Dnazymes and DNA aptamers comprising and / or targeting naturally occurring nucleic acids

Abstract

Disclosed herein are methods of identifying naturally occurring DNAzymes, DNA aptamers that bind to naturally occurring nucleic acids, DNAzymes that cleave naturally occurring nucleic acids, and DNAzymes that regulate gene expression.

Description

Attorney Docket No. 10046-678W01DNAZYMES AND DNA APTAMERS COMPRISING AND / OR TARGETING NATURALLY OCCURRING NUCLEIC ACIDSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Application No.63 / 920,683, filed November 19, 2025, and to U.S. Provisional Application No. 63 / 789,205, filed April 15, 2025, which are each incorporated by reference herein in their entirety.GOVERNMENT SUPPORT CLAUSE

[0002] This invention was made with government support under Grant No. R35 GM141931 awarded by the National Institutes of Health. The Government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] The sequence listing submitted on April 15, 2026, as an. XML file entitled “10046- 678W01„ST26.xml” created on April 15, 2026, and having a file size of 317,388 bytes is hereby incorporated by reference pursuant to 37 C. F. R. § 1.52(e)(5).BACKGROUND

[0004] Gene expression is under multiple layers of controls, including but not limited to transcriptional-, translational-, and post-transcriptional / translational- regulations. In these processes, regulatory elements that code inside both genomic DNA and mRNA sequences play critical roles in regulating gene expression. Primary examples of such kind of regulatory elements in the genomic DNA include cis- or trans-regulatory elements, such as promoters, enhancers, or other conserved motifs, which are specific DNA sequences that can be recognized and bound by related transcriptional factors. The specific interaction between the regulatory elements and the transcriptional factors can either initiate or suppress gene transcription. Gene transcription and expression can be controlled by a variety of naturally occurring and synthetic nucleic acids, for example, miRNA, sRNA, and shRNA.

[0005] MicroRNAs (miRNAs) are small non-coding RNAs, typically 15-27 nucleotides in length, that guide post-transcriptional gene silencing by directing the RNA-induced silencing complex (RISC) to target mRNAs for degradation or translational repression. Their expression is precisely regulated across developmental stages and tissue types, and aberrant miRNAAttorney Docket No. 10046-678W01activity is implicated in a broad spectrum of human diseases, including cancer, cardiovascular dysfunction, and neurodegenerative and infectious disorders.

[0006] Small RNAs (sRNAs) and short hairpin RNAs (shRNAs) are distinct classes of regulatory RNA molecules with roles in post-transcriptional gene silencing. sRNAs are endogenous non-coding RNAs, typically found in both prokaryotic and eukaryotic systems. In bacteria, sRNAs often regulate gene expression by base pairing with complementary sequences in target mRNAs, modulating translation initiation or promoting mRNA degradation, frequently with the assistance of RNA chaperones such as Hfq. shRNAs are artificially engineered RNA molecules designed to form a stem-loop (hairpin) structure, and are commonly used in RNA interference (RNAi)-based gene silencing. Upon expression in a host cell - typically via plasmid or viral vectors - shRNAs are processed by the endogenous RNase III enzyme Dicer into -21-25 nucleotide small interfering RNAs (siRNAs), which are then loaded into RISC to guide sequence-specific degradation of complementary mRNA targets. Thus, sRNAs function as natural regulators of gene expression, and shRNAs serve as powerful synthetic tools for stable, targeted gene knockdown in functional genomics and therapeutic applications.

[0007] There exists a need for technologies to target and control naturally occurring and synthetic nucleic acids, particularly nucleic acids which regulate gene expression. This need and others are at least partially satisfied by the present disclosure.SUMMARY

[0008] In some aspects, disclosed herein is a method to identify naturally occurring DNAzymes and / or DNA aptamers, the method comprising: a) providing a first database comprising sequences of DNAzymes, DNA aptamers, or portions thereof; b) providing a second database comprising naturally occurring nucleic acid sequences; and c) searching the second database for a first match sequence comprising about 90% similarity or more to a sequence in the first database using an algorithm that finds regions of local similarity between sequences; wherein the local similarity has an expectation threshold of about 0.05 or less.

[0009] In some aspects, also disclosed herein is a DNAzyme or DNA aptamer identified by any of the disclosed methods of identifying naturally occurring DNAzymes and / or DNA aptamers.

[0010] In some aspects, also disclosed herein is a DNAzyme or DNA aptamer identified by any of the disclosed methods of identifying naturally occurring DNAzymes and / or DNA aptamers and further engineered to comprise a detectable signal.Attorney Docket No. 10046-678W01

[0011] In some aspects, also disclosed herein is a system comprising: a processor; and a memory having instructions stored thereon, wherein execution of the instructions by a processor causes the processor to perform any of the disclosed methods of identifying naturally occurring DNAzymes and / or DNA aptamers.

[0012] In some aspects, also disclosed herein is a computer readable medium having instructions stored thereon, wherein execution of the instructions by a processor causes the processor to perform any of the disclosed methods of identifying naturally occurring DNAzymes and / or DNA aptamers.

[0013] In some aspects, also disclosed herein is a DNA aptamer comprising: a naturally occurring nucleic acid which selectively binds to a target molecule; and a signaling nucleic acid which is at least partially complementary to at least a portion of the naturally occurring nucleic acid; wherein, when the naturally occurring nucleic acid is bound to the target molecule, the signaling nucleic acid produces a detectable signal.

[0014] In some aspects, also disclosed herein is a method of detecting a naturally occurring nucleic acid in a sample, the method including: providing to the sample any of the disclosed DNA aptamers; and detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid.

[0015] In some aspects, also disclosed herein is a method of treating and / or preventing a disease or disorder in a subject in need thereof, the method including: providing any of the disclosed DNA aptamers to the subject or a sample taken from the subject; detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid; wherein overexpression of the naturally occurring nucleic acid indicates presence of a disease or disorder and / or increased severity of a disease or disorder; and if presence of the disease or disorder is detected, administering one or more therapeutic agents to the subject.

[0016] In some aspects, also disclosed herein is a DNAzyme comprising: an enzyme strand comprising two arms and a catalytic core disposed between the two arms; wherein at least one of the two arms is at least partially complementary to a naturally occurring nucleic acid; and wherein the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule.

[0017] In some aspects, also disclosed herein is a method of cleaving a naturally occurring nucleic acid in a sample, the method comprising providing to the sample any of the disclosed DNAzymes; wherein the DNAzyme is capable of cleaving the naturally occurring nucleic acid.Attorney Docket No. 10046-678W01

[0018] In some aspects, also disclosed herein is a method of decreasing levels of a naturally occurring nucleic acid in a cell or tissue, the method comprising: providing to the cell or tissue any of the disclosed DNAzymes; wherein the DNAzyme is capable of cleaving the naturally occurring nucleic acid; and wherein the naturally occurring nucleic acid is overexpressed in the cell or tissue.

[0019] In some aspects, also disclosed herein is a method of treating and / or preventing cancer or a tumor in a subject in need thereof, the method comprising: providing to the subject any of the disclosed DNAzymes; wherein the DNAzyme is capable of cleaving an oncogenic niiRNA or apre-miRNA associated with an oncogenic miRNA.

[0020] In some aspects, also disclosed herein is a method of gene editing in a cell or tissue, the method comprising: providing to the subject any of the disclosed DNAzymes; wherein the DNAzyme is capable of cleaving genomic DNA.

[0021] In some aspects, also disclosed herein is a DNAzyme comprising: a substrate strand comprising a cleavage site; and an enzyme strand at least partially complementary to the substrate strand; wherein the enzyme strand is capable of cleaving the substrate strand at the cleavage site in presence of a target molecule; wherein, when the substrate strand is cleaved, the cleaved substrate strand triggers upregulation or downregulation of expression of a nucleic acid encoding a target protein.

[0022] In some aspects, also disclosed herein is a method of upregulating or downregulating expression of a target protein in a sample, subject, or system, the method comprising: providing to the sample, subject, or system any of the disclosed DNAzymes; wherein the DNAzyme is capable of triggering upregulation or downregulation of expression of a nucleic acid encoding the target protein; and wherein the sample, subject, or system comprises the nucleic acid encoding the target protein.

[0023] In some aspects, also disclosed herein is a method of detecting a target molecule in a sample, the method comprising: providing to the sample any of the disclosed DNAzymes; wherein the DNAzyme is capable of triggering upregulation or downregulation of expression of a nucleic acid encoding a target protein; wherein the sample comprises the nucleic acid encoding a target protein; wherein the target protein provides a detectable signal upon cleavage of the substrate strand; and detecting presence or absence of the detectable signal, thereby indicating presence or absence of the target molecule in the sample.

[0024] Other systems, methods, features and / or advantages will be or may become apparent to one with skill in the art upon examination of the following drawings and detailedAttorney Docket No. 10046-678W01description. It is intended that all such additional systems, methods, features and / or advantages be included within this description and be protected by the accompanying claims.BRIEF DESCRIPTION OF DRAWINGS

[0025] FIGURES 1A-1F depict that adenosine reduced the amount of RNA generated with in vitro transcription in a concentration -dependent manner by interacting with the aptamer region in the SLC25A13 gene. FIG. 1A is a scheme showing the design of the plasmid that was used as the template for testing the in vitro transcription. A cassette of DNA that contained a T7 promoter and 500 bp genomic sequence including the upstream and downstream of the SLC25A13Adenosine was inserted into the PCR 2.1 plasmid. Xhol located at the cleavage site was used to linearize the plasmid with the insertion at the forward direction and serve as the template for in vitro transcription. The red letters labeled the sequence that mutated for the control template that contained point mutations. Top strand, left - SEQ ID NO: 178. Top strand, right - SEQ ID NO: 35. Bottom strand, left - SEQ ID NO: 179. Bottom strand, right - SEQ ID NO: 180. FIG. IB shows a structure comparison between ATP and 7 -Deaza ATP. FIG. 1C shows an agarose gel assay for visualizing the product of in vitro transcription with the template that contains SLC25A13Adenosine. An increasing amount of adenosine resulted in a decreased amount of RNA products, while inosine which does not bind to the aptamer sequence did not change the RNA amount. FIG. ID shows quantification of the band intensity observed in FIG.1C using Image Lab. FIG. IE shows an agarose gel assay for visualizing the product of in vitro transcription with the template that contains a mutated SLC25A13Adenosine. When introducing point mutations into SLC25A13Adenosine, the same amount of adenosine did not show a significant decrease in the RNA amount in the presence of either adenosine or inosine. FIG. IF shows a quantification of the band intensity observed in FIG. IE using Image Lab. Unpaired student-t tests were used to compare the differences between each group and 0 mM adenosine, n.s., p > 0.05; *, p < 0.05; ***, p <0.001.

[0026] FIGURES 2A-2G depict that adenosine down-regulates the expression of EGFP by interacting with SLC25A13Adenosine that was introduced into the intron region of the EGFP plasmid. FIG. 2A shows the design of the EGFP plasmid. SLC25A13Adenosine and 500 bp of its upstream and downstream region were inserted into the intron of the EGFP plasmid at the nucleotide 105 of EGFP. Red letters labeled the mutated sequence for the Mutant plasmid that was used in later experiments. Top strand - SEQ ID NO: 35. Bottom strand - SEQ ID NO: 180. FIG. 2B shows the EGFP plasmid generated green fluorescence after being transfected into Uela cells. The fluorescence intensity decreased in the cells that were transfected withAttorney Docket No. 10046-678W01plasmid containing SLC25A13Adenosine and incubated with adenosine. The fluorescence intensity further decreased with increased concentrations of adenosine. mM labels the concentrations of adenosine that were used per group. FIG. 2C shows the statistical analysis of the average fluorescence intensity from experiments showed in FIG. 2B. FIG. 2D shows that when incubating adenosine, cytidine, guanosine, or thymidine respectively with the cells that transfected with the EGFP plasmid that contains SLC25A13Adenostae, only adenosine inhibited the GFP expression. FIG. 2E shows the statistical analysis of FIG. 2C. FIG. 2F shows cells transfected with a plasmid that contained mutated SLC25A13Adenosme showed higher fluorescence intensity than the cells transfected with the plasmid that contained SLC25A13Adenosine. Wlicu incubating the cells with different concentrations of adenosine, the cells containing SI X '25 A:,x;r. showed a dramatic decrease in the fluorescence intensity with increased concentrations of adenosine, while the cells that contained mutated SLC25A13Adenosme only showed a small decrease. FIG. 2G shows the statistical analysis of FIG. 2F. Scale bars are 50 pm. Student t-tests were used for statistical analysis. *, p < 0.05; ** p < 0.01; *** p < 0.001.

[0027] FIGURES 3A-3G demonstrate that adenosine down-regulates the expression of SLC25A13 by interacting with the SLC25A13Adenosine. FIG. 3A shows 4 hr 4 mM adenosine incubation reduced the expression of SLC25A13 significantly. FIG. 3B shows that when incubating the cells with different nucleosides, only adenosine reduced the expression of SLC25A13 significantly. FIG. 3C shows that with the increased concentrations of adenosine, the expression of SLC25A13 decreased. No further decrease of gene expression was observed with a concentration higher than 0.5 mM. FIG. 3D shows the sequence of mutation introduced to SLC25A13 was confirmed by Sanger sequencing. Wildtype allele - SEQ ID NO: 181. Point mutation sequence / Sanger sequencing readout - SEQ ID NO: 182. FIG. 3E shows that the cell line with point mutations in SLC25A13 showed higher expression of the SLC25A13 gene. FIG.3F shows that when comparing the wild-type and mutated cell lines, 0.5 mM adenosine incubation significantly reduced the expression of SLC25A13 in wild-type cells but not in the mutated cells. FIG. 3G shows the expression of SLC25A13 in wild-type cell lines decreased significantly when incubating the cells with adenosine at concentrations higher than 0.5 mM, while only slightly decreasing the expression in the mutated cell line. Significant differences were identified between genotypes according to a two-way ANOVA test. Unpaired student-t tests were performed at each concentration. The stars on each concentration point compared their change with 0 mM adenosine. B2M, GAPDH, and ACTB were used as reference genes, and relative expression represents 2~AAct. *, p<0.05; **, pcO. Ol; ***, pcO. OOl.Attorney Docket No. 10046-678W01

[0028] FIGURES 4A-4C show an ITC binding assay for the aptamer identified in the SLC25A13 intron region. FIG. 4A shows a sequence comparison between Adenosine aptamer (SEQ ID NO: 84) and SLC25A13Adenosme (SEQ ID NO: 183). The letter in red shows the mismatches between two sequences. FIG.4B shows the binding curve obtained with ITC when 2.5 mM ATP was titrated into 75 pM SLC25A13Adenosine at 25 degrees showed a Kd of 38.7+22.8 pM. FIG. 4C shows the binding curve obtained with ITC when 20 pM DNA sequences that were found in the MY07A were titrated into 2 mM adenosine, showed no binding between the DNA sequence and adenosine.

[0029] FIGURES 5A-5D detail that bioinformatics reveals the existence of an 8-17 DNAzyme in the human biological system and its potential target. FIG. 5A shows the bioinformatics workflow for the identification of cfDNA. FIG. 5B shows an overview of a DNAzyme (SEQ ID NO: 125) hybridized to an engineered RNA substrate (SEQ ID NO: 184). FIG. 5C shows the identification of natural miRNA substrates of DNAzymes. DNAzyme -SEQ ID NO: 125. Artificial all-RNA substrate - SEQ ID NO: 184. Natural miRNA substrate - SEQ ID NO: 185. FIG. 5D shows the bioinformatics workflow for the identification of natural miRNAs that are substrates of DNAzymes. DNAzyme - SEQ ID NO: 125. 8-17G engineered substrate sequence - SEQ ID NO: 184. hsa-miR-6865-5p natural substrate sequence - SEQ ID NO: 185. The DNAzyme is the bottom strand of ail structures shown.

[0030] FIGURES 6A-6D show' the assessment and comparison of 8-17G activity with artificial and natural RNA substrates. FIG. 6A shows substrates for the 8-17G enzyme. 8-17G enzyme - SEQ ID NO: 125. Engineered substrate v2.0 - SEQ ID NO: 184. miR6865-5p - SEQ ID NO: 185. FIG. 6B show's the cleavage of the engineered and natural substates under different metal conditions. FIG. 6C shows the cleavage of the microRNA overtime in the presence of 10 mM Ca2+. FIG. 6D show's the cleavage of the modified miRNA under different metal conditions.

[0031] FIGURES 7A-7C show that fluorescence studies validate activity under physiological conditions. FIG. 7A shows a representative schematic of fluorescence assay.. 8-17G enzyme - SEQ ID NO: 125. miR6865-5p - SEQ ID NO: 185. FIG. 7B shows raw¬ fluorescence data. FIG.7C show's fluorescence due to DNAzyme activity under different metal conditions.

[0032] FIGURES 8A-8B show' cell studies and miR6865 target prediction to survey 8-17G and miR6865 biological functions. FIG. 8A shows an overview of assay workflow. FIG.8B show's the relative gene expression of different microRNAs when different DNAzymes are present in cells.Attorney Docket No. 10046-678W01

[0033] FIGURE 9 shows miRNA natural substrate alignments; top candidates identified via the bioinformatics method. Input - SEQ ID NO: 184. hsa-miR-6865 precursor - SEQ ID NO: 184 (top strand), SEQ ID NO: 186 (bottom strand). hsa-miR-6865-5p -SEQ ID NO: 184 (top strand), SEQ ID NO: 171 (bottom strand). 8-17G + hsa-miR-6865-5p - SEQ ID NO: 125 (top strand), SEQ ID NO: 171 (bottom strand), hsa-mir-4292 precursor - SEQ ID NO: 184 (top strand), SEQ ID NO: 187 (bottom strand), hsa-mir-5585 precursor - SEQ ID NO: 184 (top strand), SEQ ID NO: 188 (bottom strand), hsa-mir-4726 precursor - SEQ ID NO: 184 (top strand), SEQ ID NO: 189 (bottom strand). hsa-miR-3922-5p - SEQ ID NO: 184 (top strand), SEQ ID NO: 190 (bottom strand), hsa-mir-6826 precursor - SEQ ID NO: 184 (top strand), SEQ ID NO: 191. hsa-miR-4726-5p - SEQ ID NO: 184 (top strand), SEQ ID NO: 192 (bottom strand).

[0034] FIGURE 10 shows the 8-17G + miR6865 predicted secondary structure (SEQ ID NO: 193).

[0035] FIGURES 11A-11B show other 8-17G cleavage junctions and substrate matches tested (negative results). FIG. 11A shows priority target test sequences. (1) - SEQ ID NO: 194. (2) - SEQ ID NO: 195. (3) - SEQ ID NO: 196. (4) - SEQ ID NO: 197. FIG. 11B 8-17G GA substrate cleavage target miRNA activity assay. 8-17G enzyme - SEQ ID NO: 125. 8-17G engineered substrate - SEQ ID NO: 134. miRNA-642b - SEQ ID NO: 198. miRNA-3190.3p+3 - SEQ ID NO: 199. miRNA-6758.5p+5 - SEQ ID NO: 200.

