisense strand.

[0043] In one embodiment, the internal positions include all positions except positions 11-13 on the sense strand, counting from the 3 ’-end, and positions 12-14 on the antisense strand, counting from the 5’-end.

[0044] In one embodiment, the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5 ’-end of each strand. In one embodiment, the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5 ’-end of each strand.

[0045] In one embodiment, the positions in the double stranded region exclude a cleavage site region of the sense strand.

[0046] In one embodiment, wherein the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand.

[0047] In another embodiment, the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 21, position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand.

[0048] In one embodiment, the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound.

[0049] MEI 52746940v.1 4121301-24420

[0050] In one embodiment, the lipophilic moiety is selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, l,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.

[0051] In one embodiment, the lipophilic moiety contains a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. In one embodiment, the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain. In one embodiment, the lipophilic moiety contains a saturated or unsaturated Cl 6 hydrocarbon chain. In one embodiment, the saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6, counting from the 5’-end of the strand.

[0052] In one embodiment, the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotide(s) in the internal position(s) or the double stranded region. In one embodiment, the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; or is an acyclic moiety based on a serinol backbone or a diethanolamine backbone.

[0053] In one embodiment, the lipophilic moiety is conjugated to the dsRNA agent, or a pharmaceutically acceptable salt thereof, via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction, or carbamate. In one embodiment, the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or intemucleosidic linkage.

[0054] In one embodiment, at least one of the nucleotide modifications is selected from the group a deoxy -nucleotide modification, a 3 ’-terminal deoxythimidine (dT) nucleotide modification, a 2'-O-methyl nucleotide modification, a 2'-fluoro nucleotide modification, a 2'-deoxy- nucleotide modification, a 2’-5’-linked ribonucleotide (3’-RNA) modification, a locked nucleotide modification, an unlocked nucleotide modification, a conformationally restricted nucleotide modification, a constrained ethyl nucleotide modification, an abasic nucleotide modification, a 2’-amino- nucleotide modification, a 2’-O-allyl-nucleotide modification, 2’-C-alkyl- nucleotide modification, 2’-hydroxly- nucleotide modification, a 2’-methoxy ethyl nucleotide modification, a 2’-O-alkyl- nucleotide modification, a morpholino nucleotide modification, a phosphoramidate modification, a non-natural base comprising nucleotide modification, a tetrahydropyran nucleotide modification, a 1,5-anhydrohexitol nucleotide modification, a cyclohexenyl nucleotide modification, a nucleotide comprising a 5'-phosphorothioate group modification, a nucleotide comprising a 5'-methylphosphonate group modification, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic modification, a nucleotide comprising vinyl phosphonate modification, a nucleotide comprising adenosine-glycol nucleic acid (GNA) modification, a glycol nucleic acid S-lsomer (S-GNA) modification, a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate modification, a nucleotide comprising 2’-deoxythymidine-3 ’phosphate modification, a nucleotide comprising 2’-

[0055] MEI 52746940v.1 5121301-24420

[0056] deoxyguanosine-3 ’-phosphate modification, a nucleotide comprising 2’ -deoxyadenosine-3 ’phosphate modification, a nucleotide comprising 2’ -deoxycytidine-3 ’ -phosphate modification, and a terminal nucleotide linked to a cholesteryl derivative modification, a dodecanoic acid bisdecylamide group modification; acytidine-2' -phosphate modification, a guanosine-2' -phosphate modification, a uridine-2'-phosphate modification, a adenosine-2' -phosphate modification, a 2'-O-hexadecyl-adenosine-3’-phosphate modification, a 2'-O-hexadecyl-cytidine-3'-phosphate modification, a 2'-O-hexadecyl-guanosine-3'-phosphate modification, and a 2'-O-hexadecyl-uridine-3'-phosphate modification, and combinations thereof.

[0057] In another embodiment, at least one of the nucleotide modifications is selected from the group consisting of a 2'-deoxy-2'-fluoro nucleotide modification, a 2'-deoxy- nucleotide modification, 3’-terminal deoxythimidine nucleotides (dT) modification, a locked nucleotide modification, an abasic nucleotide modification, a 2’-amino- nucleotide modification, a 2’-alkyl- nucleotide modification, a morpholino nucleotide modification, a phosphoramidate modification, and a non-natural base comprising nucleotide modification.

[0058] In one embodiment, at least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide modification, a 2'-O-methyl nucleotide modification, a 2'-fluoro nucleotide modification, a 2'-deoxy- nucleotide modification, a glycol nucleotide (GNA) modification, S-GNA modification, 3’-RNA modification, and, a vinyl-phosphonate nucleotide modification; and combinations thereof.

[0059] In another embodiment, at least one of the nucleotide modifications is a thermally destabilizing nucleotide modification. In one embodiment, the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex modification; and destabilizing sugar modification, a 2’ -deoxy modification, an acyclic nucleotide modification, an unlocked nucleic acids (UNA) modification, and a glycerol nucleic acid (GNA) modification.

[0060] In one embodiment, the nucleotide modifications comprises a short sequence of 3 ’-terminal deoxythimidine nucleotides (dT).

[0061] In another embodiment, the nucleotide modifications are 2’-O-methyl modifications, GNA modifications, and 2’fluoro modifications.

[0062] In one embodiment, the dsRNA agent, or a pharmaceutically acceptable salt thereof, further comprises at least one phosphorothioate intemucleotide linkage. In one embodiment, the dsRNA agent comprises 6-8 phosphorothioate intemucleotide linkages.

[0063] In one embodiment, each strand is no more than 30 nucleotides in length.

[0064] In one embodiment, at least one strand comprises a 3 ’ overhang of at least 1 nucleotide.

[0065] In another embodiment, at least one strand comprises a 3’ overhang of at least 2 nucleotides. The double stranded region may be 15-30 nucleotide pairs in length; 17-23 nucleotide pairs in length; 17-25 nucleotide pairs in length; 23-27 nucleotide pairs in length; 19-21 nucleotide pairs in length; or 21-23 nucleotide pairs in length.

[0066] MEI 52746940v.1 6121301-24420

[0067] Each strand may be 19-30 nucleotides in length; 19-23 nucleotides in length; or 21-23 nucleotides in length.

[0068] In one embodiment, the lipophilic moiety or targeting ligand is conjugated via a bio-cleavable linker selected from the group consisting of DNA, RNA, disulfide, amide, functionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof.

[0069] In one embodiment, the 3 ’ end of the sense strand is protected via an end cap which is a cyclic group having an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl.

[0070] In one embodiment, the dsRNA agent, or a pharmaceutically acceptable salt thereof, further comprises a phosphate or phosphate mimic at the 5 ’-end of the antisense strand, such as a 5 ’-vinyl phosphonate (VP).

[0071] In one embodiment, the base pair at the 1 position of the 5'-end of the antisense strand of the duplex is an AU base pair.

[0072] In one embodiment, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

[0073] In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Prion protein (PrP) in a cell, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand differs by no more than 4 unmodified or modified nucleotides from the nucleotide sequence of 5’-asuscuu(Uhd)cuAfAfUfcuuuuuccsasa-3’ of SEQ ID NO:9228 and the antisense strand differs by no more than 4 unmodified or modified nucleotides from the nucleotide sequence of 5’-VPusdTsggdAadAaagadTuAfgaaagausgsg-3 of SEQ ID NO:9248, wherein a, g, c and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af and Uf are 2'-fluoro A and U, respectively; (Uhd) is 2'-O-hexadecyl-uridine-3'-phosphate; dT is 2' -deoxythymidine-3' -phosphate; dA is 2'-deoxyadenosine-3'-phosphate; and VP is 5’-vinyl phosphonate.

[0074] In one embodiment, the sense strand differs by no more than 3 unmodified or modified nucleotides from the nucleotide sequence of 5’- asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand differs by no more than 3 unmodified or modified nucleotides from the nucleotide sequence of 5’- VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

[0075] In another embodiment, the sense strand differs by no more than 2 unmodified or modified nucleotides from the nucleotide sequence of 5’- asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand differs by no more than 2 unmodified or modified nucleotides from the nucleotide sequence of 5’- VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

[0076] MEI 52746940v.1 7121301-24420

[0077] In one embodiment, the sense strand differs by no more than 1 unmodified or modified nucleotide from the nucleotide sequence of 5’- asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand differs by no more than 1 unmodified or modified nucleotide from the nucleotide sequence of 5’- VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

[0078] In another embodiment, the sense strand comprises the nucleotide sequence of 5’-asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand comprises the nucleotide sequence of 5’- VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

[0079] In one embodiment, the sense strand consists of the nucleotide sequence of 5’-asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand consists of the nucleotide sequence of 5’- VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

[0080] In one embodiment, the dsRNA agent is in a salt form.

[0081] In one embodiment, the dsRNA agent is in a sodium salt form.

[0082] In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prion protein (PRNP) in a cell, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand differs by no more than 4 unmodified or modified nucleotides from the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO:9227 and the antisense strand differs by no more than 4 unmodified or modified nucleotides from the nucleotide sequence of 5’-VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc-3’ of SEQ ID NO:9247, a, g, c andu are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, and Uf are 2'-fluoro A, C, and U, respectively; (Chd) is 2'-O-hexadecyl-cytidine-3’-phosphate; dT is 2'-deoxythymidine-3'-phosphate; (Agn) is Adenosine-glycol nucleic acid (GNA) S-lsomer; and VP is 5’-vinyl phosphonate.

[0083] In one embodiment, the sense strand differs by no more than 3 unmodified or modified nucleotides from the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO: 9227 and the antisense strand differs by no more than 3 unmodified or modified nucleotides from the nucleotide sequence of 5’- VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

[0084] In another embodiment, the sense strand differs by no more than 2 unmodified or modified nucleotides from the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO: 9227 and the antisense strand differs by no more than 2 unmodified or modified nucleotides from the nucleotide sequence of 5’- VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

[0085] In one embodiment, the sense strand differs by no more than 1 unmodified or modified nucleotide from the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO:9227 and the antisense strand differs by no more than 1 unmodified or modified nucleotide from the nucleotide sequence of 5’- VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

[0086] In another embodiment, the sense strand comprises the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO:9227 and the antisense strand comprises the nucleotide sequence of 5’- VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

[0087] MEI 52746940v.1 8121301-24420

[0088] In one embodiment, the sense strand consists of the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO:9227 and the antisense strand consists of the nucleotide sequence of 5’- VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

[0089] In one embodiment, the dsRNA agent is in a salt form.

[0090] In one embodiment, the dsRNA agent is in a sodium salt form.

[0091] In yet another aspect, the instant disclosure provides a double stranded ribonucleic acid (RNAi) agent for inhibiting expression of a PRNP gene, where the RNAi agent includes a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding PRNP, and wherein the region of complementarity comprises at least 17, e.g., 17, 18, 19, 20, or 21, contiguous nucleotides differing by no more than 3 nucleotides (z.e., differing by 3, 2, 1, or 0 nucleotides) from any one of the antisense sequences listed in any one of Tables 2-3, and wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand is conjugated to one or more lipophilic moieties.

[0092] In certain embodiments, the antisense strand includes a region of complementarity which includes at least 15 contiguous nucleotides of any one of the antisense sequences listed in any one of Tables 2-3. In certain embodiments, the antisense strand includes a region of complementarity which includes at least 17 contiguous nucleotides of any one of the antisense sequences listed in any one of Tables 2-3. In certain embodiments, the antisense strand includes a region of complementarity which includes at least 19 contiguous nucleotides of any one of the antisense sequences listed in any one of Tables 2-3. In certain embodiments, the antisense strand includes a region of complementarity which includes at least 20 contiguous nucleotides of any one of the antisense sequences listed in any one of Tables 2-3. In certain embodiments, the antisense strand includes a region of complementarity which includes at least 21 contiguous nucleotides of any one of the antisense sequences listed in any one of Tables 2-3. In certain embodiments, thymine -to-uracil or uracil-to-thymine differences between aligned (compared) sequences are not counted as nucleotides that differ between the aligned (compared) sequences.

[0093] In some embodiments, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one the sense nucleotide sequences in any one of Tables 2-3, and the antisense strand comprises at least 17 contiguous nucleotides differing by no more than 3 nucleotides from any one the antisense nucleotide sequences in any one of Tables 2-3.

[0094] In some embodiments, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 2 nucleotides from any one the sense nucleotide sequences in any one of Tables 2-3, and the antisense strand comprises at least 17 contiguous nucleotides differing by no more than 2 nucleotides from any one the antisense nucleotide sequences in any one of Tables 2-3.

[0095] In some embodiments, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1 nucleotide from any one the sense nucleotide sequences in any one of Tables 2-3, and the antisense strand comprises at least 17 contiguous nucleotides differing by no more than 1 nucleotide from any one the antisense nucleotide sequences in any one of Tables 2-3.

[0096] MEI 52746940v.1 9121301-24420

[0097] In some embodiments, the sense strand comprises any one the sense nucleotide sequences in any one of Tables 2-3, and the antisense strand comprises any one the antisense nucleotide sequences in any one of Tables 2-3.

[0098] In some embodiments, the sense strand consists of any one the sense nucleotide sequences in any one of Tables 2-3, and the antisense strand consists of any one the antisense nucleotide sequences in any one of Tables 2-3.

[0099] In some embodiments, the lipophilic moiety is conjugated via a linker or a carrier.

[0100] The sense strand, the antisense strand, or both the sense strand and the antisense strand may be conjugated to one or more lipophilic moieties. In some embodiments, the lipophilic moiety is conjugated to one or more internal positions in the double stranded region of the dsRNA agent, e.g., the one or more lipophilic moieties may be conjugated to one or more internal positions on the antisense strand. In some embodiments, the one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand via a linker or carrier.

[0101] In some embodiments, lipophilicity of the lipophilic moiety, measured by logKow, exceeds 0. In some embodiments, the hydrophobicity of the dsRNA agent, measured by the unbound fraction in a plasma protein binding assay of the dsRNA agent, exceeds 0.2. In some embodiments, the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein.

[0102] In some embodiments, the internal positions include all positions except the terminal two positions from each end of the sense strand or the antisense strand. In other embodiments, the internal positions include all positions except the terminal three positions from each end of the sense strand or the antisense strand.

[0103] In some embodiments, the internal positions exclude a cleavage site region of the sense strand, e.g., the internal positions include all positions except positions 9-12, counting from the 5’-end of the sense strand or the internal positions include all positions except positions 11-13, counting from the 3’-end of the sense strand.

[0104] In some embodiments, the internal positions exclude a cleavage site region of the antisense strand. In other embodiments, the internal positions include all positions except positions 12-14, counting from the 5’-end of the antisense strand. In some embodiments, the internal positions include all positions except positions 11-13 on the sense strand, counting from the 3 ’-end, and positions 12-14 on the antisense strand, counting from the 5 ’-end.

[0105] In some embodiments, the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5 ’end of each strand.

[0106] In some embodiments, the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5 ’-end of each strand.

[0107] MEI 52746940v.1 10121301-24420

[0108] In some embodiments, the positions in the double stranded region exclude a cleavage site region of the sense strand.

[0109] In some embodiments, the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand.

[0110] In other embodiments, the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 21, position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand.

[0111] In some embodiments, the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound. In some embodiments, the lipophilic moiety is selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, l,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.

[0112] In some embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, lithocholic acid (LCA), eicosapentaenoic acid (EP A), docosahexaenoic acid (DHA), docosanoic acid (DCA), choline, vitamin A, vitamin E, retinoic acid, and alpha-tocopheryl succinate. In some embodiments, the lipophilic moiety is selected from the group consisting of eicosapentaenoic acid (EP A), docosahexaenoic acid (DHA), and docosanoic acid (DCA). In some embodiments, the lipophilic moiety is not cholesterol.

[0113] In some embodiments, the lipophilic moiety contains a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne.

[0114] In some embodiments, the lipophilic moiety contains a saturated or unsaturated C6-C 18 hydrocarbon chain.

[0115] In some embodiments, the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain. In some embodiments, the saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6, counting from the 5 ’-end of the strand.

[0116] In some embodiments, the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotide(s) in the internal position(s) or the double stranded region. In some embodiments, the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; or is an acyclic moiety based on a serinol backbone or a diethanolamine backbone.

[0117] In some embodiments, the lipophilic moiety is conjugated to the dsRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide -thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction, or carbamate.

[0118] MEI 52746940v.1 11121301-24420

[0119] In some embodiments, the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or intemucleosidic linkage.

[0120] In some embodiments, the dsRNA agent comprises at least one modified nucleotide. In some embodiments, no more than five of the sense strand nucleotides and no more than five of the nucleotides of the antisense strand are unmodified nucleotides. In other embodiments, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification.

[0121] In some embodiments, at least one of the modified nucleotides is selected from the group a deoxy -nucleotide, a 3 ’-terminal deoxythimidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, 2’-hydroxly-modified nucleotide, a 2 ’-methoxy ethyl modified nucleotide, a 2’ -O-alkyl -modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5'-methylphosphonate group, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic, a nucleotide comprising vinyl phosphonate, a glycol nucleic acid (GNA) or a glycol nucleic acid S-isomer (S-GNA) (e.g., a nucleotide comprising adenosine-glycol nucleic acid (GNA), a nucleotide comprising cytidine-glycol nucleic acid (GNA), a nucleotide comprising guanosine-glycol nucleic acid (GNA), or a nucleotide comprising thymidine -glycol nucleic acid (GNA)), a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate, a nucleotide comprising 2’-deoxythymidine-3 ’phosphate, a nucleotide comprising 2’-deoxyguanosine-3 ’-phosphate, a nucleotide comprising 2 ’-deoxyadenosine-3 ’phosphate, a nucleotide comprising 2’-deoxycytidine-3’-phosphate, and a terminal nucleotide linked to a cholesteryl derivative and a dodecanoic acid bisdecylamide group; and combinations thereof.

[0122] In other embodiments, the modified nucleotide is selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, 3 ’-terminal deoxythimidine nucleotides (dT), a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.

[0123] In some embodiments, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a glycol modified nucleotide (GNA), and a vinyl-phosphonate nucleotide; and combinations thereof.

[0124] In some embodiments, at least one of the modifications on the nucleotides is a thermally destabilizing nucleotide modification. In some embodiments, the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex; and destabilizing sugar modification, a 2 ’-deoxy modification, an acyclic nucleotide, an unlocked nucleic acids (UNA), and a glycerol nucleic acid (GNA)

[0125] MEI 52746940v.1 12121301-24420

[0126] In some embodiments, the modified nucleotide comprises a short sequence of 3 ’-terminal deoxythimidine nucleotides (dT).

[0127] In some embodiments, the modifications on the nucleotides are 2’-O-methyl, GNA and 2’fluoro modifications.

[0128] In some embodiments, the dsRNA agent further comprises at least one phosphorothioate intemucleotide linkage. In some embodiments, the dsRNA agent comprises 6-8 phosphorothioate intemucleotide linkages. In one embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3 ’-terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In a related embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 5 ’-terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In another embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the both the 5’- and 3 ’-terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand.

[0129] In some embodiments, each strand is no more than 30 nucleotides in length.

[0130] In some embodiments, at least one strand comprises a 3 ’ overhang of at least 1 nucleotide or a 3 ’ overhang of at least 2 nucleotides.

