Transposase system and method of use

Abstract

A transposase system comprising a modified Myotis lucifugus transposase protein and at least one targeting element and a method of using the transposase system to stably integrate an exogenous nucleic acid into the genome of a cell, in particular into genomic safe harbor sites such as ribosomal RNA genes.

Description

UH0013WO PATENT TRANSPOSASE SYSTEM AND METHOD OF USEREFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority from U.S. Provisional Application Serial Number 63 / 789,906, f iled April 16, 2025, the content of which is incorporated herein by reference in its entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (name: UH0013WO_ST26.xml; size: 342,786 bytes; and date of creation: April 5, 2026) is herein incorporated by reference in its entirety.BACKGROUND OF THE INVENTION

[0003] Integrating large DNA sequences into precise locations within the human genome remains a significant challenge in gene therapy. Many genetic conditions arise from distinct patient -specific mutations, necessitating customized genome editors for each case. A single therapy capable of inserting large DNA sequences to replace the entire defective gene could theoretically treat these conditions regardless of the specific mutation. Although virus -based methods are highly efficient, they lack control over the insertion site, raising concerns about potential adverse effects, such as insertional mutagenesis and oncogenesis. Moreover, non- integrating viral vectors such as AAV can be immunogenic, making repeat dosing problematic. Although RNA-guided CRISPR-Cas systems can employ homology-directed repair (HDR) for site-specific insertion, this mechanism is inefficient in non-dividing cells and is often impractical for large DNA sequences. Alternate approaches such as homology- independent targeted integration (HITI) have been developed but, like all nuclease-based approaches, theyUH0013WO PATENT introduce double -strand breaks (DSBs ) that can lead to undesirable consequences like deletions, chromosomal rearrangements, and chromothripsis through the activation of non-homologous end joining (NHEJ) pathways. Genomic cleavage by CRISPR nucleases has been shown to activate a DNA damage response by the p53 tumor suppressor, resulting in unwanted selection for cells with impaired p53 function. Furthermore, CRISPR-based tools such as base and prime editors, which do not require DSBs, are limited by the availability of protospacer adjacent motifs (PAMs ) and are restricted in the size of the edits they can introduce.

[0004] Transposases are capable of integrating DNA sequences into the genome without the need for DSBs, presenting a safer alternative to nuclease -based methods. Among the transposable elements being explored for human gene therapy are piggyBac, Sleeping Beauty, and the only known active transposable element isolated from a mammal (the litt le brown bat ), Myotis lucifugus transposase (MLT, or piggyBat) (Mitra et al. (2013 ) Proc. Natl. Acad. Sci. USA 110: 234 -239; Ding et al. (2005 ) Cell 122: 473 -483; Yusa et al. (2011 ) Proc. Natl. Acad. Sci. USA 108: 1531 - 1536; Ivies et al. ( 1997 ) Cell 91: 501 - 510; Hickman et al. (2025 ) Nat. Comm. 16: 458 ). These mobi le elements use a single transposase enzyme to integrate large DNA sequences ( as many as 100 kilobases ) at TA dinucleotides ( Sleeping Beauty) or TTAA tetranucleotides (piggyBac, MLT) ( Ivies et al. ( 1997 ) Cell 91: 501 - 510; Li et al. (2011 ) Nucl. Acids Res. 39: el48 ). The DNA cargo is flanked by left and right transposon ends (also called terminal inverted repeats (TIRs ) ) that are excised by the transposase, forming a transpososome that inserts the transposon DNA without generating DSBs (Mitra et al. (2008 ) EMBO J. 27: 1097 -1109; Chen et al. (2020 ) Nat. Comm. 11: 3446 ).

[0005] A transposable element system capable of precisely integrating large, gene-sized DNA sequences at defined genomicUH0013WO PATENT sites would be a powerful tool for gene therapy. It has been demonstrated that fusing DNA-binding proteins such as transcription activator- like effectors (TALEs) or catalytically inactive ' dead' Cas9 (dCas9) to the piggyBac transposase could facilitate targeted DNA insertion, detected in clonally expanded cells with single insertions (Owens et al. (2013 ) Nucl. Acids Res. 41: 9197-9207; Hew et al. (2019) Syn. Biol. 4: ysz018). However, these approaches require screening from polyclonal populations due to low targeting efficiencies (-0. 06%). Other attempts to link DNA-binding proteins to transposases have similarly produced low efficiencies. Recently, CRISPR-associated transposase (CAST) systems have been developed, demonstrating high efficiency RNA-guided targeting in bacterial cells (Klompe et al. (2019) Nature 571: 219-225; Strecker et al. (2019) Science 365 (6448): 48-53 ). However, efforts to apply CAST systems in human cells have had limited success, with targeting efficiencies of 0.6% in unsorted and 4.7% in sorted cells measured by droplet digital PCR (ddPCR) (Lampe et al. (2024) Nat. Biotechnol. 42: 87-98). Additionally, the therapeutic use of CAST is hindered by its reliance on a complex mix of components (a guide RNA plus eight different proteins), including the bacterial accessory factor ClpX, which is toxic to human cells (Lampe et al. (2024) Nat. Biotechnol. 42: 87 -98). Accordingly, needed in the art are alternative approaches for integrating large, gene-sized DNA sequences into the genome. The present invention addresses this need in the art.SUMMARY OF THE INVENTION

[0006] Provided herein is a transposase system comprising a transposase protein comprising an amino acid sequence having at least about 90% sequence identity to SEQ ID NO: 1 and at least one targeting element comprising an amino acid sequence havingUH0013WO PATENT at least about 90% sequence identity to any one of SEQ ID NOs: 2 -25.

[0007] A nucleic acid encoding a protein of any one of SEQ ID NO: 1-25 is also provided.

[0008] Further provided is a method of stably integrating an exogenous nucleic acid into the genome of a cell, comprising: (a) introducing into the cell a transposon comprising the exogenous nucleic acid flanked by a first transposon end sequence and a second transposon end sequence; and (b) introducing into the cell the transposase system of the invention to stably integrate the exogenous nucleic acid into the genome.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] FIGS. 1A-1B. Identification of Exc+Int-DNA-binding domain mutants to minimize off-target integration. FIG. 1A, Successful excision of the transposon restores a complete ZsGreen reading frame. Excision activity is quantified by measuring ZsGreen fluorescence by f low cytometry. FIG. 1B, Stable TurboGFP integration is assessed by flow cytometry after 17 days, once transient expression from unintegrated plasmid is lost. P, promoter; pA, polyA tail; L and R, left and right TALE binding sites.

[0010] FIGS. 2A-2B. Linking MLT to DNA-binding proteins mediates targeting to plasmids. FIG. 2A, ZnF targeting of MLT to binding sites on the P2P reporter plasmid results in insertion of the transposon at the target TTAA. Splicing of the two halves of EmGFP leads to expression quantified by flow cytometry. FIG.2B, Helper plasmids for distinct strategies linking the ZnF to MLT. P, promoter; NLS, nuclear localization signal.

[0011] FIG. 3. System for improved genome targeting. The MLT comprises a combination of R333S, K334A, N335A, R336K, D416N amino acid substitutions and is fused to an ALFA- tag. The TALEUH0013WO PATENT was redesigned to bind the reverse complement (REVCOM) of the original recognition sequence, and the NbALFA nanobody was repositioned from the C- terminus to the N-terminus of the TALE.

[0012] FIGS. 4A-4E. A panel of optimizations contributes to improved genome targeting. FIG. 4A, ALFA MLT m2 was directed by flanking left and right (L / R) TALEs designed to bind three ribosomal gene (rDNA) target sites (rDNAl, rDNA2, and rDNA3). Both 9 bp and 11 bp TALE recognition sequences were tested. For comparison, chr 6 TALE NbALFA fusions were paired with ALFA MLT without an Exc+Int-mutation or ALFA MLT m2. Controls included TALE NbALFA fusions without transposase (stuffer), and MLT without an ALFA tag that was with or without a TALE NbALFA fusion, n = 3. FIG. 4B, Spacing constraints for the improved configuration NbALFA TALE E2Crev using a TALE that binds the reverse complement of the e2c recognition sequence. P2P reporter plasmids contained e2c recognition sequences, spaced 6 to 22 bp from the target TTAA on the left (L) and right (R). n = 3. FIG.4C, MLT excision and integration comparing ALFA MLT Exc+Int-mutants ml, m2, mil, and ml2. Controls included ALFA MLT without an Exc+Int-mutation and MLT without an ALFA tag. Donor only control did not include a helper plasmid and represents background non-enzymatic inserted plasmid, n = 3. FIG. 4D, ALFA MLT mutants m2 or ml2 were directed by heterodimeric TALEs flanking the target TTAA site on chr 6 and on-target insertion efficiency was measured by ddPCR. Two fusion configurations were tested: NbALFA fused to the N-terminus (NbALFA TALE) or to the C-terminus (TALE NbALFA) of the TALE, n = 3. FIG. 4E, Spacing constraints for ALFA MLT ml2 were assessed by varying the position of the ALFA tag ( I64-G67) within the unstructured N-terminal domain. ALFA MLT ml2 was paired with the NbALFA TALE E2Crev fusion designed to bind to the reverse complement of the e2c recognition sequence. P2P reporter plasmids contained e2cUH0013WO PATENT recognition sequences, spaced 16 to 22 bp from the target TTAA on the left (L) and right (R). ALFA MLT m2 with ALFA tag at G66 and MLT without an ALFA tag were included for comparison, n = 2. Data are shown as mean + s. d.

[0013] FIG. 5. High efficiency targeting to multi -copy rDNA sites. ALFA MLT ml2 was directed to the rDNAl site by flanking left and right (L / R) TALEs designed to bind recognition sequences ranging from 12 bp to 17 bp in length. On- target insertion efficiency for all combinations of TALE lengths was measured by ddPCR. For comparison, ALFA MLT mutants m2 and ml2 were paired with chr 6 TALE NbALFA fusions. Controls included rDNAl NbALFA TALE fusions without transposase (stuffer) or with unmodif ied MLT. n = 3.DETAILED DESCRIPTION OF THE INVENTION

[0014] The following descriptions and examples illustrate embodiments of the present disclosure in detail. Although the present disclosure has been described in some details by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications can be practiced within the scope of the appended claims.

[0015] Although various features of the disclosure can be described in the context of a single embodiment, the features can also be provided separately or in any suitable combination. Conversely, although the present disclosure can be described herein in the context of separate embodiments for clarity, the present disclosure can also be implemented in a single embodiment. It is to be understood that the present disclosure is not limited to the particular aspects described herein and as such can vary. Those of skill in the art will recognize that there can be variations and modifications of the present disclosure, which can be encompassed within its scope.UH0013WO PATENT

[0016] It is intended that every maximum numerical limitation given throughout this specification include every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

[0017] All terms are intended to be understood as they would be understood by a person skilled in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.

[0018] In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification, the singular forms "a, " "an, " and "the" include plural referents unless the context clearly dictates otherwise.

[0019] In this application, the use of "or" means "and / or" unless stated otherwise. The terms "and / or" and "any combination thereof" and their grammatical equivalents as used herein, can be used interchangeably. These terms can convey that any combination is specif ically contemplated. Solely for illustrative purposes, the following phrases " A, B, and / or C" or " A, B, C, or any combination thereof" can mean A individually; B individually; C individually; A and B; B and C; A and C; and A, B, and C. The term "or" can be used conjunctively or disjunctively unless the context specifically refers to a disjunctive use.UH0013WO PATENT

[0020] As used in this specification and claim (s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises" ), "having" (and any form of having, such as "have" and "has" ), "including" (and any form of including, such as "includes" and "include" ) or "containing" (and any form of containing, such as "contains" and "contain" ) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any aspect described herein can be implemented with respect to any method or composition herein, and vice versa. Furthermore, compositions of the present disclosure can be used to achieve the methods described herein.