[0036] FIGURES 12A-12B and 12B show the 10-12opt DNAzyme USCF alignment and activity assay. FIG. 12A shows an alignment of the 10-12opt DNAzyme. DNAzyme sequence - SEQ ID NO: 103. Published substrate sequence - SEQ ID NO: 201. Top alignment sequence - SEQ ID NO: 202. Top alignment sequence with flanking regions - SEQ ID NO: 126. Engineered substrate - SEQ ID NO: 203. Extended version - SEQ ID NO: 128 (top strand), SEQ ID NO: 204 (bottom strand). FIG. 12B shows the cleavage assay of engineered substrates.10-12G enzyme - SEQ ID NO: 126. 10-12G engineered substrate - SEQ ID NO: 131. 10-12GX enzyme - SEQ ID NO: 128. 10-12GX engineered substrate - SEQ ID NO: 205.

[0037] FIGURES 13A-13B show DNAzyme-mediated cleavage of miRNA precursors and mimics enables metal ion-responsive RNA regulation and cellular phenotyping. FIG. 13A shows DNAzymes responsive to Zn2+or Mg2+to selectively cleave EGFP-targeting shRNA (shEGFP), resulting in the restoration of EGFP expression. This enables ratiometric imaging of intracellular metal ion levels in living cells, providing a real-time, functional readout of DNAzyme activity and metal-dependent gene regulation. FIG. 13B shows the same DNAzyme platform is applied to endogenous miRNA precursors, such as pre-miR-21, to achieve metalAttorney Docket No. 10046-678W01ion-dependent suppression of niiRNA maturation. This leads to modulation of cell migration, demonstrating conditional control of disease-relevant phenotypes through programmable RNA-level intervention.

[0038] FIGURES 14A-14C show that the 8-17 DNAzyme cleaves EGFP-targeting shRNA (shEGFP) in vitro. FIG. 14A shows the nucleotide sequence (SEQ ID NO: 206) of the shEGFP construct indicating potential 8—17 DNAzyme recognition sites. Cleavage-prone dinucleotide motifs (5'-GA-3' and 5'-GG-3') are marked with red arrows. FIG. 14B shows a schematic of site-specific binding between shEGFP and the 8-17 DNAzyme (SEQ ID NO: 143) targeting site 44 (8-17Dz44, shown in orange). A catalytically inactive mutant (M8-17Dz44) was generated by substituting the conserved AG dinucleotide in the catalytic core (circled) with GC, a mutation known to abolish cleavage activity. FIG. 14C shows denaturing polyacrylamide gel electrophoresis (PAGE) analysis of shEGFP cleavage in the presence of DNAzymes targeting sites 44, 45, and 50. Arrowheads indicate cleavage products. Lane labels correspond to the targeted cleavage sites. “M” indicates catalytically inactive mutant DNAzymes. “+” anddenote the presence or absence, respectively, of the DNAzyme in each reaction.

[0039] FIGURES 15A-15B show DNAzyme-mediated regulation of EGFP expression in living cells. FIG. 15A shows representative confocal fluorescence images of HEK293T cells co-transfected with plasmids encoding EGFP, mRuby, and shEGFP, together with either a phosphorothioate-modified 8—17 DNAzyme targeting site 44 (8-17Dz44-PS) or its catalytically inactive mutant (M8-17Dz44-PS). EGFP and mRuby fluorescence are shown in green and red, respectively. Images were acquired 10 hours post-transfection. Scale bar, 20 pm. FIG. 15B shows quantification of EGFP fluorescence intensity corresponding to the conditions in FIG. 15A. Statistical significance was assessed using unpaired two-tailed Student’s t-tests. *, p < 0.05; ***, p < 0.001.

[0040] FIGURES 16A-16B show metal ion-responsive regulation of EGFP expression by a shEGFP-targeting DNAzyme. FIG. 16A shows representative confocal images of HEK293T cells co-transfected with plasmids encoding EGFP, mRuby, and a phosphorothioate-modified 8-17 DNAzyme targeting site 44 of shEGFP (8-17Dz44-PS). Following transfection, cells were cultured in media containing varying concentrations of Zn2+. Images were acquired 24 hours post-transfection. EGFP and mRuby fluorescence are shown in green and red, respectively. Scale bar, 50 pm. FIG. 16B shows quantification of EGFP fluorescence intensity corresponding to the conditions in FIG. 16A. Statistical significance was determined using unpaired two-tailed Student’s t-tests. ns, not significant (p > 0.05); p < 0.001.Attorney Docket No. 10046-678W01

[0041] FIGURES 17A-17C show metal ion-dependent regulation of wound healing by a pre-miR-21-targeting DNAzyme. FIG. 17A shows representative microscope images of MCF7 cells transfected with a phosphorothioate-modified 8-17 DNAzyme targeting site 52 of pre-miR-21 (8-17Dz52-PS). The wound-healing process was monitored over time. White lines indicate wound boundaries. Scale bar, 100 pm. FIG. 17B shows quantification of wound closure rate at 20 hours post-wound creation. FIG. 17C shows quantification of wound closure rate at 50 hours post-wound creation. Statistical significance was assessed using unpaired two- tailed Student’s t-tests.

[0042] FIGURES 18A-18E show screening of the 8-17 and 10-23 DNAzymes cleave sites on shRNA for GFP. FIG. 18A showsl0% denatured polyacrylamide gel electrophoresis (PAGE) assay screened all potential cleavage sites and DNAzyme pairs on the shRNA of GFP. Among all the candidates, sites 44, 45, 50, and 47 showed cleaved products. Arrowhead pointed to the cleaved product. FIG. 18B shows a 10% denature PAGE assay with the cleavage of four cleavage sites. The DNAzyme and shRNA were mixed at a 1: 1 ratio. When compared with the shRNA and the DNAzyme, two bands of cleaved products showed on the gel (pointed by arrowheads). Dz is abbreviated for DNAzyme. FIG. 18C shows a 10% denature PAGE assay with the cleavage of four cleavage sites. The DNAzyme and shRNA were mixed at a 1: 10 ratio. When compared with the shRNA and the DNAzyme, two bands of cleaved products showed on the gel (pointed by arrowheads). Dz is abbreviated for DNAzyme. FIG. 18D shows the statistical analysis of RNA cleavage from PAGE gel assays in FIG. 18B. The percentage of cleavage was evaluated by the ratio between the average intensity of two cleaved products and the intensity of the total RNA amount. Numbers under the x-axis represent the location of cleavage sites. FIG. 18E shows the statistical analysis of RNA cleavage from PAGE gel assays in (C). The percentage of cleavage was evaluated by the ratio between the average intensity of two cleaved products and the intensity of the total RNA amount. Numbers under the x-axis represent the location of cleavage sites.

[0043] FIGURES 19A-19D show that shRNA down-regulates the expression of GFP in HEK293T cells. FIG. 19A shows confocal images of cells that transfected with different amounts of plasmids coding shR A or scrambled RNA. The scale bar represents 20 pm. FIG.19B shows the quantification and statistical analysis of the changes in the fluorescence intensity of GFP with different ratios of shRNA and scrambled RNA in mRuby positive cells 10 hrs after transfection. FIG. 19C shows the quantification and statistical analysis of the changes in the fluorescence intensity of GFP with different ratios of shRNA and scrambled RNA in mRuby positive cells 24 lies after transfection. FIG. 19D shows a comparison of transfectionAttorney Docket No. 10046-678W01efficiency between groups using the average fluorescence intensity of mRuby as an indicator. *, pc0.05; **, pcO. Ol; ***, pcO. OOl.

[0044] FIGURES 20A-20C show screened DNAzymes that cleave the shRNA for regulating GFP expression at 10 hours after transfection. FIG.20A shows the confocal imaging of cells that transfected with DNAzymes and plasmids coding GFP and shRNA. The images were taken 10 hrs after transfection. 40 mM MgCl2was supplemented to the group that transfected with 10-23 DNAzyme, while 30 pM ZnCh was supplemented to all other groups by incubating the cells in the cell culture media containing these metal ions after transfection. The scale bar represents 20 pm. FIG. 20B shows the quantification and statistical analysis of the changes in the fluorescence intensity of GFP with shRNA and different DNAzymes. FIG.20C shows GFP / mRuby ratio with shRNA and different DNAzymes. **, pcO. Ol; ***, pcO. OOl.

[0045] FIGURES 21A-21C show screened DNAzymes that cleave the shRNA for regulating GFP expression at 24 hours after transfection. FIG.21A shows the confocal imaging of cells that transfected with DNAzymes and plasmids coding GFP and shRNA. The images were taken 24 hrs after transfection. 40 mM MgCl2was supplemented to the group that transfected with 10-23 DNAzyme, while 30 uM ZnCl2was supplemented to all other groups by incubating the cells in the cell culture media containing these metal ions after transfection. The scale bar represents 20 pm. FIG. 21B show's quantification and statistical analysis of the changes in the fluorescence intensity of GFP with shRNA and different DNAzymes. FIG. 21 C shows GFP / mRuby ratio with shRNA and different DNAzymes. **, pcO. Ol; ***, pcO. OOl.

[0046] FIGURES 22A-22E show the test of the ratio between the plasmids coding shRNA and GFP in IIEK293T cells. FIG. 22A shows the confocal imaging of cells that transfected with different amounts of plasmids coding shRNA or scrambled RNA. The ratio represents the ratio between the plasmid that codes GFP and the plasmid that codes shRNA or scrambled RNA. SCR is abbreviated for scrambled RNA. The scale bar represents 20 pm. FIG. 22B shows quantification and statistical analysis of the changes in the fluorescence intensity of GFP with different ratios of shRNA and scrambled RNA. FIG.22C shows GFP / mRuby ratio 1: 1 of shRNA and scrambled RNA. *, pc0.05; **, pcO. Ol; ***, pcO. OOl. FIG. 22D show's GFP / mRuby ratio 1:2 of shRNA and scrambled RNA. *, pc0.05; **, pcO. Ol; ***, pcO. OOl. FIG. 22E show's GFP / mRuby ratio 1:3 of shRNA and scrambled RNA. *, pc0.05; **, pcO. Ol; ***, pcO. OOl.

[0047] FIGURES 23A-23C show' the test of the ratio between the plasmids coding shRNA and GFP in HEK293T cells. FIG. 23A shows confocal images of cells that transfected withAttorney Docket No. 10046-678W01the plasmids coding GFP, mRuby, and shRNA or scrambled RNA. The cells are also co¬ transfected with DNA oligos with 60 Ts, 8-17 DNAzyme that recognizes site 44 (8-1744), or its point mutated control (8-17 44M) that does not have catalytical activity. SCR: Scrambled RNA. The scale bar represents 20 um. FIG.23B shows statistical analysis of GFP / mRuby ratio in groups that transfected with GFP:shRNA at a ratio of 1:2. ns, p>0.05; ***, pcO.001. FIG.23C shows statistical analysis of GFP / mRuby ratio in groups that transfected with GFP:shRNA at a ratio of 2:2. ns, p>0.05; *p<0.05; **, pcO. Ol; ***, p<0.001.

[0048] FIGURES 24A-24C show the test of different protection groups for the DNAzymes at 24 hours after transfection. FIG. 24A shows the chemical structure and explanations of the protections that were tested. Both sides of the DNAzymes were modified with the protection groups. 8-17 DNAzyme at recognizing site 44 was used for the screening.FIG. 24B shows confocal imaging of cells transfected with the plasmids that code GFP, mRuby, and shRNA or scrambled RNA. DNA oligo that contains 60 Ts or the DNAzyme that recognizes site 44 were co-transfected to the cells. The letters after 8-17 44 indicate the modification that was used for both ends of the 8-17 DNAzyme. The images were taken 24 hrs after transfection. The scale bar represents 20 pm. FIG. 24C shows the statistical analysis of GFP / mRuby ratio for (B). ns, p>0.05; *, p<0.05; ***, pcO.001.

[0049] FIGURES 25A-25C show the test of different protection groups for the DNAzymes at 10 hours after transfection. FIG. 25A shows confocal imaging of cells transfected with the plasmids that code GFP, mRuby, and shRNA or scrambled RNA. DNA oligo that contains 60 Ts or the DNAzyme that recognizes site 44 were co-transfected to the cells. The letters after 8-1744 indicate the modification that was used for both ends of the 8-17 DNAzyme. The images were taken 24 hrs after transfection. The scale bar represents 20 um. FIG. 25B shows the statistical analysis of GFP / mRuby ratio for (A), ns, p>0.05; **, pcO. Ol; ***, pcO.001. FIG. 25C shows the fluorescence intensity of mRuby in each group, ns, p>0.05; **, pcO. Ol; ***, pcO.001.

[0050] FIGURES 26A-26B show that inverted dT-modified DNAzymes regulates GFP expression in living cells. FIG. 26A shows confocal images demonstrating the expression levels of GFP (green) and mRuby (red) in HEK293T cells under the regulation of inverted dT-modified DNAzyme and its point mutated control. Scale bar: 20 pm. FIG. 26B shows the statistical analysis of the fluorescence intensity in FIG. 26A. 5 cells per picture and 6 pictures from different regions of the dish were quantified with ZEN. Unpaired student t-tests were used for statistical analysis. **, p<0.01; ***, pcO.001.Attorney Docket No. 10046-678W01

[0051] FIGURES 27A-27B 10-23 DNAzyme regulates GFP expression in living cells. FIG. 27A shows cellular images displaying the expression levels of GFP (green) and mRuby (red) in HEK293T cells under the regulation of phosphorothioate bond modified 10-23 DNAzyme and its point mutated control. Scale bar: 50 pm. FIG. 27B shows the statistical analysis of the fluorescence intensity in FIG. 27A. 5 cells per picture and 6 pictures from different regions of the dish were quantified with ZEN. Unpaired student t-tests were used for statistical analysis. **, p<0.01; ***, pcO.001.

[0052] FIGURES 28A-28B show the 8-17 DNAzyme regulated GFP expression depends on Zn2+concentration. FIG. 28A shows confocal images displaying the expression levels of GFP (green) and mRuby (red) in HEK293T cells under the regulation of phosphorothioate bond modified DNAzyme 8-17 44. Different concentrations of Zn2+were added to the cell culture media after the transfection. Images were taken 10 hrs after the initiation of transfection. Scale bar: 50 pm. FIG. 28B shows the statistical analysis of the fluorescence intensity in FIG.28A. ns, p>0.05; ***, p<0.001.

[0053] FIGURES 29A-29B show the 10-23 DNAzyme regulated GFP expression depends on Mg2+concentrations. FIG. 29A shows confocal images displaying the expression levels of GFP (green) and mRuby (red) in HEK293T cells under the regulation of phosphorothioate bond modified DNAzyme 10-23 47. Different concentrations of Mg2+were added to the cell culture media after the transfection. Images were taken 18 hrs after the initiation of transfection. Scale bar: 20 pm. FIG.29B shows the statistical analysis of the fluorescence intensity in FIG.29A. ns, p>0.05; *, p<0.05; ***, p<0.001.

[0054] FIGURES 30A-30B show DNAzymes that cleave pre-miR21 in test tube. FIG.30A shows the sequence of pre-miRNA of miR21 (SEQ ID NO: 164). The red site and blue sites are the conserved sequences that are needed for 8-17 (red) and 10-23 (blue) DNAzymes to recognize the target, respectively. The arrowheads pointed to the cleavage sites, and the numbers represent the location of the cleavage sites on the shRNA. The binding arms of the DNAzyme were designed based on base-pair interaction between the DNAzyme and pre- miRNA sequences. FIG. 30B shows denatured polyacrylamide gel electrophoresis with the cleavage of the pre-miRNA in the presence of DNAzymes that recognize some of the locations. Arrowhead pointed to the cleaved product. Numbers are the location of the cleavage site. The lanes with number represent the reaction product with the incubation of both pre-miRNA and DNAzymes at corresponding locations. RNA represents pre-miRNA, Dz represents DNAzyme, both serve as size marker.Attorney Docket No. 10046-678W01

[0055] FIGURE 31 shows DNAzymes that cleave pre-miR21 in test tube. Sequence of pre-miRNA of miR21. The red site and blue sites are the conserved sequences that are needed for 8-17 (red) and 10-23 (blue) DNAzymes to recognize the target, respectively. The arrowheads pointed to the cleavage sites, and the numbers represent the location of the cleavage sites on the shRNA. The binding arms of the DNAzyme were designed based on base -pair interaction between the DNAzyme and pre-miRNA sequences. Denatured polyacrylamide gel electrophoresis shows the cleavage of the pre-miRNA in the presence of DNAzymes that recognize some of the locations. Arrowhead pointed to the cleaved product. Numbers are the location of the cleavage site. The lanes with number represent the reaction product with the incubation of both pre-miRNA and DNAzymes at corresponding locations. RNA represents pre-miRNA, Dz represents DNAzyme, both serve as size marker.

[0056] FIGURES 32A-32B show that 10-23 DNAzyme delayed the wound healing of MCF-7 cells. FIG. 32A shows the microscope image with the wound in MCF-7 cell culture at Oh, 24h, and 39h after creating the wound gap. White line highlighted the boundary of the wound. Scale bar: 100 pM. FIG. 32B shows quantification and statistical analysis to evaluate the gap size in different groups over different time points. The gap ratio was calculated by normalizing the gap size in each time point with the size of the gap created initially at Oh. Unpaired student t-tests were used for statistical analysis. *, p<0.05; **, pcO. Ol.

[0057] FIGURES 33A-33B depict preliminary data which suggests that the DZ6_2.2 cfDNAzyme cleaves the miR4740-3p substrate under several conditions: Tris only, IIEPES with K+, HEPES with Mg2+, and DPBS.

[0058] FIGURE 34 depicts that 8-17G cleaves miR6865 in a plasma buffer mimic.

[0059] FIGURE 35 depicts FRET efficiency ratio test of 5’FAM-labeled miR6865 and 3’TAMRA-labled miR6865 targets, CHD5 or CAMTAI, indicating binding of miR6865 to the predicted mRNA target. (CHD5 mimic: SEQ ID NO: 176) (CAMTAI mimic: SEQ ID NO: 177).

[0060] FIGURES 36A-36B depict additional cell experiments. FIG. 36A shows a workflow scheme illustrating 8-17G / miR6865 mediated gene regulation experiments (cells to be transfected are not restricted to HeLa cells). FIG. 36B shows a scheme illustrating the hypothesis of the cell experiments.

[0061] FIGURES 37A-37D show identification of a genomic intronic sequence with adenosine-binding activity. FIG. 37A shows alignment of the canonical adenosine DNA aptamer (SEQ ID NO: 84) with two human genomic candidates, SLC25A13A (SEQ ID NO: 183) and MY07AA (SEQ ID NO: 36). Nucleotides that differ from the canonical aptamer areAttorney Docket No. 10046-678W01highlighted in red. MY07AA contains a single-nucleotide deletion adjacent to the conserved adenosine-binding core, shown as a gap in the alignment. FIG. 37B shows isothermal titration calorimetry (ITC) analysis of the canonical adenosine aptamer (20 pM) titrated into adenosine (2. mM), yielding a dissociation constant (Ka) of 5.5 ± 1.7 pM. FIG. 37C shows ITC analysis of the SLC25A13A sequence (50 pM) titrated into adenosine (5 mM) revealed measurable adenosine binding, with a K of 16.0 ± 14.4 pM, indicating that this genomic variant retains ligand-binding activity despite sequence divergence from the canonical aptamer. FIG. 37D shows ITC measurements of the MY07AA sequence (20 pM) titrated into adenosine (2 mM) showed no detectable binding under the tested conditions, consistent with disruption of the conserved binding architecture by the single-nucleotide deletion. Together, these data show that a naturally occurring intronic DNA sequence can preserve adenosine -binding activity characteristic of a canonical DNA aptamer, while a closely related variant lacking a conserved nucleotide does not.