[0131] The double stranded region may be 15-30 nucleotide pairs in length; 17-23 nucleotide pairs in length; 17-25 nucleotide pairs in length; 23-27 nucleotide pairs in length; 19-21 nucleotide pairs in length; or 21 -23 nucleotide pairs in length.

[0132] Each strand may be 19-30 nucleotides; 19-23 nucleotides; or 21-23 nucleotides.

[0133] In some embodiments, the dsRNA agent further comprises a targeting ligand that targets a liver tissue. In some embodiments, the targeting ligand is a GalNAc conjugate.

[0134] In certain embodiments, the double-stranded RNAi agent further includes a targeting ligand that targets a receptor which mediates delivery to a CNS tissue, e.g., a hydrophilic ligand.

[0135] In certain embodiments, the targeting ligand is a Cl 6 ligand. In one embodiment, the ligand is conjugated at the 2 ’-position of a nucleotide or modified nucleotide within the sense or antisense strand. For example, a C16 ligand may be conjugated as shown in the following structure:

[0136]

[0137] where * denotes a bond to an adjacent nucleotide, and B is a nucleobase or a nucleobase analog, optionally where B is adenine, guanine, cytosine, thymine or uracil.

[0138] MEI 52746940v.1 13121301-24420

[0139] In some embodiments, the lipophilic moeity or targeting ligand is conjugated via a bio-clevable linker selected from the group consisting of DNA, RNA, disulfide, amide, funtionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof.

[0140] In some embodiments, the 3’ end of the sense strand is protected via an end cap which is a cyclic group having an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl.

[0141] In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first intemucleotide linkage at the 3 ’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp configuration or Sp configuration.

[0142] In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first and second intemucleotide linkages at the 3 ’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.

[0143] In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first, second and third intemucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.

[0144] In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first, and second intemucleotide linkages at the 3 ’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the third intemucleotide linkages at the 3 ’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.

[0145] In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first, and second intemucleotide linkages at the 3 ’ end of the antisense strand, having the

[0146] MEI 52746940v.1 14121301-24420

[0147] linkage phosphorus atom m Sp configuration, a terminal, chiral modification occurring at the first, and second intemucleotide linkages at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.

[0148] In some embodiments, the dsRNA agent further comprises a phosphate or phosphate mimic at the 5 ’-end of the antisense strand. In some embodiments, the phosphate mimic is a 5 ’-vinyl phosphonate (VP). When the phosphate mimic is a 5’-vinyl phosphonate (VP), the 5’-terminal nucleotide can have the following structure,

[0149]

[0150] wherein * indicates the location of the bond to 5’-position of the adjacent nucleotide;

[0151] R is hydrogen, hydroxy, methoxy, fluoro, or another 2 ’-modification described herein (e.g., hydroxy or methoxy); and

[0152] B is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine or uracil.

[0153] In some embodiments, the base pair at the 1 position of the 5’-end of the antisense strand of the duplex is an AU base pair.

[0154] In some embodiments, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.

[0155] In one embodiment, the dsRNA agent comprises at least one modified nucleotide.

[0156] In one embodiment, substantially all of the nucleotides of the sense strand; substantially all of the nucleotides of the antisense strand comprise a modification; or substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification.

[0157] In one embodiment, all of the nucleotides of the sense strand comprise a modification; all of the nucleotides of the antisense strand comprise a modification; or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification.

[0158] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 3 ’-terminal deoxythimidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’ -O-allyl -modified nucleotide, 2’-C-alkyl-modified nucleotide, a 2’-methoxyethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nucleotide, a

[0159] MEI 52746940v.1 15121301-24420

[0160] phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5 ’-phosphate, a nucleotide comprising a 5 ’-phosphate mimic, a thermally destabilizing nucleotide, a glycol modified nucleotide (GNA), and a 2-O-(N-methylacetamide) modified nucleotide; and combinations thereof.

[0161] In one embodiment, the modifications on the nucleotides are selected from the group consisting of LNA, glycol nucleic acid (GNA), hexitol nucleic acid (HNA), 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2’-hydroxyl, and glycol; and combinations thereof.

[0162] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 2’-O-methyl modified nucleotide, a 2’-fluoro modified nucleotide, a 2’-deoxy-modified nucleotide, a glycol modified nucleotide (GNA), e.g., Ggn, Cgn, Tgn, or Agn, and, a vinyl-phosphonate nucleotide; and combinations thereof.

[0163] In another embodiment, at least one of the modifications on the nucleotides is a thermally destabilizing nucleotide modification.

[0164] In one embodiment, the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex; and destabilizing sugar modification, a 2 ’-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), and a glycerol nucleic acid (GNA).

[0165] The double stranded region may be 19-30 nucleotide pairs in length; 19-25 nucleotide pairs in length; 19-23 nucleotide pairs in length; 23-27 nucleotide pairs in length; or 21-23 nucleotide pairs in length.

[0166] In one embodiment, each strand is independently no more than 30 nucleotides in length.

[0167] In one embodiment, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

[0168] The region of complementarity may be at least 17 nucleotides in length; 19-23 nucleotides in length; or 19 nucleotides in length.

[0169] In one embodiment, at least one strand comprises a 3 ’ overhang of at least 1 nucleotide.

[0170] In another embodiment, at least one strand comprises a 3’ overhang of at least 2 nucleotides. In one embodiment, the dsRNA agent further comprises a targeting ligand.

[0171] In one embodiment, the ligand is conjugated to the 3 ’ end of the sense strand of the dsRNA agent. In one embodiment, the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate intemucleotide linkage.

[0172] In one embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3 ’-terminus of one strand, e.g., the antisense strand or the sense strand.

[0173] In another embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 5’-terminus of one strand, e.g., the antisense strand or the sense strand.

[0174] MEI 52746940v.1 16121301-24420

[0175] In one embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the both the 5’- and 3 ’-terminus of one strand. In one embodiment, the strand is the antisense strand.

[0176] In one embodiment, the base pair at the 1 position of the 5'-end of the antisense strand of the duplex is an AU base pair.

[0177] The present invention also provides cells containing any of the dsRNA agents of the invention and pharmaceutical compositions comprising any of the dsRNA agents of the invention.

[0178] The pharmaceutical composition of the invention may include dsRNA agent in an unbuffered solution, e.g., saline or water, or the pharmaceutical composition of the invention may include the dsRNA agent is in a buffer solution, e.g., a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.

[0179] In one aspect, the present invention provides a composition for intrathecal administration. The composition includes a dsRNA agent, or a pharmaceutically acceptable salt thereof, as described herein; a calcium ion source; and a diluent, wherein the molar ratio of the calcium ion to the dsRNA agent, or a pharmaceutically acceptable salt thereof, is greater than 3 to 1.

[0180] In one embodiment, the composition is substantially free of inorganic phosphate and / or comprises less than 100 ppm of inorganic phosphate, optionally less than 50 ppm of inorganic phosphate, optionally less than 10 ppm of inorganic phosphate, optionally less than 5 ppm of inorganic phosphate, optionally wherein the composition does not comprise inorganic phosphate.

[0181] In one embodiment, the composition is isotonic to CSF.

[0182] In one embodiment, the composition further comprises a sodium source, a potassium source, a magnesium source, and a calcium source.

[0183] In one embodiment, the composition comprises sodium chloride, magnesium chloride, potassium chloride, and calcium chloride.

[0184] In one embodiment, the composition has a pH between about 6 and about 10, optionally wherein the pH is between about 6.5 and about 8.0.

[0185] In one embodiment, the composition has an osmolality between about 200 and 400 mOsm / kg. In one embodiment, the composition does not comprise a hydrogen phosphate or dihydrogen phosphate.

[0186] In one embodiment, the composition does not comprise a buffer.

[0187] In one embodiment, the composition comprises greater than 1 mg of the dsRNA agent, or a pharmaceutically acceptable salt thereof, per mL of the composition, optionally wherein the composition comprises greater than 5 mg of the dsRNA per mL of the composition, optionally wherein the composition comprises greater than 10 mg of the dsRNA agent, or a pharmaceutically acceptable salt thereof, per mL of the composition, optionally wherein the composition comprises greater than 25 mg of the dsRNA agent, or a pharmaceutically acceptable salt thereof, per mL of the composition, optionally wherein the composition comprises greater than 50 mg of the dsRNA agent, or a pharmaceutically acceptyable salt thereof, per mL of the composition, optionally wherein the composition comprises about 60 mg of the dsRNA agent, or a pharmaceutically acceptable salt thereof, per mL of the composition.

[0188] MEI 52746940v.1 17121301-24420

[0189] In some embodiments, the antisense strand of the dsRNA is present at molar equivalence or in molar excess relative to the sense strand of the dsRNA. In one embodiment, the antisense strand molar excess is about 1 - 2 %.

[0190] In one aspect, the present invention provides a method of inhibiting expression of a PRNP gene in a cell. The method includes contacting the cell with any of the dsRNAs of the invention or any of the pharmaceutical compositions of the invention, thereby inhibiting expression of the PRNP gene in the cell.

[0191] In one embodiment, the cell is within a subject, e.g., a human subject, e.g., a subject having a PRNP-associated disease.

[0192] In certain embodiments, the PRNP-associated disease is a prion disease. In certain embodiments, the prion disease is a genetic prion diseass selected from the group consisting of familial Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1). In some embodiments, the prion disease is a sporadic prion disease selected from the group consisting of sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase-Sensitive Prionopathy (VPSPr). In another embodiment, the prion disease is an acquired prion disease selected from the group consisting of Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).

[0193] In some embodiments, contacting the cell with the dsRNA agent inhibits the expression of PRNP by at least 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, inhibiting expression of PRNP decreases Prion protein (PrP) levels in serum of the subject by at least 50%, 60%, 70%, 80%, 90%, or 95%.

[0194] In one aspect, the present invention provide a method of treating a subject having a disorder that would benefit from reduction in PRNP expression, the method comprising administering to the subject a therapeutically effective amount of any one of the dsRNA agents of the invention, or any one of the pharmaceutical compositions of the invention, thereby treating the subject having the disorder that would benefit from reduction in PRNP expression.

[0195] In another aspect, the present invention provides a method of preventing at least one symptom in a subject having a disorder that would benefit from reduction in PRNP expression, the method comprising administering to the subject a prophylactically effective amount of any one of the dsRNA agents of the invention, or any one of the pharmaceutical compositions of the invention, thereby preventing at least one symptom in the subject having the disorder that would benefit from reduction in PRNP expression.

[0196] In some embodiments, the disorder is a PRNP-associated disease. In some embodiments, the PRNP-associated disease is a prion disease. In some embodiments, the prion disease is a genetic prion disease selected from the group consisting of familial Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1). In some embodiments, the prion disease is a sporadic prion disease selected from the group consisting of sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase- Sensitive Prionopathy (VPSPr). In another embodiment, the prion disease is an acquired prion disease selected from the group consisting of Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).

[0197] MEI 52746940v.1 18121301-24420

[0198] Another aspect of the instant disclosure provides a method of inhibiting the expression of PRNP in a subject, the method comprising administering to the subject a therapeutically effective amount of any one of the dsRNA agents of the invention, or any one of the pharmaceutical compositions of the invention, thereby inhibiting the expression of PRNP in the subject.

[0199] An additional aspect of the disclosure provides a method for treating or preventing a PRNP-associated disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of any one of the dsRNA agents of the invention, or any one of the pharmaceutical compositions of the invention, thereby treating or preventing a PRNP-associated disorder in the subject.

[0200] In certain embodiments, the PRNP-associated disorder is selected from the group consisting of a prion disease, such as a genetic prion disease, e.g., familial Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1). In some embodiments, the prion disease is a sporadic prion disease selected from the group consisting of sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase- Sensitive Prionopathy (VPSPr). In another embodiment, the prion disease is an acquired prion disease selected from the group consisting of Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).

[0201] In some embodiments, the subject is human.

[0202] In some embodiments, the dsRNA agent is administered to the subject at a dose of about 0.01 mg / kg to 50 mg / kg or at a dose of about 5 mg to 1000 mg.

[0203] In some embodiments, the dsRNA agent is administered to the subject intrathecally.

[0204] In some embodiments, the dsRNA agent is administered to the subject subcutaneously.

[0205] In one embodiment, the method reduces the expression of a PRNP gene in a brain or spine tissue, e.g., striatum, cortex, cerebellum, cervical spine, lumbar spine, or thoracic spine.

[0206] In one embodiment, the method reduces the expression of a PRNP gene in the brain.

[0207] In some embodiments, the methods of the invention further comprise administering to the subject an additional agent for treatment or prevention of a PRNP-associated disorder. Exemplary additional therapeutics and treatments include, for example, sedatives, antidepressants, clonazepam, sodium valproate, opiates, antiepileptic drugs, cholinesterase inhibitors, memantine, benzodiazepines, levodopa, COMT inhibitors (e.g., tolcapone and entacapone), dopamine agonists (e.g., bromocriptine, pergolide, pramipexole, ropinirole, piribedil, cabergoline, apomorphine and lisuride), MAO-B inhibitors (e.g., safinamide, selegiline and rasagiline), amantadine, an anticholinergic, modafinil, pimavanserin, doxepin, rasagline, an antipsychotic, an atypical antipsychotic (e.g., amisulpride, olanzapine, risperidone, and clozapine), riluzole, edaravone, deep brain stimulation, non-invasive ventilation (N1V), invasive ventilation physical therapy, occupational therapy, speech therapy, dietary changes and swallowing technique a feeding tube, a PEG tube, probiotics, and psychological therapy.

[0208] The present invention also provides kits comprising any of the dsRNAs of the invention or any of the pharmaceutical compositions of the invention, and optionally, instructions for use.

[0209] In another embodiment, the RNAi agent is a pharmaceutically acceptable salt thereof.

[0210] “Pharmaceutically acceptable salts” of each of RNAi agents herein include, but are not limited to, a

[0211] MEI 52746940v.1 19121301-24420

[0212] sodium salt, a calcium salt, a lithium salt, a potassium salt, an ammonium salt, a magnesium salt, an mixtures thereof. One skilled in the art will appreciate that the RNAi agent, when provided as a polycationic salt having one cation per free acid group of the optionally modified phosophodiester backbone and / or any other acidic modifications (e.g., 5’-terminal phosphonate groups). For example, an oligonucleotide of “n” nucleotides in length contains n- 1 optionally modified phosophodiesters, so that an oligonucleotide of 21 nt in length may be provided as a salt having up to 20 cations (e.g., 20 sodium cations). Similarly, an RNAi agents having a sense strand of 21 nt in length and an antisense strand of 23 nt in length may be provided as a salt having up to 42 cations (e.g., 42 sodium cations). In the preceding example, where the RNAi agent also includes a 5 ’-terminal phosphate or a 5 ’-terminal vinylphosphonate group, the RNAi agent may be provided as a salt having up to 44 cations (e.g., 44 sodium cations). Metabolites of the dsRNA agents described herein are also encompassed by the present disclosure. A “metabolite” is any product of the dsRNA agents disclosed herein that permits specific degradation of target RBP4 RNA through a RISC pathway and that is produced in vivo following contacting of a cell with a dsRNA agent or following administration of a dsRNA agent to a subject. Exemplary metabolites include, for example, the antisense strand of a dsRNA agent, or a pharmaceutically acceptable salt, targeting RBP4 as disclosed herein that has been unwound and separated from the sense strand of dsRNA agent on entering a RISC complex and the antisense strand lacking the 3’-terminal nucleotide (3’N-l AS).

[0213] The present invention further provides an RNA-induced silencing complex (RISC) comprising an antisense strand of any of the dsRNA agents of the invention.

[0214] BRIEF DESCRIPTION OF THE DRAWINGS FIG.l is a graph depicting the percentage of human PRNP remaining relative to control in the right hemisphere of Tg26372 hPRNP mice following intracerebroventricular administration of a single 1500 pg dose of the indicated duplexes.

[0215] FIG. 2 depicts the design of the study to assess the effect of single dose of duplexes of interest on human PRNP mRNA and Prion protein (PrP) in Tg26372 hPRNP mice.

[0216] FIG. 3 is a graph depicting the percentage of human PRNP mRNA (left panel) and percentage of human PrP (middle panel) remaining at Day 28 post-dose in the right hemisphere of Tg26372 hPRNP mice following intracerebroventricular administration of a single dose of 37.5 pg, 75 pg, 150 pg, or 300 pg dose of AD-2521027 or AD-2521028, as well as the correlation of human PRNP mRNA and human PrP knockdown.

[0217] FIG. 4 is a graph depicting the percentage of human PRNP mRNA and percentage of human PrP remaining at Day 84 post-dose in the right hemisphere of Tg26372 hPRNP mice following intracerebroventricular administration of a single dose of 300 pg dose of AD-2521027 or AD-2521028.

[0218] FIG. 5 is a graph depicting the percentage of PRNP mRNA relative to control remaining at Day 85 post-administration of a single 10 mg, or 60 mg dose of AD-2521027 or AD-2521028 in the

[0219] MEI 52746940v.1 20121301-24420

[0220] prefrontal cortex, thalamus, medulla, cerebellum, hippocampus, hypothalamus and thoracic spine of non-human primates having a >1000ng / mL 24 hour CSF drug level.

[0221] FIG. 6 is a graph depicting the percentage of PrP remaining at Day 85 post-administration of a single 10 mg, or 60 mg dose of AD-2521027 or AD-2521028 in the prefrontal cortex, thalamus, medulla, cerebellum, hippocampus, hypothalamus and thoracic spine of non-human primates having a >1000 ng / mL 24 hour CSF drug level.

[0222] DETAILED DESCRIPTION OF THE INVENTION

[0223] The present disclosure provides RNAi compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a PRNP gene. The PRNP gene may be within a cell, e.g., a cell within a subject, such as a human. The use of these iRNAs enables the targeted degradation of mRNAs of the corresponding gene (PRNP gene) in mammals.

[0224] The iRNAs of the invention have been designed to target a PRNP gene, including portions of the gene that are conserved in the PRNP orthologs of other mammalian species. Without intending to be limited by theory, it is believed that a combination or sub-combination of the foregoing properties and the specific target sites, or the specific modifications in these iRNAs confer to the iRNAs of the invention improved efficacy, stability, potency, durability, and safety.

[0225] Accordingly, the present disclosure also provides methods of using the RNAi compositions of the disclosure for inhibiting the expression of a PRNP gene or for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of a PRNP gene, e.g., a PRNP-associated disesase, e.g., a prion disease, such as a genetic prion disease, such as, Creutzfeldt- Jakob Disease (CJD), Gerstmann-Straussler-Scheinker Disease (GSS), and Fatal Familial Insomnia (FF1), an acquired prion disease, such as Mad Cow Disease, Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD), or a sporadic prion diseasesuch as sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase-Sensitive Prionopathy (VPSPr).

[0226] The RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15- 23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21- 24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a PRNP gene. In certain embodiments, the RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 21-23 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a PRNP gene.

[0227] In certain embodiments, the RNAi agents of the disclosure include an RNA strand (the antisense strand) which can include longer lengths, for example up to 66 nucleotides, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of a PRNP gene. These RNAi

[0228] MEI 52746940v.1 21121301-24420

[0229] agents with the longer length antisense strands can, for example, include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.