[0021] The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i. e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. In another example, the amount "about 10" includes 10 and any amounts from 9 to 11. In yet another example, the term "about" in relation to a reference numerical value can also include a range of values plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value. Alternatively, particularly with respect to biological systems or processes, the term "about" can mean within an order of magnitude, preferably within 5 -fold, and more preferably within 2 -fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term "about" meaning within an acceptable error range for the particular value should be assumed. The term "under suitable condition" or "under suitable reaction condition"UH0013WO PATENT refers to any environment that permits a desired reaction to take place.

[0022] To design a programmable transposase, the AlphaFold2 predicted structure of MLT was used to identify a set of mutations that disrupt the native DNA-binding function of MLT and prevent integration but preserve its catalytic activity for excision (Exc+Int-mutants). The transposase' s ability to mediate DNA integration was subsequently restored by tethering the enzyme to a DNA-binding protein that anchors the complex to defined genomic loci. This engineered transposase system, referred to herein as INsertion by Targeted Anchoring and Conditional Transposition (INTACT), enables targeted integration at user-defined sequences. A systematic analysis of the engineered system was conducted to determine (i ) spacing between the DNA-binding protein' s target sequence and the TTAA insertion site, (ii) target sequence orientation relative to the TTAA site, (iii) whether one or two DNA-binding protein target sequences f lank the TTAA site, (iv) transposase linkage site (N-terminus, C-terminus, or internally), (v) DNA-binding protein type (zinc finger or TALE), (vi) surrounding sequence adj acent to the TTAA site, (vii) location of the genomic target sequence, (viii) whether the binding protein was covalently or non-covalently linked, and (ix) mutations in the transposase DNA-binding domain to reduce off-target insertion while maintaining efficiency. Efficient targeting via INTACT included a non-covalent linkage between the transposase and a TALE protein and a defined base-pair spacing between the TALE protein target sequence and TTAA site. Applying these rules to safe harbor sites, high-efficiency on-target insertions at multiple loci was achieved. The most effective configuration targeted multi -copy sites at ribosomal RNA genes, resulting in most cells receiving at least one targeted insertion, with an average of 1.2 on-target insertions per cell. Off -target analysis revealed near-UH0013WO PATENT background activity, indicating that DNA-binding domain mutations successfully reduced unintended integrations. This programmable transposase system enables site-specific integration without inducing DSBs and minimizes off -target integration, offering a safe and efficient method for inserting large DNA into the human genome.

[0023] Accordingly, provided herein is a transposase system comprising a transposase protein and at least one targeting element and a method of using the transposase system to stably integrate an exogenous nucleic acid into the genome of a cell. As used herein, a "transposase system" refers to a system capable of altering a target nucleic acid by a DNA repair pathway.

[0024] In one aspect, the transposase system comprises a transposase protein. In some aspects, the transposase protein is a capable of integrating DNA sequences into the genome without introducing DSBs. In some aspects, the transposase protein is a Myotis lucifugus transposase (MLT). In some aspects, the transposase protein is an MLT protein that has been modified to improve activity. In some aspects, the transposase protein is an MLT protein that has been modified to include each of the following mutations R333S, K334A, N335A, R336K, and D416N. In some aspects, the transposase (MLT protein) further comprises an ALFA-tag peptide therein. As used herein, an ALFA-tag peptide is a rationally designed epitope tag ( SRLEEELRRRLTE; SEQ ID NO: 138) that forms a small and stable a-helix that is functional irrespective of its position with a protein. In some aspects, the transposase comprises an ALFA-tag peptide inserted immediately after Gly 66 of the MLT protein. In some embodiments, the transposase protein comprises an amino acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99. 5%, 99.7%, or 99.9%) sequence identity to SEQ ID NO: 1. In some embodiments, the transposase protein comprises an amino acid sequence having at least 90% (sequence identityUH0013WO PATENT to SEQ ID NO: 1; retains a Ser at position 364, Ala at pos ition 365, Ala at posit ion 366, Lys at position 367, and Asn at position 447 of SEQ ID NO: 1; comprises an ALFA-tag; and exhibits transposase activity.

[0025] In some aspects, the transposase protein is capable of inserting an exogenous nucleic acid in a genomic safe harbor site. In some aspects, the transposase is capable of inserting an exogenous nucleic acid at a TTAA integration site. In some aspects, the transposase is capable of inserting an exogenous nucleic acid at an octanucleot ide selected from tattaata, ttttaata, or ttttaaaa. In some aspects, the transposase is capable of inserting an exogenous nucleic acid at a TTAA integration site in a ribosomal RNA gene (rDNA). In some aspects, the transposase is capable of inserting an exogenous nucleic acid at a TTAA integrat ion site within the nucleic acid sequence of any one of SEQ ID NOs: 108 - 110.

[0026] In one aspect, the transposase system comprises at least one targeting element that binds to a target sequence within the genome of a target cel l and recruits the transposase to the target sequence. In some aspects, the targeting element is a transcription activator- like effector (TALE) DNA binding domain (DBD). In some aspects, the TALE DBD is fused ( i. e., linked) to a recombinant variable domain of a heavy-chain-only antibody (VHH) (nanobody or Nb) that specif ically binds to an ALFA-tag peptide ( i. e., NbALFA). In some aspects, the nanobody is fused to the C- terminus of the TALE DBD. In some aspects, the nanobody is fused to the N- terminus of the TALE DBD. In some aspects, the targeting element comprises an amino acid sequence having at least about 90% (e. g., at least 90%, 91%, 92%, 93 %, 94%, 95%, 96 %, 97%, 98 %, 99%, 99. 5%, 99. 7%, or 99. 9 % ) sequence identity to any one of SEQ ID NOs: 2 -25. In some aspects, the targeting element comprises an amino acid sequence having at least about 90 % sequence identity to any one of SEQ ID NOs: 2 - 7 or 14 - 19. InUH0013WO PATENT some aspects, the targeting element comprises an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOs: 8 - 13 or 20 -25. In some aspects, the targeting element comprises an amino acid sequence having at least about 90 % sequence identity to any one of SEQ ID NOs: 17 - 19. In some aspects, the targeting element comprises an amino acid sequence having at least about 90% sequence ident ity to any one of SEQ ID NOs: 20 -25.

[0027] In some aspects, the TALE DBD binds to a target sequence adj acent to a TTAA integration site. In some aspects, the TALE DBD binds to target sequence within about 9 to about 20 base pairs (e. g., within about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 base pairs) upstream and / or downstream of the TTAA integration site. In some aspects, the TALE DBD binds to target sequence within about 9 to about 20 base pairs of a TTAA integration site in a genomic safe harbor s ite. In some aspects, the TALE DBD binds to target sequence within about 9 to about 20 base pairs of a TTAA integration site selected from tattaata, ttttaata, or ttttaaaa. In some aspects, the TALE DBD binds to target sequence within about 9 to about 20 base pairs of a TTAA integration site in a rDNA. In some aspects, the TALE DBD binds to target sequence within the nucleic acid sequence of any one of SEQ ID NOs: 108 - 110. In some aspects, the TALE binds to the reverse complement of a target sequence described herein (e. g., a target sequence within the nucleic acid sequence of any one of SEQ ID NOs: 108 - 110 ). By way of i llustration and as shown in FIG. 3, in the nucleic acid sequence gtgtatgtatatcct tcctcccttccttcattcattattTATTAATAattttcgtt tatttattttcttttcttttggggccggcc (SEQ ID NO:108), which has the TTAA integration site TATTAATA, a TALE DBD having the target sequence ttcctccct binds to the reverse complement sequence of agggaggaa.UH0013WO PATENT

[0028] In some aspects, the transposase system comprises a targeting element that binds to the same sequence upstream and downstream of the TTAA integration site, i. e., a homodimer. In some aspects, the transposase system comprises two targeting elements that bind to different sequences upstream and downstream of the TTAA integration site, i. e., a heterodimer. In some aspects, the transposase system comprises a first targeting element comprising the amino acid sequence of any one of SEQ ID NOs: 2 -7 or 14-19 and a second targeting element comprising the amino acid sequence of any one of SEQ ID NOs: 8 -13 or 20-25. In some aspects, the transposase system comprises a first targeting element comprising the amino acid sequence of any one of SEQ ID NOs: 17-19 and a second targeting element comprising the amino acid sequence of any one of SEQ ID NOs: 20-25.

[0029] In some aspects, the transposase system further comprises a donor nucleic acid comprising a transposon and optionally an exogenous nucleic acid. As used herein, a "transposon" is a nucleic acid that is flanked at either end by inverted repeats that are recognized by a transposase. By "recognized" is meant that a transposase, such as a transposase of SEQ ID NO: 1, is capable of binding to the inverted repeat, excising the segment of nucleic acid flanked by the inverted repeats, and integrating the segment of nucleic acid (e.g., exogenous nucleic acid) flanked by the inverted repeats into the genome of the target cell.

[0030] The transposase system herein may be used to modify a target cell of interest by inserting an exogenous nucleic acid into the genome of the target cell. Accordingly, a target cell may be transformed, transduced, or transfected with the transposase system (e. g., expressed proteins) and / or nucleic acid encoding one or more components of the transposase system to facilitate insertion of the exogenous nucleic acid into theUH0013WO PATENT genome of the target cell. Thus, in some aspects, the disclosure provides a nucleic acid encoding a protein of any one of SEQ ID NO: 1-25. In some aspects, the nucleic acid is a DNA molecule. In some aspects, the nucleic acid is a RNA molecule. In some aspects, nucleic acids encoding the transposase protein and targeting element are present on the same nucleic acid. In some aspects, nucleic acids encoding the transposase protein and targeting element are present on a vector.

[0031] The various elements of the transposase system described herein may be produced by standard methods of restriction enzyme cleavage, ligation, and molecular cloning. One protocol for constructing a vector described herein includes the following steps. Purif ied nucleic acid fragments containing the desired component nucleotide sequences as well as extraneous sequences are cleaved with restriction endonucleases from initial sources, such as a vector comprising the transposase gene. Fragments containing the desired nucleotide sequences are separated from unwanted fragments of different size using conventional separation methods, such as for example, agarose gel electrophoresis. The desired fragments are excised from the gel and ligated together in the appropriate configuration so that a nucleic acid or replication backbone (e. g., plasmid, miniplasmid, nanoplasmid, doggybone, or close-ended linear DNA) containing the desired sequences, such as for example, sequences corresponding to the various elements of the subject vectors, as described above is produced. Where desired, circular molecules so constructed may then be amplified in a prokaryotic host, such as, for example, E. coli. Alternately, an RNA comprising the transposase may be produced with an RNA polymerase, using a DNA plasmid as a substrate. Recombinant protein comprising the transposase and / or targeting element may be produced by methods including, but not limited to, in vitro transcription and translation, or expression in E. coli followedUH0013WO PATENT by purification by affinity or fractionation. The procedures of cleavage, plasmid construction, cell transformation, plasmid production, RNA transcription / purif ication, and recombinant protein purification involved in these steps are well-known to one skilled in the art and the enzymes required for restriction and ligation are available commercially.

[0032] A transposon herein may include a wide variety of inserted nucleic acids, where the nucleic acids may include a sequence of bases that is endogenous and / or exogenous to a multicellular or unicellular organism. The nature of the nucleic acid may vary depending upon the particular protocol being carried out. In some aspects, the exogenous nucleic acid may be a gene. The inserted nucleic acid that is positioned between the flanking inverted repeats may vary greatly in size. The only limitation on the size of the inserted nucleic acid is that the size should not be so great as to inactivate the ability of the transposon system to integrate the transposon into the target genome. The upper and lower limits of the size of inserted nucleic acid may be determined empirically by those of skill in the art.