[0062] FIGURES 38A-38B depict the genomic context of candidate adenosine aptamer¬ like loci identified by genome-wide sequence analysis. FIG. 38A shows UCSC Genome Browser (GRCh38 / hg38) visualization of the SLC25A13 locus identifies the SLC25A13A sequence within intronic, noncoding regions, as confirmed by both GENCODE and RefSeq transcript annotations. The presence of ENCODE candidate cis-regulatory elements (cCREs) and enriched H3K27ac tracks indicates active regulatory potential at this site. FIG.38B shows UCSC Genome Browser (GRCh38 / hg38) visualization of the MY07A region locates the MY07AA sequence within a noncoding segment adjacent to the MY07A gene. Annotation tracks, including gene models, ENCODE cCREs, and H3K27ac signals, are provided to enable comparative analysis of the local regulatory elements.

[0063] FIGURES 39A-39D depict that point mutations disrupt the binding of SLC25A13A to adenosine. FIG. 39A shows isothermal titration calorimetry (ITC) analysis of adenosine (2.5 mM) titrated into SLC25A13A (75 pM) in nuclear ion-mimicking buffer showed detectable binding, with an estimated dissociation constant (Ka) of 38.7 ± 22.8 pM.FIG. 39B shows ITC analysis of the point-mutated SLC25A13A sequence under identical conditions showed markedly reduced adenosine binding compared with the wild-type sequence. FIG. 39C shows ITC measurements of guanosine titrated into SLC25A13A showed no detectable binding under the same buffer conditions. FIG. 39D shows control titrations of adenosine into buffer alone produced no detectable signal under identical conditions.

[0064] FIGURES 40A-40B depict Sanger sequencing verification of the SEC25A13A insert and binding-site mutant. FIG. 40A shows sequence alignments comparing the Sanger-Attorney Docket No. 10046-678W01derived consensus sequences of the wild-type SLC25A13A construct and the SLC25A13A mutant construct to the predicted reference sequence for a correct SLC25A13A insertion (labeled as Topo 2.1). Alignments span the insert and include the aptamer-like region. The wild-type construct matches the predicted reference sequence, whereas the mutant construct contains the intended nucleotide substitutions at the specified positions. Topo 2.1 - SEQ ID NO: 232. SLC25A13a- SEQ ID NO: 232. Mut SLC25 - SEQ ID NO: 233. FIG. 40B shows representative Sanger chromatograms for the wild-type and mutant constructs across the aptamer-like region, highlighting the mutated bases. SCL25A13A - SEQ ID NO: 234. Mutated SLC25A13A - SEQ ID NO: 235.

[0065] FIGURES 41A-41C depict ligand-dependent transcriptional repression is specific to the SLC25A13A sequence. FIG. 41A shows in vitro transcription products were generated from the wild-type SLC25A13A-containing template in the presence of increasing concentrations of adenosine. Adenosine reduced RNA yield in a concentration -dependent manner, whereas inosine did not alter RNA yield under the same conditions. FIG. 41B shows in vitro transcription products generated from a reverse-complement SLC25A13A template. Under the same conditions, adenosine did not produce a comparable reduction in RNA yield, and inosine had no effect. FIG. 41 C shows in vitro transcription products generated from a scrambled template that matched length and base composition. Adenosine did not reduce RNA yield across the tested concentration range, and inosine had no effect. The bar graphs quantify RNA band intensity normalized to the corresponding DNA template band intensity in each lane. Band intensities were quantified using Image Lab; data represent mean + SD from n - 3 independent experiments.

[0066] FIGURES 42A-42F depict that adenosine reduces SLC25A13 expression through the intronic adenosine-binding motif. FIG. 42A shows quantitative RT-qPCR analysis of SLC25A13 mRNA in cells treated with adenosine (4 mM, 4 h) relative to untreated controls.FIG. 42B shows quantitative RT-qPCR analysis of SLC25A13 mRNA following incubation with the indicated nucleosides under matched conditions. Adenosine produced a significant reduction, whereas the other nucleosides tested had no comparable effect. FIG. 42C shows quantitative RT-qPCR analysis of SLC25A13 mRNA levels across an adenosine dose series. SLC25A1 expression decreased with increasing adenosine concentration and plateaued above 0.5 mM under the tested conditions. FIG. 42D shows baseline SLC25A13 mRNA levels in wild-type and motif-mutant ceil lines measured by RT-qPCR, showing higher expression in the mutant line. FIG. 42E shows RT-qPCR analysis comparing wild-type and motif-mutant cell lines following treatment with 4 mM adenosine. Adenosine significantly reducedAttorney Docket No. 10046-678W01SLC25A13 expression in wild-type cells, whereas the response was strongly attenuated in the motif-mutant line. FIG.42F shows RT-qPCR analysis of SLC25A13 mRNA in wild-type and motif-mutant cell lines exposed to increasing concentrations of adenosine. Wild-type cells showed robust repression at >0.5 mM adenosine, whereas motif-mutant cells exhibited only minimal changes. Two-way ANOVA revealed a significant genotype x adenosine interaction. RT-qPCR data were normalized to the geometric mean of B2M, GAPDH, and ACTB. Data represent mean ± SD. Statistical significance was assessed using two-way ANOVA and unpaired Student’s t-tests: P < 0.05; P < 0.01; P < 0.001.

[0067] FIGURES 43A-43C depict that a RAP1GAP2 intronic sequence similar to the canonical adenosine aptamer (RAP1GAP2A) does not bind adenosine or confer regulatory activity. FIG. 43A shows UCSC Genome Browser (GRCh38 / hg38) visualization of the RAP1GAP2 region locates the RAP1GAP2A sequence within a noncoding segment adjacent to the RAP1GAP2 gene. Scale chrl7 - SEQ ID NO: 236. Human - SEQ ID NO: 236. Rhesus - SEQ ID NO: 237. FIG. 43B shows the sequence of the RAP1GAP2 candidate element (SEQ ID NO: 238). Nucleotides that differ from the canonical adenosine DNA aptamer are highlighted in red. FIG. 43C shows ITC analysis of the RAP1GAP2A sequence showed no detectable binding to adenosine under the tested conditions. FIGS.43D-43E show quantitative RT-qPCR analysis of RAP1GAP2 (FIG. 43D) and MY07A mRNA (FIG. 43E) following incubation with 4 mM adenosine for 4 h showed no significant alteration in transcript abundance.DETAILED DESCRIPTION

[0068] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate aspects, can also be provided in combination with a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, can also be provided separately or in any suitable subcombination. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure.DEFINITIONS

[0069] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:Attorney Docket No. 10046-678W01

[0070] As used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by”, “comprising,” “comprises”, “comprised of,” “including,” “includes,” “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, non- limiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of’ and “consisting of.” Similarly, the term “consisting essentially of” is intended to include examples encompassed by the term “consisting of.

[0071] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound”, “a composition”, or “a cancer”, includes, but is not limited to, two or more such compounds, compositions, or cancers, and the like.

[0072] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It can be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it can be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0073] When a range is expressed, a further aspect includes from the one particular-value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g. the phrase “x to y” includes the range from A’ to ‘y’ as well as the range greater than ‘x’ and less than ‘y’. The range can also be expressed as an upper limit, e.g. ‘about x, y, z, or less’ and should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘less than x’, less than y’, and ‘less than z’. Likewise, the phrase ‘about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x’, greater than y’, and ‘greater than z’. In addition, the phrase “about ‘x’ to ‘y’”, where ‘x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’”.Attorney Docket No. 10046-678W01

[0074] It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “about 0.1% to 5%” should be interpreted to include not only the explicitly recited values of about 0.1 % to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the sub¬ ranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.

[0075] As used herein, the terms “about,” “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about,” “approximate,” or “at or about” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0076] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired modification of a physical property of the composition or material. For example, an “effective amount” of a monomer refers to an amount that is sufficient to achieve the desired improvement in the property modulated by the formulation component, e.g. desired antioxidant release rate or viscoelasticity. 'The specific level in terms of wt% in a composition required as an effective amount will depend upon a variety of factors including the amount and type of monomer, amount and type of polymer, e.g., acrylamide, amount of antioxidant, and desired release kinetics.

[0077] As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to achie ve the desired therapeutic result or to have an effect on undesired symptomsAttorney Docket No. 10046-678W01but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors within the knowledge and expertise of the health practitioner and which may be well known in the medical arts. In the case of treating a particular disease or condition, in some instances, the desired response can be inhibiting the progression of the disease or condition. This may involve only slowing the progression of the disease temporarily. However, in other instances, it may be desirable to halt the progression of the disease permanently. This can be monitored by routine diagnostic methods known to one of ordinary skill in the art for any particular disease. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.

[0078] For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. It is generally preferred that a maximum dose of the pharmacological agents of the invention (alone or in combination with other therapeutic agents) be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

[0079] A response to a therapeutically effective dose of a disclosed drug delivery composition can be measured by determining the physiological effects of the treatment or medication, such as the decrease or lack of disease symptoms following administration of the treatment or pharmacological agent. Other assays will be known to one of ordinary skill in the art and can be employed for measuring the level of the response. The amount of a treatment may be varied for example by increasing or decreasing the amount of a disclosed compound and / or pharmaceutical composition, by changing the disclosed compound and / or pharmaceutical composition administered, by changing the route of administration, by¬ changing the dosage timing and so on. Dosage can vary, and can be administered in one orAttorney Docket No. 10046-678W01more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.

[0080] As used herein, the term “prophylactically effective amount” refers to an amount effective for preventing onset or initiation of a disease or condition.

[0081] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.

[0082] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0083] As used interchangeably herein, “subject,” “individual,” or “patient” can refer to a vertebrate organism, such as a mammal (e.g. human). " Subject" can also refer to a cell, a population of cells, a tissue, an organ, or an organism, preferably to human and constituents thereof.

[0084] As used herein, the terms "treating" and "treatment" can refer generally to obtaining a desired pharmacological and / or physiological effect. The effect can be, but does not necessarily have to be, prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof. The effect can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease, disorder, or condition. The term "treatment" as used herein can include any treatment of a disease disorder in a subject, particularly a human and can include any one or more of the following: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., mitigating or ameliorating the disease and / or its symptoms or conditions. The term "treatment" as used herein can refer to both therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of treatment (subjects in need thereof) can include those already with the disorder and / or those in which the disorder is to be prevented. As used herein, the term "treating", can include inhibiting the disease, disorder or condition, e.g., impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and / or condition. Treating the disease, disorder, or condition can include ameliorating at least one symptom of the particular disease, disorder, or condition, even if the underlyingAttorney Docket No. 10046-678W01pathophysiology is not affected, e.g., such as heating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.

[0085] As used herein, “dose,” “unit dose,” or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of a disclosed compound and / or a pharmaceutical composition thereof calculated to produce the desired response or responses in association with its administration.

[0086] As used herein, “therapeutic” can refer to treating, healing, and / or ameliorating a disease, disorder, condition, or side effect, or to decreasing in the rate of advancement of a disease, disorder, condition, or side effect.METHODS OF IDENTIFYING NATURALLY OCCURRING DNAZYMES AND / OR DNA APTAMERS

[0087] In some aspects, disclosed herein is a method to identify naturally occurring DNAzymes and / or DNA aptamers, the method including: a) providing a first database including sequences of DNAzymes, DNA aptamers, or portions thereof; b) providing a second database including naturally occurring nucleic acid sequences; and c) searching the second database for a first match sequence comprising about 90% similarity (e.g., sequence similarity and / or structural similarity) or more (e.g., about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, about 100%) to a sequence in the first database using an algorithm that finds regions of local similarity between sequences.

[0088] In some aspects, the local similarity can have an expectation threshold of about 0.05 or less (e.g., about 0.045 or less, about 0.04 or less, about 0.035 or less, about 0.03 or less, about 0.025 or less, about 0.02 or less, about 0.015 or less, about 0.01 or less, about 0.005 or less).

[0089] In some aspects, the second database can include mRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof. In some aspects, cfDNA can include ultrashort cell-free DNA (uscfDNA), circulating tumor DNA (ctDNA), fetal DNA (cffDNA), donor-derived cfDNA, or any combination thereof.

[0090] In some aspects, NCBI standard nucleotide BLAST blastn can be used to find local similarity between sequences.

[0091] In some aspects, the first match sequence can be a DNA aptamer including a binding nucleic acid which selectively binds to a target molecule. In some aspecst, the target molecule can be an amino acid, adenosine, xanthine, 4-HNE, methylglyoxal, cyclic AMP, NAD+,Attorney Docket No. 10046-678W01NADPH, SAM (S-adenosylmethionine), CoA, acetyl-CoA, 2-hydroxyglutarate, choline, phosphocholine, GSH (glutathione), thrombin, ATP, glutathione, sugar, or hemin.

[0092] In some aspects, the first match sequence can be an enzyme strand of a DNAzyme. In some aspects, the enzyme strand can be capable of cleaving a substrate strand in the presence of a target molecule (e.g., the enzyme strand can be a DNA aptazyme enzyme strand). In some aspects, the target molecule can be Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+, or Cr3+

[0093] In some aspects, the method can further include: d) designing a substrate strand that is at least partially complementary to the enzyme strand; e) providing a third database comprising naturally occurring nucleic acid sequences; and f) searching the third database for a second match sequence using an algorithm that finds regions of local similarity between sequences. In some aspects, the second database can include cfDNA and / or genomic DNA, and the third database can include mRNA, pre-miRNA, miRNA, siRNA, or any combination thereof.

[0094] In some aspects, the first match sequence can be a substrate strand of a DNAzyme which can be cleaved by an enzyme strand. In some aspects, the substrate strand can be cleaved by an enzyme strand in the presence of a target molecule (e.g., the substrate strand can be a DNA aptazyme substrate strand). In some aspects, the target molecule can be Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+, or Cr;.

[0095] In some aspects, the method can further include: d) engineering an enzyme strand that is at least partially complementary to the substrate strand; e) providing a third database including naturally occurring nucleic acid sequences; and f) searching the third database for a second match sequence using an algorithm that finds regions of local similarity between sequences. In some aspects, the second database can include mRNA, pre-miRNA, miRNA, siRNA, or any combination thereof, and the third database can include cfDNA and / or genomic nucleic acid.

[0096] In some aspects, the second match sequence can include query coverage of about 60% or more (e.g., about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 81 % or more, about 82% or more, about 83% or more, about 84% or more, about 85% or more, about 86% or more, about 87% or more, about 88% or more, about 89% or more, about 90% or more, about 91%’ or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, about 100%).Attorney Docket No. 10046-678W01

[0097] In some aspects, the second match sequence can include target coverage of about 60% or more (e.g., about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 81 % or more, about 82% or more, about 83% or more, about 84% or more, about 85% or more, about 86% or more, about 87% or more, about 88% or more, about 89% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99%’ or more, about 100%).

[0098] In some aspects, the second match sequence can include about 80% or more sequence similarity to the substrate strand (e.g., about 81% or more, about 82% or more, about 83% or more, about 84% or more, about 85% or more, about 86% or more, about 87% or more, about 88% or more, about 89% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, about 100%).

[0099] In some aspects, also disclosed herein is a DNAzyme or DNA aptamer identified by any of the disclosed methods of identifying naturally occurring DNAzymes and / or DNA aptamers.

[0100] In some aspects, also disclosed herein is a DNAzyme or DNA aptamer identified by any of the disclosed methods of identifying naturally occurring DNAzymes and / or DNA aptamers and further engineered to include a detectable signal.

[0101] In some aspects, the detectable signal can be a fluorophore or fluorescent dye. In some aspects, the fluorophore or fluorescent dye can be Hydroxycoumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC, Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X-Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Cy5.5, LC red 705, Cy7, IRDye 800 CW, IRDye 700, Cy7.5, Dy780, Dy781, DyLight 800, IRDye 800 CW, Alexa Fluor 647, Alexa Fluor 488, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 750, Alexa Fluor 790, JOE, or MAX.

[0102] In some aspects, also disclosed herein is a system including: a processor; and a memory having instructions stored thereon, wherein execution of the instructions by a processor causes the processor to perform any of the disclosed methods of identifying naturallyAttorney Docket No. 10046-678W01occurring DNAzymes and / or DNA aptamers. In some aspects, the system can further include a data store including the first database, the second database, and / or the third database.

[0103] In some aspects, also disclosed herein is a computer readable medium having instructions stored thereon, wherein execution of the instructions by a processor causes the processor to perform any of the disclosed methods of identifying naturally occurring DNAzymes and / or DNA aptamers.DNA APTAMERS THAT BIND TO NATURALLY OCCURRING NUCLEIC ACIDS

[0104] In some aspects, disclosed herein is a DNA aptamer including: a naturally occurring nucleic acid which selectively binds to a target molecule; and a signaling nucleic acid which is at least partially complementary to at least a portion of the naturally occurring nucleic acid; wherein, when the naturally occurring nucleic acid is bound to the target molecule, the signaling nucleic acid produces a detectable signal.

[0105] In some aspects, the naturally occurring nucleic acid can include mRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof.

[0106] In some aspects, the target molecule can be an amino acid, adenosine, xanthine, 4-HNE, methylglyoxal, cyclic AMP, NAD+, NADPH, SAM (S-adenosylmethionine), CoA, acetyl-CoA, 2 -hydroxyglutarate, choline, phosphocholine, GSH (glutathione), thrombin, ATP, glutathione, sugar, or hemin.

[0107] In some aspects, the signaling nucleic acid can include DNA. In other aspects, the signaling nucleic acid can include RNA. In yet other aspects, the signaling nucleic acid can include a combination of DNA and RNA.

[0108] In some aspects, the signaling nucleic acid can include one or more modifications. In some aspects, the signaling nucleic acid can include one or more non-naturally occurring nucleotides, one or more non-naturally occurring linkages, a hairpin loop, one or more spacers, or any combination thereof. In some aspects, the one or more modifications can improve the stability, biocompatibility, nuclease resistance, and / or activity of the DNA aptamer.

[0109] In some aspects, the one or more non-naturally occurring nucleotides can include locked nucleotides, 2’-O-Me-modified nucleotides, inverted nucleotides, peptide nucleotides, or any combination thereof.

[0110] In some aspects, the one or more non-naturally occurring linkages can include phosphorothioate linkages, methylphosphonate linkages, oranophosphate linkages, morpholino linkages, or any combination thereof.

[0111] In some aspects, the one or more spacers can include Ci-6 alkyl. The term “alkyl” as used herein is a branched or unbranched saturated hydrocarbon group. In someAttorney Docket No. 10046-678W01embodiments, the alkyl comprises 1 to 10 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, and the like. The alkyl group can also be substituted or unsubstituted. The alkyl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, acyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol.