[0230] The use of these RNAi agents enables the targeted degradation of mRNAs of a PRNP gene in mammals. Thus, methods and compositions including these RNAi agents are useful for treating a subject who would benefit by a reduction in the levels or activity of PRNP mRNA and / or a Prion protein (PrP), such as a subject having a PRNP-associated disease, e.g., a prion disease.

[0231] The following detailed description discloses how to make and use compositions containing RNAi agents to inhibit the expression of a PRNP gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition or reduction of the expression of the PRNP gene.

[0232] 1. Definitions

[0233] In order that the present disclosure may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this disclosure.

[0234] The articles “a” and “an” are used herein to refer to one or to more than one (z.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.

[0235] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

[0236] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.

[0237] The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

[0238] The term “at least”, “no less than”, or “or more” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 18 nucleotides of a 21 nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.

[0239] MEI 52746940v.1 22121301-24420

[0240] As used herein, “no more than” or “or less” is understood as the value adjacent to the phrase and logical lower values or intergers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range. As used herein, ranges include both the upper and lower limit.

[0241] As used herein, methods of detection can include determination that the amount of analyte present is below the level of detection of the method.

[0242] In the event of a conflict between an indicated target site and the nucleotide sequence for a sense or antisense strand, the indicated sequence takes precedence.

[0243] In the event of a conflict between a chemical structure and a chemical name, the chemical structure takes precedence.

[0244] As used herein, the term “prion protein,” used interchangeably with the term “PRNP,” refers to the well-known gene and polypeptide, also known in the art as AltPrP, ASCR, CD230 antigen, CJD, GSS, Kuru, prion protein (p27-30), PR1P, PrP, PrP27-30, PrP33-35C and PrPc.

[0245] Prion protein genes are highly conserved in mammals, and have been implicated in neurogenesis and differentiation of neural stem cells, neuritogenesis, involvement and interaction with signal transduction pathways, synaptogenesis, neuronal survival via anti- or pro-apoptotic functions, copper binding, redox homeostasis, long-term renewal of hemopoietic stem cells, activation and development of T cells, differentiation and modulation of phagocytosis of leukocytes, and altering leukocyte recruitment to sites of inflammation (Caughey B, Baron GS. Nature. 2006;443:803-810).

[0246] Multiple isoforms of the prion protein exist, two of which are most relevant to prion disease, cellular prion protein (PrPc) and scrapie prion protein (PrPSc). Both PrPcand PrPScisoforms have the same amino acid sequence, however, PrPcconsists mainly of a-helices while PrPSchas undergone a three-dimentsonal structure change to have an increased P-sheet structure. This conformational difference makes PrPScinsoluble in detergents and relatively resistant to degradation by proteases. PrPSchas been shown to be infectious and to self-propagate by acting as a template that induces the conversion of PrPcto PrPSc. PrPScpropagates as oligomers, which polymerize to form amyloid fibrils. The abnormal PrPScprotein builds up in the brain, forming clumps that damage or destroy neurons. The loss of these cells creates microscopic sponge-like holes (vacuoles) in the brain, which leads to the signs and symptoms of prion disease.

[0247] The term “PRNP” includes human PRNP, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. NM 000311.5 (Gl: 1653962152; SEQ ID NO:1); mouse PRNP, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. NM 001278256.1 (Gl: 506326230; SEQ ID NO:2); and rat PRNP, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. XM 006235062.3 (Gl: 1046878307; SEQ ID NOG). The term “PRNP” also includes Macaca fascicularis PRNP, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No.

[0248] XM 005568413.2 (GE982273619; SEQ ID NO:4).

[0249] MEI 52746940v.1 23121301-24420

[0250] Additional examples of PRNP mRNA sequences are readily available using, e.g., GenBank, UniProt, 0M1M, and the Macaca genome project web site.

[0251] Exemplary PRNP nucleotide sequences may also be found in SEQ ID NOs: 1-4. SEQ ID NOs:5-8 are the reverse complement sequences of SEQ ID NOs: 1-4, respectively.

[0252] Further information on PRNP is provided, for example in the NCB1 Gene database at www.ncbi.nlm.nih.gov / gene / 5621.

[0253] The entire contents of each of the foregoing GenBank Accession numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application.

[0254] The terms “prion protein” and “PRNP,” as used herein, also refers to naturally occurring DNA sequence variations of the PRNP gene. Numerous sequence variations within the PRNP gene have been identified and may be found at, for example, NCB1 dbSNP and UniProt (see, e.g., www.ncbi.nlm.nih.gov / snp? LinkName=gene_snp&from_uid=5621, the entire contents of which is incorporated herein by reference as of the date of filing this application.

[0255] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a PRNP gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embedment, the target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a PRNP gene. In one embodiment, the target sequence is within the protein coding region of the PRNP gene. In another embodiment, the target sequence is within the 3’ UTR of the PRNP gene.

[0256] The target sequence may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15- 26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21- 27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In some embodiments, the target sequence is about 19 to about 30 nucleotides in length. In other embodiments, the target sequence is about 19 to about 25 nucleotides in length. In still other embodiments, the target sequence is about 19 to about 23 nucleotides in length. In some embodiments, the target sequence is about 21 to about 23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0257] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

[0258] “G,” “C,” “A,” “T”, and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively in the context of a modified or unmodified nucleotide. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1).

[0259] MEI 52746940v.1 24121301-24420

[0260] The skilled person is well aware that guanine, cytosine, adenine, thymidine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the disclosure by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the disclosure.

[0261] The terms “iRNA”, “RNAi agent,” “iRNA agent,” “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. RNA interference (RNAi) is a process that directs the sequence-specific degradation of mRNA. RNAi modulates, e.g., inhibits, the expression of PRNP in a cell, e.g., a cell within a subject, such as a mammalian subject.

[0262] In one embodiment, an RNAi agent of the disclosure includes a single stranded RNAi that interacts with a target RNA sequence, e.g., a PRNP target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into double-stranded short interfering RNAs (siRNAs) comprising a sense strand and an antisense strand by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes these dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). These siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the disclosure relates to a single stranded RNA (ssRNA) (the antisense strand of a siRNA duplex) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., a PRNP gene. Accordingly, the term “siRNA” is also used herein to refer to an RNAi as described above.

[0263] In another embodiment, the RNAi agent may be a single-stranded RNA that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAs are described in U. S. Patent No. 8,101,348 and in Lima etal., (2012) Cell 150:883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.

[0264] MEI 52746940v.1 25121301-24420

[0265] In another embodiment, a “RNAi agent” for use in the compositions and methods of the disclosure is a double stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA” refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a PRNP gene. In some embodiments of the disclosure, a double stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

[0266] In general, a dsRNA molecule can include ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide, a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides; an RNAi agent may include substantial modifications at multiple nucleotides.

[0267] As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified intemucleotide linkage, or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to intemucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.

[0268] In certain embodiments of the instant disclosure, inclusion of a deoxy-nucleotide - which is acknowledged as a naturally occurring form of nucleotide - if present within a RNAi agent can be considered to constitute a modified nucleotide.

[0269] The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0270] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3 ’-end of one strand and the 5 ’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at at least 4, at least 5, at least 6, at least 7, at least 8, at

[0271] MEI 52746940v.1 26121301-24420

[0272] least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides or nucleotides not directed to the target site of the dsRNA. In some embodiments, the hairpin loop can be 10 or fewer nucleotides. In some embodiments, the hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, the hairpin loop can be 4-10 unpaired nucleotides. In some embodiments, the hairpin loop can be 4-8 nucleotides.

[0273] In certain embodiments, the two strands of double-stranded oligomeric compound can be linked together. The two strands can be linked to each other at both ends, or at one end only. By linking at one end is meant that 5'-end of first strand is linked to the 3'-end of the second strand or 3'-end of first strand is linked to 5'-end of the second strand. When the two strands are linked to each other at both ends, 5'-end of first strand is linked to 3'-end of second strand and 3'-end of first strand is linked to 5'-end of second strand. The two strands can be linked together by an oligonucleotide linker including, but not limited to, (N)n; wherein N is independently a modified or unmodified nucleotide and n is 3-23. In some embodiments, n is 3-10, e.g., 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the oligonucleotide linker is selected from the group consisting of GNRA, (G)4, (U)4, and (dT)4, wherein N is a modified or unmodified nucleotide and R is a modified or unmodified purine nucleotide. Some of the nucleotides in the linker can be involved in base-pair interactions with other nucleotides in the linker. The two strands can also be linked together by a non-nucleosidic linker, e.g. a linker described herein. It will be appreciated by one of skill in the art that any oligonucleotide chemical modifications or variations describe herein can be used in the oligonucleotide linker.

[0274] Hairpin and dumbbell type oligomeric compounds will have a duplex region equal to or at least 14, 15, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs. The duplex region can be equal to or less than 200, 100, or 50, in length. In some embodiments, ranges for the duplex region are 15-30, 17 to 23, 19 to 23, and 19 to 21 nucleotides pairs in length.

[0275] The hairpin oligomeric compounds can have a single strand overhang or terminal unpaired region, in some embodiments at the 3', and in some embodiments on the antisense side of the hairpin. In some embodiments, the overhangs are 1-4, more generally 2-3 nucleotides in length. The hairpin oligomeric compounds that can induce RNA interference are also referred to as "shRNA" herein.

[0276] Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3 ’-end of one strand and the 5 ’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs.

[0277] In one embodiment, an RNAi agent of the invention is a dsRNA, each strand of which is 24-30 nucleotides in length, that interacts with a target RNA sequence, e.g., a PRNP target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type 111 endonuclease known as Dicer (Sharp et al.

[0278] MEI 52746940v.1 27121301-24420

[0279] (2001) Genes Dev. 15:485). Dicer, a ribonuclease-lll-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188).

[0280] In one embodiment, an RNAi agent of the invention is a dsRNA agent, each strand of which comprises 19-23 nucleotides that interacts with a PRNP RNA sequence to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type 111 endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-lll-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3’ overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). In one embodiment, an RNAi agent of the invention is a dsRNA of 24-30 nucleotides that interacts with a PRNP RNA sequence to direct the cleavage of the target RNA.

[0281] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of a RNAi agent, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3 '-end or both ends of either an antisense or sense strand of a dsRNA.

[0282] In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end or the 5 ’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

[0283] In certain embodiments, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3 ’-end or the 5 ’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

[0284] MEI 52746940v.1 28121301-24420

[0285] In certain embodiments, the overhang on the sense strand or the antisense strand, can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3 ’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5 ’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3 ’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.

[0286] In certain embodiments, at least one end of at least one strand is extended beyond a duplex targeting region, including structures where one of the strands includes a thermodynamically -stabilizing tetraloop structure (see, e.g., U. S. Patent Nos. 8,513,207 and 8,927,705, as well as W02010033225, the entire contents of each of which are incorporated by reference herein). Such structures may include single-stranded extensions (on one or both sides of the molecule)as well as double-stranded extensions.

[0287] In certain embodiments, the 3' end of the sense strand and the 5' end of the antisense strand are joined by a polynucleotide sequence comprising ribonucleotides, deoxyribonucleotides or both, optionally wherein the polynucleotide sequence comprises a tetraloop sequence. In certain embodiments, the sense strand is 25-35 nucleotides in length.

[0288] A tetraloop may contain ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. Typically, a tetraloop has 4 to 5 nucleotides. In some embodiments, the loop comprises a sequence set forth as GAAA. In some embodiments, at least one of the nucleotide of the loop (GAAA) comprises a nucleotide modification. In some embodiments, the modified nucleotide comprises a 2'-modification. In some embodiments, the 2 '-modification is a modification selected from the group consisting of 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, 2'-aminodiethoxymethanol, 2'- adem, and 2'-deoxy-2'-fhioro- -d-arabinonucleic acid. In some embodiments, all of the nucleotides of the loop are modified. In some embodiments, the G in the GAAA sequence comprises a 2'-OH. In some embodiments, each of the nucleotides in the GAAA sequence comprises a 2'-O-methyl modification. In some embodiments, each of the A in the GAAA sequence comprises a 2'-OH and the G in the GAAA sequence comprises a 2'-O-methyl modification. In some embodiments, each of the A in the GAAA sequence comprises a 2'-O-methoxyethyl (MOE) modification and the G in the GAAA sequence comprises a 2'-O-methyl modification; or each of the A in the GAAA sequence comprises a 2'- adem modification and the G in the GAAA sequence comprises a 2'-O-methyl modification. See, e.g., PCT Publication No. WO 2020 / 206350, the entire contents of which are incorporated herein by reference.

[0289] MEI 52746940v.1 29121301-24420

[0290] An exemplary 2’adem modified nucleotide is shown below:

[0291]

[0292] In one embodiment of the dsRNA, at least one strand comprises a 3 ’ overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3’ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5’ overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5’ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3’ and the 5’ end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.

[0293] In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3 ’-end or the 5 ’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

[0294] In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3 ’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5 ’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3 ’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.

[0295] The terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA

[0296] MEI 52746940v.1 30121301-24420

[0297] is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double stranded over its entire length.

[0298] The term “antisense strand” or "guide strand" refers to the strand of a RNAi agent, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a PRNP mRNA.

[0299] As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a PRNP nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- or 3’-terminus of the RNAi agent.

[0300] In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the antisense strand. In some embodiments, the antisense strand of the double stranded RNA agent of the invention includes no more than 4 mismatches with the target mRNA, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the target mRNA. In some embodiments, the antisense strand double stranded RNA agent of the invention includes no more than 4 mismatches with the sense strand, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the sense strand. In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the sense strand. In some embodiments, the sense strand of the double stranded RNA agent of the invention includes no more than 4 mismatches with the antisense strand, e.g., the sense strand includes 4, 3, 2, 1, or 0 mismatches with the antisense strand. In some embodiments, the nucleotide mismatch is, for example, within 5, 4, 3 nucleotides from the 3 ’-end of the iRNA. In another embodiment, the nucleotide mismatch is, for example, in the 3 ’-terminal nucleotide of the iRNA agent. In some embodiments, the mismatch(s) is not in the seed region.

[0301] Thus, an RNAi agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, a RNAi agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an RNAi agent as described herein contains no more than 2 mismatches. In one embodiment, an RNAi agent as described herein contains no more than 1 mismatch. In one embodiment, an RNAi agent as described herein contains 0 mismatches. In certain embodiments, if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5’- or 3 ’-end of the region of complementarity. For example, in such embodiments, for a 23 nucleotide RNAi agent, the strand which is complementary to a region of a PRNP gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of a PRNP gene. Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of a PRNP gene is important, especially if the particular region of complementarity in a PRNP gene is known to have polymorphic sequence variation within the population.

[0302] MEI 52746940v.1 31121301-24420

[0303] The term “sense strand” or "passenger strand" as used herein, refers to the strand of a RNAi agent that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

[0304] As used herein, “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0305] As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

[0306] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can be, for example, “stringent conditions”, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C or 70 °C for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

[0307] Complementary sequences within a RNAi agent, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3, or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression, in vitro or in vivo.. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that

[0308] MEI 52746940v.1 32121301-24420

[0309] is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.

[0310] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non- Watson-Crick base pairs include, but are not limited to, G: U Wobble or Hoogsteen base pairing.

[0311] The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between two oligonucleotides or polynucleotides, such as the antisense strand of a RNAi agent and a target sequence, as will be understood from the context of their use.

[0312] As used herein, a polynucleotide that is “substantially complementary to at least part of’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g, an mRNA encoding PRNP). For example, a polynucleotide is complementary to at least a part of a PRNP mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding PRNP.

[0313] Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target PRNP sequence.

[0314] In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target PRNP sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 1-4 for PRNP, or a fragment of SEQ ID NOs: 1-4, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary

[0315] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target PRNP sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the sense strand nucleotide sequences in any one of Tables 2-3, or a fragment of any one of the sense strand nucleotide sequences in any one of Tables 2-3, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

[0316] In one embodiment, an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is the same as a target PRNP sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 5-8, or a fragment of any one of SEQ ID NOs: 5-8, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

[0317] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target PRNP sequence and comprise a contiguous nucleotide sequence

[0318] MEI 52746940v.1 33121301-24420

[0319] which is at least 80% complementary over its entire length to a fragment of SEQ ID NO: 1 selected from the group of nucleotides 27-50, 64-91, 78-102, 85-125, 110-140, 143-169, 387-417, 441-475, 492-530, 539-562, 571-616, 659-722, 744-775, 799-832, 826-873, 890-922, 941-1009, 1066-1100, 1097-1123, 1120-1157, 1155-1185, 1169-1195, 1192-1222, 1226-1262, 1426-1451, 1500-1523, 1654-1703, 1709-1736, 1734-1764, 1754-1788, 1785-1831, 1828-1876, 1877-1934, 1933-1968, 2001-2036, 2045-2069, 2064-2105, 2141-2230, 2230-2276, 2276-2327, 2339-2372, and 2387-2409 of SEQ ID NO: 1, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

[0320] In some embodiments, an iRNA of the invention includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target PRNP sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the antisense strand nucleotide sequences in any one of any one of Tables 2-3, or a fragment of any one of the antisense strand nucleotide sequences in any one of Tables 2-3, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

[0321] In some embodiments, the double-stranded region of a double-stranded iRNA agent is equal to or at least, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotide pairs in length.

[0322] In some embodiments, the antisense strand of a double-stranded iRNA agent is equal to or at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0323] In some embodiments, the sense strand of a double-stranded iRNA agent is equal to or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0324] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each independently 15 to 30 nucleotides in length.

[0325] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each independently 19 to 25 nucleotides in length.

[0326] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each independently 21 to 23 nucleotides in length.

[0327] In one embodiment, the sense strand of the iRNA agent is 21 -nucleotides in length, and the antisense strand is 23 -nucleotides in length, wherein the strands form a double-stranded region of 21 consecutive base pairs having a 2-nucleotide long single stranded overhangs at the 3'-end.

[0328] In one aspect of the invention, an agent for use in the methods and compositions of the invention is a single-stranded antisense nucleic acid molecule that inhibits a target mRNA via an antisense inhibition mechanism. The single-stranded antisense RNA molecule is complementary to a sequence within the target mRNA. The single-stranded antisense oligonucleotides can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. The single-stranded antisense RNA molecule may be about 15 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence. For

[0329] MEI 52746940v.1 34121301-24420

[0330] example, the single-stranded antisense RNA molecule may comprise a sequence that is at least about 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense sequences described herein.

[0331] In one embodiment, at least partial suppression of the expression of a PRNP gene, is assessed by a reduction of the amount of PRNP mRNA which can be isolated from or detected in a first cell or group of cells in which a PRNP gene is transcribed and which has or have been treated such that the expression of a PRNP gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition may be expressed in terms of:

[0332] (mRNA in control cells) - (mRNA in treated cells)

[0333] - *100%

[0334] (mRNA in control cells)

[0335] In one embodiment, inhibition of expression is determined by the dual luciferase method in Example 1 wherein the RNAi agent is present at 10 nM.

[0336] The phrase “contacting a cell with an RNAi agent,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0337] Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the central nervous system (CNS), optionally via intrathecal or other injection, or to the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain or be coupled to a ligand, e.g., a lipophilic moiety or moieties as described below and further detailed, e.g., in PCT Publication No. WO 2019 / 217459, which is incorporated herein by reference, that directs or otherwise stabilizes the RNAi agent at a site of interest, e.g., the CNS. In some embodiments, the RNAi agent may contain or be coupled to a ligand, e.g., one or more GalNAc derivatives as described below, that directs or otherwise stabilizes the RNAi agent at a site of interest, e.g., the liver. In other embodiments, the RNAi agent may contain or be coupled to a lipophilic moiety or moieties and one or more GalNAc derivatives. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.