[0033] In some aspects, the inserted nucleic acid comprises at least one transcriptionally active gene, which is a coding sequence that is capable of being expressed under intracellular conditions, e. g., a coding sequence in combination with any requisite expression regulatory elements that are required for expression in the intracellular environment of the target cell whose genome is modified by integration of the transposon. The transcriptionally active genes of the transposon may comprise a domain of nucleotides, i. e., an expression module that includes a coding sequence of nucleotides operably linked with requisite transcriptional mediation or regulatory element (s). Requisite transcriptional mediation elements that may be present in the expression module include, but are not limited to, promoters,UH0013WO PATENT enhancers, termination and polyadenylation signal elements, splicing signal elements, and the like.

[0034] In some aspects, an expression module includes transcription regulatory elements that provide for expression of a gene of interest in a broad host range. A variety of such combinations are known, where specif ic transcription regulatory elements include, but are not limited to, SV40 elements, transcription regulatory elements derived from the LTR of the Rous sarcoma virus, transcription regulatory elements derived from the LTR of human cytomegalovirus (CMV), hsp70 promoters, and the like.

[0035] In some aspects, at least one transcriptionally active gene or expression module present in the inserted nucleic acid acts as a selectable marker. A variety of different genes have been employed as selectable markers, and the particular gene employed in the vectors herein as a selectable marker is chosen primarily as a matter of convenience. Known selectable marker genes include, but are not limited to, thymidine kinase gene, dihydrofolate reductase gene, xanthine -guanine phosphoribosyl transferase gene, CAD, adenosine deaminase gene, asparagine synthetase gene, numerous antibiotic resistance genes (tetracycline, ampicillin, kanamycin, neomycin, and the like), aminoglycoside phosphotransferase genes, hygromycin B phosphotransferase gene, and genes whose expression provides for the presence of a detectable product, either directly or indirectly, such as, for example, beta-galactosidase, GFP, and the like.

[0036] In addition to the at least one transcriptionally active gene, the portion of the transposon containing the inverted repeats may also comprise at least one restriction endonuclease recognized site, e.g., restriction site, located between the flanking inverted repeats, which serves as a site for insertion of an exogenous nucleic acid. A variety of restriction sites areUH0013WO PATENT known in the art. In some aspects, the vector includes a polylinker, i. e., a closely arranged series or array of sites recognized by a plurality of different restriction enzymes. In other aspects, the inserted exogenous nucleic acid may comprise recombinase recognition sites, such as LoxP, FRT, or AttB / AttP sites, which are recognized by the Cre, Flp, and PhiC31 recombinases, respectively.

[0037] Where the source of transposase is a nucleic acid that encodes the transposase, the nucleic acid encoding the transposase protein is generally part of an expression module, as described above, where the additional elements provide for expression of the transposase as required.

[0038] The present disclosure also provides a method of integrating an exogenous nucleic acid into the genome of at least one cell of a multicellular or unicellular organism comprising (a) introducing into the cell a transposon comprising the exogenous nucleic acid flanked by a f irst transposon end sequence and a second transposon end sequence; and (b) introducing into the cell the transposase system comprising the transposase and targeting element to stably integrate the exogenous nucleic acid into the genome. In some aspects, the transposon is present on a vector such as a plasmid or episome. In some aspects, the transposase described herein excises the exogenous nucleic acid from the vector and integrates the exogenous nucleic acid into the genome. Advantageously, the transposon system described herein results in on-target insertion at multi-copy sites, with >50% of cells being edited. In addition, the transposon system described herein exhibits a significant reduction in unwanted integration as compared to previous systems thereby enabling precise, efficient genomic insertion of large DNA cargos without unprotected double-strand breaks, offering a powerful tool for genome engineering.UH0013WO PATENT

[0039] In some aspects, the transposase protein and at least one targeting element are encoded by at least one nucleic acid that is introduced into the cell. In some aspects, the transposon and nucleic acids encoding the transposase and / or targeting element are present on separate vectors. In some aspects, the transposon and nucleic acids encoding the transposase and / or targeting element are present on the same vector. When present on the same vector, the portion of the vector encoding the transposase is located outside the portion carrying the exogenous nucleic acid. In other words, the transposase encoding region is located external to the region f lanked by the first and second transposon end sequences. In some aspects, the transposase is transiently expressed (on the same or a different vector from a vector encoding the exogenous nucleic acid) and it catalyzes the insertion events from a donor plasmid to the host genome.

[0040] In some aspects, the transposon is present on a vector and the transposase protein is introduced as a transposase RNA. The transposase described herein may have the same or better activity when delivered as RNA. The use of RNA offers several advantages over delivery of a DNA molecule. See, e. g., Wilber et al. (2006) Mol. Ther. 13 (3 ): 625 -630. For instance, without wishing to be bound by theory, there is improved control with respect to the duration of transposase expression, minimizing persistence in the tissue, and there is potential for transgene re -mobi lization and re-insertion following the initial transposition event. Furthermore, the transposase-encoding RNA sequence is incapable of integrating into the host genome, thereby eliminating concerns about long-term transposase expression and destabilizing effects with respect to the gene of interest. This safety feature may prevent the integration of the transposase gene into the human genome and circumvents potential oncogenic and mutagenic effects.UH0013WO PATENT

[0041] In some aspects, the transposon is present on a vector, and the transposase protein and / or at least one targeting element are introduced as expressed proteins. In some aspects, the transposon is present on a vector, and the transposase protein and at least one targeting element are introduced as expressed proteins. In some aspects, the transposon is present on a vector, and the transposase protein and f irst and second targeting elements are introduced as expressed proteins. In some aspects, the transposon is a double stranded DNA. In some aspects, the transposon is a single stranded DNA with the end sequences double stranded, which may be prepared by annealing an oligonucleotide to the single stranded DNA to make the end sequences double stranded.

[0042] In any of the aforementioned methods, the transposase protein recognizes the f irst and second transposon end sequences that f lank an inserted exogenous nucleic acid, such as a nucleic acid that is to be inserted into a target cell genome. In some aspects, the transposase comprises the amino acid sequence of SEQ ID NO: 1 and the first and second transposon end sequences comprise the nucleotide sequence of SEQ ID NO: 133 and SEQ ID NO: 134.

[0043] In some aspects, the exogenous nucleic acid is inserted in at least one genomic safe harbor site (GSHS) without introducing double strand breaks. In some aspects, the GSHS is in an open chromatin location in a chromosome. In some aspects, the GSHS comprises at least one TTAA integration site. In some aspects, the GSHS comprises a TTAA integration site having the nucleotide sequence of any one of tattaata, ttttaata, or ttttaaaa. In some aspects, the at least one GSHS comprises a ribosomal RNA (rRNA) gene. In some aspects, the GSHS comprises the nucleic acid sequence of any one of SEQ ID NOs: 108 -110.

[0044] In accordance with aspects of the transposon system herein, the transposase system comprises a first targetingUH0013WO PATENT element that recruits the transposase protein to a f irst nucleic acid binding s ite upstream ( 5 ' ) of the TTAA integration s ite and a second targeting element that recruits the transposase protein to a second nucleic acid binding site downstream (3 ' ) of the TTAA integration site. Binding to the f irst and second nucleic acid binding sites i s mediated by the TALE component of the targeting element and recruitment of the transposase protein to the f irst and second nucleic acid binding sites i s mediated by binding of the targeting element ' s NbALFA component to the ALFA-peptide tag present within the transposase sequence. In some aspects, the targeting element (via the TALE) may bind the same sequence upstream and downstream of the TTAA integration site such that a single target element may be used in the transposon system and method. In some aspects, the transposase system may comprise two targeting elements that bind to a f irst nucleic acid binding site upstream of the TTAA integration site and a second nucleic acid binding site downstream of the TTAA integration site, wherein the f irst and second nucleic acid binding sites have different sequences.

[0045] In some aspects, a f irst nucleic acid binding site upstream of the TTAA integration site may be within about 9 to about 20 base pairs (e. g., about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs, preferably 9 or 11 base pairs ) and a second nucleic acid binding site downstream of the TTAA integration site may independently be within about 9 to about 20 base pairs ( e. g., about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs, preferably 9 or 11 base pairs ) of the TTAA integration site. In some aspects, a f irst target ing element that binds to a f irst nucleic acid binding site within about 9 to about 20 base pairs upstream of the TTAA integration site may comprise the amino acid sequence of any one of SEQ ID NOs: 2 - 7 or 14 - 19. In some aspects, a second targeting element that binds to a second nucleic acid binding site within about 9UH0013WO PATENT to about 20 base pairs downstream of the TTAA integration site may comprise the amino acid sequence of any one of SEQ ID NOs: 8 -13 or 20 -25.

[0046] In some aspects, a f irst nucleic acid binding site upstream of the TTAA integrat ion site may be within about 15 to about 20 base pairs (e. g., about 15, 16, 17, 18, 19, or 20 base pairs, preferably 15 base pairs ) and a second nucleic acid binding s ite downstream of the TTAA integration site may independent ly be within about 12 to about 20 base pairs ( e. g., about 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs, preferably 12 base pairs ) of the TTAA integrat ion site. In some aspects, a f irst targeting element that binds to a f irst nucleic acid binding site within about 15 to about 20 base pairs (preferably 15 base pairs ) upstream of the TTAA integration site may comprise the amino acid sequence of any one of SEQ ID NOs: 17 -19. In some aspects, a second targeting element that binds to a second nucleic acid binding site within about 12 to about 20 base pairs (pref erably 12 base pairs ) downstream of the TTAA integration site may comprise the amino acid sequence of any one of SEQ ID NOs: 20 -25.

[0047] In some aspects, the multicellular or unicel lular organism is a plant or animal. In some aspects, the mult icellular or unicellular organi sm is a vertebrate. In some aspects, the vertebrate animal is a mammal, such as for example, a rodent (mouse or rat ), livestock (pig, horse, cow, etc. ), pets (dog or cat ), and primates, such as, for example, a human. A cell, multicellular organism, or unicel lular organism comprising a nucleic acid encoding a transposase (SEQ ID NO: 1), targeting element ( SEQ ID NOs: 2 -25 ), or comprising a genome with a stably integrated exogenous nucleic acid produced by the method described herein is also provided.

[0048] The methods described herein may be used in a variety of applications in which it is desired to introduce and stablyUH0013WO PATENT integrate an exogenous nucleic acid into the genome of a target cell. Ex vivo and in vivo methods of integrating exogenous nucleic acid into a target cell are known. The route of administration of the transposon system to the multicellular or unicellular organism depends on several parameters, including the nature of the vectors that carry the system components, the nature of the delivery vehicle, the nature of the multicellular or unicellular organism, and the like, where a common feature of the mode of administration is that it provides for ex vivo or in vivo delivery of the transposon system components to the target cell (s). In some aspects, linear or circularized DNA, such as a plasmid, is employed as the vector for delivery of the transposon system to the target cell. In such aspects, the plasmid may be administered in an aqueous delivery vehicle, such as a saline solution. Alternately, an agent that modulates the distribution of the vector in the multicellular or unicellular organism may be employed. For example, where the vectors comprising the subject system components are plasmid vectors, lipid-based vehicles such as liposomes or lipid nanoparticles may be employed, where the lipid-based vehicle may be targeted to a specific cell type for cell- or tissue-specific delivery of the vector. Alternately, peptides (e. g., polylysine-based peptides) may be employed as carriers, which may or may not be modified with targeting moieties, and the like (Brooks et al. (1998) J. Neurosci. Methods 80: 137-47; Muramatsu et al. (1998 ) Int. J. Mol. Med. 1: 55-62). In addition, peptide-based nanoparticles may be used to enhance delivery with reduced toxicity and improved biocompatibility. The system components may also be incorporated onto viral vectors, such as adenovirus -derived vectors, sindbis -virus derived vectors, retrovirus -derived vectors, hybrid vectors, virus -like particles, and the like. The above vectors and delivery vehicles are merely representative. Any vector / delivery vehicle combination may beUH0013WO PATENT employed, so long as it provides for in vivo administration of the transposon system to the multicellular or unicellular organism and target cell. For ex vivo delivery to a cell, electroporation (e.g., nucleof ection) may be used to delivery transposase mRNA / protein and donor DNA into T cells, NK cells, HSCs, and iPSCs.