[0112] In some aspects, the signaling nucleic acid can be shorter than the naturally occurring nucleic acid. For example, in some aspects, the signaling nucleic acid can be about 10% or more of the length of the binding nucleic acid (e.g., about 20% or more, about 30% or more, about 40% or more, about 50%’ or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more). In some aspects, the signaling nucleic acid can be less than 100% of the length of the binding nucleic acid (e.g., about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50% or less, about 40% or less, about 30% or less, about 20 ’ or less, about 10% or less).

[0113] The signaling nucleic acid can be any length of the signaling nucleic acid ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the signaling nucleic acid can be from about 10% to less than 100% of the length of the binding nucleic acid (e.g., from about 20% to about 90%, from about 30% to about 80%, from about 40% to about 70%, from about 50% to about 60%, from about 10% to about 60%, from about 20% to about 50%, from about 30% to about 40%, from about 50% to less than 100%, from about 60% to about 90%, from about 70% to about 80%).

[0114] In some aspects, the target molecule and the signaling nucleic acid can bind the naturally occurring nucleic acid in non -overlapping regions of the naturally occurring nucleic acid.

[0115] In some aspects, when the target molecule is bound to the naturally occurring nucleic acid, one or more properties in the naturally occurring nucleic acid can change. In some aspects, the one or more properties of the naturally occurring nucleic acid can include a conformational change, a difference in melting temperature, and / or a variation in sensitivity to pH or another environmental condition. In some aspects, the changes to one or more properties of the naturally occurring nucleic acid can cause the signaling nucleic acid to dissociate from the naturally occurring nucleic acid.

[0116] In some aspects, the detectable signal can include a fluorophore or a fluorescent dye conjugated to the signaling nucleic acid. In some aspects, the fluorophore or fluorescent dye can be Hydroxycoumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin, Cascade Blue,Attorney Docket No. 10046-678W01Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC, Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X-Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Cy5.5, LC red 705, Cy7, IRDye 800 CW, IRDye 700, Cy7.5, Dy780, Dy781, DyLight 800, IRDye 800 CW, Alexa Fluor 647, Alexa Fluor 488, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 750, Alexa Fluor 790, JOE, or MAX.

[0117] In some aspects, the detectable signal can include a barcode sequence.

[0118] In some aspects, the signaling nucleic acid can include the barcode sequence, and the barcode sequence can be amplifiable when the naturally occurring nucleic acid is bound to the target molecule. In some aspects, the naturally occurring nucleic acid can include the barcode sequence, and the barcode sequence can be amplifiable when the naturally occurring nucleic acid is bound to the target molecule.

[0119] In some aspects, also disclosed herein is a method of detecting a naturally occurring nucleic acid in a sample, the method including: providing to the sample any of the disclosed DNA aptamers; and detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid.

[0120] In some aspects, the sample can include the target molecule before the DNA aptamer is provided. In some aspects, the method can further include providing the target molecule to the sample.

[0121] In some aspects, the sample can be a cell, tissue, cell lysate, or biological fluid.

[0122] In some aspects, the method can take place in vitro, in vivo, or ex vivo.

[0123] In some aspects, also disclosed herein is a method of determining presence, location, and / or severity of a disease or disorder in a subject, the method including: providing any of the disclosed DNA aptamers to the subject or a sample taken from the subject; and detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid; wherein overexpression of the naturally occurring nucleic acid indicates presence of a disease or disorder and / or increased severity of a disease or disorder.

[0124] In some aspects, also disclosed herein is a method of treating and / or preventing a disease or disorder in a subject in need thereof, the method including: providing any of the disclosed DNA aptamers to the subject or a sample taken from the subject; detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally9Attorney Docket No. 10046-678W01occurring nucleic acid; wherein overexpression of the naturally occurring nucleic acid indicates presence of a disease or disorder and / or increased severity of a disease or disorder; and if presence of the disease or disorder is detected, administering one or more therapeutic agents to the subject.

[0125] In some aspects, location of the disease or disorder can be determined by distribution of the detectable signal within the subject, and the one or more therapeutic agents can be delivered to the location of the disease or disorder.

[0126] In some aspects, a higher amount of the detectable signal can indicate higher expression of the naturally occurring nucleic acid, thereby indicating increased severity of the disease or disorder. In some aspects, the severity of the disease or disorder can influence the selection and / or dosage of the one or more therapeutic agents.

[0127] In some aspects, the sample can include the target molecule before the DNA aptamer is provided. For example, in some aspects, overexpression of the naturally occurring nucleic acid can be associated with overexpression of the target molecule. In some aspects, this can be used to dually verify the presence, location, and / or severity of the disease or disorder, as activation of the detectable signal would require two markers of the disease or di sorder rather than only the target molecule or only the naturally occurring nucleic acid.

[0128] In some aspects, the method can further include providing the target molecule to the subject or the sample. In one example, the method can be used for in vivo diagnostics to identify the presence of the naturally occurring nucleic acid by providing the DNA aptamer and, separately, administering the target molecule for controlled, time-specific proof of the presence of the naturally occurring nucleic acid in the biological sample (i.e., adding an additional amount of the target molecule can confirm the binding and activation of the DNA aptamer). In another example, the method can be used for advanced drug delivery systems.

[0129] In some aspects, the disease or disorder can be cancer or a tumor; and the naturally occurring nucleic acid can be an oncogenic miRNA, or a pre-miRNA associated with an oncogenic miRNA. For example, in some aspects, the naturally occurring nucleic acid can be miR-21, miR-155, miR-lOb, pre-miR-21, pre-miR-155, or pre-miR-lOb.

[0130] In some aspects, the disease or disorder can be Alzheimer’s, Huntington’s, ALS, or another neurological disease or disorder, and the naturally occurring nucleic acid can be miR-29a, miR-29b, miR-7, miR-132, miR-218, miR-9 / 9*, or miR-124a.

[0131] In some aspects, the disease or disorder can be myocardial infarction or another cardiac disease or disorder, and the naturally occurring nucleic acid can be miR-1.Attorney Docket No. 10046-678W01

[0132] In some aspects, the disease or disorder can be systemic lupus erythematosus (SLE), psoriasis, or another autoimmune disease or disorder, and the naturally occurring nucleic acid can be miR-146a or miR-31.

[0133] In some aspects, the disease or disorder can be hepatis C virus (HCV) infection or another viral, bacterial, fungal, or parasitic infection, and the naturally occurring nucleic acid can be miR-122.

[0134] In some aspects, the sample can be a cell, tissue, cell lysate, or biological fluid. DNAZYMES THAT CLEAVE NATURALLY OCCURRING NUCLEIC ACIDS

[0135] In some aspects, also disclosed herein is a DNAzyme including: an enzyme strand comprising two arms and a catalytic core disposed between the two arms; wherein at least one of the two arms is at least partially complementary to a naturally occurring nucleic acid; and wherein the catalytic core is capable of cleaving the naturally occurring nucleic acid.

[0136] In some aspects, the naturally occurring nucleic acid can include mRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof.

[0137] In some aspects, the enzyme strand can include DNA. In other aspects, the enzyme strand can include RNA. In yet other aspects, the enzyme strand can include a combination of DNA and RNA.

[0138] In some aspects, the two arms can have a same or different lengths.

[0139] In some aspects, each of the two binding arms can independently be about 5 or more nucleotides in length (e.g., about 6 or more, about 7 or more, about 8 or more, about 9 or more, about 10 or more, about 11 or more, about 12 or more, about 13 or more, about 14 or more, about 15 or more). In some aspects, each of the two binding arms can independently be about 15 or less nucleotides in length (e.g., about 14 or less, about 13 or less, about 12 or less, about 11 or less, about 10 or less, about 9 or less, about 8 or less, about 7 or less, about 6 or less, about 5 or less).

[0140] Each of the two binding arms can independently be any length ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, each of the two binding arms can independently be from about 5 to about 15 nucleotides in length (e.g., from about 6 to about 14, from about 7 to about 13, from about 8 to about 12, from about 9 to about 11, from about 5 to about 10, from about 6 to about 9, from about 7 to about 8, from about 10 to about 15, from about 11 to about 14, from about 12. to about 13).

[0141] In some aspects, both of the two arms can be at least partially complementary to the naturally occurring nucleic acid.Attorney Docket No. 10046-678W01

[0142] In some aspects, one or both of the two arms can be about 60% or more complementary to the naturally occurring nucleic acid (e.g., about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, about 100%). In some aspects, one or both of the two arms can be about 100% or less complementary to the naturally occurring nucleic acid (e.g., about 99% or less, about 98% or less, about 97% or less, about 96% or less, about 95% or less, about 94% or less, about 93% or less, about 92% or less, about 91% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less).

[0143] One or both of the two arms can be any percent complementary to the naturally occurring nucleic acid ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, one or both of the two arms can be from about 60% to about 100% complementary to the naturally occurring nucleic acid (e.g., from about 65% to about 99%, from about 70% to about 98%, from about 75% to about 97%, from about 80% to about 96%, from about 85% to about 95%, from about 90% to about 94%, from about 91% to about 93%, from about 60% to about 92%, from about 65% to about 91%, from about 70% to about 90%, from about 75% to about 85%, from about 92% to about 100%, from about 93% to about 99%, from about 94% to about 98%, from about 95% to about 97%).

[0144] In some aspects, the enzyme strand can include one or more modifications. In some aspects, the enzyme strand can include one or more non-naturally occurring nucleotides, one or more non-naturally occurring linkages, a hairpin loop, one or more spacers, or any combination thereof. In some aspects, the one or more modifications can improve the stability, biocompatibility, nuclease resistance, and / or activity of the DNA aptamer.

[0145] In some aspects, the one or more non-naturally occurring nucleotides can include locked nucleotides, 2’ -O-Me- modified nucleotides, inverted nucleotides, peptide nucleotides, or any combination thereof.

[0146] In some aspects, the one or more non-naturally occurring linkages can include phosphorothioate linkages, methylphosphonate linkages, oranophosphate linkages, morpholino linkages, or any combination thereof.

[0147] In some aspects, the one or more spacers can include Ci-e alkyl.

[0148] In some aspects, the naturally occurring nucleic acid can be pre-miR-21, and the enzyme strand can include about 80% sequence similarity or more (e.g., about 81% or more,Attorney Docket No. 10046-678W01about 82% or more, about 83% or more, about 84% or more, about 85% or more, about 86% or more, about 87% or more, about 88% or more, about 89% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, about 100%) to any one of SEQ ID NOS: 3-32.

[0149] In some aspects, the naturally occurring nucleic acid can be hsa-miR-6865-5p, hsa-miR-4740-3p, hsa-miR-892c-5p, hsa-miR-147b-3p, or hsa-miR-6827-5p and the enzyme strand can include about 80% sequence similarity or more (e.g., about 81% or more, about 82% or more, about 83% or more, about 84% or more, about 85% or more, about 86% or more, about 87% or more, about 88%’ or more, about 89% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, about 100%) to SEQ ID NO: 125 or any one of SEQ ID NOS: 165-170.

[0150] In some aspects, the catalytic core can be capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule (e.g., the DNAzyme can be a DNA aptazyme). In some aspects, the target molecule can be Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+, or Cr3+.

[0151] In some aspects, the target molecule can be Mg2+, and the catalytic core can include SEQ ID NO: 1 or a variant thereof. In some such aspects, the naturally occurring nucleic acid comprises a 5 ’-AG-3’ motif or a5’-GG-3’ motif; and the catalytic core can cleave the naturally occurring acid at said motif (e.g., between the two nucleotides of the motif).

[0152] In some aspects, the target molecule can be Zn2+, and the catalytic core can include SEQ ID NO: 2 or a variant thereof. In some such aspects, the naturally occurring nucleic acid comprises a 5’-GU-3’ motif or a 5 ’-AU-3’ motif; and the catalytic core can cleave the naturally occurring acid at said motif (e.g., between the two nucleotides of the motif).

[0153] In some aspects, also disclosed herein is a method of cleaving a naturally occurring nucleic acid in a sample, the method including providing to the sample any of the disclosed DNAzymes; wherein the DNAzyme is capable of cleaving the naturally occurring nucleic acid.

[0154] In some aspects, the DNAzyme can cleave multiple copies of the naturally occurring nucleic acid.

[0155] In some aspects, for example, when the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule, the sample can include the target molecule before the DNAzyme is provided. In some aspects, for example, when theAttorney Docket No. 10046-678W01catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule, the method can further include providing the target molecule to the sample.

[0156] In some aspects, the sample can be a cell, tissue, cell lysate, or biological fluid.

[0157] In some aspects, the method can occur in vitro, in vivo, or ex vivo.

[0158] In some aspects, also disclosed herein is a method of decreasing levels of a naturally occurring nucleic acid in a cell or tissue, the method including: providing to the cell or tissue any of the disclosed DNAzymes; wherein the DNAzyme is capable of cleaving the naturally occurring nucleic acid; and wherein the naturally occurring nucleic acid is overexpressed in the cell or tissue.

[0159] In some aspects, overexpression of the naturally occurring nucleic acid can indicate presence of a disease or disorder and / or increased severity of a disease or disorder.

[0160] In some aspects, the disease or disorder can be cancer or a tumor; and the naturally occurring nucleic acid can be an oncogenic miRNA, or a pre-miRNA associated with an oncogenic miRNA. For example, in some aspects, the naturally occurring nucleic acid can be miR-21, miR-155, miR-lOb, pre-miR-21, pre-miR-155, or pre-miR-lOb.

[0161] In some aspects, the disease or disorder can be Alzheimer s, Huntington’s, ALS, or another neurological disease or disorder, and the naturally occurring nucleic acid can be miR-29a, miR-29b, miR-7, miR-132, miR-218, miR-9 / 9*, or miR-124a.

[0162] In some aspects, the disease or disorder can be myocardial infarction or another cardiac disease or disorder, and the naturally occurring nucleic acid can be miR-1.

[0163] In some aspects, the disease or disorder can be systemic lupus erythematosus (SLE), psoriasis, or another autoimmune disease or disorder, and the naturally occurring nucleic acid can be miR-146a or miR-31.

[0164] In some aspects, the disease or disorder can be hepatis C virus (HCV) infection or another viral, bacterial, fungal, or parasitic infection, and the naturally occurring nucleic acid can be miR-122.

[0165] In some aspects, for example, when the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule, the cell or tissue can include the target molecule before the DNAzyme is provided. For example, in some aspects, overexpression of the naturally occurring nucleic acid can be associated with overexpression of the target molecule. In some aspects, this can be used to regulate the activity of the DNAzyme to prevent off-target or unnecessary cleavage, as cleavage of the naturally occurring nucleic acid would require the presence of the target molecule as well to confirm that the cleavage is physiologically appropriate. For example, in some aspects, particularly when theAttorney Docket No. 10046-678W01overexpression of the naturally occurring nucleic acid is associated with a disease or disorder, this could direct cleavage of the oncogenic miRNA or pre-miRNA to occur primarily within the site of the disease or disorder in order to regulate gene expressions at specific environment to determine cell fate during disease progression.

[0166] In some aspects, for example, when the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule, the method can further include providing the target molecule to the cell or tissue.

[0167] In some aspects, also disclosed herein is a method of treating and / or preventing cancer or a tumor in a subject in need thereof, the method including: providing to the subject any of the disclosed DNAzymes; wherein the DNAzyme is capable of cleaving an oncogenic miRNA or a pre-miRNA associated with an oncogenic miRNA.

[0168] In some aspects, for example, when the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule, the cell or tissue can include the target molecule before the DNAzyme is provided. For example, in some aspects, overexpression of the naturally occurring nucleic acid can be associated with overexpression of the target molecule. In some aspects, this can be used to regulate the activity of the DNAzyme to prevent off-target or unnecessary cleavage, as cleavage of the naturally occurring nucleic acid would require the presence of the target molecule as well to confirm that the cleavage is physiologically appropriate. For example, in some aspects, this could direct cleavage of the oncogenic miRNA or pre-miRNA to occur primarily within the cancer or tumor in order to reduce the local expression of oncogenic miRNA or pre-miRNA, therefore slowing down the migration or proliferation of cancer cells. For example, if the mRNA target of a miRNA is a tumor suppressor gene, cleavage of the miRNA enables tumor suppression, whereas absence of miRNA cleavage (i.e., unregulated presence of the miRNA) promotes tumor growth.

[0169] In some aspects, for example, when the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule, the method can further include providing the target molecule to the cell or tissue.

[0170] In some aspects, the naturally occurring nucleic acid can be miR-21, miR-155, miR-10b, pre-miR-21, pre-miR-155, or pre-miR-lOb.

[0171] In some aspects, the method can decrease tumor cell proliferation and / or migration.

[0172] In some aspects, the method can further include administering one or more anticancer treatments to the subject.Attorney Docket No. 10046-678W01

[0173] In some aspects, also disclosed herein is a method of gene editing in a cell or tissue, the method including: providing to the subject any of the disclosed DNAzymes; wherein the DNAzyme is capable of cleaving genomic DNA.

[0174] In some aspects, the DNAzyme can cleave the genomic DNA near splicing sites or untranslated regions (UTRs), for example, to modulate transcript isoforms or translation efficiency.

[0175] In some aspects, the DNAzyme can remove or replace mutant sequences in damaged or irregular genomic DNA, for example, to treat genetic disorders.

[0176] In some aspects, the method can further include providing to the subject one or more components of an RNA editing system, for example, an RNA ligase and / or a trans-splicing tool. In some aspects, the method can further include providing to the subject a target gene for insertion into the cleaved genomic DNA.DNAZYMES THAT REGULATE GENE EXPRESSION

[0177] In some aspects, disclosed herein is a DNAzyme including: a substrate strand comprising a cleavage site; and an enzyme strand at least partially complementary to the substrate strand; wherein the enzyme strand is capable of cleaving the substrate strand at the cleavage site; wherein, when the substrate strand is cleaved, the cleaved substrate strand triggers upregulation or downregulation of expression of a nucleic acid encoding a target protein.

[0178] In some aspects, the nucleic acid encoding the target protein can be a naturally occurring gene. In other aspects, the nucleic acid encoding the target protein can be a non- naturally occurring vector.

[0179] In some aspects, the substrate strand can be sRNA or shRNA targeting the nucleic acid sequence encoding the target protein; and cleavage of the substrate strand can deactivate the sRNA or shRNA such that said sRNA or shRNA can no longer block expression of the target protein.

[0180] In some aspects, the target protein can provide a detectable signal. For example, in some aspects, the target protein can be fluorescent. In some aspects, the target protein can be eGFP or mRuby. Additionally or alternatively, in other aspects, the target protein can have a therapeutic effect.

[0181] In some aspects, the enzyme strand can be capable of cleaving the substrate strand at the cleavage site in the presence of a target molecule (e.g., the DNAzyme can be a DNA aptazyme). In some aspects, the target molecule can be Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+, or Cr3+Attorney Docket No. 10046-678W01

[0182] In some aspects, also disclosed herein is a method of upregulating or downregulating expression of a target protein in a sample, subject, or system, the method including: providing to the sample, subject, or system any of the disclosed DNAzymes; wherein the DNAzyme is capable of triggering upregulation or downregulation of expression of a nucleic acid encoding the target protein; and wherein the sample, subject, or system includes the nucleic acid encoding the target protein.