[0338] In one embodiment, contacting a cell with an RNAi agent includes “introducing” or “delivering the RNAi agent into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of a RNAi agent can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing a RNAi agent into a cell may be in vitro or in vivo. For example, for in vivo introduction, a RNAi agent can be injected into a tissue site or administered systemically. In vitro

[0339] MEI 52746940v.1 35121301-24420

[0340] introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or are known in the art.

[0341] The term “lipophile” or “lipophilic moiety” broadly refers to any compound or chemical moiety having an affinity for lipids. One way to characterize the lipophilicity of the lipophilic moiety is by the octanol-water partition coefficient, logKow, where KoWis the ratio of a chemical’s concentration in the octanol-phase to its concentration in the aqueous phase of a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it may also be predicted by using coefficients attributed to the structural components of a chemical which are calculated using first-principle or empirical methods (see, for example, Tetko et al., J. Chem. Inf. Comput. Set. 41: 1407-21 (2001), which is incorporated herein by reference in its entirety). It provides a thermodynamic measure of the tendency of the substance to prefer a non-aqueous or oily milieu rather than water (z.e. its hydrophilic / lipophilic balance). In principle, a chemical substance is lipophilic in character when its logKow exceeds 0. Typically, the lipophilic moiety possesses a logKow exceeding 1, exceeding 1.5, exceeding 2, exceeding 3, exceeding 4, exceeding 5, or exceeding 10. For instance, the logKow of 6-amino hexanol, for instance, is predicted to be approximately 0.7. Using the same method, the logKow of cholesteryl N-(hexan-6-ol) carbamate is predicted to be 10.7.

[0342] The lipophilicity of a molecule can change with respect to the functional group it carries. For instance, adding a hydroxyl group or amine group to the end of a lipophilic moiety can increase or decrease the partition coefficient (e.g., logKow) value of the lipophilic moiety.

[0343] Alternatively, the hydrophobicity of the double-stranded RNAi agent, conjugated to one or more lipophilic moieties, can be measured by its protein binding characteristics. For instance, in certain embodiments, the unbound fraction in the plasma protein binding assay of the double-stranded RNAi agent could be determined to positively correlate to the relative hydrophobicity of the double-stranded RNAi agent, which could then positively correlate to the silencing activity of the double-stranded RNAi agent.

[0344] In one embodiment, the plasma protein binding assay determined is an electrophoretic mobility shift assay (EMSA) using human serum albumin protein. An exemplary protocol of this binding assay is illustrated in detail in, e.g., PCT Publication No. WO 2019 / 217459. The hydrophobicity of the doublestranded RNAi agent, measured by fraction of unbound siRNA in the binding assay, exceeds 0.15, exceeds 0.2, exceeds 0.25, exceeds 0.3, exceeds 0.35, exceeds 0.4, exceeds 0.45, or exceeds 0.5 for an enhanced in vivo delivery of siRNA.

[0345] Accordingly, conjugating the lipophilic moieties to the internal position(s) of the double-stranded RNAi agent provides optimal hydrophobicity for the enhanced in vivo delivery of siRNA.

[0346] The term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., a RNAi agent or a plasmid from which a RNAi agent is transcribed. LNPs are described in, for example, U. S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

[0347] MEI 52746940v.1 36121301-24420

[0348] As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), or a non-primate (such as a cow, sheep, rat, or a mouse). In one embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder, or condition that would benefit from reduction in PRNP expression; a human at risk for a disease, disorder, or condition that would benefit from reduction in PRNP expression; a human having a disease, disorder, or condition that would benefit from reduction in PRNP expression; or human being treated for a disease, disorder, or condition that would benefit from reduction in PRNP expression as described herein.

[0349] As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more signs or symptoms associated with PRNP gene expression or Prion protein (PrP) production, e.g., a PRNP-associated disease, e.g., a prion disease, such as a genetic prion disease, a sporadic prion disease, or an acquired prion disease, in subjects having such diseases. “Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment.

[0350] The term “lower” in the context of the level of PRNP and / or PrP in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, 15%, 20%, 25%, 30%, %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In certain embodiments, a decrease is at least 20%. In certain embodiments, the decrease is at least 50% in a disease marker, e.g., protein or gene expression level. “Lower” in the context of the level of PRNP and / or PrP in a subject is a decrease to a level accepted as within the range of normal for an individual without such disorder. In certain embodiments, “lower” is the decrease in the difference between the level of a marker or symptom for a subject suffering from a disease and a level accepted within the range of normal for an individual, e.g., the level of decrease in bodyweight between an obese individual and an individual having a weight accepted within the range of normal.

[0351] As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder, or condition thereof, that would benefit from a reduction in expression of a PRNP gene or production of PRNP mRNA and / or Prion protein (PrP), refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of a PRNP-associated disease. The failure to develop a disease, disorder, or condition, or the reduction in the development of a symptom associated with such a disease, disorder, or condition, e.g., by at least about 10% on a clinically accepted scale for that disease or disorder, or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention.

[0352] As used herein, the term “PRNP-associated disease” or “PRNP-associated disorder” is understood as any disease or disorder that would benefit from reduction in the expression or activity of PRNP. Such PRNP-associated diseases are characterized by increasing deposition of the abnormally folded scrapie form of PrP protein (PrPsc) in areas of the brain associated with neuronal cell death in such diseases, e.g., prion diseases, such as a genetic prion disease, e.g., Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1), a sporadic prion

[0353] MEI 52746940v.1 37121301-24420

[0354] disease, e.g., sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase-Sensitive Prionopathy (VPSPr), or an acquired prion disease, e.g., Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).

[0355] In one embodiment, a PRNP-associated disease is prion disease. Prion disease is a chronic neurodegenerative disease and is caused by abnormal prions, microscopic infectious agents made of protein. Prions cause a number of diseases in a variety of mammals, including bovine spongiform encephalopathy (BSE or mad cow disease) in cattle and scrapie in sheep. Spongiform refers to the characteristic appearance of infected brains, which become filled with holes until they resemble sponges when examined under a microscope. There are three different subtypes of prion disease categorized by how the disease is contracted. All differ slightly with regards to typical signs, symptoms and duration of illness. The subtypes are sporadic, genetic and acquired. In some embodiments, the PRNP-associated disease is a genetic prion disease, e.g., familial Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1). In some embodiments, the PRNP-associated disease is a sporatic prion disease, e.g., sporadic Creutzfeldt- Jakob disease, sporadic fatal insomnia. In other embodiments, the PRNP-associated disease is an acquired prion disease, e.g., iatogenic Creutzfeldt- Jakob disease, variant Creutzfeldt- Jakob disease or Kuru.

[0356] Prion disease usually starts slowly and gradually worsens over time. The common symptoms of prion disease include difficulties with thinking, memory andjudgment, personality changes such as apathy, agitation and depression, confusion or disorientation (including easily getting lost), involuntary muscle spasms (myoclonus), loss of coordination (ataxia), trouble sleeping (insomnia), difficult or slurred speech and impaired vision or blindness. As a person's condition declines, they often withdraw from family and society. Gradually, bodily functions are lost, ultimately leading to death.

[0357] Creutzfeldt- Jakob disease (CJD) is the most common of the known human prion disease. CJD is a rare, degenerative, fatal brain disorder. It affects about one person in every one million per year worldwide; in the United States there are about 350 cases per year. CJD usually appears in later life and runs a rapid course. Typical onset of symptoms occurs at about age 60, and about 70 percent of individuals die within one year. In the early stages of the disease, people may have failing memory, behavioral changes, lack of coordination, and visual disturbances. As the illness progresses, mental deterioration becomes pronounced and involuntary movements, blindness, weakness of extremities, and coma may occur.

[0358] There are three major categories of CJD. In sporadic CJD, the disease appears even though the person has no known risk factors for the disease. This is by far the most common type of CJD and accounts for at least 85 percent of cases. In genetic CJD, the person may have a family history of the disease and test positive for a genetic mutation associated with CJD. About 10 to 15 percent of cases of CJD in the United States are hereditary. In acquired CJD, the disease is transmitted by exposure to brain or nervous system tissue, usually through certain medical procedures. There is no evidence that CJD is contagious through casual contact with someone who has CJD. Since CJD was first described in 1920, fewer than one percent of cases have been acquired CJD. A type of CJD called variant CJD (or vCJD) can

[0359] MEI 52746940v.1 38121301-24420

[0360] be acquired by eating meat from cattle affected by a disease similar to CJD called bovine spongiform encephalopathy (BSE) or, commonly, “mad cow” disease.

[0361] CJD is characterized by rapidly progressive dementia. Initially, individuals experience problems with muscle coordination, personality changes (including impaired memory, judgment, and thinking), and impaired vision. People with the disease, especially with FF1, also may experience insomnia, depression, or unusual sensations. As the illness progresses, peoples’ mental impairment becomes severe. They often develop involuntary muscle jerks called myoclonus, and they may go blind. They eventually lose the ability to move and speak, and enter a coma. Pneumonia and other infections often occur in these individuals and can lead to death. Variant CJD begins primarily with psychiatric symptoms, affects younger individuals than other types of CJD, and has a longer than usual duration from onset of symptoms to death.

[0362] Some symptoms of CJD can be similar to symptoms of other progressive neurological disorders, such as Alzheimer’s and Huntington’s disease. However, CJD causes unique changes in brain tissue which can be seen at autopsy. It also tends to cause more rapid deterioration of a person’s abilities than Alzheimer’s disease or most other types of dementia.

[0363] " Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a PRNP-associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating, or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.

[0364] “Prophylactically effective amount,” as used herein, is intended to include the amount of a RNAi agent that, when administered to a subject having a PRNP-associated disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0365] A "therapeutically-effective amount" or “prophylacticaly effective amount” also includes an amount of a RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. A RNAi agent employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment.

[0366] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials (including salts), compositions, or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without

[0367] MEI 52746940v.1 39121301-24420

[0368] excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0369] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen- free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.

[0370] The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the brain (e.g., whole brain or certain segments of brain, e.g, striatum, or certain types of cells in the brain, such as, e.g, neurons and glial cells (astrocytes, oligodendrocytes, microglial cells)). In other embodiments, a “sample derived from a subject” refers to liver tissue (or subcomponents thereof) derived from the subject. In some embodiments, a “sample derived from a subject” refers to blood drawn from the subject or plasma or serum derived therefrom. In further embodiments, a “sample derived from a subject” refers to brain tissue (or subcomponents thereof) or retinal tissue (or subcomponents thereof) derived from the subject.

[0371] II. RNAi Agents of the Disclosure

[0372] Described herein are RNAi agents which inhibit the expression of a PRNP gene. In one embodiment, the RNAi agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a PRNP gene in a cell, such as a cell within a subject, e.g, a mammal, such as a human

[0373] MEI 52746940v.1 40121301-24420

[0374] having a PRNP-associated disease, e.g., a prion disease, such as a genetic prion disease, e.g., familial Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1); a sporadic prion disease, e.g., sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase-Sensitive Prionopathy (VPSPr); or an acquired prion disease, e.g., Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).

[0375] The dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a PRNP gene. The region of complementarity is about 15-30 nucleotides or less in length. Upon contact with a cell expressing the PRNP gene, the RNAi agent inhibits the expression of the PRNP gene (e.g., a human gene, a primate gene, a non-primate gene) by at least 50% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western blotting or flowcytometric techniques. In certain embodiments, inhibition of expression is by at least 50% as assayed by the Dual-Glo lucifierase assay in Example 1 where the siRNA is at a 10 nM concentration.

[0376] A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of a PRNP gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.

[0377] Generally, the duplex structure is 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain embodiments, the duplex structure is 18 to 25 base pairs in length, e.g, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-25, 20-24,20-23, 20-22, 20-21, 21-25, 21-24, 21-23, 21-22, 22-25, 22-24, 22-23, 23-25, 23-24 or 24-25 base pairs in length, for example, 19-21 basepairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0378] Similarly, the region of complementarity to the target sequence is 15 to 30 nucleotides in length, e.g, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, for

[0379] MEI 52746940v.1 41121301-24420

[0380] example 19-23 nucleotides in length or 21 -23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0381] In some embodiments, the duplex structure is 19 to 30 base pairs in length. Similarly, the region of complementarity to the target sequence is 19 to 30 nucleotides in length.

[0382] In some embodiments, the dsRNA is 15 to 23 nucleotides in length, or 25 to 30 nucleotides in length. In general, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21 -23 nucleotides can serve as substrates for Dicer. As the ordinarily skilled person will also recognize, the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (z.e., cleavage through a RISC pathway).

[0383] One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 15 to 36 base pairs, e.g., 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18- 30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19- 26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20- 22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs, for example, 19- 21 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex, of e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, a miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, a RNAi agent useful to target PRNP expression is not generated in the target cell by cleavage of a larger dsRNA.

[0384] A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3 '-end or both ends of either an antisense or sense strand of a dsRNA. In certain embodiments, longer, extended overhangs are possible.

[0385] A dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

[0386] iRNA compounds of the invention may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solutionphase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single-

[0387] MEI 52746940v.1 42121301-24420

[0388] stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.

[0389] An siRNA can be produced, e.g., in bulk, by a variety of methods. Exemplary methods include: organic synthesis and RNA cleavage, e.g., in vitro cleavage.

[0390] An siRNA can be made by separately synthesizing a single stranded RNA molecule, or each respective strand of a double-stranded RNA molecule, after which the component strands can then be annealed.

[0391] A large bioreactor, e.g., the OligoPilot 11 from Pharmacia Biotec AB (Uppsala Sweden), can be used to produce a large amount of a particular RNA strand for a given siRNA. The OligoPilotll reactor can efficiently couple a nucleotide using only a 1.5 molar excess of a phosphoramidite nucleotide. To make an RNA strand, ribonucleotides amidites are used. Standard cycles of monomer addition can be used to synthesize the 21 to 23 nucleotide strand for the siRNA. Typically, the two complementary strands are produced separately and then annealed, e.g., after release from the solid support and deprotection.

[0392] Organic synthesis can be used to produce a discrete siRNA species. The complementary of the species to a PRNP gene can be precisely specified. For example, the species may be complementary to a region that includes a polymorphism, e.g., a single nucleotide polymorphism. Further the location of the polymorphism can be precisely defined. In some embodiments, the polymorphism is located in an internal region, e.g., at least 4, 5, 7, or 9 nucleotides from one or both of the termini.

[0393] In one embodiment, RNA generated is carefully purified to remove endsiRNA is cleaved in vitro into siRNAs, for example, using a Dicer or comparable RNAse 111-based activity. For example, the dsiRNA can be incubated in an in vitro extract from Drosophila or using purified components, e.g., a purified RNAse or RISC complex (RNA- induced silencing complex). See, e.g., Ketting et al. Genes Dev 2001 Oct 15;15(20):2654-9 and Hammond Science 2001 Aug 10;293(5532): 1146-50.

[0394] dsiRNA cleavage generally produces a plurality of siRNA species, each being a particular 21 to 23 nt fragment of a source dsiRNA molecule. For example, siRNAs that include sequences complementary to overlapping regions and adjacent regions of a source dsiRNA molecule may be present.

[0395] Regardless of the method of synthesis, the siRNA preparation can be prepared in a solution (e.g., an aqueous or organic solution) that is appropriate for formulation. For example, the siRNA preparation can be precipitated and redissolved in pure double- distilled water, and lyophilized. The dried siRNA can then be resuspended in a solution appropriate for the intended formulation process.

[0396] In one aspect, a dsRNA of the disclosure includes at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence for PRNP may be selected from the group of sequences provided in any one of Tables 2-3, and the corresponding nucleotide sequence of the antisense strand of the sense strand may be selected from the group of sequences of any one of Tables 2-3. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of a PRNP gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where

[0397] MEI 52746940v.1 43121301-24420

[0398] one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 2-3, and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 2-3 for PRNP.

[0399] In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.

[0400] It will be understood that, although the sequences provided herein are described as modified or conjugated sequences, the RNA of the RNAi agent of the disclosure e.g., a dsRNA of the disclosure, may comprise any one of the sequences set forth in any one of Tables 2-3 that is un-modified, un-conjugated, or modified or conjugated differently than described therein. One or more lipophilic ligands or one or more GalNAc ligands can be included in any of the positions of the RNAi agents provided in the instant application.

[0401] The skilled person is well aware that dsRNAs having a duplex structure of about 20 to 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBOJ., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of a PRNP gene by not more than 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence using the in vitro assay with Cos7 and a 10 nM concentration of the RNA agent and the PCR assay as provided in the examples herein, are contemplated to be within the scope of the present disclosure.

[0402] In addition, the RNAs described herein identify a site(s) in a PRNP transcript that is susceptible to RISC-mediated cleavage. As such, the present disclosure further features RNAi agents that target within this site(s). As used herein, a RNAi agent is said to target within a particular site of an RNA transcript if the RNAi agent promotes cleavage of the transcript anywhere within that particular site. Such a RNAi agent will generally include at least about 15 contiguous nucleotides, such as at least 19 nucleotides, from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in a PRNP gene.

[0403] An RNAi agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an RNAi agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an RNAi agent as described herein contains no more than 2 mismatches. In one embodiment, an RNAi agent as described herein contains no more than 1 mismatch. In one embodiment, an RNAi agent as described herein contains 0 mismatches. In certain embodiments,

[0404] MEI 52746940v.1 44121301-24420

[0405] if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5’- or 3 ’-end of the region of complementarity. For example, in such embodiments, for a 23 nucleotide RNAi agent, the strand which is complementary to a region of a PRNP gene generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of a PRNP gene. Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of a PRNP gene is important, especially if the particular region of complementarity in a PRNP gene is known to have polymorphic sequence variation within the population.

[0406] III. Modified RNAi Agents of the Disclosure

[0407] In one embodiment, the RNA of the RNAi agent of the disclosure e.g., a dsRNA, is un-modified, and does not comprise, e.g., chemical modifications or conjugations known in the art and described herein. In certain embodiments, the RNA of an RNAi agent of the disclosure, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the disclosure, substantially all of the nucleotides of an RNAi agent of the disclosure are modified. In other embodiments of the disclosure, all of the nucleotides of an RNAi agent of the disclosure are modified. RNAi agents of the disclosure in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides. In still other embodiments of the disclosure, RNAi agents of the disclosure can include not more than 5, 4, 3, 2 or 1 modified nucleotides.

[0408] The nucleic acids featured in the disclosure can be synthesized or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5 ’-end modifications (phosphorylation, conjugation, inverted linkages) or 3 ’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’-position or 4’-position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages.

[0409] Specific examples of RNAi agents useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or no natural intemucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their intemucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified RNAi agent will have a phosphorus atom in its intemucleoside backbone.

[0410] MEI 52746940v.1 45121301-24420

[0411] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, e.g., sodium salts, mixed salts and free acid forms are also included.

[0412] Representative U. S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U. S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and US Pat RE39464, the entire contents of each of which are hereby incorporated herein by reference.