[0049] The elements of the transposase system may be introduced into a cell or multicellular or unicellular organism in an in vivo manner such that they are introduced into a target cell of the multicellular or unicellular organism under conditions sufficient for excision of the transposon end flanked exogenous nucleic acid from the vector carrying the transposon and subsequent integration of the excised nucleic acid into the genome of the target cell. As the transposon is introduced into the cell "under conditions sufficient for excision and integration to occur, " the method may further include a step of ensuring that the requisite transposase activity is present in the target cell along with the introduced transposon. Depending on the structure of the transposon vector itself, such as whether or not the vector includes a region encoding a product having transposase activity, the method may further include introducing a second vector into the target cell that encodes the requisite transposase activity, where this step also includes an in vivo administration step. Because of the multitude of different types of vectors and delivery vehicles that may be employed, administration may be by a number of different routes, where representative routes of administration include, but are not limited to, oral, topical, intraarterial, intravenous, intraperitoneal, intramuscular, and the like. In some aspects, the administering is administering systemically. The particular mode of administration depends, at least in part, on the nature of the delivery vehicle employed for the vectors that harbor the transposons system. In some aspects, the vector or vectorsUH0013WO PATENT harboring the transposase system may be administered intravascularly, such as intraarterially or intravenously, employing an aqueous based delivery vehicle, such as a saline solution.

[0050] The amount of vector nucleic acid comprising the transposon element, and in some aspects the amount of nucleic acid encoding the transposase and / or targeting element, which is introduced into the cell is sufficient to provide for the desired excision and insertion of the transposon nucleic acid into the target cell genome. As such, the amount of nucleic acids introduced should provide for a suff icient amount of transposase activity and a sufficient copy number of the nucleic acid that is desired to be inserted into the target cell. The amount of nucleic acids that is introduced into the target cell may vary depending on the efficiency of the particular introduction protocol that is employed, such as the particular in vivo administration protocol that is employed.

[0051] The particular dosage of each component of the system that is administered to the multicellular or unicellular organism may vary depending on the nature of the transposon nucleic acid, e.g., the nature of the expression module and gene, the nature of the vector on which the component elements are present, the nature of the delivery vehicle and the like. Dosages may readily be determined empirically by those of skill in the art. For example, in mice where a PiggyBac transposase system is present on separate plasmids which are intravenously administered to a mammal in a saline solution vehicle, the amount of transposon plasmid that is administered may typically range from about 0.5 to 40 μg (e.g., about 25 μg), while the amount of transposase encoding plasmid that is administered may typically range from about 0.5 to 25 μg (e.g., about 1 μg).

[0052] Once the nucleic acids have entered the target cell in combination with the requisite transposase, the exogenousUH0013WO PATENT nucleic acid that is flanked by transposon end sequences is excised from the vector via the provided transposase and inserted into the genome of the targeted cell. As such, introduction of the nucleic acids into the target cell is followed by subsequent transposase-mediated excision and insertion of the exogenous nucleic acid carried by the vector into the genome of the targeted cell. The subj ect methods may be used to integrate nucleic acids of various sizes into the target cell genome. Generally, the size of DNA that is inserted into a target cell genome using the subj ect methods ranges from about 0. 5 kb to 100.0 kb, usually from about 1.0 kb to about 60. 0 kb, or from about 1. 0 kb to about 10. 0 kb.

[0053] The subject methods result in stable integration of the nucleic acid into the target cell genome. By stable integration is meant that the nucleic acid remains present in the target cell genome for more than a transient period of time, and is passed on a part of the chromosomal genetic material to the progeny of the target cell. The subj ect methods of stable integration of nucleic acids into the genome of a target cell find use in a variety of applications in which the stable integration of a nucleic acid into a target cell genome is desired. Applications in which the subj ect vectors and methods find use include, for example, research applications, polypeptide synthesis applications and therapeutic applications.

[0054] The present system and method may be used in, for example, germline mutagenesis in a rat, mouse, or other vertebrate; somatic mutagenesis in a rat, mouse, or other vertebrate; transgenesis in a rat, mouse, or other vertebrate; and use in human gene therapy. In each of these, the transposase may be delivered as DNA, RNA, or protein.

[0055] In some aspects, the system and method herein find use in the preparation of chimeric antigen receptor (CAR) -T cell andUH0013WO PATENT CAR-natural killer (NK) cell therapies, engineered stem cells (hematopoietic stem cells (HSCs) / induced pluripotent stem cells (iPSCs) ), and in vivo gene therapies for genetic diseases.

[0056] CAR T cells are patient or donor T lymphocytes genetically modified to express a receptor that targets specific antigens on cancer cells. A targeted transposase can insert a CAR transgene into T cells without viral vectors, at predefined safe locations. In some aspects, the system and method herein are of use in the preparation of: CD19 CAR-T cells for use in the treatment of B-cell cancers such as acute lymphoblastic leukemia (ALL) and large B-cell lymphoma; BCMA CAR-T cells for use in the treatment of multiple myeloma. CD22 CAR-T cells for the treatment of B-cell ALL relapse post-CD19 therapy; SLAMF7 (CS1) CAR-T cells for use in the treatment of multiple myeloma; prostate-specific membrane antigen (PSMA) CAR-T cells for use in the treatment of prostate cancer; HER2 CAR-T cells for use in the treatment of breast and brain tumors; GD2 CAR-T cells for use in the treatment of neuroblastoma or osteosarcoma; and mesothelin CAR-T cells for use in the treatment of mesothelioma. CD19 and BCMA dual-target CAR T cells targeting B cells have also been described for inducing durable remission in lupus patients by "resetting" the immune system. A safe-harbor targeted transposase may be used to insert one or more of these CARs into T cells, producing a potent therapy with reduced risk of insertional mutagenesis.

[0057] NK cells may also be engineered with CARs to recognize tumor antigens, offering some advantages over T cells. CAR-NK cells do not cause graft -versus -host disease, enabling the use of allogeneic donors for "universal" cell therapy products. For example, cord blood-derived CD19 CAR-NK cells have been shown to achieve a 73% response rate in patients with CD19-positive leukemias and lymphomas, with no major toxicities (no severe cytokine release syndrome or neurotoxicity) observed. A targetedUH0013WO PATENT transposase may be used to insert CAR genes, as well as supporting genes such as cytokine IL-15 for persistence, into NK cells or their progenitors to produce uniform CAR-NK products. CAR-NK therapies targeting CD19, BCMA, CD33 (for acute myeloid leukemia), and various solid tumor antigens have also been described.

[0058] Macrophages and other myeloid cells may also be engineered to target cancer cells (e. g., CAR-macrophages that can infiltrate solid tumors and phagocytose cancer cells). For example, a CAR macrophage targeting HER2 -positive tumors has been described. A safe harbor- targeted transposase may be used to facilitate stable CAR integration in macrophages or CAR neutrophils for use in the treatment of tumors that are resistant to T cells.

[0059] HSC and iPSC engineering is also contemplated. HSCs are bone marrow-derived stem cells that give rise to all blood and immune cells. HSC gene therapy is a proven approach for the treatment of genetic disorders such as p -thalassemia and sickle cell disease. In some aspects, a targetable transposase may be used ex vivo to integrate therapeutic genes into HSCs at safe harbors, creating a one-time cure that produces corrected blood cells for the patient ' s lifetime. This could apply to diseases such as immunodef iciencies (e. g., severe combined immunodeficiency (SCID) ), enzyme def iciencies, hemoglobinopathies, and other blood disorders. In addition, HSCs may be engineered with CAR genes. Targeted integration in HSCs would ensure that the CAR (or any transgene) inserts in a safe site, reducing the risk of leukemia due to insertional mutagenesis. In some aspects, engineered iPSCs may be produced. iPSCs are lab-generated pluripotent cells that can differentiate into any cell type. A clonal iPSC line may be genetically engineered by, e.g., inserting a CAR into a safe harbor locus, and then expanded indefinitely. In addition to CARs, iPSCs mayUH0013WO PATENT be engineered to produce cells secreting therapeutic factors, or to replace diseased tissue (e. g., iPSC-derived pancreatic beta cells for diabetes). These master cells may then be differentiated into the desired therapeutic cell type (e. g., T cells, NK cells, etc. ).

[0060] A targetable transposase system may also be delivered directly into patients (in vivo) to permanently correct or compensate for genetic diseases. Unlike non- integrating vectors such as traditional AAV gene therapy, which provides transient expression, an integrating transposase can insert a therapeutic gene into the tissue' s genome, achieving durable expression even in dividing cells. Examples of liver- targeted gene therapies include, but are not limited to, treatment of metabolic disorders such as hemophilia A by integrating a correct Factor VIII gene into the genome of liver cells and ornithine transcarbamylase (OTC) def iciency by integrating the OTC gene into liver cells. Hematopoietic disorders may also be treated by in vivo delivery of a transposon system to bone marrow or HSCs. For instance, an infusion of targeted transposase mRNA and a donor DNA transposon may be recruited to HSC niches and integrate a corrective gene safely. Subjects with genetic diseases affecting muscles (e. g., muscular dystrophies) may also benefit from a targeted transposase approach, which delivers therapeutic genes into muscle satellite cells or myofibers to permanently express a missing protein. Similarly, for disorders of the skin or gut epithelium, integrating a corrective gene in tissue stem cells in vivo may provide a lasting cure.

[0061] The following examples are provided for illustrative purposes only and not intended to limit the scope of the claims.EXAMPLE 1: Materials and Methods

[0062] Plasmid constructio. Plasmids were generated via Gibson cloning using the NEBUILDER® HiFi DNA Assembly reagent (NewUH0013WO PATENT England Biolabs). Plasmid DNA for transfection was purified by ZYMOPURE™ Plasmid Miniprep Kit or ZYMOPURE™ Express Plasmid Midiprep Kit (Zymo). Descriptions of all 123 plasmids are included in Table 1.TABLE 1UH0013WO PATENTUH0013WO PATENTUH0013WO PATENTUH0013WO PATENTUH0013WO PATENTUH0013WO PATENTUH0013WO PATENT

[0063] Transposase (helper) plasmids. To generate the MLT helper plasmid, the gene for the full-length Myotis lucifugus transposase (MLT) was codon-optimized for human expression and synthesized as a gBlock gene fragment (Integrated DNA Technologies) and cloned into pcDNA3.3-TOPO (Mitra et al. (2013) Proc. Natl. Acad. Sci. USA 110:234-239). For covalent approaches including E2C MLT and HoD MLT plasmids, zinc finger (ZnF) or TALE DNA binding proteins were synthesized as gBlock gene fragments and cloned after the G66 position within the N-terminal domain. The DNA binding proteins contained a GGGS (SEQ ID NO: 136) linker at their N-terminus and a GGGGS (SEQ ID NO: 137) linker at their C-terminus. To generate ALFA MLT, the ALFA tag (Jumper et al. (2021) Nature 596: 583 -589) was inserted afterUH0013WO PATENT position G66 using primers containing the ALFA tag sequence (TCCAGACTGGAAGAGGAACTGAGAAGAAGGCTCACAGAA; SEQ ID NO: 28). Plasmids expressing fusion domains containing the nanobody that binds the ALFA tag (NbALFA) and including ZnF or TALE DNA binding proteins were synthesized as gBlock gene fragments and cloned into pcDNA3.3-TOPO. All TALEs used an N-terminal domain allowing for the recognition sequence to start with any base (Lamb et al. (2013) Nucl. Acids Res. 41:9779-9785).