[0183] In some aspects, the sample can be a cell, tissue, cell lysate, or a biological fluid.

[0184] In some aspects, the subject can be a human, animal, or plant. In some aspects, the system can be an environmental system or an industrial system.

[0185] In some aspects, the nucleic acid encoding the target protein can be a naturally occurring gene. In other aspects, the method can further include administering a non-naturally occurring vector encoding the target protein to the sample, subject, or system.

[0186] In some aspects, for example, when the enzyme strand is capable of cleaving the substrate strand at the cleavage site in the presence of a target molecule, the sample, subject, or system can include the target molecule before the DNAzyme is provided. For example, in some aspects, this can allow the DNAzyme to respond to fluctuations of the target molecule within the sample, subject, or system to provide more or less DNAzyme activity (and, subsequently, more or less gene regulation) as is needed (e.g., more target molecule causes more DNAzyme activity and more gene regulation, less target molecule causes less DNAzyme activity and less gene regulation).

[0187] In some aspects, for example, when the enzyme strand is capable of cleaving the substrate strand at the cleavage site in the presence of a target molecule, the method can further include administering the target molecule to the sample, subject, or system. For example, in some aspects, the method can be used to express the target protein only upon administration of the target molecule, for example, for induced expression of fluorescent proteins or other products.

[0188] In some aspects, the subject can be a human or animal, and the method can be used to express the target protein only if the target molecule is present. For example, this can be used to express a therapeutic target protein only if the target molecule is present (e.g., if the target molecule is indicative of a disease or disorder). As another example, this can be used to express a detectable target protein only if the target molecule is present (e.g., to determine the presence, absence, or quantity of the target molecule).

[0189] In some aspects, the subject can be a plant in soil, and the method can be used to express the target protein only if the target molecule is present in the soil. For example, thisAttorney Docket No. 10046-678W01can be used to respond to changes in soil metals in response to drought, nutrient deficiency, or pathogen exposure.

[0190] In some aspects, the system can be an environmental system or an industrial system, and the method can be used to express the target protein only if the target molecule is present in the environmental system or industrial system.

[0191] In some aspects, the method can occur in vivo, in vitro, or ex vivo.

[0192] In some aspects, also disclosed herein is a method of detecting a target molecule in a sample, the method including: providing to the sample any of the disclosed DNAzymes; wherein the enzyme strand is capable of cleaving the substrate strand at the cleavage site in the presence of a target molecule; wherein the DNAzyme is capable of triggering upregulation or downregulation of expression of a nucleic acid encoding a target protein; wherein the sample includes the nucleic acid encoding the target protein; wherein the target protein provides a detectable signal upon cleavage of the substrate strand; and detecting presence or absence of the detectable signal, thereby indicating presence or absence of the target molecule in the sample.

[0193] In some aspects, the target protein can be fluorescent. For example, in some aspects, the target protein can be eGFP or mRuby.

[0194] In some aspects, the sample can be a cell, tissue, cell lysate, biological fluid, an environmental sample, or an industrial sample.

[0195] In some aspects, the method can further include administering a non-naturally occurring vector encoding the target protein to the sample.

[0196] In some aspects, the method can occur in vivo, in vitro, or ex vivo.EXAMPLESExample 1: Native adenosine aptamer in the human genome regulates gene expression under the control of target-binding events

[0197] Gene expression is under multiple layers of controls, including but not limited to transcriptional-, translational-, and post-transcriptional / translational- regulations. In these processes, regulatory elements that code inside both genomic DNA and mRNA sequences play critical roles in regulating gene expression. Primary examples of such kind of regulatory elements in the genomic DNA include cis- or trans-regulatory elements, such as promoters, enhancers, or other conserved motifs, which are specific DNA sequences that can be recognized and bound by related transcriptional factors. The specific interaction between the regulatory elements and the transcriptional factors can either initiate or suppress gene transcription. Similar mechanism also exists in mRNA, in which some specific sequences canAttorney Docket No. 10046-678W01be recognized by protein factors and control the degradation or translation of the mRNA. In addition to the protein transcriptional factors, small metabolites or metal ions also play a critical role in regulating gene expression. These metabolites and metal ions can act as energy resources for transcriptional factors or serve as essential components for metalloenzymes. They can also regulate gene expression by interacting with specific DNA or mRNA sequences, such as a metal -responsive element, and regulate the interactions between protein regulators and mRNA or DNA. A special type of small metabolites- and metal ion-based regulation relies on their direct interaction with metal ion- and metabolite- sensing RNA, riboswitches. The interaction between riboswitches and their small metabolites- or metal ion- targets induce conformation changes and consequently stimulate or inhibit the transcription and translation of the mRNA. However, whether a similar regulatory mechanism exists natively at the DNA level remains unclear.

[0198] Although most of the genomic DNA is in the form of double-stranded DNA, long single-stranded DNA regions were identified in the human genome during replication, transcription, or disease status. These single-stranded DNA regions can form specific DNA structures, such as DNA triplexes, G-quadruplexes (G4s), and i-motifs, which are important to genome stability and involved in the regulation of gene expressions. For example, G4 can form spontaneously with DNA sequences that contain runs of adjacent guanosines and disturb the conformations of the double-helical structure. 'The formation of G4 during transcription of replication was observed by ChlP-seq, which utilizes a G4 antibody to sequence the region containing the structure in the genome. They are mostly enriched in the gene promoters and telomeres regions. More importantly, the formation of the G4 structure may stimulate gene transcription as demonstrated in a synthetic system. The formation of those secondary structures can be regulated by metal ions and small metabolites. For example, the interaction between metal complex and G4 can stabilize the conformation of G4, and serve as a target of anticancer therapeutics. Metal ions and small metabolites can also interact with DNA and change the structure of DNA sequences. The formation of those structures can interfere with the progress of DNA polymerase and impede gene expression, causing DNA damage and genomic instability. For example, RecQ helicase-like protein binding to the G4 showed a regulatory role in Bloom syndrome, an autosomal recessive disorder. On the complementary strand of G4, the DNA sequence that contains runs of cytidine can form a tetrameric structure, i-motif. Small molecules that disrupt G4 DNA or regulate the formation of i-motif structures regulate gene expression, indicating that both DNA structures are involved in the regulation of gene expression. Thus, structured single-stranded DNA has the potential to regulate geneAttorney Docket No. 10046-678W01expression with its conformation changes. However, these structures, such as G4s and i-motifs, are not specific to certain targets. Instead, their interaction relies more on the formation of a specific structure.

[0199] Similar to riboswitches, some of these bindings can cause conformational changes in DNA sequences. Thus, it was hypothesized that they may also have the potential to regulate gene expression. However, most of the current research on DNA aptamers focuses on in-test-tube identification and cellular or in vivo applications. The in-test-tube identification utilizes a process of systematic evolution of ligands by exponential enrichment (SELEX). During the SELEX process, around 1014-1015 random DNA sequences were amplified with PCR and selected against specific targets for multiple rounds until the population was enriched for the desired target. Researchers used this method to generate over 2000 aptamers during the past 30 years.

[0200] To understand the genome regulatory elements, genomic SELEX was applied to discover unexpected molecule interactions or regulatory elements with RNA and genomic DNA. However, these reported SELEX methods mostly used RNA as the initial library and focused on identifying RNA targets for the splicing factor and RNA-RNA interactions. Interestingly, through the selection from an RNA library, a GTP-binding motif was identified and found to exist in the genomic DNA of multiple species. However, the binding could be caused by the structural interactions between guanines and the G-vacancy of G4 instead of aptamer and target interactions. More importantly, the case that DNA and RNA aptamers share the same sequence is infrequent and thus not generalizable for identifying other genomic DNA aptamers. A few studies used genomic DNA as the initial library for SELEX but focused on identifying DNA targets for transcriptional factors. This may be because most of the genome sequences are double-stranded and do not match the nature of a DNA aptamer, which is single¬ stranded DNA. Thus, to the best of knowledge, DNA aptamer towards specific small molecules that exist in the human genome and can regulate gene expression has not been reported yet.

[0201] With the recent studies that prove the existence of single-stranded DNA and structures in the human genome, it was hypothesized that it is possible to identify aptamers in these single-stranded regions of the human genome. To test if DNA aptamer sequences can exist in the human genome and regulate gene expression by binding to their target, the study searched the sequence of existing DNA aptamers in the human genome with NCBI-BLAST. A sequence was found that is similar to the adenosine aptamer inside the intron region of SLC25A13, which encodes Citrin, a mitochondrial membrane transporter protein that transports glutamate and aspartate in response to calcium binding. The study tested the bindingAttorney Docket No. 10046-678W01with Isothermal Titration Calorimetry (ITC) and observed binding between adenosine and the aptamer sequence under physiological conditions. The study further tested how the interaction between the aptamer region and adenosine influences gene transcription with an in vitro transcriptional assay. The study constructed a plasmid containing spliced GFP and the aptamer sequence inside the intron and observed the regulation of fluorescence intensity under different concentrations of adenosine in mammalian cells. To further confirm their native function in the human genome, the study generated mutated cell lines with mutations in these aptamer regions using the CRISPR / Cas9 system. qPCR was performed to compare the gene expression between native and mutated cells. The study also compared the gene expression of SLC25A13 in the presence of additional adenosine and observed higher gene expression in mutants and cells. These results provide evidence of the existence of aptamer sequences in the human genome and support the existence of a new mechanism, deoxyriboswitch, for regulating gene expression at the transcriptional level by interacting with their small molecule targets.Materials and MethodsCell Lines and Media: HEK293T, HeLa, HCT, and HepG2 cell lines were used in this study. Similar results were observed with different cell lines. In the presented work, the plasmids assay was performed with HEK293T cells, while the qPCR assays were performed with HepG2 cells. HCT cells were cultured with McCoy's 5A media, HeLa and HEK293T cells were cultured with DMEM media, and HepG2 cells were cultured with EMEM media. The cell culture maintenance followed the standard culturing protocol. Point-mutated HepG2 cells were generated with CRISPR / Cas9 -based genome editing and a guide RNA with the sequence of SEQ ID NO: 33. Ribonucleoprotein (RNP) was transfected into cells to introduce a cut near the mutation site. After the cleavage, homology templates were provided to generate point mutations through homologous recombination. Mutations were identified with LongAmp Taq DNA polymerase with an annealing temperature of 60 °C. The amplicon is 1602 bp in size for wild-type cells and 1603 bp in size for the mutated cell line. Sanger sequencing was performed with the sequencing primer to confirm the point mutations. PCR primers and sequencing primers are listed in TABLE 1 (Huizenga ATP aptamer: SEQ ID NO: 34). The top 10 off- target sites were validated, and no off-target mutations were identified. The cell line before mutagenesis was used as a wild-type control for the experiments.TABLE 1. Genome annotation of Huizenga aptamer matched regions.Attorney Docket No. 10046-678W01Attorney Docket No. 10046-678W01TABLE 2. Genome annotation of Huizenga aptamer matched regions.Attorney Docket No. 10046-678W01Attorney Docket No. 10046-678W01

[0202] Isothermal Titration Calorimetry (ITC): DNA sequences were ordered from IDT and purified with an Amicon® Ultra Centrifugal Filter. Both adenosine and DNA wereAttorney Docket No. 10046-678W01diluted in the nucleus environment mimicking buffer: 2.0 mM MOPS, 110 mM NaCl, 2.65 mM KCl, 10 mM MgCl2, 0.01 mM CaCl2, 9.5 mM Na2HPO4, and 0.01 mM ZnCl2at pH 7.4. A titration of adenosine into DNA sequences was performed, and the heat release was recorded. Data processing and calculations followed the standard protocol. When testing the binding of the double-stranded DNA, the forward and reverse strands are mixed at 1: 1 ratio in the nucleus mimicking buffer, and incubated at 95 °C for 5 min, then cooled down with a speed of 0.5 °C per 30 s until reached 25 °C. After this annealing step, the DNA was diluted to the desired concentration, and a titration of adenosine into the double-stranded DNA was performed with nano ITC.

[0203] Gel-based in vitro transcription assay: The aptamer sequence, including 500 bp upstream and downstream, was synthesized as gblocks and cloned into the PCRII Topo vector following the standard protocol. The plasmids were sequenced to confirm the sequence and the inserted direction. Plasmids with forward insertion were digested with Xhol to generate the linearized template for in vitro transcription. The in vitro transcriptions were performed using the NEB standard protocol for RNA synthesis. 100 ng DNA templates were used, and ATP was replaced with the same amount of 7-deaza-ATP. Master mixes were made for all the compounds without adenosine. 2x stock solution of Adenosine or analogous were made in water and adjusted to pH 7.0 with NaOH. Then the stock solution was mixed with other components for in vitro transcription. The systems were incubated at 37 degrees for 1.5 hr, and then a 1% agarose gel was run with the same loading amount to visualize the bands. The gels were stained with S YBR gold and imaged with a Biorad Gel Doc imaging system. The intensity of each band was quantified with Image Lab Software. The transcriptional products were normalized by dividing the intensity of the RNA product, by the intensity of the DNA template and were used for the comparison between treatments.

[0204] In vitro transcription assay in living ceils: A GPP plasmid, pEGFP-SLC25A13- in Iron, with an intron inserted at nucleotide 105 of EGFP cDNA was prepared by replacing the middle region of the p-globin intron with SLC25A13Adenosine sequence together with 445 bp of its upstream and downstream sequence. The artificial intron region kept 231 bp of the head and the tail regions of the P-globin intron, IVS2-654, to maintain the key compounds for splicing. The pEGFP-slc25al3-intron plasmid was prepared in two steps. First, an intermediate plasmid was prepared by assembling two PCR fragments using the NEBuilder HiFi DNA Assembly Kit (NEB). 'Hie first PCR fragment was generated using F-EGFP105-vec and R- EGFP105-vec as primers, and the pEGFP-Nl plasmid was used as the template. The pEGFP-N1 plasmid was assembled from EGFP-pBAD and dClover2-Nl plasmids. EGFP-pBAD wasAttorney Docket No. 10046-678W01a gift from Michael Davidson (Addgene plasmid # 54762; RRID: Addgene_54762), and dClover2-Nl was a gift from Michael Davidson (Addgene plasmid # 54538; RRID: Addgene_54538). The second PCR fragment was generated using F-EGFP105-ins and R-EGFP105-ins as primers and slc25al3-intron-EGFP-2 as the template. Then, the full pEGFP-slc25al3-intron plasmid was prepared using the Q5 Site-Directed Mutagenesis Kit (NEB) on the intermediate plasmid using F-slc25a13-intron-EGFP-1 and F-slc25a13-intron-EGFP-2 as primers to insert the high GC region. Mutated control plasmids were generated with an NEB Q5 site-directed mutagenesis kit, and the same mutation as the in-test tube in vitro transcriptional assay was generated. The sequence of the plasmids was confirmed with Sanger sequencing. The plasmids were then transfected into HEK293T cells with 4 h incubation with TurboFect. The cells were changed into DMEM with different concentrations of Adenosine after transfection and imaged overnight. The fluorescence intensity of GFP-positive cells was quantified with Image J and compared between groups.

[0205] qPCR analysis: Cells were cultured in 24 well plates and incubated with different concentrations of adenosine or its analogous for 4 hours before the RNA extraction. The pH of the chemicals was balanced to neutral pH according to the color of phenol red inside the EMEM media. RNA extraction was performed with the magnetic mRNA isolation kit from NEB Company (SI 550) and followed the standard protocol. The concentrations of RNA were detected with a nanodrop. 10 ng RNA was used per well to serve as the template. The qPCR was performed with iTaqTM Universal SYBR® Green One-Step Kit and the BioRad CFX96 Touch Real-Time PCR machine with three technical replicates. Reference genes were selected from published primer pairs, according to their stability under different chemical treatments. Negative control was reverse-transcriptase-free mRNA prepared together with the cDNA, which was used to observe cross-contamination or genomic DNA contamination. A standard curve was performed before each experiment to decide the proper dilution for the cDNA template. At least three biological replicates were performed and quantified as the single data points on the graph for comparison between different genotypes and treatments. Relative expression of SLC25A13 was quantified as 2’AAQand normalized with the average expression of B2M, ACTB, and GAPDH, which were used as the reference.

[0206] Statistical analysis and imaging processing: To compare the differential expression between groups, an unpaired Student's t-test was used to compare the differences between two individual groups. For the comparison between genotypes with different treatment concentrations, a two-way ANOVA was used to estimate the differences and interactionsAttorney Docket No. 10046-678W01between variations. *, p<0.05; **, p<0.01; ***, p<0.001. Individual figure panels were generated with GraphPad 5.Results and Discussion

[0207] Identify DNA aptamer sequences in the human genome: To identify the potential existence of DNA aptamers in the genomic DNA, the sequences of DNA aptamers were collected in DNA aptamer databases, and searched for their presence in the human genome sequence database using NCBI standard nucleotide BLAST blastn. The expectation threshold was set to be 0.05 for the sequence matches and picked all the sequences that showed > 90% matches. The search found several genes or loci containing sequences that are similar to the adenosine aptamer. These aptamer-like sequences are located in their intron or intergenic region. The study further narrowed down the candidates by annotating them with their biological functions and found that SLC25A13 (SEQ ID NO: 35) and MY07A (SEQ ID NO: 36) (FIG. 1A) are associated with proteins that have been annotated with adenosine-associated functions. Therefore, it was hypothesized that they may bind to adenosine and that their functions may be regulated by adenosine.

[0208] Since the aptamer-like sequences of SLC25A13 and MY07A are shorter than that of the original adenosine aptamer (SEQ ID NO: 34) and have mismatches (see FIG. 1A), the study tested if they can bind to adenosine using ITC in 0.9x dPBS buffer. By titrating 50 pM SLC25A13 DNA into 5 mM adenosine, a binding with a Kd of 438.6 ± 11.2 pM (FIG. 4B) was observed. However, when the same binding assay was carried out for MY07A, the study did not observe any binding (FIG. 4C). Therefore, the study investigated SLC25A13 (called SLC25A13Adenosine) in the following experiments.