[0413] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0414] Representative U. S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U. S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0415] In other embodiments, suitable RNA mimetics are contemplated for use in RNAi agents, in which both the sugar and the intemucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U. S. patents that teach the preparation of PNA compounds include, but are not limited to, U. S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents

[0416] MEI 52746940v.1 46121301-24420

[0417] of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the RNAi agents of the disclosure are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0418] Some embodiments featured in the disclosure include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular — CH2— NH— CH2-, — CH2— N(CH3)— O--CH2— [known as a methylene (methylimino) or MM1 backbone], — CH2— O— N(CH3)— CH2—, — CH2— N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2-CH2— of the above-referenced U. S. Patent No. 5,489,677, and the amide backbones of the above -referenced U. S. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced US5,034,506. The native phosphodiester backbone can be represented as -O-P(O)(OH)-OCH2-.

[0419] Modified RNAs can also contain one or more substituted sugar moieties. The RNAi agents, e.g., dsRNAs, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: Ci to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a RNAi agent, or a group for improving the pharmacodynamic properties of a RNAi agent, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O— CH2CH2OCH3, also known as 2'-O-(2 -methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O— CH2— O— CH2— N(CH;)2. Further exemplary modifications include: 5’-Me-2’-F nucleotides, 5’-Me-2’-OMe nucleotides, 5’-Me-2’-deoxynucleotides, (both R and S isomers in these three families); 2’-alkoxyalkyl; and 2’-NMA (N-methylacetamide).

[0420] Other modifications include 2'-methoxy (2'-OCH;), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2’-O-hexadecyl, and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of a RNAi agent, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. RNAi agents can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U. S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U. S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and

[0421] MEI 52746940v.1 47121301-24420

[0422] 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0423] An RNAi agent of the disclosure can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5 -trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3 -deazaguanine and 3 -deazaadenine. Further nucleobases include those disclosed in U. S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0424] Representative U. S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U. S. Patent Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0425] An RNAi agent of the disclosure can also be modified to include one or more bicyclic sugar moities. A “bicyclic sugar” is a furanosyl ring modified by a ring formed by the bridging of two carbons, whether adjacent or non-adjacent. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a ring formed by bridging two carbons, whether adjacent or non-adjacent, of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the

[0426] MEI 52746940v.1 48121301-24420

[0427] 2'-carbon of the sugar ring, optionally, via the 2’-acyclic oxygen atom. Thus, in some embodiments an agent of the disclosure may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH2-O-2’ bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al., (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31 ( 12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the disclosure include one or more bicyclic nucleosides comprising a 4' to 2' bridge.

[0428] A locked nucleoside can be represented by the structure (omitting stereochemistry),

[0429]

[0430] wherein B is a nucleobase or modified nucleobase and L is the linking group that joins the 2’-carbon to the 4’-carbon of the ribose ring. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'-(CH2) — O-2' (LNA); 4'-(CH2) — S-2'; 4'-(CH2)2 — O-2' (ENA); 4'-CH(CH3) — O-2' (also referred to as “constrained ethyl” or “cEt”) and 4'-CH(CH2OCH3) — O-2' (and analogs thereof; see, e.g., U. S. Pat. No. 7,399,845); 4'-C(CH3)(CH3) — 0-2' (and analogs thereof; see e.g., US Patent No. 8,278,283); 4'-CH2 — N(OCH3)-2' (and analogs thereof; see e.g., US Patent No. 8,278,425); 4'-CH2— O— N(CH3)-2' (see, e.g., U. S. Patent Publication No. 2004 / 0171570); 4'-CH2— N(R)— 0-2', wherein R is H, C1-C12 alkyl, or a nitrogen protecting group (see, e.g, U. S. Pat. No. 7,427,672); 4'-CH2 — C(H)(CH3)-2' (see, e.g, Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2 — C(=CH2)-2' (and analogs thereof; see, e.g, US Patent No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0431] Additional representative US Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: US Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133;7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, the entire contents of each of which are hereby incorporated herein by reference.

[0432] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and -D-ribofuranose (see WO 99 / 14226).

[0433] MEI 52746940v.1 49121301-24420

[0434] An RNAi agent of the disclosure can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-O-2' bridge (i.e., L in the preceding structure). In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.” An RNAi agent of the disclosure may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the PRNP and -C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

[0435] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US 2013 / 0190383; and WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference.

[0436] In some embodiments, a RNAi agent of the disclosure comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between Cl'-C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the Cl' and C4' carbons). In another example, the C2'-PRNP' bond (i.e. the covalent carbon-carbon bond between the C2' and PRNP' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

[0437] Representative U. S. publications that teach the preparation of UNA include, but are not limited to, US8, 314,227; and US Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0438] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3’- phosphate, inverted 2’-deoxy-modified ribonucleotide, such as inverted dT(idT), inverted dA (idA), and inverted abasic 2’-deoxyribonucleotide (iAb) and others. Disclosure of this modification can be found in WO 2011 / 005861.

[0439] In one example, the 3’ or 5’ terminal end of a oligonucleotide is linked to an inverted 2 ’-deoxymodified ribonucleotide, such as inverted dT(idT), inverted dA (idA), or a inverted abasic 2’-deoxyribonucleotide (iAb). In one particular example, the inverted 2’-deoxy-modified ribonucleotide is linked to the 3 ’end of an oligonucleotide, such as the 3 ’-end of a sense strand described herein, where the linking is via a 3’ -3’ phosphodiester linkage or a 3’-3’-phosphorothioate linkage.

[0440] In another example, the 3 ’-end of a sense strand is linked via a 3’-3’-phosphorothioate linkage to an inverted abasic ribonucleotide (iAb). In another example, the 3 ’-end of a sense strand is linked via a 3’-3’-phosphorothioate linkage to an inverted dA (idA).

[0441] MEI 52746940v.1 50121301-24420

[0442] In one particular example, the inverted 2’-deoxy-modified ribonucleotide is linked to the 3’end of an oligonucleotide, such as the 3 ’-end of a sense strand described herein, where the linking is via a 3 ’-3’ phosphodiester linkage or a 3’-3’-phosphorothioate linkage.

[0443] In another example, the 3 ’-terminal nucleotides of a sense strand is an inverted dA (idA) and is linked to the preceding nucleotide via a 3’-3’- linkage (e.g., 3’-3’-phosphorothioate linkage).

[0444] Other modifications of a RNAi agent of the disclosure include a 5’ phosphate or 5’ phosphate mimic, e.g., a 5’-terminal phosphate or phosphate mimic on the antisense strand of a RNAi agent.

[0445] Suitable phosphate mimics are disclosed in, for example US 2012 / 0157511, the entire contents of which are incorporated herein by reference.

[0446] A. Modified RNAi agents Comprising Motifs of the Disclosure

[0447] In certain aspects of the disclosure, the double-stranded RNAi agents of the disclosure include agents with chemical modifications as disclosed, for example, in WO 2013 / 075035, the entire contents of which are incorporated herein by reference. As shown herein and in WO 2013 / 075035, one or more motifs of three identical modifications on three consecutive nucleotides may be introduced into a sense strand or antisense strand of an RNAi agent, particularly at or near the cleavage site. In some embodiments, the sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if present, of the sense or antisense strand. The RNAi agent may be optionally conjugated with a lipophilic ligand, e.g., a C16 ligand, for instance on the sense strand. The RNAi agent may be optionally modified with a (. S’J-glycol nucleic acid (GNA) modification, for instance on one or more residues of the antisense strand.

[0448] Accordingly, the disclosure provides double stranded RNAi agents capable of inhibiting the expression of a target gene (z.e., a PRNP gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may be 15-30 nucleotides in length. For example, each strand may be 16-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length. In certain embodiments, each strand is 19-23 nucleotides in length.

[0449] The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as an “RNAi agent.” The duplex region of an RNAi agent may be 15-30 nucleotide pairs in length. For example, the duplex region can be 16-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21 -25 nucleotide pairs in length, or 21 -23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length. In certain embodiments, the duplex region is 19-21 nucleotide pairs in length.

[0450] MEI 52746940v.1 51121301-24420

[0451] In one embodiment, the RNAi agent may contain one or more overhang regions or capping groups at the 3’-end, 5’-end, or both ends of one or both strands. The overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. In certain embodiments, the nucleotide overhang region is 2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.

[0452] In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2 ’-sugar modified, such as, 2-F, 2’-O-methyl, thymidine (T), and any combinations thereof.

[0453] For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.

[0454] The 5’- or 3 overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3 ’-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3 ’-overhang is present in the antisense strand. In one embodiment, this 3 ’-overhang is present in the sense strand.

[0455] The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3'-terminal end of the sense strand or, alternatively, at the 3'-terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5’-end of the antisense strand (i.e., the 3 ’-end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3 ’-end, and the 5 ’-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5 ’-end of the antisense strand and 3 ’-end overhang of the antisense strand favor the guide strand loading into RISC process.

[0456] In one embodiment, the RNAi agent is a double blunt-ended of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5’end.

[0457] In another embodiment, the RNAi agent is a double blunt-ended of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 8, 9, and 10 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5’end.

[0458] MEI 52746940v.1 52121301-24420

[0459] In yet another embodiment, the RNAi agent is a double blunt-ended of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5 ’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5 ’end.

[0460] In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5 ’end; the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5 ’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. In one example, the two nucleotide overhang is at the 3’-end of the antisense strand. When the two nucleotide overhang is at the 3 ’-end of the antisense strand, there may be two phosphorothioate intemucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate intemucleotide linkages between the terminal three nucleotides at both the 5 ’-end of the sense strand and at the 5 ’-end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2’-O-methyl or 2’-fluoro, e.g., in an alternating motif. Optionally, the RNAi agent further comprises a ligand (e.g., a lipophilic ligand, optionally a C16 ligand).

[0461] In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1 - 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5' overhang; wherein at least the sense strand 5' terminal and 3' terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.

[0462] MEI 52746940v.1 53121301-24420

[0463] In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at position 11, 12, and 13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3 ’ end than the first strand, wherein the duplex region region which is at least 25 nucleotides in length, and the second strand is sufficiently complemenatary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent results in an siRNA comprising the 3 ’ end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.

[0464] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.

[0465] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.

[0466] For an RNAi agent having a duplex region of 17-23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5 ’-end. Thus the motifs of three identical modifications may occur at the 9, 10, and 11 positions; 10, 11, and 12 positions; 11, 12, and 13 positions; 12, 13, and 14 positions; or 13, 14, and 15 positions of the antisense strand, the count starting from the first nucleotide from the 5 ’-end of the antisense strand, or, the count starting from the first paired nucleotide within the duplex region from the 5’- end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5 ’-end.

[0467] The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

[0468] In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the

[0469] MEI 52746940v.1 54121301-24420

[0470] cleavage site of the same strand. The wing modification is either adajacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.

[0471] Like the sense strand, the antisense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.

[0472] In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3 ’-end, 5 ’-end or both ends of the strand.

[0473] In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3 ’-end, 5 ’-end or both ends of the strand.

[0474] When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.

[0475] When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two, or three nucleotides in the duplex region.

[0476] In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mistmatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A: U is preferred over G: C; G: U is preferred over G: C; and I: C is preferred over G: C (l=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A: T, A: U, G: C) pairings; and pairings which include a universal base are preferred over canonical pairings.

[0477] In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand independently selected from the group of: A: U, G: U, 1: C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings

[0478] MEI 52746940v.1 55121301-24420

[0479] which include a universal base, to promote the dissociation of the antisense strand at the 5 ’-end of the duplex.

[0480] In one embodiment, the nucleotide at the 1 position within the duplex region from the 5 ’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.

[0481] In another embodiment, the nucleotide at the 3 ’-end of the sense strand is deoxythimidine (dT). In another embodiment, the nucleotide at the 3 ’-end of the antisense strand is deoxythimidine (dT). In one embodiment, there is a short sequence of deoxythimidine nucleotides, for example, two dT nucleotides on the 3 ’-end of the sense or antisense strand.

[0482] In certain embodiments, the compositions and methods of the disclosure include a vinyl phosphonate (VP) modification of an RNAi agent as described herein. In exemplary embodiments, a 5’-vinyl phosphonate modified nucleotide of the disclosure has the structure:

[0483] wherein

[0484]

[0485] R is hydrogen, hydroxy, fluoro, or Ci-2oalkoxy (e.g., methoxy or n-hexadecyloxy);

[0486] R5is =C(H)-P(O)(OH)2 and the double bond between the C5’ carbon and R5is in the E or Z orientation (e.g., E orientation); and

[0487] B is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine, or uracil.

[0488] In one embodiment, R5is =C(H)-P(O)(OH)2 and the double bond between the C5’ carbon and R5’ is in the E orientation. In another embodiment, R is methoxy and R5is =C(H)-P(O)(OH)2 and the double bond between the C5’ carbon and R5’ is in the E orientation. In another embodiment, X is S, R is methoxy, and R5is =C(H)-P(O)(OH)2 and the double bond between the C5’ carbon and R5’ is in the E orientation.

[0489] A vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure. In certain embodiments, a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5’ end of the antisense strand of the dsRNA.

[0490] Vinyl phosphate modifications are also contemplated for the compositions and methods of the instant disclosure. An exemplary vinyl phosphate structure includes the preceding structure, where R5is

[0491] MEI 52746940v.1 56121301-24420

[0492] =C(H)-OP(O)(OH)2 and the double bond between the C5’ carbon and R5is in the E or Z orientation (e.g., E orientation).

[0493] A. Thermally Destabilizing Modifications

[0494] In certain embodiments, a dsRNA molecule can be optimized for RNA interference by incorporating thermally destabilizing modifications in the seed region of the antisense strand. As used herein “seed region” means at positions 2-9 of the 5 ’-end of the referenced strand. For example, thermally destabilizing modifications can be incorporated in the seed region of the antisense strand to reduce or inhibit off-target gene silencing.

[0495] The term “thermally destabilizing modification(s)” includes modification(s) that would result with a dsRNA with a lower overall melting temperature (Tm) than the Tmof the dsRNA without having such modification s). For example, the thermally destabilizing modification(s) can decrease the Tmof the dsRNA by 1 - 4 °C, such as one, two, three or four degrees Celcius. And, the term “thermally destabilizing nucleotide” refers to a nucleotide containing one or more thermally destabilizing modifications.

[0496] It has been discovered that dsRNAs with an antisense strand comprising at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5’ end, of the antisense strand have reduced off-target gene silencing activity. Accordingly, in some embodiments, the antisense strand comprises at least one (e.g., one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5’ region of the antisense strand. In some embodiments, one or more thermally destabilizing modification(s) of the duplex is / are located in positions 2-9, such as positions 4-8, from the 5’-end of the antisense strand. In some further embodiments, the thermally destabilizing modification(s) of the duplex is / are located at position 6, 7 or 8 from the 5 ’-end of the antisense strand. In still some further embodiments, the thermally destabilizing modification of the duplex is located at position 7 from the 5’-end of the antisense strand. In some embodiments, the thermally destabilizing modification of the duplex is located at position 2, 3, 4, 5 or 9 from the 5 ’-end of the antisense strand.

[0497] The thermally destabilizing modifications can include, but are not limited to, abasic modification; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2 ’-deoxy modification, acyclic nucleotide, e.g, unlocked nucleic acids (UNA) or glycol nucleic acid (GN A); and 2 ’-5 ’-linked ribonucleotides (“3 ’-RNA”).

[0498] Exemplified abasic modifications include, but are not limited to the following:

[0499] MEI 52746940v.1 57121301-24420

[0500]

[0501] wherein B is a modified or unmodified nucleobase.

[0502] Exemplified sugar modifications include, but are not limited to the following:

[0503]

[0504] 2'~deoxy unlocked nucleic acid glycol nucleic acid

[0505]

[0506] MEI 52746940v.1 58121301-24420

[0507] wherein B is a modified or unmodified nucleobase.

[0508] In some embodiments the thermally destabilizing modification of the duplex is selected from the group consisting of:

[0509]

[0510] wherein B is a modified or unmodified nucleobase and the asterisk on each structure represents either R, S or racemic.

[0511] In some embodiments the thermally destabilizing modification of the duplex is selected from the group consisting of:

[0512]

[0513] wherein B is a modified or unmodified nucleobase and the asterisk represents either R, S or racemic (e.g. S).

[0514] The term "acyclic nucleotide" refers to any nucleotide having an acyclic ribose sugar, for example, where any of bonds between the ribose carbons (e.g, Cl’-C2’, C2’-PRNP’, PRNP’-C4’, C4’- 04’, or Cl’-O4’) is absent or at least one of ribose carbons or oxygen (e.g, Cl’, C2’, PRNP’, C4’, or 04’) are independently or in combination absent from the nucleotide. In some embodiments, acyclic

[0515]

[0516] wherein B is a modified or unmodified nucleobase, R1and R2independently are H, halogen, OR3, or alkyl; and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar). The term “UNA” refers to

[0517] MEI 52746940v.1 59121301-24420

[0518] unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomers with bonds between Cl C4' being removed (z.e. the covalent carbon-oxygen-carbon bond between the Cl' and C4' carbons). In another example, the C2'-PRNP' bond (z.e. the covalent carbon-carbon bond between the C2' and PRNP' carbons) of the sugar is removed (see Mikhailov et. al., Tetrahedron Letters, 26 (17): 2059 (1985); and Fluiter et al., Mol. Biosyst., 10: 1039 (2009), which are hereby incorporated by reference in their entirety). The acyclic derivative provides greater backbone flexibility without affecting the Watson-Crick pairings. The acyclic nucleotide can be linked via 2’-5’ or 3’-5’ linkage.

[0519] The term ‘GN A’ refers to glycol nucleic acid which is a polymer similar to DNA or RNA but differing in the composition of its “backbone” in that is composed of repeating glycerol units linked by phosphodiester bonds:

[0520]

[0521] The thermally destabilizing modification of the duplex can be mismatches (z.e., noncomplementary base pairs) between the thermally destabilizing nucleotide and the opposing nucleotide in the opposite strand within the dsRNA duplex. Exemplary mismatch base pairs include G: G, G: A, G: U, G: T, A: A, A: C, C: C, C: U, C: T, U: U, T: T, U: T, or a combination thereof. Other mismatch base pairings known in the art are also amenable to the present invention. A mismatch can occur between nucleotides that are either naturally occurring nucleotides or modified nucleotides, z.e., the mismatch base pairing can occur between the nucleobases from respective nucleotides independent of the modifications on the ribose sugars of the nucleotides. In certain embodiments, the dsRNA molecule contains at least one nucleobase in the mismatch pairing that is a 2’-deoxy nucleobase; e.g., the 2’-deoxy nucleobase is in the sense strand.

[0522] In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes nucleotides with impaired Watson-Crick hydrogen-bonding to the complementary base on the target mRNA, such as modified nucleobases:

[0523] MEI 52746940v.1 60121301-24420

[0524]

[0525] More examples of abasic nucleotide, acyclic nucleotide modifications (including UNA and GNA), and mismatch modifications have been described in detail in WO 2011 / 133876, which is herein incorporated by reference in its entirety.

[0526] The thermally destabilizing modifications may also include universal base with reduced or abolished capability to form hydrogen bonds with the opposing bases, and phosphate modifications.