[0064] Excision plasmids. To construct the excision assay reporter plasmid, a gBlock was synthesized containing the ZsGreen gene, which was disrupted at a naturally occurring TTAA site by a 607 bp transposon. This transposon included full-length MLT left and right transposon ends flanking a polyadenylation signal (Lamb et al. (2013) Nucl. Acids Res. 41:9779-9785). The disrupted gene was placed under the CAG (cytomegalovirus (CMV) immediate early enhancer, chicken b-actin promoter and b-globin intron) promoter. Upon transposon excision, seamless repair restores the TTAA site within the ZsGreen gene, restoring the uninterrupted sequence.

[0065] Integration plasmids. To construct the integration assay donor plasmid, the piggyBac transposon end sequences from the pB GIN donor (Hew et al. (2019) Syn. Biol. 4:ysz018) were swapped with MLT left and right transposon end sequences that were synthesized as gBlocks and cloned by Gibson assembly (Lamb et al. (2013) Nucl. Acids Res. 41:9779-9785).

[0066] Plasmid- to-plasmid (P2P) reporter assay components. Donor and reporter plasmids for the P2P assay were modified from the previously described EmGFP splicing based reconstitution assay (Pallares-Masmitja et al. (2021) Nat. Comm. 12: 7071). To prepare the P2P donor plasmid, the 5 ' -half of EmGFP and SMN1 intron was PCR-amplified from 1 / 2 EmGFP SMN1 transposon and placed under the CMV promoter. The donor transposon was flanked by the transposon end sequences of MLT (SEQ ID NO: 133 and SEQUH0013WO PATENT ID NO: 134) that were synthesized as gBlocks. To construct the reporter plasmid, the 3 ' -half of EmGFP was PCR-amplified from pT4 SMN1 2 / 2 EmGFP and cloned downstream of a 639 bp target region containing 26 randomly spaced TTAA sites. Reporter plasmids contained a unique DNA binder recognition sequence at the center of the target region. The 'e2c ' DNA recognition sequence is bound by the E2C ZnF. Reporter plasmids, lx e2c and 2x e2c contained a single or two e2c sequences placed 15 bp away from the target TTAA, respectively. The control reporter plasmid (no e2c) did not contain a binder recognition sequence. Reporters containing endogenous sequences contained 86 bp of genomic sequence inserted into the target region. For experiments interrogating the required spacing of recognition sequences to the TTAA, all other TTAA sites within 100 bp of the single target TTAA were removed and e2c sequences were inserted flanking the target TTAA at the indicated spacing on either side. Control conditions without functional helper plasmid used the pcDNA3.3 backbone, designated as ' stuffer.1

[0067] General cul ture conditions. HEK293T cells (Thermo Fisher Scientific) were maintained in Dulbecco's Modified Eagle Medium (DMEM) with an L-alanyl -L-glutamine dipeptide alternative to L-glutamine sold under the tradename GLUTAMAX™ (Gibco) supplemented with 10% heat- inactivated fetal bovine serum (FBS; Neuromics), lx Penicillin / Streptomycin (Gibco), and 0.75 pg / mL Amphotericin B (Gibco). Cells were grown at 37 °C with 5% carbon dioxide (CO2) and passaged twice per week.

[0068] Excision assay. The excision assay used a ZsGreen f luorescent protein gene disrupted by an MLT transposon (SEQ ID NO: 135). Transposase expression resulted in seamless excision, restoring ZsGreen expression, that was quantified by flow cytometry. HEK293T cells were seeded in 12 -well plates at a density of 4.8 x 105cells per well. The following day, cells were co-transfected with the excision assay reporter plasmid andUH0013WO PATENT a MLT helper plasmid at a 3: 1 ratio (900 ng of reporter plasmid: 300 ng of helper plasmid). Transfections were performed using the X-TREMEGENE™ 9 DNA transfection reagent (Roche) at a 1: 3 ratio (1.2 pg of DNA: 3.6 pl transfection reagent per well). Following four days of culture, the percentage of ZsGreen+ cells was measured by flow cytometry using an Attune NXT flow cytometer (Thermo Fisher Scientific).

[0069] Integration assay. The integration assay used a donor plasmid with a transposon containing a constitutively expressed TurboGFP fluorescent protein gene. Co-transf ection with a MLT transposase helper plasmid resulted in transposon integration into the genome. Following 17 days of culture, stably expressing cells were measured by flow cytometry. Similar to the excision assay, HEK293T cells were seeded in 12-well plates. The following day, cells were co-transfected with the integration assay donor plasmid and a MLT helper plasmid at a 1: 1 ratio (600 ng of donor plasmid: 600 ng of helper plasmid). Transfections were performed using the X-TREMEGENE™ 9 DNA transfection reagent (Roche) at a 1: 3 ratio (1.2 pg of DNA: 3.6 pl transfection reagent per well). Following two days of culture, half the cells were resuspended and the percentage of TurboGFP+ cells was measured by flow cytometry to assess transient transfection efficiency. The remaining cells were cultured until 17 days post transfection, and the percentage of TurboGFP+ cells were again measured by flow cytometry. To normalize for transfection efficiency, the f inal integration efficiency was calculated by dividing the percentage of GFP+ cells from day 17 by day 2.

[0070] Plasmid to plasmid reporter (P2P) assay. The P2P assay measured site-directed plasmid targeting. A donor plasmid carried a transposon with a CMV promoter driving the 5 ' half of EmGFP, followed by a splice donor sequence. A reporter plasmid contained the target sequence, a splice acceptor, and the 3 ' EmGFP fragment. Transposon insertion at the target sequenceUH0013WO PATENT restored EmGFP expression, that was quantified by flow cytometry. PCR amplification of transposon-reporter junctions identified insertion sites. HEK293T cells were seeded in 24 -well plates at a density of 2.4 x 105cells per well. The following day, cells were co-transfected with 300 ng of helper plasmid, 150 ng of P2P donor plasmid and 150 ng of reporter plasmid. Transfections were performed using TRANSIT®-2020 Transfection Reagent (Mirus Bio) at a 1: 3 ratio (0.6 pg of DNA: 1.8 pl transfection reagent per well). Following three days of culture, half the cells were pelleted and the remaining cells were measured by flow cytometry to detect the percentage of EmGFP+ cells. To prepare PCR template, cell pellets were lysed with 90 µl DIRECTPCR® Cell lysis reagent (Viagen) with 1.0 mg / ml proteinase K (Meridian Bioscience) and rotated in a hybridization oven for three hours at 55°C, then heat-inactivated for 45 min at 85°C. PCR was performed using 1 pl of lysate, 10 µl of KOD ONE™ BLUE polymerase 2x mastermix (Toyobo), 7.8 µl water and 0.6 µl each primer (10 pM). The forward primer was located on the reporter plasmid and the reverse primer (with or without amplicon sequencing barcodes) was located on the donor transposon. PCR cycle conditions were 95°C for 30 sec followed by 32 cycles of 98°C for 10 sec, 60°C for 5 sec, and 68 °C for 10 sec. Products were run on a 2% agarose gel in Tris-acetate-EDTA buffer and fragments for Sanger sequencing were extracted using the ZYMO™ Gel DNA recovery Kit (Zymo). For amplicon sequencing, half the PCR reaction was cleaned using the DNA Clean and Concentrator Kit (Zymo) and eluted barcoded products were pooled in equimolar amounts and submitted for sequencing (Genewiz). Amplicon sequence reads were analyzed with custom Python scripts to generate percent reads containing inserted transposon at designated reporter plasmid TTAA sites.

[0071] Safe harbor genome targeting. The donor plasmid was cotransfected with helper plasmids encoding engineered MLT, guidedUH0013WO PATENT to the genome by DNA-binding proteins specific to the described frameworks. Insertions of the transposon at genomic target sites were detected by ddPCR using genomic DNA as template. HEK293T cells were seeded in 24-well plates at a density of 2.4 x 105cells per well and the following day, unless indicated, cells were co-transfected with 100 ng of helper plasmid and 500 ng of the same donor plasmid used in the P2P assay. Transfections were performed using TRANSIT®-2020 Transfection Reagent (Mirus Bio) at a 1: 3 ratio (0.6 pg of DNA: 1.8 pl transfection reagent per well). Following three days of culture, the cells were pelleted and lysed to prepare genomic DNA for ddPCR, as described above. To reduce the influence of variable transfection efficiency, HEK293T cells were sorted for expression of the near-infrared fluorescent protein iRFP670 to ensure uptake of the DNA. HEK293T cells were seeded in 6 -well plates at a density of 9.6 x 105cells per well. Using the f inal optimal ratio that was determined, cells were co-transf ected with 280 ng of ALFA MLT ml2 helper plasmid or indicated control helper plasmid, 60 ng of each of rDNAl NbALFA TALE fusion plasmids, 1980 ng of donor plasmid, and 20 ng of piRFP670 -Nl plasmid (Addgene), which constitutively expresses iRFP670, and cultured for 4 days. A FACSARIA™ IIu f low cytometer (BD Biosciences) was used to sort the brightest ~20% of iRFP670+ live cells (excitation 635 nm, emission 780 / 60 nm). Following FACS, 50 pl of cells in Live Cell Imaging Solution (Thermo Fisher Scientific) were combined with 50 pl of DIRECTPCR® Cell lysis reagent (Viagen) with 1.0 mg / ml proteinase K (Meridian Bioscience) and rotated for three hours at 55°C, then heat-inactivated for 45 min at 85°C to prepare for ddPCR analysis.

[0072] Droplet digital PCR (ddPCR). ddPCR was performed on cell lysates from safe harbor genome targeting experiments to determine the frequency of targeted integrations. Reactions (22 pl) contained 0. 5 pl of cell lysate, 11 pl of 2X ddPCR SupermixUH0013WO PATENT for Probes (BioRad), 10 units Xhol (New England Biolabs), target and reference primers at 900 nM and probes at 250 nM. The plate was sealed with a PX1 PCR Plate Sealer (BioRad). Droplets were prepared using the QX200 AutoDG Droplet Generator System (BioRad). PCR cycle conditions were 95°C for 10 min followed by 45 cycles of 95°C for 30 sec, 60°C for two min and 72°C for two min, and a final incubation at 98°C for 10 min. Droplets were read on a QX200 Droplet Reader (BioRad) and analyzed using QX Manager 1.2 Standard Edition software (BioRad). The number of on-target insertions per 100 cells was calculated by multiplying the ratio value of target to reference by the number of reference copies per cell. The UBE2D2 reference sequence, located on chromosome 5, was previously shown to be present in three copies per cell in HEK293T cells (Binz et al. (2019) Sci. Rep. 9: 10554 ). The copy number was validated by comparing the UBE2D2 reference to single- and double-copy insertions generated by prime editing in HEK293T single-cell clones (Hew et al. (2024). Nucl. Acids Res. 52 (14): e64). Because HEK293T cells have abnormal karyotypes with variable chromosome copy numbers, the choice of reference locus can significantly affect the calculated ratio of target to reference and the resulting efficiency per 'genome. ' For example, a reference on a disomic chromosome would yield a higher calculated efficiency than one on a trisomic chromosome. To avoid over- or under-reporting due to user reference selection, total integration efficiency per cell is reported. A description of all primers and probes is provided in Tables 2 and 3.TABLE 2UH0013WO PATENTUH0013WO PATENTUH0013WO PATENTUH0013WO PATENTTABLE 3

[0073] Identification of preferred octanucleotide sites by¬ whole genome insertion site recovery using the self-reporting transposon (SRT) assay. The SRT protocol was performed as previously described (Moudgil et al. (2020) Cell 182: 992-1008). Briefly, the SRT donor plasmid contained a constitutively expressed hygromycin B gene lacking a polyadenylation signal. RNA polymerase II transcription extended beyond the hygromycinUH0013WO PATENT B gene, through the transposon end, and into the flanking genomic sequence. Sequencing of SRT-derived transcripts identified transposon-genome junctions, enabling mapping of insertion sites. HEK293T cells were seeded in 24-well plates and the following day, cells were co- transfected with 100 ng of helper plasmid encoding unmodified MLT and 500 ng of SRT donor plasmid. Cells were cultured under hygromycin B selection for 3 weeks and pelleted for SRT analysis. RNA was isolated using the RNEASY® Plus Mini Kit (Qiagen) from hygromycin B selected cells. RNA was reverse transcribed to cDNA using Maxima H Minus Reverse Transcriptase (Thermo Fisher Scientific). Self -reporting transcripts were generated by PCR-amplif ication from cDNA template. Libraries were prepared using the Nextera XT DNA Library Preparation Kit ( Illumina) and were sequenced on a NEXTSEQ® 2000 (Illumina) instrument.