[0209] Adenosine can regulate in vitro transcription of DNA containing SLC25A13Adenosine sequence: To test if the binding between SLC25A13 and adenosine can regulate transcription of the DNA containing SLC25A13 sequence, the study cloned the DNA containing this sequence as well as 500 bp of upstream and downstream of this sequence in the human genome and a T7 promoter (FIG. 1A) into a pCRII-TOPO vector. The study evaluated adenosine-dependent transcription of this DNA using an in vitro transcriptional assay. The inserted sequence and its orientation were confirmed by Sanger sequencing. The plasmid with a forward insertion was linearized by Xhol digestion and purified to serve as the DNA template for the in vitro transcription assay. However, adenosine triphosphate (ATP), which is required as a building block and the energy source for the in vitro transcription, can complicate the investigation of the regulatory effect of SLC25A13 upon binding to adenosine because the ATP can also bind to SLC25A13Adenosine. To address this issue, ATP was replaced with 7 -deazaAttorney Docket No. 10046-678W01ATP (FIG. IB), which has been used to synthesize neonatal RNA and can serve as an alternative building block and energy resource for transcription. More importantly, even if 7-deaza ATP is similar to ATP, it does not bind to the adenosine aptamer. Therefore, the 7-deaza ATP can support transcription while having minimal effect on the binding between adenosine and SLC25A13Adenosine. Using such a transcriptional system with ATP replaced with 7-deaza ATP, different amounts of adenosine were added to the system and compared the amount of RNA generated using an agarose gel. As shown in FIGS. 1C-1D, with increasing concentration of adenosine, the amount of in vitro transcribed RNA product decreased when the template contained SLC25A13Adenosine. In contrast, adding inosine, which has a similar structure to adenosine but is not able to bind to the aptamer region, resulted in minimal change in the amount of RNA generated from the in vitro transcription system (FIGS. 1C-1D). To further validate this finding, the same assay was carried out except that point mutations were introduced to SLC25A13Adenosme to disrupt its ability to bind ATP (FIG. 1A), followed by the mutagenesis study that was performed by Huizenga et al. (A DNA Aptamer That Binds Adenosine and ATP. Biochemistry 1995, 34 (2), 656-665). It was found that the amount of RNA generated by the in vitro transcription system did not change significantly when the same amount of adenosine was added to the system (FIGS. 1E-1F). These observations indicate that SLC25A13Adenosine may bind adenosine and downregulate gene transcription.

[0210] The SLC25A13Adenosine regulates gene expression: Encouraged by the results that the SLC25A13Adenosine can regulate in vitro transcription in the presence of adenosine, the study- tested if SLC25A13Adenosine could also regulate gene expression when located in an intron region since it is natively located in the intron of the SLC25A13 gene. The study inserted the DNA containing this sequence as well as 500 bp of its upstream and downstream sequences into the intron of the EGFP-intron reporter system at nucleotide 105 of EGFP cDNA (FIG.2A). The EGFP-intron reporter and the inserting position were used to test the intron splicing event and did not interrupt the expression of GFP. GFP expression was observed after delivering tills plasmid into HEK293 cells (FIG. 2B, 0 mM compared with no plasmid). To test if adenosine can regulate the GFP expression with this SLC25A13Adenosine in the intron of EGFP, the cells were incubated with different concentrations of adenosine and observed a concentration-dependent inhibition of the GFP signal (FIGS. 2B-2C). This observation indicates that the SLC25A13Adenosine may be able to serve as a regulatory element inside the intron of a gene. Additionally, the regulation may be related to adenosine and aptamer binding. To test this hypothesis, the cells were incubated with 5 mM adenosine, cytidine, guanosine, and thymidine, respectively, and observed that only adenosine inhibits the expression of GFPAttorney Docket No. 10046-678W01(FIGS. 2D-2E). Noticeably, the guanosine slightly reduced the expression of GFP, but the reduction was not significant. This disruption could be related to the interaction between guanine and G-vacancy G4 structure since the adenosine aptamer contains two stacked G4. To further confirm that it was the SLC25A13Adenosme that interacted with adenosine, the same mutations were introduced to interrupt the binding site. The cells that transfected with plasmids that contained the mutated sequence (FIG. 2A, Mutant) showed a significantly higher fluorescence signal than the cells transfected with plasmids that contained the native SLC25A13Adenosme (FIGS. 2F-2G, Mutant 0 niM compared with Wildtype 0 mM). This observation indicates that intrinsic adenosine can bind to the SLC25A13Adenosine and reduce gene expression. Furthermore, the study incubated cells that were transfected with the plasmids that contain SLC25A13Adenosine or the mutated SLC25A13Adenosme with different concentrations of adenosine and observed a significantly lower fluorescence signal in the cells that transfected with plasmid that contains SLC25A13Adenosine than the cells that transfected with plasmid contains mutated SLC25A1 ^Adenosine (FIGS. 2F-2G). These observations indicate that the expression of GFP was regulated by the interaction between adenosine and the SLC25A13Adenosine.

[0211] The SLC25A13Adenosine regulates the expression of SLC25A13 in living cells: To test if the SLC25A13Adenosine can regulate the expression of SLC25A13 by interacting with adenosine, a qPCR assay was performed to evaluate if adenosine incubation regulates the mRNA level of SLC25A13 in mammalian cells. The study used B2M, GAPDH, and ACTB as reference genes since their expression was most stable from 14 candidate reference genes that the study tested when the cells were incubated with different concentrations of small metabolites including ATP and adenosine. The cells were incubated with 4 mM adenosine for 4 hours and compared the mRNA levels of SLC25A13 in the cells treated with adenosine and cells incubated in cell culture media. A significant decrease was observed in SLC25A13 when incubating the cells with adenosine (FIG. 3A). The study further compared the mRNA expression levels of SLC25A13 when incubating the cells in cytidine, guanosine, thymidine, and inosine and observed a significant decrease in SLC25A13 mRNA level when incubated the cells with only adenosine but not other nucleosides (FIG. 3B). This observation indicates that the decrease of SLC25A13 was induced by adenosine. To confirm if this regulation is related to the concentration of adenosine, the study compared the expression of SLC25A13 when incubating the cells with different concentrations of adenosine and observed a concentration-related decrease of SLC25A13 gene expression (FIG. 3C). When the concentration of adenosine is higher than 0.5 mM, the expression of SLC25A13 did not furtherAttorney Docket No. 10046-678W01decrease, which indicates that it may reached the maximal amount of adenosine that the genome aptamer can respond to.

[0212] To validate if it is the SLC25A13Adenosme that responded to the adenosine-induced gene expression changes, a cell line was generated that contained the same point mutations that were tested in earlier experiments in the SLC25A13Adenosine (FIG. 3D) using the CRISPR / Cas9 system. When comparing the mRNA levels of SLC25A13 in the wild-type cells and mutated cells with qPCR assays, a significant increase of SLC25A13 was observed in the mutant (FIG. 3E). These results suggest that the endogenous adenosine may interact with the aptamer sequence located in the intron of SLC25A13 and regulate the expression of the gene. To confirm this assumption, the cells were incubated with 4 mM adenosine and observed significant decrease of SLC25A13 in wild-type cells but not mutated cells. Moreover, when the cells were incubated with inosine, minimal changes were observed in SLC25A13 in both cell lines (FIG. 3F). The study further compared the mRNA levels of SLC25A13 under different concentrations of adenosine and found that with 0.5 mM of adenosine, the expression of SLC25A13 decreased significantly in the wild-type cells but not the cells with mutated SLC25A13Adenosme. With an increasing amount of adenosine, the expression of SLC25A13 significantly decreased in wild-type cells but only slightly reduced in the mutated cells. According to the two-way ANOVA assay, the expression of SLC25A13 responds to adenosine is significantly different between wild-type and mutated cell lines (FIG.3G). 'This observation further suggests that the interaction between the aptamer-like sequence and adenosine is one of the mechanisms that regulate the expression of SLC25A13.Conclusion

[0213] A riboswitch has been identified that can recognize small metabolites and metal ions, and serve as a regulatory element inside of the mRNA sequence. In comparison, DNA aptamers that have similar abilities to recognize specific targets were yet identified from the genome. Herein, the study identified an adenosine aptamer in the intron of SLC25A13. With ITC binding assay, in vitro transcription assay, testing the regulatory effect of the EGFP reporter, and qPCR assay for the SLC25A13 gene expression, the study provided evidence that the aptamer region may bind to adenosine and downregulate the expression of SLC25A13. This may be a new mechanism by which cell metabolites regulate gene expression by interacting with the genome sequence. To this end, the observations of this study revealed a potential existence of deoxyriboswitches within the genome, which can regulate gene transcription under the control of specific metabolites.Attorney Docket No. 10046-678W01Example 2: A Natural DNAzyme: Discovering a novel, RNA-cleaving metalloenzyme in the biological system

[0214] The field of synthetic DNAzymes has made substantial strides in recent decades, yet published research on naturally occurring functional DNA, specifically with enzymatic function, does not yet exist, to the best of knowledge. Recent developments in the sequencing methods of ultrashort cell-free DNA (uscfDNA) have uncovered the existence of naturally occurring single-stranded DNA fragments in a size range that reflects synthetic DNAzymes that have been identified through in vitro selection. In this work, the existence of an 8-17 DNAzyme in the native human biological system has been identified from uscfDNA. Furthermore, this native DNAzyme cleaves a native microRNA substrate under physiological conditions. This discovery marks the introduction of a new class of metalloenzymes in the native human system. It reveals new' biology by which a DNAzyme including uscfDNA cleaves a microRNA substrate under physiological conditions. Ultimately, this work opens the door for researchers to explore previously unknowm biological functions of DNA and its role(s) in human biology and disease pathology.Introduction

[0215] While the field of the identification and applications of synthetic DNAzymes has seen great progress in the past few decades, one long-standing biological question remains: could DNAzymes exist in nature? As such, here the study identifies naturally occurring DNA sequences that harbor the ability to perform functions in the presence of metal ions, such that they demonstrate catalytic properties, as opposed to DNA’s ubiquitous natural role as genomic material.

[0216] Deoxyribozymes, or DNAzymes, are a class of functional nucleic acids that possess the ability to perform enzymatic functions. In the presence of a metal cofactor, the single¬ stranded DNAzymes form complex secondary and tertiary structures that catalyze numerous reactions, the most common of which is RN A cleavage. Until now, DNAzymes have only been obtained through the process of in vitro selection, in which random pools of synthetic DNA molecules are cycled through iterative selection rounds to identify sequences that perform a desired catalytic function with a specific metal cofactor. To identify the first non-synthetic, RNA-cleaving DNAzyme that exists naturally in biological systems, the study has developed and applied an experimental method that utilizes bioinformatics rather than in vitro selection to investigate the functions of ultra-short single-stranded cell-free (cf) DNA. This methodology combines bioinformatics with in vitro experiments to identify the first naturally occurring RNA-cleaving cfDNAzyme and its microRNA target. MicroRNAs can modulate geneAttorney Docket No. 10046-678W01expression through numerous mRNA targets. Therefore, a cfDNAzyme has the potential to indirectly influence gene expression by inactivating microRNAs and interfering with the microRNA-mRNA interaction. Specifically, in a system that contains biologically relevant metal ions at a physiological pH and temperature, the cfDNAzyme will cleave the microRNA target, inhibiting the downstream gene expression change that would be otherwise mediated by the target microRNA. The indirect cfDNAzyme-mediated gene expression has implications for understanding new biological pathways, as well as diagnostic and therapeutic applications involving cfDNA and microRNA. The discovery of a naturally occurring RNA-cleaving cfDNAzyme and its microRNA target introduces the existence of a new class of metalloenzymes in the human biological system. Moreover, this work enables further investigation into new potential diagnostic and therapeutic roles of cfDNA and corresponding RNA targets. The identification of a new class of metalloenzymes, the natural DNAzyme, opens the door for researchers to explore previously unknown biological functions of DNA, and its role(s) in human biology and disease pathology.Results and Discussion

[0217] Bioinformatics reveals the existence of an 8-17 DNAzyme in the human biological system and its potential target: The initial set of DNAzyme sequences used as the basis for the cfDNAzyme search included published DNAzyme (catalytic core only) sequences which both catalyzed RNA cleavage and required Mg2+, Ca2+, Na+and / or K+cofactor(s). The target molecules can be Mg2+, Ca2+. Na+, K+, Fe2+, Fe3+, Cu1+, and / or Cirh for example:K10-9, 50nt, SEQ ID NO: 37, K+, unpublishedCui Dz, 6 nt, SEQ ID NO: 38, CuF+, 10.1016 / S1074-5521(96)90170-2 and 10.1021 / ja0717358Cu2 Dz, 8 nt, SEQ ID NO: 39, Cu2+10.1021 / acs.analchem.5b04904

[0218] This sequence data was collected using the DNAzyme database, DNAmoreDB, and resulted in a set of 78 DNAzyme sequences previously identified through the process of in vitro selection (TABLE 3). In addition to creating a specific search input set, the search database was also carefully selected from recently published ultrashort single stranded cell free DNA (uscfDNA) sequencing data (SR A: SRX 15203068). BLAST searches using the BLASTN algorithm were conducted to compare the initial set of 78 DNAzymes with the uscfDNAAttorney Docket No. 10046-678W01sequencing data. These searches yielded a single 100% match to the 14 nucleotide 8-17 sequence, several partial matches to the 8-17 and 10-23 sequences, and very few or no matches to query sequences > 20nt, even under less stringent BLAST search parameters (FIG. 5A). TABLES 4-9 show results of the bioinformatics searches and sequences used in biochemical assays. The most promising of the results, the 100% match to the original 8-17 DNAzyme (hereafter referred to as 8-17G) sequence alignment was then extended beyond the alignment sequence of interest to include approximately 10 nucleotides on both the 5 prime and 3 prime flanking regions of uscfDNA sequence data. In theory, this created the substrate binding arms, the length of which achieved two goals: 1) matched the length of the ideal natural target substrate, miRNA (~21nt); and 2) had Tms that would allow for DNAzyme enzyme-substrate duplex formation at a physiological temperature (FIG. 6A). A perfectly complementary all-RNA substrate was designed based on this 8-17G 33nt sequence, including a rG-rG cleavage junction and a rG-dT wobble pair immediately downstream of the cleavage site, as required by the canonical 8-17 sequence (FIG. 5B). To determine whether a natural version of the 8-17G substrate existed, miRNA substrates native to the human biological system were assessed using the microRNA database, miRbase, with the engineered all-RNA substrate as the query input and results filtered to mature miRNAs of homo sapiens origin. Of the 8 alignments returned (FIG. 9), one alignment possessed the greatest potential as a natural substrate: hsa-miR-6865-5p (miR6865) (FIGS. 5C, 5D, 6A) which was used for further testing.TABLE 3. Complete Initial Search Set of DNAzyme Sequences.Attorney Docket No. 10046-678W01Attorney Docket No. 10046-678W01Attorney Docket No. 10046-678W01Attorney Docket No. 10046-678W01TABLE 4. Final Search Set of DNAzyme Sequences by Filtering Strategies.TABLE 5. Final Search Set of DNAzyme Sequences by Filtering Strategies.Attorney Docket No. 10046-678W01TABLE 6. Complete uscfDNA alignment results. BLASTN query: SEQ ID NO: 40. Length: 14 nucleotides. SRA search experiment set: SRX15203068. Alignments: 8 results with 14 / 14 match. Corresponding alignment is plus / plus: SEQ ID NO: 40. Corresponding alignment in plus / minus: SEQ ID NO: 117.Attorney Docket No. 10046-678W01TABLE 7. Additional uscfDNA alignment results.Attorney Docket No. 10046-678W01TABLE 8. Sequences in Activity Assay Set 1 (negative results) (underline = binding arm regions).Attorney Docket No. 10046-678W01TABLE 9. Initial miRNA alignment result summary (GA cleavage junction) (underline = binding arm regions).

[0219] Assessment and comparison of 8-17G activity with artificial and natural RNA substrates: Predicted secondary structures and Tms for both the artificial and natural substrates were evaluated using IDT’s UNAfold tool. Encouragingly, despite miR6865 not having full complementarity to the 8-17G binding arms, the predicted structure and Tms were consistent with those of the artificial substrate (FIG. 6A). In gel-based activity assays, 8-17G showedAttorney Docket No. 10046-678W01cleavage with the artificial substrate under all experimental physiological mimics (extracellular and intracellular buffers) and positive control conditions (500 uM Pb2+’ 2.5mM Mg2" 2.5mM Ca2+) and no cleavage under the no metal, negative control condition (150 mM Tris, pH 7.4) (FIG. 6B, left). When annealed with miR6865, 8-17G showed similar cleavage patterns with the exception of the 2.5mM Mg2+and intracellular mimic conditions (FIG. 6B, right). The experiment was repeated using a concentration of Mg2+that matched the intracellular Mg2+concentration (5 mM), and loading extra sample to the gel to better resolve the results. These results showed partial cleavage under both conditions (FIG. 6D). Given these results and the composition of the extracellular and intracellular mimic solutions, Ca2+was determined to be the cofactor responsible for the majority of the cleavage under physiological conditions, with some contribution from Mg2+. More specifically, 8-17G + miR6865 is active in the presence of extracellular levels of Ca2+(2 mM) and intracellular levels of Mg2+(5 mM), but is more active with Ca2+(control activity: Pb2+> Ca2+> Zn2+> Mg2+) (Fig. 6B-6D). In addition to cleavage assays, the stability of the enzyme and substrate strands was also assessed. Both strands remained stable at 37°C for 72. hours showing minimal degradation when evaluated by 10% denaturing PAGE.

[0220] Fluorescence studies validate activity under physiological conditions: Given the promising results of the PAGE-based activity assays, fluorescence-based assays were performed to validate the previous data and provide more insight into the cleavage occurring under physiological conditions. A sensor version of the 8-17G + miR6865 cfDNAzyme was designed by adding a fluorophore to the 5 prime end of the miR6865 strand and a quencher to the 3 prime end of the 8-17G strand. When uncleaved and in duplex form, the fluorophore would be quenched because of proximity but once cleaved, both substrate portions would dehybridized from the complex due to the two fragments having Tms < 37°C, and result in a fluorescence turn-on (FIG. 7A). These studies were carried out using a plate reader for up to 48 hours. Results indicate that cleavage indeed occurs in both the extracellular and intracellular conditions and validated the data previously observed in the gel-based assays (FIGS. 7B-7C). Interestingly, while 8-17G did not cleave miR6865 under Na+or K+conditions, cleavage was abundant under 150 mM Li+(FIG. 7C). This is likely due to the similarity of Li+and Mg2+ions, in addition to the high concentration of Li+used in the experiment.