[0527] In some embodiments, the thermally destabilizing modification of the duplex includes nucleotides with non-canonical bases such as, but not limited to, nucleobase modifications with impaired or completely abolished capability to form hydrogen bonds with bases in the opposite strand. These nucleobase modifications have been evaluated for destabilization of the central region of the dsRNA duplex as described in WO 2010 / 0011895, which is herein incorporated by reference in its entirety. Exemplary nucleobase modifications are:

[0528]

[0529] inosine nebularine 2-aminopurine

[0530]

[0531] zimidazole n hylbenzimidazcfe

[0532] In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes one or more a-nucleotide complementary io the base on the target mRNA, such as:

[0533] MEI 52746940v.1 61121301-24420

[0534]

[0535] wherein R is H, OH, OCH3, F, NH2, NHMe, NMe2or O-alkyl.

[0536] Exemplary phosphate modifications known to decrease the thermal stability of dsRNA duplexes compared to natural phosphodiester linkages are:

[0537]

[0538] The alkyl for the R group can be a Ci-CTalkyl. Specific alkyls for the R group include, but are not limited to methyl, ethyl, propyl, isopropyl, butyl, pentyl and hexyl.

[0539] As the skilled artisan will recognize, in view of the functional role of nucleobases is defining specificity of a RNAi agent of the disclosure, while nucleobase modifications can be performed in the various manners as described herein, e.g., to introduce destabilizing modifications into a RNAi agent of the disclosure, e.g, for purpose of enhancing on-target effect relative to off-target effect, the range of modifications available and, in general, present upon RNAi agents of the disclosure tends to be much greater for non-nucleobase modifications, e.g., modifications to sugar groups or phosphate backbones of polyribonucleotides. Such modifications are described in greater detail in other sections of the instant disclosure and are expressly contemplated for RNAi agents of the disclosure, either possessing native nucleobases or modified nucleobases as described above or elsewhere herein.

[0540] In addition to the antisense strand comprising a thermally destabilizing modification, the dsRNA can also comprise one or more stabilizing modifications. For example, the dsRNA can comprise at least two (e.g, two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, the stabilizing modifications all can be present in one strand. In some embodiments, both the sense and the antisense strands comprise at least two stabilizing modifications. The stabilizing modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the stabilizing modification can occur on every nucleotide on the sense strand or antisense strand; each stabilizing modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both stabilizing modification in an alternating pattern. The alternating pattern of the stabilizing modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the stabilizing modifications on the sense strand can have a shift relative to the alternating pattern of the stabilizing modifications on the antisense strand.

[0541] In some embodiments, the antisense strand comprises at least two (e.g, two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises stabilizing modifications at positions 2, 6, 8, 9, 14, and 16 from the 5’-end. In some other embodiments,

[0542] MEI 52746940v.1 62121301-24420

[0543] the antisense comprises stabilizing modifications at positions 2, 6, 14, and 16 from the 5 ’-end. In still some other embodiments, the antisense comprises stabilizing modifications at positions 2, 14, and 16 from the 5 ’-end.

[0544] In some embodiments, the antisense strand comprises at least one stabilizing modification adjacent to the destabilizing modification. For example, the stabilizing modification can be the nucleotide at the 5 ’-end or the 3 ’-end of the destabilizing modification, i.e., at position -1 or + 1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a stabilizing modification at each of the 5 ’-end and the 3 ’-end of the destabilizing modification, i.e., positions -1 and +1 from the position of the destabilizing modification.

[0545] In some embodiments, the antisense strand comprises at least two stabilizing modifications at the 3 ’-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.

[0546] In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the sense strand can be present at any positions. In some embodiments, the sense strand comprises stabilizing modifications at positions 7, 10, and 11 from the 5 ’-end. In some other embodiments, the sense strand comprises stabilizing modifications at positions 7, 9, 10, and 11 from the 5 ’-end. In some embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12, and 15 of the antisense strand, counting from the 5 ’-end of the antisense strand. In some other embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5 ’-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three, or four stabilizing modifications.

[0547] In some embodiments, the sense strand does not comprise a stabilizing modification in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.

[0548] Exemplary thermally stabilizing modifications include, but are not limited to, 2 ’-fluoro modifications. Other thermally stabilizing modifications include, but are not limited to, LN A.

[0549] In some embodiments, the dsRNA of the disclosure comprises at least four (e.g., four, five, six, seven, eight, nine, ten, or more) 2’-fluoro nucleotides. Without limitations, the 2’-fluoro nucleotides all can be present in one strand. In some embodiments, both the sense and the antisense strands comprise at least two 2’-fluoro nucleotides. The 2’-fluoro modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the 2’-fluoro modification can occur on every nucleotide on the sense strand or antisense strand; each 2 ’-fluoro modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both 2’ -fluoro modifications in an alternating pattern. The alternating pattern of the 2 ’-fluoro modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the 2 ’-fluoro

[0550] MEI 52746940v.1 63121301-24420

[0551] modifications on the sense strand can have a shift relative to the alternating pattern of the 2’ -fluoro modifications on the antisense strand.

[0552] In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) 2’-fluoro nucleotides. Without limitations, a 2’-fluoro modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises 2’ -fluoro nucleotides at positions 2, 6, 8, 9, 14, and 16 from the 5’-end. In some other embodiments, the antisense comprises 2 ’-fluoro nucleotides at positions 2, 6, 14, and 16 from the 5 ’-end. In still some other embodiments, the antisense comprises 2’-fluoro nucleotides at positions 2, 14, and 16 from the 5’-end.

[0553] In some embodiments, the antisense strand comprises at least one 2’-fluoro nucleotide adjacent to the destabilizing modification. For example, the 2’-fluoro nucleotide can be the nucleotide at the 5’-end or the 3 ’-end of the destabilizing modification, i.e., at position -1 or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a 2’-fluoro nucleotide at each of the 5 ’-end and the 3 ’-end of the destabilizing modification, i.e., positions -1 and +1 from the position of the destabilizing modification.

[0554] In some embodiments, the antisense strand comprises at least two 2 ’-fluoro nucleotides at the 3’-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.

[0555] In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) 2’-fluoro nucleotides. Without limitations, a 2’-fluoro modification in the sense strand can be present at any positions. In some embodiments, the antisense comprises 2’ -fluoro nucleotides at positions 7, 10, and 11 from the 5 ’-end. In some other embodiments, the sense strand comprises 2 ’-fluoro nucleotides at positions 7, 9, 10, and 11 from the 5 ’-end. In some embodiments, the sense strand comprises 2’-fluoro nucleotides at positions opposite or complimentary to positions 11, 12, and 15 of the antisense strand, counting from the 5 ’-end of the antisense strand. In some other embodiments, the sense strand comprises 2’ -fluoro nucleotides at positions opposite or complimentary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5’-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four 2’-fluoro nucleotides.

[0556] In some embodiments, the sense strand does not comprise a 2 ’-fluoro nucleotide in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.

[0557] In some embodiments, the dsRNA molecule of the disclosure comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide occurs in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), wherein one end of the dsRNA is blunt, while the other end is comprises a 2 nt overhang, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 62’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated

[0558] MEI 52746940v.1 64121301-24420

[0559] with a ligand; (iv) the sense strand comprises 2, 3, 4, or 52’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; (vi) the dsRNA comprises at least four 2’-fluoro modifications; and (vii) the dsRNA comprises a blunt end at 5’-end of the antisense strand. In another emobodiment, the two nucleotide overhang is at the 3 ’-end of the antisense.

[0560] In some embodiments, the dsRNA molecule of the disclosure comprising a sense and antisense strands, wherein: the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5' overhang; wherein at least the sense strand 5' terminal and 3' terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when said double stranded nucleic acid is introduced into a mammalian cell; and wherein the antisense strand contains at least one thermally destabilizing nucleotide, where at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (z.e. at position 2-9 of the 5’-end of the antisense strand). For example, the thermally destabilizing nucleotide occurs between positions opposite or complimentary to positions 14-17 of the 5’-end of the sense strand, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 62’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; and (vi) the dsRNA comprises at least four 2’-fluoro modifications; and (vii) the dsRNA comprises a duplex region of 12-30 nucleotide pairs in length.

[0561] In some embodiments, the dsRNA molecule of the disclosure comprises a sense and antisense strands, wherein the dsRNA molecule comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified nucleotide that is susceptible to enzymatic degradation at position 11 from the 5’end, wherein the 3’ end of said sense strand and the 5’ end of said antisense strand form a blunt end and said antisense strand is 1 -4 nucleotides longer at its 3 ’ end than the sense strand, wherein the duplex region which is at least 25 nucleotides in length, and said antisense strand is sufficiently complementary to a target mRNA along at least 19 nucleotides of said antisense strand length to reduce target gene expression when said dsRNA molecule is introduced into a mammalian cell, and wherein

[0562] MEI 52746940v.1 65121301-24420

[0563] dicer cleavage of said dsRNA results in an siRNA comprising said 3 ’ end of said antisense strand, thereby reducing expression of the target gene in the mammal, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (z.e. at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 62’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2 ’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; and (vi) the dsRNA comprises at least four 2’-fluoro modifications; and (vii) the dsRNA has a duplex region of 12-29 nucleotide pairs in length.

[0564] In some embodiments, every nucleotide in the sense strand and antisense strand of the dsRNA molecule may be modified. Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribosephosphate backbone.

[0565] As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non- linking O of a phosphate moiety. In some cases, the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3’ or 5’ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of an RNA or may only occur in a single stranded region of an RNA. For example, a phosphorothioate modification at a nonlinking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5’ end or ends can be phosphorylated.

[0566] It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both. For example, it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2’-deoxy-2’-fluoro (2’-F) or 2’-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.

[0567] MEI 52746940v.1 66121301-24420

[0568] In some embodiments, each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2 ’-methoxy ethyl, 2’- O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-deoxy, or 2’-fluoro. The strands can contain more than one modification. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2’ -O-methyl or 2’ -fluoro. It is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.

[0569] At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2’-deoxy, 2’- O-methyl or 2’-fluoro modifications, acyclic nucleotides or others. In some embodiments, the sense strand and antisense strand each comprises two differently modified nucleotides selected from 2’-O-methyl or 2’-deoxy. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2'-O-methyl nucleotide, 2’-deoxy nucleotide, 2 ’-dcoxy-2’ -fluoro nucleotide, 2'-O-N-methylacetamido (2'-O-NMA, 2’0-CH2C(O)N(Me)H) nucleotide, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleotide, 2'-O-aminopropyl (2'-O-AP) nucleotide, or 2'-ara-F nucleotide. Again, it is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.

[0570] In some embodiments, the dsRNA molecule of the disclosure comprises modifications of an alternating pattern. The term “alternating motif’ or “alternative pattern” as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be “AB AB AB AB AB AB...,” “AABBAABBAABB...,”

[0571] “AABAABAAB AAB...,” “AAAB AAABAAAB...,” “AAABBBAAABBB...,” or “ABCABCABCABC...,” etc.

[0572] The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB...”, “ACACAC...” “BDBDBD...” or “CDCDCD...,” etc.

[0573] In some embodiments, the dsRNA molecule of the disclosure comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with “ABABAB” from 5’-3’ of the strand and the alternating motif in the antisense strand may start with “BAB AB A” from 3 ’-5 ’of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with “AABBAABB” from 5’-3’ of the strand and the alternating motif in the antisense strand may start with

[0574] MEI 52746940v.1 67121301-24420

[0575] “BBAABBAA” from 3’-5’of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.

[0576] In one particular example, the alternating motif in the sense strand is “AB AB AB” sfrom 5 ’-3’ of the strand, where each A is an unmodified ribonucleotide and each B is a 2’-Omethyl modified nucleotide.

[0577] In one particular example, the alternating motif in the sense strand is “AB AB AB” sfrom 5 ’-3’ of the strand, where each A is an 2 ’-deoxy-2’ -fluoro modified nucleotide and each B is a 2’-Omethyl modified nucleotide.

[0578] In another particular example, the alternating motif in the antisense strand is “BABABA” from 3’-5’of the strand, where each A is a 2’ -deoxy-2’ -fluoro modified nucleotide and each B is a 2’-Omethyl modified nucleotide.

[0579] In one particular example, the alternating motif in the sense strand is “AB AB AB” sfrom 5 ’-3’ of the strand and the alternating motif in the antisense strand is “BABABA” from 3 ’-5 ’of the strand, where each A is an unmodified ribonucleotide and each B is a 2’-Omethyl modified nucleotide.

[0580] In one particular example, the alternating motif in the sense strand is “AB AB AB” sfrom 5 ’-3’ of the strand and the alternating motif in the antisense strand is “BABABA” from 3 ’-5 ’of the strand, where each A is a 2 ’-deoxy-2 ’-fluoro modified nucleotide and each B is a 2’-Omethyl modified nucleotide.

[0581] The dsRNA molecule of the disclosure may further comprise at least one phosphorothioate or methylphosphonate intemucleotide linkage. The phosphorothioate or methylphosphonate intemucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand. For instance, the intemucleotide linkage modification may occur on every nucleotide on the sense strand or antisense strand; each intemucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both intemucleotide linkage modifications in an alternating pattern. The alternating pattern of the intemucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the intemucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the intemucleotide linkage modification on the antisense strand.

[0582] In some embodiments, the dsRNA molecule comprises the phosphorothioate or methylphosphonate intemucleotide linkage modification in the overhang region. For example, the overhang region comprises two nucleotides having a phosphorothioate or methylphosphonate intemucleotide linkage between the two nucleotides. Intemucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate intemucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate intemucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate intemucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are

[0583] MEI 52746940v.1 68121301-24420

[0584] overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. In one emobodiment, these terminal three nucleotides may be at the 3’-end of the antisense strand.

[0585] In some embodiments, the sense strand of the dsRNA molecule comprises 1-10 blocks of two to ten phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0586] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of two phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0587] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of three phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0588] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of four phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0589] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of five phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0590] MEI 52746940v.1 69121301-24420

[0591] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of six phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0592] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of seven phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, or 8 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0593] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of eight phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, 4, 5, or 6 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0594] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of nine phosphorothioate or methylphosphonate intemucleotide linkages separated by 1, 2, 3, or 4 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate intemucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate intemucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

[0595] In some embodiments, the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate intemucleotide linkage modification within 1-10 nucleotides of the termini position(s) of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked through phosphorothioate or methylphosphonate intemucleotide linkage at one end or both ends of the sense or antisense strand.

[0596] In some embodiments, the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate intemucleotide linkage modification within 1-10 nucleotides of the internal region of the duplex of each of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked through phosphorothioate or methylphosphonate intemucleotide linkage at position 8-16 of the duplex region counting from the 5 ’-end of the sense strand; the dsRNA

[0597] MEI 52746940v.1 70121301-24420

[0598] molecule can optionally further comprise one or more phosphorothioate or methylphosphonate intemucleotide linkage modification within 1-10 of the termini position(s).

[0599] In some embodiments, the dsRNA molecule of the disclosure further comprises one to five phosphorothioate or methylphosphonate intemucleotide linkage modification(s) within position 1 -5 and one to five phosphorothioate or methylphosphonate intemucleotide linkage modification(s) within position 18-23 of the sense strand (counting from the 5’-end), and one to two phosphorothioate or methylphosphonate intemucleotide linkage modification at positions 1 and 2 and one to five within positions 18-23 of the antisense strand (counting from the 5’-end).

[0600] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate intemucleotide linkage modification within position 1 -5 and one phosphorothioate or methylphosphonate intemucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 ’-end), and one phosphorothioate intemucleotide linkage modification at positions 1 or 2 and two phosphorothioate or methylphosphonate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).

[0601] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications within position 1 -5 and one phosphorothioate intemucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 ’-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).

[0602] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications within position 1 -5 and two phosphorothioate intemucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).

[0603] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications within position 1 -5 and two phosphorothioate intemucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and one phosphorothioate intemucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).

[0604] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate intemucleotide linkage modification within position 1 -5 and one phosphorothioate intemucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 ’-end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).

[0605] MEI 52746940v.1 71121301-24420

[0606] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate intemucleotide linkage modification within position 1-5 and one within position 18-23 of the sense strand (counting from the 5 ’-end), and two phosphorothioate intemucleotide linkage modification at positions 1 and 2 and one phosphorothioate intemucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).

[0607] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate intemucleotide linkage modification within position 1-5 (counting from the 5 ’-end) of the sense strand, and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and one phosphorothioate intemucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).

[0608] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications within position 1-5 (counting from the 5 ’-end) of the sense strand, and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).

[0609] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications within position 1 -5 and one within position 18-23 of the sense strand (counting from the 5 ’-end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and one phosphorothioate intemucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).

[0610] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications within position 1 -5 and one phosphorothioate intemucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 ’-end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).

[0611] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications within position 1 -5 and one phosphorothioate intemucleotide linkage modification within position 18-23 of the sense strand (counting from the 5 ’-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).

[0612] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications at position 1 and 2, and two phosphorothioate intemucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5 ’-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and one at position 21 of the antisense strand (counting from the 5 ’-end).

[0613] MEI 52746940v.1 72121301-24420

[0614] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate intemucleotide linkage modification at position 1, and one phosphorothioate intemucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications at positions 20 and 21 the antisense strand (counting from the 5’-end).

[0615] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications at position 1 and 2, and two phosphorothioate intemucleotide linkage modifications at position 21 and 22 of the sense strand (counting from the 5 ’-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and one phosphorothioate intemucleotide linkage modification at position 21 of the antisense strand (counting from the 5’-end).

[0616] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate intemucleotide linkage modification at position 1, and one phosphorothioate intemucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications at positions 21 and 22 the antisense strand (counting from the 5’-end).

[0617] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate intemucleotide linkage modifications at position 1 and 2, and two phosphorothioate intemucleotide linkage modifications at position 22 and 23 of the sense strand (counting from the 5 ’-end), and one phosphorothioate intemucleotide linkage modification at positions 1 and one phosphorothioate intemucleotide linkage modification at position 21 of the antisense strand (counting from the 5’-end).

[0618] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate intemucleotide linkage modification at position 1, and one phosphorothioate intemucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications at positions 23 and 23 the antisense strand (counting from the 5’-end).

[0619] In some embodiments, compound of the disclosure comprises a pattern of backbone chiral centers. In some embodiments, a common pattern of backbone chiral centers comprises at least 5 intemucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 6 intemucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 7 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 8 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 9 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at

[0620] MEI 52746940v.1 73121301-24420

[0621] least 11 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 12 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 16 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 17 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 18 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 19 intemucleotide linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 intemucleotide linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 intemucleotide linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 intemucleotide linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 intemucleotide linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 intemucleotide linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 intemucleotide linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 intemucleotide linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 intemucleotide linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 intemucleotide linkages which are not chiral (as a nonlimiting example, a phosphodiester). In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 intemucleotide linkage which is not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 intemucleotide linkages in the Sp configuration, and no more than 8 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 11 intemucleotide linkages in the Sp configuration, and no more than 7 intemucleotide linkages which are not chiral. In

[0622] MEI 52746940v.1 74121301-24420

[0623] some embodiments, a common pattern of backbone chiral centers comprises at least 12 intemucleotide linkages in the Sp configuration, and no more than 6 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 intemucleotide linkages in the Sp configuration, and no more than 6 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 intemucleotide linkages in the Sp configuration, and no more than 5 intemucleotide linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 intemucleotide linkages in the Sp configuration, and no more than 4 intemucleotide linkages which are not chiral. In some embodiments, the intemucleotide linkages in the Sp configuration are optionally contiguous or not contiguous. In some embodiments, the intemucleotide linkages in the Rp configuration are optionally contiguous or not contiguous. In some embodiments, the intemucleotide linkages which are not chiral are optionally contiguous or not contiguous.