[0074] Identification of SRT genomic insertion sites and flanking sequence patterns. For the SRT pipeline, a modified bioinformatic algorithm as described previously (Moudgil et al. (2020) Cell 182: 992 -1008) was employed. For each sample, 150 x 2 reads were demultiplexed using i7 and i5 barcodes, where i5 was inline in readl (Rl). Cutadapt (Martin (2011) EMBnet.journal 17: 3) was used for trimming the reads, removing adapters, and extracting the inline i5 barcode and the left transposon end sequence. The TTAA was retained during trimming. The Rl sequences were aligned to the human hg38 reference genome using STAR (Dobin et al. (2013) Bioinformatics 29: 15 -21) with default parameters. Using BAM alignment, the location of each Rl was tagged by their barcode and position in the reference genome (Moudgil et al. (2020) Cell 182: 992-1008).

[0075] Identifi cation of DNA binder recognition sequences in the human genome. Custom python scripts were used to search for octanucleotide target sequences in the human genome reference sequence (hg38) and a list of genomic coordinates parsed fromUH0013WO PATENT an entire genome FASTA file were generated. DNA binder (ZnF or TALE) recognition sequences occurring within the specified number of base pairs of the target site were compiled. The resulting sequences were aligned to the human genome to determine exact genomic coordinates.

[0076] Genomic PCR. Lysates from the safe harbor genome targeting experiments using helper plasmids designed to target the Chr 6 site (ALFA MLT m2, chr 6L NbALFA, and chr 6R NbALFA) were used as PCR template to amplify the junction between the transposon and genome. Similar to above, 1 pl of lysate, 10 pl of KOD ONE™ BLUE polymerase 2x mastermix (Toyobo), 7. 8 pl water and 0.6 pl each primer was used. The forward primer extended from the transposon (Left end For or Right end For) and the reverse primer extended from the genome (chr 6 genome For). PCR cycle conditions were 95°C for 30 sec followed by 32 cycles of 98 °C for 10 sec, 60°C for 5 sec, and 68°C for 10 sec. Products were run on a 2% agarose gel and cleaned using the ZYMO™ Gel DNA Recovery Kit (Zymo). For sequencing, cleaned PCR products were ligated into pJETl. 2 / blunt sequencing vector using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific). Primer sequences are listed in Table 2.EXAMPLE 2: Mutations in the native MLT DNA-binding domain reduce random genomic integration

[0077] To develop a conditional transposase for INTACT, it was hypothesized that off-target insertions could be minimized by disrupting the interaction between the transposase's native DNA-binding domain and genomic DNA. By subsequently introducing a DNA-binding protein, such as a programmable ZnF or TALE, the transposase could be directed to the target sequence, thereby restoring integration activity.

[0078] The structure of MLT predicted by AlphaFold2 aligned to the piggyBac strand transfer complex (pdb 6x67) using PyMOLUH0013WO PATENT (Chen et al. (2020) Nat. Comm. 11: 3446) was used to identify regions of the protein that, when mutated, would impair its DNA-binding function and reduce integration while preserving its catalytic activity for excision (Exc+Int-). In all experiments, a previously characterized hyperactive transposase was employed. To screen for Exc+Int” mutants, excision and integration assays were designed, both of which were quantif ied using flow cytometry. The excision assay uses a reporter gene disrupted by an MLT transposon (FIG. 1A). Upon expression of the transposase and seamless excision of the transposon, the reporter gene is reformed, resulting in expression. The integration assay uses a plasmid with a transposon containing a constitutively expressed reporter gene that is inserted into the genome. Cells with stable insertions are quantified following 17 days of culture (FIG. IB).

[0079] To identify Exc+Int” mutants, alanine scanning of residues along a loop (1332- 1338) predicted by AlphaFold2 to interact with DNA was performed. Substitutions I332A, R333A, R336A, G337A, and I338A strongly impaired both integration and excision, while substitutions K334A and N335A slightly reduced these activities.

[0080] Given that nonpolar, hydrophobic alanine substitutions appeared too disruptive to DNA binding, it was subsequently determined whether polar but uncharged serine, which can engage in hydrogen bonding with DNA, could be used as a less disruptive alternative. Positively charged lysine, which can form electrostatic interactions with DNA and potentially counterbalance the effects of alanine or serine when used in combination, was also tested. Given the predicted importance of direct interactions of arginine residues R333 and R336 with DNA, the panel of mutants focused on positions spanning R333 -R336, with residues R333 and R336 either left unchanged or convertedUH0013WO PATENT to lysine or serine. K334 and N335, shown to tolerate alanine substitution, were left unchanged or replaced with alanine. Because mutations in the putative DNA-interacting loop might reduce excision activity, the MLT D416N mutation was included due to its structural homology to the piggyBac mutant, D450N, known to improve excision in the context of integration-dampening mutations (Li et al. (2013 ) Proc. Natl. Acad. Sci. USA 110 (25): E2279-E2287). Of the 64 combinations evaluated, 10 exhibited >30% excision efficiency and <5% integration efficiency (R333K+K334A+R336S+D416N, R333K+K334A+R336K+D416N, R333K+K334 A+N335 +R336K+D416N, R333K+N335A+R336K+D416N, R333S+K334A+D416N, R333S+K334A+N335A+D416N, R333S+N335A+R336K+D416N, R333K+N335A+R336S+D416N, R333S+R336K+D416N, and K334A+N335A+R336S+D416N). Notably, all 10 contained the D416N mutation. One mutant, containing R333K, K334A, N335A, R336K and D416N (herein referred to as ml), exhibited a 1.4% integration efficiency, close to the background signal without transposase helper plasmid. Therefore, ml was selected for further characterization.EXAMPLE 3: Linking artificial DNA-binding proteins to MLT targets integration to plasmids in human cells

[0081] In an effort to target the Exc+Int-mutant to a specific sequence during INTACT, the transposase was linked to the well -characterized ZnF protein E2C, that binds the 9 bp recognition sequence called ' e2c' (Beerli et al. (1998 ) Proc. Natl. Acad. Sci. USA 95: 14628-14633). It was reasoned that the small footprint (-90 amino acids) would offer optimal targeting efficiency while minimally interfering with transpososome formation.

[0082] A plasmid- to-plasmid (P2P) targeting assay was developed to screen transposase frameworks (FIG. 2A). The P2P assay uses a donor plasmid in which the transposon contains a promoterUH0013WO PATENT driving the first 5 ' -half of an EmGFP gene followed by a splice donor sequence. A reporter plasmid contains the target sequence followed by a splice acceptor and the 3 ' fragment of EmGFP. Successful excision of the transposon followed by insertion at the target sequence results in restored EmGFP expression that is measured by flow cytometry (FIG. 2A). PCR primers are used to amplify the transposon-reporter junction to identify the location of insertions. In the initial design, a 640 bp target region containing 26 TTAA sites and the e2c recognition sequence was included to study targeting performance in a localized region of competing integration sites. A control reporter plasmid, containing the identical target region, but lacking the e2c recognition sequence, was used for measuring untargeted integration.

[0083] Initial attempts at INTACT explored three transposase frameworks (FIG. 2B) including E2C fused to the transposase N-terminus (Nterm E2C MLT), E2C inserted after the glycine at position 66 within the N-terminus (E2C MLT), and E2C tethered to MLT through a nanobody bound to an ALFA-tag peptide (E2C ALFA + NbALFA MLT) (Gotzke et al. (2019) Nat. Comm. 10: 4403 ).

[0084] For the E2C MLT framework, it was hypothesized that the unstructured N-terminal domain may serve as a de facto ' flexible linker' for covalently linked DNA-binding proteins. By incorporating the ZnF within the N-terminal domain, this linker was shortened and the catalytic domain was positioned closer to the target DNA. The E2C ALFA + NbALFA MLT framework used a non-covalent strategy that connected the DNA-binding protein to the transposase via an interaction allowing for transient dissociation, potentially allowing them to separate and undergo necessary conformational changes during catalytic insertion.

[0085] Helper, donor, and reporter plasmids were co-transf ected into HEK293T cells and lysed three days later. PCR analysis of the P2P integration products demonstrated that all threeUH0013WO PATENT frameworks generated prominent products representing insertions near the e2c recognition sequence. Amplicon sequencing revealed that insertions primarily occurred at a TTAA 15 bp downstream of the e2c recognition sequence. Because MLT forms a dimer, it was posited that efficiency might improve with two e2c recognition sequences flanking a central TTAA (Hickman et al. (2025) Nat. Comm. 16: 458). Target sequence of the 2x e2c reporter: gtggggtGCCGCAGTGgagatgacttgtttgTTAAcggcactttaaacagCACTGCGGCatttctta (SEQ ID NO: 97), wherein the e2c recognition sequence is in upper case and italic, the e2c-complementary sequence is in upper case and underlining, and the TTAA sequence is in upper case and bold.

[0086] Indeed, reporter plasmids with dual e2c recognition sites showed increased targeting efficiency by flow cytometry and brighter PCR products of the expected size. The ml mutation abolished activity in the non-covalent system, potentially due to a suboptimal configuration when linked to the end of the unstructured N- terminal domain. The ml MLT Exc+Int" mutant with an internal E2C DNA-binding protein at the G66 position (E2C MLT ml) produced 1. 8 -fold more GFP+ cells on the 2x e2c reporter plasmid relative to the lx e2c reporter, and 3.6-fold more GFP+ cells compared to the reporter lacking an e2c recognition site (no e2c). E2C MLT ml displayed an especially prominent PCR product of the expected size and DNA sequence.