[0221] Cell studies and miR6865 target prediction to survey 8-17G and miR6865 biological functions: In an effort to gain an understanding of the biological function of the 8- 17G cfDNAzyme in the native system, cell studies were carried out. Importantly, the function of the natural 8-17G substrate, miR6865, is unknown. No literature currently exists on thisAttorney Docket No. 10046-678W01particular miRNA aside from that which establishes its existence. Therefore, to understand the function of the 8-17G cfDNAzyrne, the potential function(s) of the miR6865 substrate required investigation. To this end, HeLa cells were transfected with a combination of miR6865, miR6865 antisense, 8-17G, and / or inactive 8-17G. After which, total RNA was extracted and purified and RT-qPCR was performed to evaluate the expression of predicted miR6865 targets under each experimental condition (FIG. 8A). In general, the results indicate that miR6865 increases target gene expression while miR6865 + 8-17G decreases target gene expression, whereas miR6865 + 8-17G inactive is similar to miR6865 alone, and miR6865 antisense induces almost no change. Furthermore, the additional conditions with miR6865 antisense do not reflect those of miR6865 (FIG. 8B). These results present promising insight into the biological function of the 8-17G cfDNAzyrne and a new interplay between cfDNA and miRNA.Conclusion

[0222] In this work, the first DNAzyme native to the human biological system has been identified through bioinformatic methods, 8-17G. Not only is this DNAzyme active under physiological conditions with an ideal, “perfect” all-RNA substrate, but it is also active in the presence of a native all-RNA substrate, niiR6865. Given the small size and robustness of the 8-17 DNAzyme across in vitro selections, it seems serendipitous that this particular 14 nucleotide sequence is present in the native system as well. A long-standing concern in identifying a natural DNAzyme has been the question of how a short, single stranded portion of DNA could exist. However, with its utility as a biomarker in liquid biopsy testing, recent advances in sequencing technology specifically geared towards cfDNA, have established the existence of uscfDNA: short, single stranded cell free DNA - a prime candidate for the natural occurrence of DNAzyme within the native human biological system. Future research into the cfDNAzyrne, 8-17G, and its target, miR6865, identified in this work should focus on uncovering the complete biological story of this native system. Comprehensive target prediction studies should be carried out on miR6865 to fully understand the role(s) of the 8-17G cfDNAzyrne. The abundance of publicly available data has made bioinformatics an invaluable tool and has allowed the first naturally occurring DNAzyme, endogenous to the human biological system, to be identified. This discovery has substantial and broad implications for the new biology to be revealed by a class of native metalloenzymes, the function of cfDNA, and the interplay between cfDNA and miRNA.Attorney Docket No. 10046-678W01Materials and Methods

[0223] Materials: All DNA and RNA sequences used in this work were obtained from Integrated DNA Technologies (IDT) and purified by 10% denaturing polyacrylamide gel electrophoresis upon receipt. DNase- and RNase-free techniques were utilized in all experimental steps to avoid the contamination and / or degradation of sequences. Buffers, metal stocks, and working solutions were prepared using chemicals from Sigma Aldrich, Thermo Fisher, and Fisher Scientific. Sequence databases and search tools used to carry out bioinformatics studies in this work include DNAmoreDB, a database of DNAzymes, SRA search experiment set SRX15203068, the National Center for Biotechnology Information Basic Local Alignment Search Tool (NCBI BLAST), miRbase, miRDB, and The Human Protein Atlas. Instruments utilized in this work include Thermo Fisher Nanodrop, BioRad PCR and qPCR Thermal Cyclers, Benchmark heat block, BioRad GelDoc Imager and Plate Reader.

[0224] Cell studies were conducted using HeLa cells (ATCC) with Dulbecco’s DMEM (%FBS), Lipofectamine 3000 (Thermo Fisher), and incubation at 37°C, 5% CO2. RNAzoI (Thermo Fisher) was used to lyse cells and isolate total RNA, and NEB Monarch RNA Cleanup Kit to purify total RNA. RT-qPCR protocols were carried out using the High Capacity cDNA Reverse Transcription Kit without RNase Inhibitor (Thermo Fisher) and PowerUp S YBR Green Master Mix. Primers used in qPCR were obtained through IDT and purified using 3k Amicon Molecular Weight Cutoff spin columns.

[0225] Methods: Publicly available data was used to carry out all sequence-based bioinformatics studies. The initial set of DNAzyme sequences used as the basis for the cfDNAzyme search included published DNAzyme (catalytic core only) sequences which both catalyzed RNA cleavage and required Mg2+, Ca2+, Na+and / or K+cofactor(s). This sequence data was collected using the DNAzyme database, DNAmoreDB, and resulted in a set of 78 DNAzyme sequences previously identified through the process of in vitro selection (TABLE 2). In addition to creating a specific search input set, the search database was also carefully selected from recently published ultrashort single stranded cell free DNA (uscfDNA) sequencing data (SRA: SRX15203068). BLAST searches using the BLASTN algorithm were conducted to compare the initial set of 78 DNAzymes with the uscfDNA sequencing data. DNAzyme – uscfDNA sequence alignments were then extended beyond the alignment sequence of interest to include approximately 10 nucleotides on both the 5 prime and 3 prime flanking regions of uscfDNA sequence data. The extended sequences were submitted as the query to a secondary BLAST search where the human genome (taxid: 9606) was used as the database to validate sequence fidelity and origin. Natural, all-RNA substrates native to theAttorney Docket No. 10046-678W01human biological system were assessed using the microRNA database, miRbase, with the engineered all-RNA substrate as the query input and results filtered to mature miRNAs of homo sapiens origin. For cell studies, predicted miRNA targets were obtained using the miRDB target prediction database. The expression levels of predicted targets were then evaluated in HeLa cells using The Human Protein Atlas to determine the most appropriate targets for cell studies.

[0226] Gel-based activity assays using unmodified nucleic acid enzyme and substrate strands were performed in extracellular and intracellular buffer mimics, as well as control conditions. Enzyme and substrate strands were annealed in 150 mM Tris, pH 7.4, at an enzyme to substrate ratio of 1:2 with a final DNAzyme concentration of 2X. A thermal cycler was used for annealing with the following protocol. The annealed 2X DNAzyme and reaction solutions containing 10 uL 2X solutions were prewarmed separately to 37°C. 10 uL of 2X DNAzyme was then added to each of the 10 uL 2X reaction solutions and mixed by pipetting. 2 uL of the final reaction solutions were aliquoted at timepoints from 0 to 48 hours and quenched on ice in 10 uL of a stop solution. Quenched solutions were kept on ice to preserve samples until gel loading. 10% denaturing polyacrylamide gels were prepared using 40:1 bis:acrylamide, 1000X TEMED and 25% APS. Quenched samples were heated at 95°C for 5 minutes to ensure complete denaturation of the strands, and 10% dPAGE gels were pre-run at 26W for 30 minutes. 10 uL of each sample was loaded to the wells and the gel was run at 26W for 60 minutes. SYBR Gold nucleic acid stain was then used to resolve the assay results with a BioRad GelDoc Imager.

[0227] Fluorescence-based activity assays utilizing nucleic acid enzyme and substrate strands modified by quencher (lABkFQ) and fluorophore (FAM), respectively, were performed under the same reaction conditions (experimental and control buffers) with the same annealing protocol as described previously. The enzyme to substrate ratio for the fluorescence assays was 10:1, respectively, as enzyme-substrate titrations indicated this ratio provided the most consistent results with the least noise. 50 uL of 2X DNAzyme was added to 50 uL of each 2X reaction solution in black, flat-bottom 96-well plate, which was then loaded to a plate reader where a fluorescence reading (excitation: nm, emission: nm) was conducted every 60 minutes for 48 hours. Plate reader fluorescence experiments were conducted at 37°C with continuous double-orbital shaking. Each reaction condition was performed in triplicate and three independent experiments were conducted. The change in fluorescence intensity (F) over time was calculated by (F-Fo) / Fo where Fo was the fluorescence intensity at 2 hours. Between 0 hours and 2 hours, the DNAzyme is reaching an equilibrium in the system, consistent across all experimental and control conditions.Attorney Docket No. 10046-678W01

[0228] Cell studies were based on a published bio-protocol. HeLa cells were seeded in 6-well plates and grown to 80% confluency. Cells were then transfected with either 10 nM miRNA and / or 100 nM DNA for 48 hours using Lipofectamine 3000, following the manufacturer’s instructions. Transfected cells were then lysed by RNAzol, and total RNA was isolated following the manufacturer’s protocol. The isolated total RNA was then purified using the NEB Monarch RNA Spin-column Clean-up Kit and quantified by Nanodrop to ensure total RNA quality was acceptable for downstream RT-qPCR experiments (A260 / A280 = 2.0, A260 / A230 ≥ 1.7). Reverse transcription was performed according to the manufacturer’s protocol with 2 μg total RNA input. Quantitative PCR was performed according to the manufacturer’s protocol with 1 uL of reverse transcription product (cDNA) input. RT-qPCR data was analyzed by the ddCq method where β-actin served as the non-target reference gene. All conditions were performed in triplicate and three, independent biological replicate experiments were conducted.Example 3: The identification of a Natural RNA-cleaving DNAzyme and its miRNA Target by Bioinformatic Methods

[0229] Deoxyribozymes, or DNAzymes, are a class of functional nucleic acids that possess the ability to perform enzymatic functions. In the presence of a metal cofactor, the single¬ stranded DNAzymes form complex secondary and tertiary structures that catalyze numerous reactions, the most common of which is RNA cleavage. Until now, DNAzymes have only been obtained through the process of in vitro selection, wherein random pools of synthetic DNA molecules are cycled through iterative selection rounds to identify sequences that perform a desired catalytic function with a specific metal cofactor. To identify non-synthetic, RNA-cleaving DNAzymes that exist in biological systems, bioinformatics were utilized to search and predict published RNA-cleaving DNAzyme sequences from the library of single stranded cell-free (cf) DNA and validate their functions in miRNA cleavage. The discovery of a naturally occurring RNA-cleaving cfDNAzyme and its microRNA target introduces the existence of a new class of metalloenzymes in the human biological system. This experimental method enables further investigation of potential diagnostic and therapeutic roles of cfDNA and corresponding RNA targets.

[0230] The existence of naturally occurring ribozymes is well-established, and synthetic DNAzymes have been utilized for numerous applications within the biological system, but endogenous DNAzyme sequences, (e.g., cfDNAzyme) have not been previously identified. This work uses bioinformatics to search and predict potential existence of published DNAzymes in human genome. The cfDNAzyme introduces the existence of a new class ofAttorney Docket No. 10046-678W01metalloenzymes in the human biological system and also introduces a bioinformatics method for endogenous DNAzyme sequence identification, as well as RNA target identification. The bioinformatics basis of the cfDNAzyme discovery is built upon a database of published DNAzymes. This allows effective searching of potential cfDNAzyme and target RNA pairs based on their sequences complementation, prior to experimental testing. Regarding the cfDNAzyme and its microRNA target, specifically, further research will be required to investigate cfDNA function, as well as cfDNA- and small RNA-related diseases.

[0231] The disclosed methodology combines bioinformatics with in vitro experiments to identify the first naturally occurring RNA-cleaving cfDNAzyme and its microRNA target. In a system which contains biologically relevant metal ions at a physiological pH, the cfDNAzyme cleaves the microRNA target, changing downstream gene expression that is mediated by the target microRNA.

[0232] The cfDNAzyme has the potential to influence gene expression by inactivating miRNA functions. The indirect cfDNAzyme-mediated gene expression has implications for understanding new biological pathways, as well as diagnostic and therapeutic applications involving cfDNA and microRNA. The identification of a new class of metalloenzymes, the natural DNAzyme, opens the door to explore previously unknown biological functions of DNA, and its role(s) in human biology and disease pathology. The bioinformatic method disclosed facilitates this process.Example 4: Programmable microRNA regulation through metal-ion responsive DNAzyme cleavage of pre-miRNA

[0233] MicroRNAs (miRNAs) are critical post-transcriptional regulators of gene expression, with dysregulation implicated in diverse human diseases. Despite their importance as biomarkers for diagnostics and therapy, current technologies for modulating miRNA activity lack dynamic responsiveness to endogenous cellular signals, limiting their utility in complex biological contexts. To overcome these limitations, this study reports herein a DNAzyme-based platform that enables conditional, metal ion-dependent suppression of pre-miRNA maturation in mammalian cells. By engineering Zn2+- and Mg2+-responsive DNAzymes 8—17 and 10-23 to target precursor miRNAs (pre-miRNAs) and short hairpin RNAs (shRNAs), this study achieves dose-dependent cleavage of pre-miR-21. Target recognition is guided by Watson-Crick base pairing, enabling sequence programmability. This system results in reduced miRNA maturation and inhibition of cancer cell migration. This system is modular, functions across cell types, and responds to physiologically relevant metal ion concentrations. These findings establish a versatile framework for coupling metal ion availability to RNA-level geneAttorney Docket No. 10046-678W01regulation, offering a new strategy for programmable, context-sensitive control of miRNA function with broad applications in synthetic biology, biosensing, and therapeutic development.Introduction

[0234] MicroRNAs (miRNAs) are small non-coding RNAs, typically 15-27 nucleotides in length, that direct post-transcriptional gene silencing through the RNA-induced silencing complex (RISC), guiding mRNAs for degradation or translational repression. Their expression is precisely regulated across developmental stages and tissue types, and aberrant miRNA activity is implicated in a broad spectrum of human diseases, including cancer, cardiovascular dysfunction, and neurodegenerative and infectious disorders. Given their central role in gene regulation, miRNAs are widely studied as both disease biomarkers and therapeutic targets. Consequently, developing effective technologies that enable dynamic, context-dependent control of miRNA activity is crucial for mechanistic studies and therapeutic development.

[0235] To control miRNA expression for both mechanistic studies and therapeutic applications, several strategies have been developed, including transgenic models, synthetic miRNA mimics, viral overexpression systems, antisense oligonucleotides, CRISPR / Cas-based genome editing, miRNA sponges, and target protectors. While effective in modulating miRNA levels, most of these tools are constitutively active, lack tunability, and do not respond to endogenous cellular signals. This static mode of operation limits their utility in complex biological environments where miRNA function is dynamic and context- specific. In particular, existing approaches cannot provide conditional, signal-responsive control over miRNA biogenesis or function, despite growing evidence that miRNA expression displays tissuespecific patterns and is modulated by local regulators. This limitation reduces their effectiveness in dynamic or spatially heterogeneous biological environments.

[0236] Metal ions such as zinc and magnesium function as key biochemical signals and are tightly regulated across different tissues and physiological states. Their concentrations can vary in response to developmental stages, metabolic activity, or disease-associated stress, offering a potential regulatory modality for dynamic gene control. While aberrant metal ion levels have been correlated with changes in miRNA expression in certain pathological contexts, the direct use of metal ions as programmable inputs to control miRNA activity remains underexplored. Notably, no existing system harnesses elevated physiological or engineered levels of metal ions to trigger RNA-level regulation of miRNA biogenesis. This gap presents an opportunity to develop synthetic regulatory platforms that leverage metal ion availability as a tunable and modular control signal.Attorney Docket No. 10046-678W01

[0237] To address this unmet need, here this study presents a DNAzyme-based platform that enables metal-dependent downregulation of miRNA maturation in mammalian cells. DNAzymes are single-stranded DNA molecules with catalytically active sites that cleave RNAs in the presence of specific metal cofactors. DNAzymes can be obtained from a DNA library of 10 through in vitro selection. This selection system has been utilized to identify a range of DNAzymes responsive to various metals. These DNAzymes have been extensively studied for biosensing applications, such as metal ion sensing and microRNA detection. Among these, the 8-17 and 10-23 DNAzymes are well-characterized for their robust RNA cleavage activity in vitro and have recently shown intracellular efficacy against mRNA. However, applying DNAzymes to directly regulate microRNAs presents distinct challenges due to the short length, extensive secondary structure, and protein-bound nature of microRNAs in their native context. These obstacles have historically limited enzymatic strategies for microRNA modulation. In this study, these two canonical DNAzyme motifs were adapted to selectively recognize and cleave shRNA (FIG. 13A) and pre-miRNA in response to Zn2+and Mg2+(FIG. 13B) through rational design and chemical modification. This system enables metal-triggered dose-dependent cleavage of pre-miR-21, resulting in decreased miRNA maturation and suppression of downstream phenotypes such as cancer cell migration. Furthermore, this system is generalizable: it can regulate synthetic targets (e.g., shRNA), function across diverse cell types, and respond to physiologically relevant metal ions. These results establish a versatile framework for coupling metal ion availability to gene regulation through conditional miRNA control, with broad implications for conditional gene regulation, biosensing, and programmable synthetic biology.Results

[0238] Programmable shRNA Cleavage by Metal-Responsive DNAzymes n vitro To establish the potential of metal -responsive DNAzymes for programmable post-transcriptional gene regulation, first, a short hairpin RNAs (shRNAs) was employed as a model for precursor microRNAs (pre-miRNAs). shRNAs mimic the stem-loop structure of pre-miRNAs and engage similar Dicer- and Argonaute-dependent RNA interference (RN Ai) pathways, making them widely used for gene silencing in mammalian systems. As a tractable proof-of-concept system, a well-characterized shRNA targeting green fluorescent protein (shEGFP) was selected, which enables direct monitoring of regulatory effects via live-cell fluorescence imaging. This platform allows for the validation of DNAzyme functionality in a controlled context prior to extending the approach to endogenous miRNA targets.Attorney Docket No. 10046-678W01

[0239] First evaluated was the 8—17 DNAzyme (8-17Dz), a catalytic DNA known to cleave RNA in the presence of divalent metal ions, particularly Zn2+in living cells, with preferential activity at 5'-RG-3' (R = A or G) dinucleotide junctions. Guided by this cleavage preference, the shEGFP transcript was scanned to identify candidate 5'-AG-3' and 5'-GG-3' motifs (FIG. 14A). For each of the identified sites, DNAzymes were designed incorporating the conserved catalytic core of the 8-17 DNAzyme and rationally designed binding arms to flank the target site via Watson-Crick base pairing (TABLE 10). The binding arms were 10- 11 nucleotides in length, based on prior optimization studies that indicated this configuration supports a balance between hybridization stability and catalytic efficiency.TABLE 10. Sequences of shRNA of GFP, DNAzymes that target the shRNA, and mutated control DNAzymes that were used in this study.

[0240] To apply this system in living cells, two major challenges were anticipated. First, the intramolecular base pairing that stabilizes the shRNA stem-loop (FIG. 14A) could hinder DNAzyme access to the cleavage site by competing with DNAzyme-shRNA intermolecular hybridization (FIG. 14B). Second, the intracellular environment is likely to impose additional barriers, including RNA-binding proteins, molecular crowding, and endogenous nucleases, all of which could interfere with DNAzyme binding and function. Therefore, it was first assessedAttorney Docket No. 10046-678W01whether 8—17 DNAzymes could cleave shEGFP in vitro under physiologically relevant conditions, by incubating in vitro-transcribed shEGFP RNA with candidate DNAzymes in the presence of 100 μM ZnCl2 in a buffer including 100 mM NaCl and 10 mM Tris-HCl (pH 7.5) for 1 hour at 37 °C. The cleavage activity was analyzed by denaturing polyacrylamide gel electrophoresis (PAGE). Among the five tested sites -positions 9, 21 (FIGS. 18A-E), 44, 45, and 50 (FIG. 14C) — distinct cleavage products were observed for multiple targets, indicating successful site-specific RNA cleavage. To verify that cleavage was mediated by DNAzyme catalysis, parallel reactions were performed with a catalytically inactive 8—17 mutant, M8- 17Dz, in which the AG dinucleotide within the catalytic core was substituted with GC. Replacing 8-17Dz with M8-17Dz abolished the shRNA cleavage activity, confirming that the observed cleavage was dependent on DNAzyme catalysis rather than nonspecific hybridization (FIG. 14C). These results demonstrate that Zn2+-responsive 8-17Dz can invade the secondary structure of shRNA and achieve specific cleavage in vitro, supporting their potential for intracellular RNA targeting. It was next assessed whether 8-17Dz retains activity under sub- stoichiometric conditions—reflecting physiologically relevant environments where RNA substrates are typically present in excess — 8-17Dz was incubated with shEGFP RNA at DNAzyme: substrate molar ratios of 1:1 and 1:10 by keeping the concentration of the substrate the same. Quantification of cleavage products by denaturing PAGE revealed an average cleavage efficiency of 13.3% at the 1:1 ratio and 7.6% at the 1:10 ratio (FIGS. 18B-18E), suggesting that 8-17Dz can perform intracellular RNA targeting even under sub-stoichiometric conditions.