[0624] In some embodiments, compound of the disclosure comprises a block is a stereochemistry block. In some embodiments, a block is an Rp block in that each intemucleotidic linkage of the block is Rp. In some embodiments, a 5 ’-block is an Rp block. In some embodiments, a 3 ’-block is an Rp block. In some embodiments, a block is an Sp block in that each intemucleotidic linkage of the block is Sp. In some embodiments, a 5’-block is an Sp block. In some embodiments, a 3’-block is an Sp block. In some embodiments, provided oligonucleotides comprise both Rp and Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Rp but no Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Sp but no Rp blocks. In some embodiments, provided oligonucleotides comprise one or more natural phosphate linkage (PO) blocks wherein each intemucleotide linkage in a natural phosphate linkage.

[0625] In some embodiments, compound of the disclosure comprises a 5 ’-block is an Sp block wherein each sugar moiety comprises a 2’-F modification. In some embodiments, a 5’-block is an Sp block wherein each of intemucleotide linkages is a modified intemucleotide linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 5 ’-block is an Sp block wherein each of intemucleotide linkage is a phosphorothioate linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 5 ’-block comprises 4 or more nucleoside units. In some embodiments, a 5’-block comprises 5 or more nucleoside units. In some embodiments, a 5’-block comprises 6 or more nucleoside units. In some embodiments, a 5’-block comprises 7 or more nucleoside units. In some embodiments, a 3 ’-block is an Sp block wherein each sugar moiety comprises a 2’-F modification. In some embodiments, a 3 ’-block is an Sp block wherein each of intemucleotide linkage is a modified intemucleotide linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 3 ’-block is an Sp block wherein each of intemucleotide linkage is a phosphorothioate linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 3 ’-block comprises 4 or more nucleoside units. In some embodiments, a 3 ’-block comprises 5 or more nucleoside units. In some embodiments, a 3 ’-block comprises 6 or more nucleoside units. In some embodiments, a 3 ’-block comprises 7 or more nucleoside units.

[0626] MEI 52746940v.1 75121301-24420

[0627] In some embodiments, compound of the disclosure comprises a type of nucleoside in a region or an oligonucleotide is followed by a specific type of intemucleotide linkage, e.g., natural phosphate linkage, modified intemucleotide linkage, Rp chiral intemucleotide linkage, Sp chiral intemucleotide linkage, etc. In some embodiments, A is followed by Sp. In some embodiments, A is followed by Rp. In some embodiments, A is followed by natural phosphate linkage (PO). In some embodiments, U is followed by Sp. In some embodiments, U is followed by Rp. In some embodiments, U is followed by natural phosphate linkage (PO). In some embodiments, C is followed by Sp. In some embodiments, C is followed by Rp. In some embodiments, C is followed by natural phosphate linkage (PO). In some embodiments, G is followed by Sp. In some embodiments, G is followed by Rp. In some embodiments, G is followed by natural phosphate linkage (PO). In some embodiments, C and U are followed by Sp. In some embodiments, C and U are followed by Rp. In some embodiments, C and U are followed by natural phosphate linkage (PO). In some embodiments, A and G are followed by Sp. In some embodiments, A and G are followed by Rp.

[0628] In some embodiments, the antisense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (z.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 62’-fluoro modifications; (ii) the antisense comprises 3, 4, or 5 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 52’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; (vi) the dsRNA comprises at least four 2’-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5 ’-end of the antisense strand.

[0629] In some embodiments, the antisense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (z.e., at position 2-9 of the 5 ’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g, one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 62’-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 52 ’-fluoro modifications; (iv) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; (v) the dsRNA comprises at least four 2’-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5 ’-end of the antisense strand.

[0630] In some embodiments, the sense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, wherein the antisense

[0631] MEI 52746940v.1 76121301-24420

[0632] strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5 ’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 62’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’-fluoro modifications; (v) the sense strand comprises 3, 4 or 5 phosphorothioate intemucleotide linkages; (vi) the dsRNA comprises at least four 2’-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’-end of the antisense strand.

[0633] In some embodiments, the sense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, the antisense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 62 ’-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2 ’-fluoro modifications; (iv) the sense strand comprises 3, 4 or 5 phosphorothioate intemucleotide linkages; (v) the dsRNA comprises at least four 2’-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (vii) the dsRNA has a blunt end at 5 ’-end of the antisense strand.

[0634] In some embodiments, the dsRNA molecule of the disclosure comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch can occur in the overhang region or the duplex region. The base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A: U is preferred over G: C; G: U is preferred over G: C; and 1: C is preferred over G: C (l=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A: T, A: U, G: C) pairings; and pairings which include a universal base are preferred over canonical pairings.

[0635] In some embodiments, the dsRNA molecule of the disclosure comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand can be chosen independently from the group of: A: U, G: U, 1: C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5 ’-end of the duplex.

[0636] In some embodiments, the nucleotide at the 1 position within the duplex region from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least

[0637] MEI 52746940v.1 77121301-24420

[0638] one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.

[0639] It was found that introducing 4 ’-modified or 5 ’-modified nucleotide to the 3 ’-end of a phosphodiester (PO), phosphorothioate (PS), or phosphorodithioate (PS2) linkage of a nucleotide at any position of single stranded or double stranded oligonucleotide can exert steric effect to the intemucleotide linkage and, hence, protecting or stabilizing it against nucleases.

[0640] In some embodiments, 5 ’-modified nucleotide is introduced at the 3 ’-end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 5’-alkylated nucleotide may be introduced at the 3 ’-end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 5’ position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 5 ’-alkylated nucleoside is 5 ’-methyl nucleotide. The 5 ’-methyl can be either racemic or chirally pure R or S isomer.

[0641] In some embodiments, 4 ’-modified nucleotide is introduced at the 3 ’-end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 4’-alkylated nucleotide may be introduced at the 3 ’-end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 4’ position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4’-alkylated nucleotide is 4’-methyl nucleoside. The 4’-methyl can be either racemic or chirally pure R or S isomer. Alternatively, a 4’-0-alkylated nucleotide may be introduced at the 3 ’-end of a dinucleotide at any position of single stranded or double stranded siRNA. The 4’-0-alkyl of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4’-0-alkylated nucleotide is 4’-O-methyl nucleoside. The 4’-0-methyl can be either racemic or chirally pure R or S isomer.

[0642] In some embodiments, 5 ’-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 5 ’-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 5 ’-alkylated nucleotide is 5 ’ -methyl nucleotide. The 5 ’-methyl can be either racemic or chirally pure R or S isomer.

[0643] In some embodiments, 4 ’-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 4 ’-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4 ’-alkylated nucleotide is 4’-methyl nucleoside. The 4 ’-methyl can be either racemic or chirally pure R or S isomer.

[0644] In some embodiments, 4’-0-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 5’-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4’-0-alkylated nucleotide is 4’-0-methyl nucleotide. The 4’-0-methyl can be either racemic or chirally pure R or S isomer.

[0645] In some embodiments, the dsRNA molecule of the disclosure can comprise 2 ’-5’ linkages (with 2’-H, 2’-OH and 2’-OMe and with P=O or P=S). For example, the 2’-5’ linkages modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5’ end of the sense strand to avoid sense strand activation by RISC.

[0646] MEI 52746940v.1 78121301-24420

[0647] In another embodiment, the dsRNA molecule of the disclosure can comprise L sugars (e.g, L ribose, L-arabinose with 2’-H, 2’-OH and 2’-OMe). For example, these L sugars modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5’ end of the sense strand to avoid sense strand activation by RISC.

[0648] Various publications describe multimeric siRNA which can all be used with the dsRNA of the disclosure. Such publications include W02007 / 091269, US 7858769, W02010 / 141511, W02007 / 117686, W02009 / 014887, and WO2011 / 031520 which are hereby incorporated by their entirely.

[0649] As described in more detail below, the RNAi agent that contains conjugations of one or more carbohydrate moieties to an RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g, a non-carbohydrate (such as, cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g, nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

[0650] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” such as two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g, the phosphate, or modified phosphate, e.g, sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g, a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide.

[0651] Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g, an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g, a ligand to the constituent ring.

[0652] The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group. For example, the cyclic group can be selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin. The acyclic group is selected from, for example, serinol backbone or diethanolamine backbone.

[0653] MEI 52746940v.1 79121301-24420

[0654] In certain specific embodiments, the RNAi agent for use in the methods of the disclosure is an agent selected from the group of agents listed in any one of Tables 2-3. These agents may further comprise a ligand, such as one or more lipophilic moieties, one or more GalNAc derivatives, or both of one of more lipophilic moieties and one or more GalNAc derivatives.

[0655] IV. iRNAs Conjugated to Ligands

[0656] Another modification of the RNA of an iRNA of the invention involves chemically linking to the iRNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA, e.g., into a cell. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Set. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Set., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium l,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0657] In certain embodiments, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Typical ligands will not take part in duplex pairing in a duplexed nucleic acid.

[0658] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g, a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g, a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ethermaleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer

[0659] MEI 52746940v.1 80121301-24420

[0660] polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an a helical peptide.

[0661] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin Bl 2, biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is a multivalent galactose, e.g., an N-acetyl-galactosamine.

[0662] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3 -propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]?, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport / absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0663] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.

[0664] The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by disrupting the cell’s microtubules, microfilaments, or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0665] In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides,

[0666] MEI 52746940v.1 81121301-24420

[0667] diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc.

[0668] Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

[0669] Ligand-conjugated iRNAs of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

[0670] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems® (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

[0671] In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

[0672] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphorami dites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0673] A. Lipid Conjugates

[0674] In certain embodiments, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule can typically bind a serum protein, such as human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase

[0675] MEI 52746940v.1 82121301-24420

[0676] targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e.g., HSA.

[0677] A lipid-based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

[0678] In certain embodiments, the lipid-based ligand binds HSA. For example, the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced. However, the affinity is typically not so strong that the HSA-ligand binding cannot be reversed.

[0679] In certain embodiments, the lipid-based ligand binds HSA weakly or not at all, such that distribution of the conjugate to the kidney is enhanced. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid-based ligand.

[0680] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low density lipoprotein (LDL).

[0681] B. Cell Permeation Agents

[0682] In another aspect, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In certain embodiments, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is typically an a-helical agent and can have a lipophilic and a lipophobic phase.

[0683] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[0684] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence

[0685] AAV ALLP AVLLALLAP (SEQ ID NO: 9). An RFGF analogue (e.g., amino acid sequence

[0686] MEI 52746940v.1 83121301-24420

[0687] AALLPVLLAAP (SEQ ID NO: 10)) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 11)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 12)) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one -bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Typically, the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

[0688] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand, such as PECAM-1 or VEGF.

[0689] An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide can facilitate targeting of an dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell expressing UvRs (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).

[0690] A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an a-helical linear peptide (e.g., LL-37 or Ceropin Pl), a disulfide bond-containing peptide (e.g., a -defensin, P-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0691] C. Carbohydrate Conjugates

[0692] In some embodiments of the compositions and methods of the invention, an iRNA further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein.

[0693] MEI 52746940v.1 84121301-24420

[0694] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide.

[0695] Carbohydrate conjugates and linkers suitable for use in the present invention include those described in WO 2014 / 179620 and WO 2014 / 179627, the entire contents of each of which are incorporated herein by reference.

[0696] D. Linkers

[0697] In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.

[0698] The term “linker” or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In certain embodiments, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.

[0699] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In another embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

[0700] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include:

[0701] MEI 52746940v.1 85121301-24420

[0702] redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[0703] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a selected pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

[0704] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

[0705] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

[0706] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In certain embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0707] i. Redox cleavable linking groups

[0708] In certain embodiments, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (-S-S-). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic

[0709] MEI 52746940v.1 86121301-24420

[0710] the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

[0711] ii. Phosphate-based, cleavable linking groups

[0712] In certain embodiments, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate -based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O)(ORk)-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk)-O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)-O-, -S-P(O)(Rk)-S-, -O-P(S)( Rk)-S-, wherein Rk at each occurrence can be, independently, C1-C20 alkyl, C1-C20 haloalkyl, C6-C10 aryl, or C7-C12 aralkyl.. Exemplary embodiments include -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, -O-P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O, -S-P(S)(H)-O-, -S-P(O)(H)-S-, and -O-P(S)(H)-S-. In certain embodiments a phosphate-based linking group is -O-P(O)(OH)-O-. These candidates can be evaluated using methods analogous to those described above.

[0713] Hi. Acid cleavable linking groups

[0714] In certain embodiments, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In other embodiments, acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula -C=NN-, C(O)O, or -OC(O). An exemplary embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

[0715] iv. Ester-based cleavable linking groups

[0716] In certain embodiments, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells.

[0717] Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula -C(O)O-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above.

[0718] MEI 52746940v.1 87121301-24420

[0719] v. Peptide-based, cleavable linking groups

[0720] In yet another embodiment, a cleavable linker comprises a peptide -based cleavable linking group. A peptide -based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide -based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (z.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula -NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

[0721] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

[0722] “Chimeric” iRNA compounds or “chimeras,” in the context of this invention, are iRNA compounds, such as dsRNA agents, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, or increased binding affinity for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA: DNA or RNA: RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA: DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression.

[0723] Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0724] In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(l):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), athioether, e.g., hexyl- S -tritylthiol (Manoharan et al., Ann. N. Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et

[0725] MEI 52746940v.1 88121301-24420

[0726] al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.

[0727] V. Delivery of an RNAi Agent of the Disclosure

[0728] The delivery of a RNAi agent of the disclosure to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a PRNP-associated disorder, e.g., a prion disease, such as a genetic prion disease, e.g., familial Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1), can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an RNAi agent of the disclosure either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an RNAi agent, e.g., a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the RNAi agent. These alternatives are discussed further below.

[0729] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with a RNAi agent of the disclosure (see e.g., Akhtar S. and Julian RL., (1992) Trends Cell. Biol.

[0730] 2(5): 139- 144 and WO94 / 02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an RNAi agent include, for example, biological stability of the delivered agent, prevention of non-specific effects, and accumulation of the delivered agent in the target tissue. The non-specific effects of an RNAi agent can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the RNAi agent to be administered. Several studies have shown successful knockdown of gene products when an RNAi agent is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ. et al., (2004) Retina 24: 132-138) and subretinal injections in mice (Reich, SJ. et al. (2003) Mol. Pis. 9:210-216) were both shown to prevent neovascularization in an experimental model of

[0731] MEI 52746940v.1 89121301-24420

[0732] age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, WJ. etal., (2006) Mol. Ther. 14:343-350; Li, S. etal., (2007) Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, PH. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et a.l (2002) BMC Neurosci. 3:18; Shishkina, GT., et al. (2004) Neuroscience 129:521-528; Thakker, ER., et al.

[0733] (2004) Proc. Natl. Acad. Sci. U. S. A. 101:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol.

[0734] 93:594-602) a...

Claims

121301-24420We claim:

1. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prion protein (PRNP) in a cell, or a pharmaceutically acceptable salt thereof,wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, comprises a sense strand and an antisense strand forming a double stranded region,wherein the antisense strand comprises at least 17 contiguous nucleotides differing by no more than three nucleotides from the complement of the nucleotide sequence of nucleotides 843-872 of SEQ ID NO:1,wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a nucleotide modification, andwherein the sense strand, the antisense strand, or both the sense strand and the antisense strand are conjugated to one or more lipophilic moieties.

2. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 1, wherein the antisense strand comprises at least 18 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UTGGAAAAAGATUAGAAAGAUGG -3’ of SEQ ID NO:9208.

3. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 1 or 2, wherein the antisense strand comprises at least 19 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UTGGAAAAAGATUAGAAAGAUGG -3’ of SEQ ID NO:9208.

4. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 3, wherein the antisense strand comprises the nucleotide sequence 5’-UTGGAAAAAGATUAGAAAGAUGG -3’ of SEQ ID NO:9208.

5. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 4, wherein the sense strand comprises at least 17 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9208.

6. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 5, wherein the sense strand comprises at least 18 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188.MEI 52746940v.1 408121301-244207. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 6, wherein the sense strand comprises at least 19 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188.

8. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 7, wherein the sense strand comprises the nucleotide sequence 5’- AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188.

9. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 8, wherein the sense strand comprises the nucleotide sequence 5’- AUCUUUCUAAUCUUUUUCCAA -3’ of SEQ ID NO:9188 and the antisense strand comprises the nucleotide sequence 5’-UTGGAAAAAGATUAGAAAGAUGG -3’ of SEQ ID NO:9208.

10. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 1, wherein the antisense strand comprises at least 17 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

11. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 1 or 10, wherein the antisense strand comprises at least 18 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

12. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1, 10, and 11, wherein the antisense strand comprises at least 19 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

13. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 and 10-12, wherein the antisense strand comprises the nucleotide sequence 5’-UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

14. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 and 10-13, wherein the sense strand comprises at least 17 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187.MEI 52746940v.1 409121301-2442015. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 and 10-14, wherein the sense strand comprises at least 18 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187.

16. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 and 10-15, wherein the sense strand comprises at least 19 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence 5’- UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187.

17. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 and 10-16, wherein the sense strand comprises the nucleotide sequence 5’-UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187.

18. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 and 10-17, wherein the sense strand comprises the nucleotide sequence 5’-UUUCACCAUCUUUCUAAUCUA -3’ of SEQ ID NO:9187 and the antisense strand comprises the nucleotide sequence 5’- UAGATUAGAAAGAUGGUGAAAAC -3’ of SEQ ID NO:9207.

19. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 18, wherein the one or more lipophilic moieties are conjugated to one or more internal positions in the double stranded region of the dsRNA agent, or a pharmaceutically acceptable salt thereof.

20. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 19, wherein the one or more lipophilic moieties are conjugated to one or more internal positions on the sense strand.

21. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 - 20, wherein the one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand via a linker or carrier.

22. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 21, wherein lipophilicity of the lipophilic moiety, measured by logKoW, exceeds 0.MEI 52746940v.1 410121301-2442023. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 22, wherein the hydrophobicity of the dsRNA agent, or a pharmaceutically acceptable salt thereof, measured by the unbound fraction in a plasma protein binding assay of the dsRNA agent, exceeds 0.2.

24. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 23, wherein the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein.

25. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-24, wherein the internal positions include all positions except the terminal two positions from each end of the sense strand or the antisense strand.

26. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 25, wherein the internal positions include all positions except the terminal three positions from each end of the sense strand or the antisense strand.

27. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-26, wherein the internal positions exclude a cleavage site region of the sense strand.

28. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 27, wherein the internal positions include all positions except positions 9-12, counting from the 5 ’-end of the sense strand.

29. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 27, wherein the internal positions include all positions except positions 11-13, counting from the 3 ’-end of the sense strand.

30. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-26, wherein the internal positions exclude a cleavage site region of the antisense strand.

31. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 30, wherein the internal positions include all positions except positions 12-14, counting from the 5 ’-end of the antisense strand.

32. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-31, wherein the internal positions include all positions except positions 11-13 on the sense strand, counting from the 3 ’-end, and positions 12-14 on the antisense strand, counting from the 5 ’-end.MEI 52746940v.1 411121301-2442033. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-32, wherein the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5 ’-end of each strand.

34. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 33, wherein the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5 ’-end of each strand.

35. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 19, wherein the positions in the double stranded region exclude a cleavage site region of the sense strand.

36. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-35, wherein the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand.

37. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-35, wherein the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 21, position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand.

38. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-37, wherein the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound.

39. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 38, wherein the lipophilic moiety is selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, 1, 3 -bis-O(hexadecyl) glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3 -propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.

40. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 39, wherein the lipophilic moiety contains a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne.MEI 52746940v.1 412121301-2442041. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 40, wherein the lipophilic moiety contains a saturated or unsaturated C6-C 18 hydrocarbon chain.

42. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 41, wherein the lipophilic moiety contains a saturated or unsaturated Cl 6 hydrocarbon chain.

43. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 42, wherein the saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6, counting from the 5’-end of the strand.

44. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-43, wherein the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotide(s) in the internal position(s) or the double stranded region.

45. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 44, wherein the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; or is an acyclic moiety based on a serinol backbone or a diethanolamine backbone.

46. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 45, wherein the lipophilic moiety is conjugated to the dsRNA agent, or a pharmaceutically acceptable salt thereof, via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide -thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction, or carbamate.

47. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 46, wherein the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or intemucleosidic linkage.

48. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 47, wherein at least one of the nucleotide modifications is selected from the group a deoxy-nucleotide modification, a 3 ’-terminal deoxythimidine (dT) nucleotide modification, a 2'-O-methyl nucleotide modification, a 2'-fluoro nucleotide modification, a 2'-deoxy- nucleotide modification, a 2’ -5 ’-linked ribonucleotide (3’-RNA) modification, a locked nucleotide modification, an unlocked nucleotide modification, a conformationally restricted nucleotide modification, a constrained ethyl nucleotide modification, an abasic nucleotide modification, a 2’-amino- nucleotide modification, a 2’-O-allyl-nucleotide modification, 2’-C-alkyl- nucleotide modification, 2’-hydroxly- nucleotide modification, a 2’-MEI 52746940v.1 413121301-24420methoxy ethyl nucleotide modification, a 2’-O-alkyl- nucleotide modification, a morpholino nucleotide modification, a phosphoramidate modification, a non-natural base comprising nucleotide modification, a tetrahydropyran nucleotide modification, a 1,5-anhydrohexitol nucleotide modification, a cyclohexenyl nucleotide modification, a nucleotide comprising a 5'-phosphorothioate group modification, a nucleotide comprising a 5'-methylphosphonate group modification, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic modification, a nucleotide comprising vinyl phosphonate modification, a nucleotide comprising adenosine-glycol nucleic acid (GNA) modification, a glycol nucleic acid S-lsomer (S-GNA) modification, a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate modification, a nucleotide comprising 2’-deoxythymidine-3 ’phosphate modification, a nucleotide comprising 2’-deoxyguanosine-3 ’-phosphate modification, a nucleotide comprising 2’ -deoxyadenosine-3 ’phosphate modification, a nucleotide comprising 2’ -deoxycytidine-3 ’ -phosphate modification, and a terminal nucleotide linked to a cholesteryl derivative modification, a dodecanoic acid bisdecylamide group modification; acytidine-2' -phosphate modification, a guanosine-2' -phosphate modification, a uridine-2'-phosphate modification, a adenosine-2' -phosphate modification, a 2'-O-hexadecyl-adenosine-3’-phosphate modification, a 2'-O-hexadecyl-cytidine-3'-phosphate modification, a 2'-O-hexadecyl-guanosine-3'-phosphate modification, and a 2'-O-hexadecyl-uridine-3'-phosphate modification, and combinations thereof.

49. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 48, wherein at least one of the nucleotide modifications is selected from the group consisting of a 2'-deoxy-2'-fluoro nucleotide modification, a 2'-deoxy- nucleotide modification, 3’-terminal deoxythimidine nucleotides (dT) modification, a locked nucleotide modification, an abasic nucleotide modification, a 2’-amino-nucleotide modification, a 2’-alkyl- nucleotide modification, a morpholino nucleotide modification, a phosphoramidate modification, and a non-natural base comprising nucleotide modification.

50. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 48, wherein at least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide modification, a 2'-O-methyl nucleotide modification, a 2'-fluoro nucleotide modification, a 2'-deoxy-nucleotide modification, a glycol nucleotide (GNA) modification, S-GNA modification, 3’-RNA modification, and, a vinyl-phosphonate nucleotide modification; and combinations thereof.

51. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 48, wherein at least one of the nucleotide modifications is a thermally destabilizing nucleotide modification.

52. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 51, wherein the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex modification; and destabilizingMEI 52746940v.1 414121301-24420sugar modification, a 2 ’-deoxy modification, an acyclic nucleotide modification, an unlocked nucleic acids (UNA) modification, and a glycerol nucleic acid (GNA) modification.

53. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 48, wherein the nucleotide modifications comprises a short sequence of 3 ’-terminal deoxythimidine nucleotides (dT).

54. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 48, wherein the nucleotide modifications are 2’-O-methyl modifications, GNA modifications, and 2’fluoro modifications.

55. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-54, further comprising at least one phosphorothioate intemucleotide linkage.

56. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 55, wherein the dsRNA agent comprises 6-8 phosphorothioate intemucleotide linkages.

57. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 56, wherein each strand is no more than 30 nucleotides in length.

58. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 57, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide.

59. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 58, wherein at least one strand comprises a 3’ overhang of at least 2 nucleotides.

60. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 59, wherein the double stranded region is 15-30 nucleotide pairs in length.

61. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 60, wherein the double stranded region is 17-23 nucleotide pairs in length.

62. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 60, wherein the double stranded region is 17-25 nucleotide pairs in length.

63. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 60, wherein the double stranded region is 23-27 nucleotide pairs in length.MEI 52746940v.1 415121301-2442064. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 60, wherein the double stranded region is 19-21 nucleotide pairs in length.

65. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 60, wherein the double stranded region is 21 -23 nucleotide pairs in length.

66. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-65, wherein each strand is 19-30 nucleotides in length.

67. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-65, wherein each strand is 19-23 nucleotides in length.

68. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-65, wherein each strand is 21-23 nucleotides in length.

69. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 68, wherein the lipophilic moiety or targeting ligand is conjugated via a bio-cleavable linker selected from the group consisting of DNA, RNA, disulfide, amide, functionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof.

70. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 69, wherein the 3’ end of the sense strand is protected via an end cap which is a cyclic group having an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl.

71. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1- 70, further comprising a phosphate or phosphate mimic at the 5 ’-end of the antisense strand.

72. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 71, wherein the phosphate mimic is a 5 ’-vinyl phosphonate (VP).

73. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-72, wherein the base pair at the 1 position of the 5'-end of the antisense strand of the duplex is an AU base pair.MEI 52746940v.1 416121301-2442074. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-73, wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

75. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prion protein (PRNP) in a cell, or a pharmaceutically acceptable salt thereof,wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, comprises a sense strand and an antisense strand forming a double stranded region,wherein the sense strand differs by no more than 4 unmodified or modified nucleotides from the nucleotide sequence of 5’-asuscuu(Uhd)cuAfAfUfcuuuuuccsasa-3’ of SEQ ID NO:9228 and the antisense strand differs by no more than 4 unmodified or modified nucleotides from the nucleotide sequence of 5’-VPusdTsggdAadAaagadTuAfgaaagausgsg-3 of SEQ ID NO:9248,wherein a, g, c and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af and Uf are 2'-fluoro A and U, respectively; (Uhd) is 2’-O-hexadecyl-uridine-3’-phosphate; dT is 2' -deoxythymidine-3' -phosphate; dA is 2' -deoxyadenosine-3' -phosphate; and VP is 5 ’-vinyl phosphonate.

76. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 75, wherein the sense strand differs by no more than 3 unmodified or modified nucleotides from the nucleotide sequence of 5’- asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand differs by no more than 3 unmodified or modified nucleotides from the nucleotide sequence of 5’-VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

77. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 75, wherein the sense strand differs by no more than 2 unmodified or modified nucleotides from the nucleotide sequence of 5’- asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand differs by no more than 2 unmodified or modified nucleotides from the nucleotide sequence of 5’-VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

78. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 75, wherein the sense strand differs by no more than 1 unmodified or modified nucleotide from the nucleotide sequence of 5’- asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand differs by no more than 1 unmodified or modified nucleotide from the nucleotide sequence of 5’-VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

79. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 75, wherein the sense strand comprises the nucleotide sequence of 5’- asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQMEI 52746940v.1 417121301-24420ID NO:9228 and the antisense strand comprises the nucleotide sequence of 5’-VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

80. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 85, wherein the sense strand consists of the nucleotide sequence of 5’- asuscuu(Uhd)cuAfAfUfcuuuuuccsasa -3’ of SEQ ID NO:9228 and the antisense strand consists of the nucleotide sequence of 5’-VPusdTsggdAadAaagadTuAfgaaagausgsg -3’ of SEQ ID NO:9248.

81. The dsRNA agent of any one of claims 75-80, which is in a salt form.

82. The dsRNA agent of claims 81 which is in a sodium salt form.

83. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prion protein (PRNP) in a cell, or a pharmaceutically acceptable salt thereof,wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, comprises a sense strand and an antisense strand forming a double stranded region,wherein the sense strand differs by no more than 4 unmodified or modified nucleotides from the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO:9227 and the antisense strand differs by no more than 4 unmodified or modified nucleotides from the nucleotide sequence of 5’-VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc-3’ of SEQ ID NO:9247,a, g, c and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, and Uf are 2'-fluoro A, C, and U, respectively; (Chd) is 2'-O-hexadecyl-cytidine-3’-phosphate; dT is 2'-deoxythymidine-3'-phosphate; (Agn) is Adenosine-glycol nucleic acid (GNA) S-Isomer; and VP is 5’-vinyl phosphonate.

84. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 83, wherein the sense strand differs by no more than 3 unmodified or modified nucleotides from the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO: 9227 and the antisense strand differs by no more than 3 unmodified or modified nucleotides from the nucleotide sequence of 5’-VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

85. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 83, wherein the sense strand differs by no more than 2 unmodified or modified nucleotides from the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO: 9227 and the antisense strand differs by no more than 2 unmodified or modified nucleotides from the nucleotide sequence of 5’-VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.MEI 52746940v.1 418121301-2442086. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 83, wherein the sense strand differs by no more than 1 unmodified or modified nucleotide from the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO:9227 and the antisense strand differs by no more than 1 unmodified or modified nucleotide from the nucleotide sequence of 5’-VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

87. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 83, wherein the sense strand comprises the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO: 9227 and the antisense strand comprises the nucleotide sequence of 5’-VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

88. The dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 83, wherein the sense strand consists of the nucleotide sequence of 5’-ususuca(Chd)caUfCfUfuucuaaucsusa-3’ of SEQ ID NO: 9227 and the antisense strand consists of the nucleotide sequence of 5’-VPusAfsgadTu(Agn)gaaagaUfgGfugaaasasc -3’ of SEQ ID NO:9247.

89. The dsRNA agent of any one of claims 83-88, which is in a salt form.

90. The dsRNA agent of claims 89 which is in a sodium salt form.

91. A cell containing the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-90.

92. A pharmaceutical composition for inhibiting expression of a gene encoding prion protein (PRNP) comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-90.

93. The pharmaceutical composition of claim 92, wherein dsRNA agent, or a pharmaceutically acceptable salt thereof, is in an unbuffered solution.

94. The pharmaceutical composition of claim 93, wherein the unbuffered solution is saline or water.

95. The pharmaceutical composition of claim 94, wherein said dsRNA agent, or a pharmaceutically acceptable salt thereof, is in a buffer solution.MEI 52746940v.1 419121301-2442096. The pharmaceutical composition of claim 95, wherein the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.

97. A composition for intrathecal administration, comprising(a) the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-90; (b) a calcium ion source; and(c) a diluent,wherein the molar ratio of the calcium ion to the dsRNA agent, or a pharmaceutically acceptable salt thereof, is greater than 3 to 1.

98. The composition of claim 97, wherein the composition is substantially free of inorganic phosphate and / or comprises less than 100 ppm of inorganic phosphate, optionally less than 50 ppm of inorganic phosphate, optionally less than 10 ppm of inorganic phosphate, optionally less than 5 ppm of inorganic phosphate, optionally wherein the composition does not comprise inorganic phosphate.

99. The composition of claim 97 or 98, wherein the composition is isotonic to CSF.

100. The composition of any one of claims 97-99, further comprising a sodium source, a potassium source, a magnesium source, and / or a calcium source.

101. The composition of claim 100, comprising sodium chloride, magnesium chloride, potassium chloride, and calcium chloride.

102. The composition of any one of claims 97-101, having a pH between about 6 and about 10, optionally wherein the pH is between about 6.5 and about 8.0.

103. The composition of any one of claims 97-102, having an osmolality between about 200 and 400 mOsm / kg.

104. The composition of any one of claims 97-103, wherein the composition does not comprise a hydrogen phosphate or dihydrogen phosphate.

105. The composition of any one of claims 97-104, wherein the composition does not comprise a buffer.

106. The composition of any one of claims 97-105, wherein the composition comprises greater than 1 mg of the dsRNA agent, or a pharmaceutically acceptable salt thereof, per mL of the composition,MEI 52746940v.1 420121301-24420optionally wherein the composition comprises greater than 5 mg of the dsRNA per mL of the composition, optionally wherein the composition comprises greater than 10 mg of the dsRNA agent, or a pharmaceutically acceptable salt thereof, per mL of the composition, optionally wherein the composition comprises greater than 25 mg of the dsRNA agent, or a pharmaceutically acceptable salt thereof, per mL of the composition, optionally wherein the composition comprises greater than 50 mg of the dsRNA agent, or a pharmaceutically acceptyable salt thereof, per mL of the composition, optionally wherein the composition comprises about 60 mg of the dsRNA agent, or a pharmaceutically acceptable salt thereof, per mL of the composition.

107. The composition of any one of claims 97-106, wherein the antisense strand of the dsRNA agent is present at molar equivalence or in molar excess relative to the sense strand of the dsRNA agent, or the antisense strand of the dsRNA agent is present in about 1 -2% molar excess relative to the sense strand of the dsRNA agent.

108. A method of inhibiting expression of a prion protein (PRNP) gene in a cell, the method comprising contacting the cell with the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 -90, or the pharmaceutical composition of any one of claims 92-96, or the composition of any one of claims 97-106, thereby inhibiting expression of the PRNP gene in the cell.

109. The method of claim 108, wherein the cell is within a subject.

110. The method of claim 109, wherein the subject is a human.

111. The method of claim 110, wherein the subject has a PRNP-associated disorder.

112. The method of claim 111, wherein the PRNP-associated disease is a prion disease.

113. The method of claim 112, wherein the prion disease is a genetic prion disease selected from the group consisting of familial Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1).

114. The method of claim 112, wherein the prion disease is a sporadic prion disease selected from the group consisting of sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase-Sensitive Prionopathy (VPSPr).

115. The method of claim 112, wherein the prion disease is an acquired prion disease selected from the group consisting of Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).MEI 52746940v.1 421121301-24420116. The method of any one of claims 108-115, wherein contacting the cell with the dsRNA agent, or a pharmaceutically acceptable salt thereof, inhibits the expression of PRNP by at least 50%, 60%, 70%, 80%, 90%, or 95%.

117. The method of any one of claims 108-116, wherein inhibiting expression of PRNP decreases Prion protein (PrP) levels in serum of the subject by at least 50%, 60%, 70%, 80%, 90%, or 95%.

118. A method of treating a subject having a disorder that would benefit from reduction in PRNP expression, the method comprising administering to the subject a therapeutically effective amount of the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 -90, or the pharmaceutical composition of any one of claims 92-96, or the composition of any one of claims 97-106, thereby treating the subject having the disorder that would benefit from reduction in PRNP expression.

119. A method of preventing at least one symptom in a subject having a disorder that would benefit from reduction in PRNP expression, the method comprising administering to the subject a prophylactically effective amount of the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 -90, or the pharmaceutical composition of any one of claims 92-96, or the composition of any one of claims 97-106, thereby preventing at least one symptom in the subject having the disorder that would benefit from reduction in PRNP expression.

120. The method of claim 118 or 119, wherein the disorder is a PRNP-associated disease.

121. The method of claim 120, wherein the PRNP-associated disease is a prion disease.

122. The method of claim 121, wherein the prion disease is a genetic prion disease selected from the group consisting of familial Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1).

123. The method of claim 121, wherein the prion disease is a sporadic prion disease selected from the group consisting of sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase-Sensitive Prionopathy (VPSPr).

124. The method of claim 121, wherein the prion disease is an acquired prion disease selected from the group consisting of Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).MEI 52746940v.1 422121301-24420125. A method of inhibiting the expression of PRNP in a subject, the method comprising administering to the subject a therapeutically effective amount of the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1-90, or the pharmaceutical composition of any one of claims 92-96, or the composition of any one of claims 97-106, thereby inhibiting the expression of PRNP in the subject.

126. The method of claim 125, wherein the subject has a PRNP-associated disorder127. A method for treating or preventing a PRNP-associated disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 -90, or the pharmaceutical composition of any one of claims 92-96, or the composition of any one of claims 97-106, thereby treating or preventing a PRNP-associated disorder in the subject.

128. The method of claim 126 or 127, wherein the PRNP-associated disease is a prion disease.

129. The method of claim 128, wherein the prion disease is a genetic prion disease selected from the group consisting of familial Creutzfeldt- Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FF1).

130. The method of claim 128, wherein the prion disease is a sporadic prion disease selected from the group consisting of sporadic Creutzfeldt- Jakob disease, Sporadic Fatal Insomnia (sFl), and Variably Proteinase-Sensitive Prionopathy (VPSPr).

131. The method of claim 128, wherein the prion disease is an acquired prion disease selected from the group consisting of Iatrogenic CJD (iCJD), Kuru, and Variant CJD (vCJD).

132. The method of any one of claims 118-131, wherein the subject is human.

133. The method of any one of claims 118-132, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 0.01 mg / kg to 50 mg / kg or at a dose of about 5 mg to 1000 mg.

134. The method of any one of claims 118-133, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject intrathecally.MEI 52746940v.1 423121301-24420135. The method of any one of claims 118-134, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject subcutaneously.

136. The method of any one of claims 118-135, wherein administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof, reduced the expression of PRNP in a brain or spine tissue.

137. The method of any one of claims 118-136, further comprising administering to the subject an additional agent for treatment or prevention of a PRNP-associated disorder.

138. A kit comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 -90, or the pharmaceutical composition of any one of claims 92-96, or the composition of any one of claims 97-106.

139. A vial comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 -90, or the pharmaceutical composition of any one of claims 92-96, or the composition of any one of claims 97-106.

140. A syringe comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, of any one of claims 1 -90, or the pharmaceutical composition of any one of claims 92-96, or the composition of any one of claims 97-106.MEI 52746940v.1 424

Images