[0087] To determine optimal spacing between the DNA recognition site and the target TTAA, reporter plasmids with e2c recognition sequences spaced 6 to 22 bp on either side of the target TTAA were assayed and all other TTAAs within a 100 bp window of the target site were removed to reduce confounding effects. Consistent with previous results, the optimal spacing for E2C MLT ml was 14 or 15 bp.UH0013WO PATENT

[0088] To attempt INTACT at endogenous human sites, loci with identical 9 bp ZnF recognit ion sequences spaced either 14 or 15 bp from a central TTAA on either side were ident if ied. Twenty-nine ZnFs were synthesized by modular assembly ( Segal et al. ( 1999 ) Proc. Natl. Acad. Sci. USA 96: 2758 -2763; Segal et al. ( 1999 ) Proc. Natl. Acad. Sci. USA 96: 2758 -2763; Dreier et al. ( 2005 ) J. Biol. Chem. 280: 35588 -35597; Dreier et al. (2001 ) J. Biol. Chem. 276: 29466 -29478 ) and inserted after the G66 residue of the Exc+Int“ mutant MLT ml. Helper and donor plasmids were co- transfected into HEK293T cells, but genomic targeting was not detectable by ddPCR after 3 days. Thi s may be due to inherent dif f iculties in engineering high-aff inity ZnF proteins to user-def ined sequences (Ramirez et al. (2008 ) Nat. Meth. 5: 374 -375; Bhakta et al. ( 2013 ) Genome Res. 23: 530 - 538 ). Therefore, TALES were tested as alternate DNA-binding proteins.

[0089] Two TALEs were generated, one to the forward and another to the reverse complement (revcom) of the e2c recognit ion sequence. Each TALE was inserted after the G66 residue in the Exc+Int” mutant (TALE E2Cfor MLT ml and TALE E2Crev MLT ml ). The P2P assay revealed optimal targeting at 18 or 19 bp for the forward TALE but no targeting using the reverse TALE. As with ZnFs, it was observed that targeting was improved by f lanking e2c recognition sites. To evaluate an alternative target sequence to e2c, TALEs designed to bind a sequence in the human CCR5 gene (Owens et al. (2013 ) Nucl. Acids Res. 41: 9197 - 9207 ) were tested in the P2P assay. By swapping in the CCR5 TALEs, it was observed that TALEs matched to their corresponding recognition sequences supported targeting, whi le mi smatched did not. Based on these results, targeting experiments were continued using TALEs in place of ZnFs.UH0013WO PATENT EXAMPLE 4: The target TTAA flanking sequence influences the insertion choice by Exc+Int" mutants

[0090] In the P2P assays, reproducible PCR products at off -target locations were observed, which were attributed to the presence of preferential TTAA sites within the reporter plasmid. For example, it was observed that mutant ml consistently inserted the transposon at a specific TTAA (shown at 854 bp in gels). Sequencing revealed that this specific TTAA was flanked by TA dinucleotides (taTTAAta) and integrations at this site appeared to compete with the target TTAA. TA pyrimidine -purine base steps are known to confer greater intrinsic DNA bending, leading to the hypothesis that MLT Exc+Int“ mutants, due to their impaired native DNA-binding, may prefer more deformable target TTAA sequences such as the taTTAAta octanucleotide (Harteis & Schneider (2014) Inti. J. Mol. Sci. 15: 12335-12363). Interestingly, the related transposase piggyBac requires a tight bend in the target TTAA to facilitate integration (Chen et al. (2020) Nat. Comm. 11: 3446).

[0091] To improve the sensitivity of the P2P assay by reducing competing signal from the preferred off -target taTTAAta site, the TTAA was disrupted by mutating the third thymine to a guanosine (taTGAAta). After validating the improved reporter with mutated off -target octanucleotide, nine additional Exc+Int“ mutants (E2C MLT m2 -ml0) were screened to identify variants with enhanced activity. Mutant m2 (R333K, N335A, R336K, D416N) showed a two-fold increase in targeting efficiency compared to ml.

[0092] To further validate the taTTAAta octanucleotide as a preferential integrating site, the reporter plasmid was modified to contain the octanucleotide flanked by e2c recognition sequences 15 bp apart. A prominent targeted PCR product band was observed using E2C MLT m2 on the taTTAAta reporter plasmid. Similar results were obtained using a TALE in place of the ZnFUH0013WO PATENT on reporter plasmids containing TALE binding sites 19 bp apart. Subsequent experiments exploited the m2 mutant ' s preferential targeting of taTTAAta octanucleotide sites.EXAMPLE 5: Covalent fusion of a TALE to MLT targets preferred octanucleotide sites in the human genome

[0093] Given the observed preference for insertion at the taTTAAta octanucleotide site on the reporter plasmid, it was determined whether other octanucleotide sites were similarly favored. To address this, a database of genomic insertion sites for unmodified MLT, obtained using a modified self -reporting transposon (SRT) protocol (see Methods) (Moudgil et al. (2020) Cell 182: 992 -1008), was analyzed. The most frequently targeted octanucleotide was ttTTAAaa, while the previously identified taTTAAta site ranked 21stout of 136 sites.

[0094] To investigate INTACT at genomic octanucleotide sites, loci were identified where identical 9 bp sequences flanked a target octanucleotide site spaced 18 bp or 19 bp apart. Homodimeric (HoD) flanking sites were selected to enable targeting with a single TALE. Target sites located more than 50 kb from coding genes were selected, yielding six taTTAAta sites (HoDl-6) and three ttTTAAaa sites (HoD7-9) (Table 4) TALEs designed to bind the flanking recognition sequences of these sites were inserted after the G66 residue in the m2 mutant.TABLE 4UH0013WO PATENT♦Average copy number per cell by ddPCR. Octanucleotide in bold.

[0095] Genomic targeting efficiency was quantified by ddPCR, with the HoD4 site showing the highest on-target insertion rate at 0. 9% of cells, followed by HoD7 showing an on-target insertion rate at about 0. 8% of cells. An approximately equal number of insertions from the left and right ends were observed, indicating a lack of preference for insertion in either orientation. Control experiments confirmed that targeting was TALE-mediated rather than being driven by insertion preferences at octanucleotide sites. Due to the aneuploid nature of HEK293T cells, which can contain variable numbers of chromosomes or chromosomal fragments, ddPCR was used to quantify available target sites. An average of ~8 HoD7 sites per cell were measured, approximately three-fold more than HoD4 (Table 4). Despite similar integration rates for HoD4 and HoD7 per cell, the higher copy number of HoD7 corresponded to a lower per-targetUH0013WO PATENT efficiency ( 0.4% for HoD4 compared to 0. 1% for HoD7). This demonstrates that even when individual site-targeting efficiency is low, the overall per-cell integration rate can be enhanced by increasing the number of available target sequences. Together, these results indicate that TALEs direct transposon insertions at detectable levels in the human genome.EXAMPLE 6: Non-covalent linkage of TALES to MLT improves targeting efficiency to the human genome

[0096] To improve the integration efficiency of INTACT, a non-covalent strategy was employed to allow greater flexibility during the integration reaction. The fusion of the DNA-binding domain directly to the transposase was hypothesized to constrain conformational changes required for integration, and transient separation of these components might relieve this constraint.

[0097] The initial non-covalent strategy using the Exc+Int” mutant ml failed to promote targeted integration when the NbALFA nanobody was fused to the N-terminus of MLT. To improve performance, a revised configuration was adopted, which was modeled after the successful TALE HoD MLT constructs: the 13 -amino-acid ALFA tag was inserted internally after the G66 residue in the Exc+Int” mutant m2 (ALFA MLT), and the nanobody was instead fused to the TALE (TALE NbALFA) to enable binding to the ALFA tag present on the transposase. The optimal spacing between the DNA-binding site and the target TTAA sequence was assessed using the P2P assay. The non-covalent framework maintained a spacing of 18 bp, comparable to the covalent strategy using the same TALE. P2P reporter plasmids containing the previously identif ied genomic homodimeric loci HoD4 and HoD7 target sites were generated and increased targeting efficiency was observed when TALES were matched to their corresponding target sites compared to mismatched sites.UH0013WO PATENT

[0098] Genomic targeting to homodimeric loci using the non-covalent framework achieved an 8. 9% per cell targeting efficiency at the HoD4 site, representing a >9 -fold improvement over the covalent system. Targeting to the HoD7 site (6.6%) and HoD8 site ( 0.7%) also improved.

[0099] To further optimize INTACT, the NbALFA and ALFA tag were swapped between the TALE and transposase, the domains were inserted after the S55 residue to increase linker length, and alternative Exc+Int" mutants were tested. However, none of these modifications outperformed the top -performing combination, HoD4 NbALFA + ALFA MLT m2. Given the observed increase in efficiency of genomic targeting, the non-covalent approach was used in subsequent experiments.EXAMPLE 7: TALEs mediate targeting to a genomic safe harbor

[0100] For purposes of simplicity, the initial INTACT optimizations used a single DNA-binding protein with identical homodimeric recognition sequences flanking the target TTAA. To expand the number of genomic loci available for integration, the use of two TALEs designed to bind different heterodimeric sequences flanking the TTAA were explored. Taking advantage of this flexibility, a target site on chromosome 6 (chr 6) was selected, which had several desirable characteristics including: (i ) a preferred octanucleotide site (ttTTAAaa), (ii) a previously recovered MLT insertion site (from the SRT database described above), (iii) being in open chromatin, (iv) being in a genomic safe harbor site as defined by Papapetrou et al. ( (2011) Nat. Biotechnol. 29: 73 -78), and (v) >120 kb from the nearest gene. Two TALE NbALFA fusions designed to recognition sequences spaced 18 bp on either side of the chr 6 TTAA site (chr 6L NbALFA (SEQ ID NO: 26) and chr 6R NbALFA (SEQ ID NO: 27) ) were generated. Co- transfecting these TALE fusions with ALFA MLT m2 resulted in a 67. 8% per cell targeting efficiency by ddPCR.UH0013WO PATENT Genomic PCR conf irmed the expected transposon-genome junction sequence. Furthermore, changing the TALE recognit ion sequences to bind shorter 8 bp or longer 10 bp and 11 bp sequences did not improve targeting compared to the 9 bp recognition sequences. These data demonstrate that TALES enable eff icient genome targeting to a s ingle safe harbor site.EXAMPLE 8: Optimizations of INTACT enhance genome targeting

[0101] The chr 6 s ite is located at a single genomic locus. To enhance INTACT integration ef f iciency, it was hypothesized that increas ing the number of potential target sites would be benef icial. A study demonstrated the use of precise RNA-mediated insertion of transgenes ( PRINT) for targeted gene delivery to rDNA loci ( Zhang et al. ( 2024 ) Na t. Biotechnol. 43: 2 -51 ). The rDNA arrays exist in hundreds of copies per genome, providing suf f icient redundancy such that insertional di srupt ion of individual units does not compromise cellular funct ion, thereby support ing their classif icat ion as a saf e harbor ( Zhang et al. ( 2024 ) Nat. Biotechnol. 43: 2- 51; Schenkwein et al. ( 2020 ) Mol. Therapy J. Am. Soc. Gene Therapy 28: 1858 - 1875 ). Furthermore, rDNA arrays remain stable during mitosis in normal human somatic t issues, and prior studies have demonstrated successful express ion of therapeutic proteins from rDNA- integrated transgenes in both mice and human cells, including blood clotting factors such as Factor VIII and IX (Hemophi lia A and B), f umarylacetoacetate hydrolase (def icient in tyrosinemia type I ), and mini -dystrophin ( Zeng et al. (2021 ) Biochem. Biophys. Res. Comm. 545: 40 -45; Sun et al. (2019 ) Clin. Chim. Acta Inti. J. Clin. Chem. 495: 656 - 663; Liu et al. (2012 ) PLoS ONE 7: e37071; Wang et al. (2012 ) Mol. Therapy J. Am. Soc. Gene Therapy 20: 1902 -1911; Lisowski et al. (2012 ) Mol. Therapy J. Am. Soc. Gene Therapy 20: 1912 - 1923 ). However, a l imitation of the PRINT system i s that the integration machinery often terminates prematurely,UH0013WO PATENT prevent ing full transgene insertion. In contrast, the "cut and paste" mechanism of transposases (Hickman & Dyda ( 2015 ) Mi crobiol. Spectrum 3: MDNA3 - 0034 -2014 ) ensures complete DNA cargo insertion during INTACT.

[0102] To determine whether INTACT could target rDNA, TALEs for three heterodimeric sites within rDNA intergenic spacer regions, designated rDNAl, rDNA2, and rDNA3 were generated. For each s ite, TALE NbALFA fusions were designed to recogni ze sequences spaced 18 bp apart on either side of the TTAA s ite. rDNAl and rDNA3 were both previously identi f ied octanucleotides (rDNAl: taTTAAta, rDNA3: ttTTAAaa) and rDNA2 was a new octanucleot ide that contained f lanking ' tt ' and ' ta ' sequences and was the third most common octanucleotide used by MLT (rDNA2: ttTTAAta). Both rDNAl and rDNA2 were previous ly recovered MLT insertion sites from the SRT database. Two sets of TALES (SEQ ID NOs: 2 -13 ) were designed per site: one recogni zing 9 bp sequences (Tables 5 - 6 ) at rDNAl (TALEs comprising SEQ ID NO: 2 and SEQ ID NO: 8 ), rDNA2 (TALES comprising SEQ ID NO: 4 and SEQ ID NQ: 10 ), and rDNA3 (TALEs comprising SEQ ID NO: 6 and SEQ ID NO: 12 ) and the other recogni zing 11 bp sequences (Tables 5 - 6 ) at rDNAl (TALEs compri sing SEQ ID NO: 3 and SEQ ID NO: 9 ), rDNA2 (TALEs compris ing SEQ ID NO: 5 and SEQ ID NO: 11 ), and rDNA3 (TALEs compris ing SEQ ID NO: 7 and SEQ ID NO: 13 ). Both the 9 bp and 11 bp conf igurations for rDNAl, as wel l as the 11 bp set for rDNA3, outperformed the previous chr 6 safe harbor targeting strategy ( FIG. 4A). Variability in integration was observed, likely due to sensitivity to variations in day-to-day transfection ef f iciency, including a reduction in eff iciency for chr 6 targeting compared to earlier experiments. Despite thi s variabi lity, within the same transfection, rDNA targeting achieved a two - fold improvement over the chr 6 site, with a >56 % per cel l targeting ef f iciency for the three best conditions.UH0013WO PATENT

[0103] TABLE 5‘Average copy number per cell by ddPCR. Octanucleotide in bold.TABLE 6

[0104] The orientation of the TALE NbALFA fusion was subsequently investigated. It was posited that relocating the NbALFA from the C-terminus to the N-terminus of the TALE andUH0013WO PATENT redesigning the TALE recognition site to the reverse complement (revcom) sequence would position NbALFA similarly in space to the configuration with the NbALFA at the C-terminus. To test whether this new configuration improved targeting, the E2C P2P assay was employed, which reports efficiency over a range of base-pair spacings. Using a TALE designed to bind the reverse complement of e2c (TALE E2Crev) with an NbALFA nanobody fused to the N-terminus (NbALFA TALE E2Crev), a three-fold increase in targeting eff iciency over the previous configuration was observed, with an optimal spacing shift from 18 bp to 20 bp (FIG. 4B).

[0105] When identifying Exc+Int-mutants to disrupt the native MLT DNA-binding domain, mutants with >30% excision efficiency and <5% integration efficiency were initially selected. Given the high efficiency of the latest version of INTACT, mutants with lower excision rates ( >15%) were reevaluated. Two additional mutants, mil (R333S, K334A, R336K, D416N) and ml2 (R333S, K334A, N335A, R336K, D416N; SEQ ID NO: 1), which exhibited lower excision rates but near-background integration levels, were tested for potential reductions in off -target integration compared to m2. To measure off -target activity, excision and integration assays were re-performed, now with the ALFA tag insert, for ALFA MLT ml, m2, mil, ml2 and without Exc+Int” mutation. Donor without transposase was included to estimate random background plasmid insertion. The previous mutant m2 displayed a clear increase in integration over background, while ml2 exhibited near -background integration levels (FIG. 4C). Consequently, ml2 was selected for future configurations.

[0106] Encouraged by the improvements seen in the P2P assay for NbALFA nanobody fusions at the N-terminus of TALE E2Crev, NbALFA TALE fusions targeting the chr 6 safe harbor site were generated, which incorporated a 20 bp spacing from the TTAA in the reverseUH0013WO PATENT complement orientation relative to the prior configuration (NbALFA chr 6L and NbALFA chr 6R). These fusions were paired with ALFA MLT m2 from prior experiments or ALFA MLT ml2, which reduced off -target integration to near -background levels. The highest on-target insertion levels were observed for the NbALFA TALE with the ml2 mutation, a 1. 7-fold improvement over the prior configuration with ml2 (FIG. 4D).

[0107] Until this point, only ALFA tag fusions at residues S55 and G66 has been tested. The S55 fusion, featuring a longer linker, was predicted to increase flexibility between the DNA-binding protein and transposase but resulted in lower on-target genomic insertion levels than G66. To assess how ALFA tag positioning could affect targeting levels, the ALFA tag was inserted at adjacent residues to G66 (164, E65, and G67). Since repositioning the ALFA tag could affect optimal spacing, the P2P assay with NbALFA TALE E2Crev was used, which has a known preference for 20 bp spacing when the ALFA tag was inserted at G66. Reporter plasmids containing spacing of 16 bp to 22 bp were also used to capture any changes from the new positioning. The m2 mutant with G66 fusion yielded higher on-target levels but also increased off -target activity, as indicated by signal from the negative reporter plasmid lacking e2c binding sites (FIG.4E). Notably, ml2 with ALFA tag fusion at 164 resulted in higher on- target insertion than G66, albeit with a slight increase in off -target levels. Fusion at G67 significantly reduced both on-and off -target activity, suggesting that this linker length was too short. Based on these findings, G66 was retained as the optimal residue for ALFA tag fusion due to its minimal off -target activity and sufficient flexibility without sacrificing overall efficiency.UH0013WO PATENT EXAMPLE 9: High efficiency genome targeting to rDNA safe harbor sites

[0108] The optimal configuration for fusion of the NbALFA domain to the N-terminus of the TALE, 20 bp spacing between the TALE and TTAA, the ml2 mutation for reduced off -target integration, and ALFA tag fusion at G66 were applied to rDNAl (octanucleotide taTTAAta). Both upstream and downstream TALEs were designed, with target sequences ranging from 12 bp to 17 bp in length (Table 7). Systematic testing of all possible combinations revealed that a 12 bp downstream TALE paired with a 15 bp upstream TALE achieved the highest per cell targeting efficiency of 49.9% (FIG. 5). An added benefit of this configuration is that longer 12 bp and 15 bp TALE recognition sequences occur less frequently in the genome than the 9 bp sequences flanking the chr 6 site, potentially enhancing specificity.TABLE 7UH0013WO PATENT

[0109] For consistency across experiments, all transfections were performed with 70 ng of transposase-encoding MLT helper plasmid, 15 ng of each TALE-expressing plasmid, and 500 ng of donor plasmid. To evaluate the impact of plasmid stoichiometry on integration efficiency, the amounts of ALFA MLT ml2 helper plasmid (21- 157 ng) and rDNAl TALE plasmids (5-30 ng) were varied. Integration efficiencies across the 24 conditions ranged from 22. 9% to 61.8%, with the original helper- to-donor ratio yielding the highest eff iciency.

[0110] To control for variations in transfection efficiency during INTACT, fluorescence-based sorting was performed to enrich for cells strongly expressing a co-delivered plasmid and exclude poorly transfected cells. The culture period was also extended from three to four days to allow additional time for MLT expression. An additional control of ALFA MLT ml2 without NbALFA TALE fusions was also included. Further, to demonstrate that the nanobody-tag interaction was necessary, a control helper plasmid was generated by removing the ALFA tag from ALFA MLT ml2 called MLT ml2. By targeting multi-copy rDNA sites, it is possible to have more than one targeted insertion per cell. Sorting for successfully transfected cells improved efficiency, resulting in most cells receiving at least one targeted insertion, with an average of 1.2 on-target insertions per cell. Collectively, the panel of optimizations ( fusion of the NbALFA domain to the N-terminus of the TALE, 20 bp spacing between the TALE and TTAA, the ml2 mutation for reduced off -target integration, and ALFA tag fusion at G66) were additive, contributing to the development of an improved targetable transposase system.

Claims

UH0013WO PATENT What is claimed is:

1. A transposase system comprising ( i) a transposase protein comprising an amino acid sequence having at least about 90% sequence identity to SEQ ID NO: 1 and ( ii) at least one targeting element comprising an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOs: 2 -25.

2. The transposase system of claim 1, wherein the transposase system comprises a f irst targeting element comprising the amino acid sequence of any one of SEQ ID NOs: 2 -7 or 14 -19 and a second targeting element comprising the amino acid sequence of any one Of SEQ ID NOs: 8 - 13 or 20 -25.

3. The transposase system of claim 1, further comprising a donor nucleic acid comprising a transposon and optionally an exogenous nucleic acid.

4. A nucleic acid encoding a protein of any one of SEQ ID NO: 1-25.

5. A vector comprising any one or more of the nucleic acids of claim 4.

6. A cell comprising any one or more of the nucleic acids of claim 4.

7. A method of stably integrating an exogenous nucleic acid into the genome of a cell, comprising:(a) introducing into the cell a transposon comprising the exogenous nucleic acid flanked by a first transposon end sequence and a second transposon end sequence; andUH0013WO PATENT (b) introducing into the cell the transposase system of claim 1 to stably integrate the exogenous nucleic acid into the genome.

8. The method of claim 7, wherein transposase protein and at least one targeting element are encoded by at least one nucleic acid that is introduced into the cell.

9. The method of claim 7, wherein the transposon is present on a vector and the transposase protein is introduced as a transposase RNA.

10. The method of claim 7, wherein the transposon is present on a vector, and the transposase protein and at least one targeting element are introduced as expressed proteins.

11. The method of claim 7, wherein the exogenous nucleic acid is inserted in at least one genomic safe harbor site (GSHS)12. The method of claim 11, wherein the at least one GSHS comprises a ribosomal RNA (rRNA) gene.

13. The method of claim 11, wherein the GSHS comprises at least one TTAA integration site, optionally wherein the TTAA integration site comprises the sequence tattaata, ttttaata, or ttttaaaa.

14. The method of claim 13, wherein the transposase system comprises a first targeting element that recruits the transposase protein to a f irst nucleic acid binding site upstream of the TTAA integration site and a second targeting element that recruits the transposase protein to a secondUH0013WO PATENT nucleic acid binding site downstream of the TTAA integration site.

15. The method of claim 14, wherein the first nucleic acid binding site is within about 9 to about 20 base pairs of the TTAA integration site and the second nucleic acid binding site is within about 9 to about 20 base pairs of the TTAA integration site.

16. The method of claim 15, wherein the f irst targeting element comprises the amino acid sequence of any one of SEQ ID NOs: 2 -7 or 14 -19 and the second targeting element comprises the amino acid sequence of any one of SEQ ID NOs: 8 - 13 or 20-25.

17. The method of claim 14, wherein first nucleic acid binding site is within about 15 to about 20 base pairs of the TTAA integration site and the second nucleic acid binding site is within about 12 to about 20 base pairs of the TTAA integration site.

18. The method of claim 17, wherein the f irst targeting element comprises the amino acid sequence of any one of SEQ ID NOs: 17 -19 and the second targeting element comprises the amino acid sequence of any one of SEQ ID NOs: 20-25.

19. The method of claim 13, wherein the GSHS comprises the nucleic acid sequence of any one of SEQ ID NOs: 108 - 110.

20. A cell comprising a genome with a stably integrated exogenous nucleic acid produced by the method of claim 7.

Images