[0241] DNAzyme-Mediated Cleavage of shRNA Modulates EGFP Expression in Mammalian Cells: To assess whether metal-responsive DNAzymes can regulate gene expression in living cells within the native RNA interference (RNAi) environment that includes proteins such as Drosha and Dicer, an EGFP-shEGFP reporter system was applied. HEK293 cells were co-transfected with two plasmids: one encoding enhanced green fluorescent protein (EGFP) and the other encoding a short hairpin RNA targeting EGFP (shEGFP). Co-transfection resulted in a marked reduction in EGFP fluorescence compared to cells transfected with the EGFP plasmid alone (FIGS. 19A-19C), confirming that shEGFP efficiently suppresses EGFP expression through RNAi. When shEGFP was replaced with a scrambled, non-targeting sequence at the same locus, no EGFP fluorescence reduction was observed, indicating that shEGFP specifically targets EGFP transcripts. To correct transfection efficiency variability, a third plasmid encoding a red fluorescent protein (mRuby) was co-delivered in all conditions. Fluorescence microscopy revealed consistent increases in mRuby intensity (2.2-3.1 fold) uponAttorney Docket No. 10046-678W01co-transfection with additional plasmids (FIG. 19D), each delivered at equal amounts, resulting in a higher total DNA input. This enhancement in mRuby expression was attributed to improved nuclear delivery and transcriptional efficiency associated with increased DNA load, consistent with prior observations in plasmid -based gene expression systems. Therefore, to compare the expression between groups, EGFP fluorescence was normalized to mRuby intensity in all subsequent analyses.

[0242] To evaluate whether 8-17Dz, capable of cleaving shEGFP in vitro can modulate gene expression in living cells, HEK293T cells were co-transfected with plasmids encoding EGFP, mRuby, and either shEGFP or a scrambled RNA control, along with 100 ng of 8-17Dz targeting specific sites within the shEGFP sequence. Zinc chloride (30 μM ZnCl₂) was added post-transfection to supply the divalent metal cofactor required for DNAzyme catalytic activity. Cells were imaged using confocal microscopy at 10 and 24 hours after transfection. At the 10-hour time point, co-expression of shEGFP led to a 2.1-fold reduction in EGFP fluorescence relative to the scrambled RNA control (FIGS. 20A-20B), confirming that shEGFP effectively suppresses gene expression. Co-transfection with 8-17Dz targeting positions 44, 45, or 50 of the shEGFP sequence resulted in increased EGFP fluorescence in all three conditions compared to the shEGFP-only group (FIGS. 20A-20B), suggesting that DNAzyme-mediated cleavage of shEGFP can partially restore gene expression in mammalian cells. By 24 hours, a modest increase in GFP fluorescence persisted only in cells treated with the 8-17Dz targeting position 44 (hereafter referred to as 8-17Dz44), whereas 8-17Dz targeting positions 45 and 50 showed no measurable effect (FIGS. 21A-21B). To account for transfection variability, EGFP fluorescence was normalized to the mRuby signal. After normalization, none of the DNAzyme-treated groups showed statistically significant differences in EGFP expression compared to the shEGFP-only condition at either time point (FIG. 20C and FIG. 21C), indicating that while transient recovery was observed, the regulatory effect was modest and not sustained over time.

[0243] There are two potential explanations for this limited effect: (i) incomplete knockdown by shEGFP at early time points, which could restrict the dynamic range for observing DNAzyme-based rescue, and (ii) insufficient DNAzyme levels relative to the intracellular abundance of shEGFP. To test the first possibility, the shEGFP: EGFP plasmid ratio was increased from 1:1 to 1:2 and 1:3. The 1:2 ratio yielded the strongest absolute reduction in EGFP signal, while the 1:3 ratio produced the largest decrease after normalization (FIGS. 22A-22C), confirming that increasing shEGFP expression enhances silencing efficiency. To test the second hypothesis, DNAzyme dosage was increased under strongerAttorney Docket No. 10046-678W01knockdown conditions. At the 1:2 shEGFP: EGFP ratio, doubling the DNAzyme amount from 100 to 200 ng failed to restore EGFP expression (FIGS. 23A-23B), suggesting that the DNAzyme activity remained insufficient relative to shRNA load. However, when both shEGFP and DNAzyme amounts were doubled (i.e., 200 ng shEGFP, 200 ng DNAzyme, maintaining a 1:1 plasmid ratio), a significant increase in EGFP fluorescence was observed at 10 hours post-transfection in the DNAzyme -treated group (FIG. 23C). This effect was absent in cells treated with a catalytically inactive mutant DNAzyme (M8–17Dz44) or a non-targeting 60-mer thymine oligonucleotide (T60), confirming that restoration required active catalytic cleavage of shEGFP.

[0244] Despite the recovery observed at 10 hours, no significant differences in EGFP fluorescence were detected between treatment groups at 24 hours (FIG.24C, refer to the group labeled as “no protection”). This transient effect suggests that DNAzyme degradation or continued accumulation of shEGFP transcripts limits the duration of RNA regulation. To enhance DNAzyme stability and extend regulatory activity, different chemical modifications of the 8 - 17Dz44 construct were systematically evaluated. The modifications included terminal protective modifications to the DNAzyme: a 3' C3 spacer phosphoramidite (C3), a 3' inverted deoxythymidine (T), a 5' terminal hairpin structure (H), and phosphorothioate (PS) linkages at the three terminal nucleotides of the 3' end. A combined modification including a 5' hairpin and a 3' inverted dT (HT) was also evaluated (FIG. 24A). Each modified DNAzyme was cotransfected with plasmids encoding EGFP and shEGFP into HEK293T cells, and EGFP expression was assessed 24 hours post-transfection. Partial restoration of EGFP fluorescence was observed with the C3-, T-, and PS-modified DNAzymes (FIG. 24B), suggesting that these modifications enhanced DNAzyme stability or prolonged catalytic activity in cells. However, both C3- and T-modified constructs led to a reduction in the number of mRuby-positive cells and decreased mRuby fluorescence intensity at 10 and 24 hours (FIGS. 24A-24C and FIGS.25A-C), indicating potential negative effects on transfection efficiency or cell viability. This effect was most pronounced with the C3-modified DNAzyme, which caused a marked decrease in viable cells by 24 hours, consistent with cytotoxicity. In contrast, PS-modified DNAzymes did not significantly affect mRuby expression or cell viability, and the T-modified construct had only a modest impact. Based on these results, PS and T modifications were selected for subsequent experiments, as they improved DNAzyme performance while maintaining cell health and transfection efficiency.

[0245] To further confirm that the observed gene regulation was driven by DNAzyme catalytic activity, the phosphorothioate-modified DNAzyme targeting position 44 (8-17Dz44-Attorney Docket No. 10046-678W01PS) was compared with a catalytically inactive mutant (M8-17Dz44-PS) carrying point mutations in the catalytic core but retaining identical binding arms. As shown in FIGS. 15A- 15B, shEGFP suppressed EGFP expression and showed 54.75% decrease in fluorescence intensity relative to the scrambled RNA control. Co-transfection with 8- 17Dz44-PS partially restored EGFP fluorescence and showed an 86.8% increase in fluorescence intensity, whereas neither the mutant DNAzyme nor a non-targeting 60-mer thymine oligonucleotide (T60) produced any detectable effect. These results indicate that EGFP recovery was specifically mediated by the catalytic cleavage activity of the PS-modified DNAzyme, rather than by nonspecific hybridization. To determine whether this effect was dependent on the phosphorothioate modification, a parallel experiment was conducted using an inverted deoxythymidine (T)-modified DNAzyme and its corresponding inactive mutant. A similar pattern of EGFP restoration with a 137.5% increase in fluorescence intensity was observed (FIGS. 26A-B), confirming that both PS and T modifications improve DNAzyme stability in cells without compromising catalytic function or target specificity.

[0246] Metal-Dependent Activation of DNAzymes Enables Conditional Regulation of Gene Expression: The DNAzyme-mediated RNA cleavage is catalyzed in the presence of specific metal ions, such as Zn2+. To test whether gene regulation by the phosphorothioate-modified 8—17 DNAzyme targeting site 44 of shEGFP (8-17Dz44-PS) is metal-dependent, HEK293T cells were co-transfected with plasmids encoding EGFP, mRuby, and shEGFP, along with or without 8-17Dz44-PS. Zinc chloride (30 pM) was added post-transfection to enable DNAzyme activity. In cells transfected with 8-17Dz44-PS, EGFP fluorescence increased 43% in the presence of 30 pM supplemental Zn2+compared to the intrinsic Zn2+level, indicating that elevated Zn2+enhances DNAzyme-mediated cleavage of shEGFP and restores EGFP expression (FIGS. 15A-15B). To rule out the non-specific effects of Zn2+on transcription or translation, cells were transfected with EGFP and mRuby plasmids in the absence of shEGFP and DNAzyme. Under these conditions, Zn2+did not affect the fluorescence of either reporter (FIG. 27A), confirming that the observed regulatory effect was specific to the DNAzyme -shRNA interaction.

[0247] It was next investigated whether gene expression could be modulated by varying Zn2+concentrations. In cells co-transfected with EGFP and shEGFP (in the absence of DNAzyme), EGFP expression remained consistently suppressed regardless of the presence of 30 pM Zn2+, consistent with constitutive shRNA-mediated knockdown (FIGS. 27A-27B). In contrast, in cells co-transfected with 8-17Dz44-PS, EGFP fluorescence increased with increasing Zn2+concentrations (FIGS. 16A-16B, 24hr post-transfection, and FIGS.28A-B, 10Attorney Docket No. 10046-678W01hr post-transfection). These results demonstrate that intracellular metal ion levels can conditionally activate DNAzyme-mediated gene regulation. Collectively, this establishes the 8-17 DNAzyme-shRNA system as a programmable platform for metal-responsive gene expression control.

[0248] DNAzyme Targeting of pre-miR-21 Regulates Cell Proliferation and Migration in a Metal-Dependent Manner: The miRNA biogenesis pathway involves a multistep process that begins with the transcription of primary miRNAs (pri-miRNAs), which Drosha and DGCR8 then process into precursor miRNAs (pre-miRNAs). These pre-miRNAs are exported to the cytoplasm, cleaved by Dicer, and incorporated into the RISC with Argonaute (AGO) proteins to guide mRNA silencing. Disruption in any part of this pathway — whether through transcriptional dysregulation, epigenetic alterations, or defects in processing — can result in abnormal miRNA levels and contribute to pathogenesis. A well-documented example is miR-21, a highly conserved oncogenic miRNA frequently overexpressed in solid tumors. Its upregulation promotes cell proliferation, migration, and resistance to therapy, and has been mechanistically linked to hypomethylation at its genomic locus. As such, controlling miR-21 expression has become a standard for evaluating Retargeting technologies with translational relevance.

[0249] To explore whether a DNAzyme can modulate cellular behaviors such as proliferation and migration through the regulation of endogenous microRNAs, 8-17Dz was designed to target precursor miR-21 (pre-miR-21). Candidate cleavage sites were identified based on the presence of 5'-RG-3' motifs (R = A or G), the known recognition sequence for 8- 17Dz (FIG. 30A). The 8-17Dz binding arms were then designed to hybridize to flanking regions of these cleavage motifs (TABLE 11). To evaluate cleavage efficiency in vitro, DNAzymes were incubated with synthetic pre-miR-21, and cleavage products were analyzed by PAGE. Several 8-17Dz constructs generated additional bands migrating between the full- length pre-miRNA and the DNAzyme itself, consistent with specific cleavage of pre-miR-21 (FIG. 30B). To confirm that these bands resulted from catalytic activity, catalytically inactive M8-17Dz was tested. No cleavage products were observed in these controls (FIG. 31), supporting that the observed cleavage was DNAzyme-specific.TABLE 11. Sequences of Pre-miR-21, pre-miR-21 targeting DNAzymes, and their mutated controls that were used in this study.Attorney Docket No. 10046-678W01

[0250] Next, the biological relevance of this design in living cells was assessed using a wound-healing assay in MCF-7 cells, a well-established model for studying cell migration and proliferation. Cells were transfected with phosphorothioate-modified DNAzymes targeting pre-miR-21 and subjected to scratch-wound assays. Following transfection, Zn2+(30 pM) was added to the culture medium to support DNAzyme activity. The wound area was imaged over time, and wound closure rates were calculated based on the percentage reduction in wound area relative to the initial time point. Cells transfected with 8-17Dz52-PS exhibited significantly delayed wound closure compared to those transfected with catalytically inactive M8-17Dz52-PS control (FIGS. 32A-32B). This result produces a similar phenotype to previously reported outcomes of miR-21 knockdown in MCF-7 cells, supporting the hypothesis that the observed delay in wound healing is mediated by DNAzyme-induced downregulation of miR-21. These findings suggest that DNAzyme cleavage of pre-miR-21 reduces miR-21 levels, impairing cell migration and proliferation.

[0251] To investigate whether this regulatory effect could be tuned by varying metal ion concentrations, phosphorothioate-modified 8-17 DNAzyme targeting site 52 of pre-miR-21Attorney Docket No. 10046-678W01(8-17Dz52-PS) was delivered to MCF-7 cells and wound healing in the presence of increasing Zn2+concentrations was monitored. Higher Zn2+levels led to a progressive decrease in wound closure rate (FIGS. 17A-17C), indicating a metal ion-dependent enhancement of DNAzyme activity and downstream biological effects. Together, these findings demonstrate that 8-17 DNAzymes can selectively cleave endogenous pre-miRNAs and modulate cellular phenotypes in a Zn2+-dependent manner. These results establish a foundation for engineering environmentally responsive RNA regulatory systems that enable programmable control of gene expression and cell behavior.

[0252] The DNAzyme-Mediated microRNA Regulation Platform Is Adaptable to Multiple DNAzyme Classes and Metal Ions: To explore the generalizability of the DNAzyme-based gene regulation system, its compatibility with magnesium ions (Mg2+), a physiologically abundant divalent cation that functions as a cofactor in numerous biological processes, including RNA folding, ribozyme catalysis, and miRNA biogenesis mediated by¬ enzymes such as Dicer and Drosha, was next investigated. Its adaptability to the 10-23 DNAzyme, a distinct catalytic motif from 8—17, which preferentially cleaves purine¬ pyrimidine (especially AU and GU) dinucleotide junctions in the presence of Mg2’ was also tested. Based on this recognition rule (AU ~ GU > GC » AC), the shEGFP sequence was scanned and 5'-AU-3’ and 5'-GU-3' motifs as candidate cleavage sites were identified (FIG.30A). The binding arms were designed to enable specific hybridization to target regions flanking the selected cleavage sites (TABLE 10). Among the candidates tested in vitro, the 10-23 DNAzyme targeting site 47 (10-23Dz47, FIG. 30B) produced distinct cleavage products on denaturing PAGE, while its catalytically inactive mutant (M10-23Dz47), which substitutes conserved guanine with cytosine in the catalytic core, showed no activity (FIGS.18B-18C). It was next evaluated whether 10-23Dz47 retains catalytic activity under sub- stoichiometric conditions, which better reflect physiological environments where RNA substrates are typically present in excess. Using a constant substrate concentration, cleavage efficiency was compared at DNAzyme- to-substrate molar ratios of 1:1 and 1:10, by keeping the amount of the substrate the same cross experimental groups. Denaturing PAGE analysis revealed an average cleavage efficiency of 12.1% at the 1:1 ratio and 9.5% at the 1:10 ratio (FIGS. 18B-18C). These results indicate that 10-23Dz47 remains catalytically active even when present at limiting concentrations relative to the RNA target, supporting its potential utility for intracellular RNA regulation.

[0253] To evaluate the function of 10-23 DNAzymes in living cells, HEK293T cells were co-transfected with shEGFP and EGFP plasmids along with either phosphorothioate-modifiedAttorney Docket No. 10046-678W0110-23Dz47 (10-23Dz47-PS) or its catalytically inactive mutant (M10-23Dz47-PS). Cells transfected with 10-23Dz47-PS exhibited a significantly higher EGFP / mRuby fluorescence ratio than those transfected with M10-23Dz47-PS or a T60 negative control (FIG. 27B). Furthermore, the increase in EGFP expression positively correlated with Mg2+concentration (FIGS.29A-29B), supporting the metal ion-dependent activation of 10-23 DNAzymes in cells. These findings closely parallel those observed with the 8-17 DNAzyme system, confirming that the platform is broadly adaptable to different DNAzyme architectures and metal ion cofactors.

[0254] To extend this strategy to the regulation of microRNAs, 10-23Dz was designed, targeting pre-miR-21, a well-characterized oncogenic miRNA overexpressed in various cancers. Eight candidate cleavage sites containing 5'-AU-3' or 5'-GU-3' motifs within pre-miR- 21 (FIG.30A) were identified and their cleavage efficiency in vitro was screened. Sites 14, 25, 32, 42, 53, and 57 yielded cleavage products on PAGE (FIG. 30B). Mutant DNAzymes were used to validate specificity, and cleavage was observed only with the corresponding active DNAzymes, confirming catalytic dependence. To assess functional outcomes, phosphorothioate-modified 10-23 DNAzyme targeting site 42 (10-23Dz42-PS) was delivered into MCF-7 cells and wound healing was evaluated as a readout for proliferation and migration. Cells transfected with 10-23Dz42-PS exhibited significantly reduced wound closure compared to those transfected with the catalytically inactive mutant (FIGS. 32A-32B), replicating the effects observed with the 8—17 DNAzyme targeting pre-miR-21. These results support the hypothesis that both DNAzyme classes can downregulate miR-21 and thereby attenuate cell motility and growth.

[0255] To evaluate whether endogenous Mg2+alone is sufficient to support DNAzyme activity in the absence of added metal ions, MCF-7 cells were transfected with 10-23Dz42-PS or its mutant control and tracked wound healing under standard culture conditions. Even without exogenous Mg2+, cells expressing active DNAzymes exhibited significantly slower wound healing compared to the mutant control, demonstrating that intracellular Mg2+is sufficient to support DNAzyme-mediated pre-miR-21 cleavage. These results establish that the DNAzyme-mediated regulatory platform is modular and metal-responsive, capable of functioning with multiple catalytic motifs (8—17 and 10-23) and physiologically relevant cofactors (Zn2’ and Mg2+). This adaptability underscores the potential utility of the system for various applications, including conditional gene regulation, modulation of cellular behaviors, and future therapeutic strategies targeting disease-associated noncoding RNAs.Attorney Docket No. 10046-678W01Discussions

[0256] Achieving precise and context-dependent control over miRNA activity remains a major unmet need in therapeutic development, diagnostics, and synthetic biology. Existing methods for modulating miRNA function--such as antisense oligonucleotides, CRISPR-based editing, and miRNA sponges— -are typically constitutive, lack responsiveness to physiological cues, or rely on invasive genomic manipulation. These limitations constrain their utility in complex biological systems where gene expression responds dynamically to environmental or disease -related signals.

[0257] This study introduces programmable, metal -responsive DNAzymes, such as Zn2+- dependent 8—17 DNAzyme or Mg2+-dependent 10-23 DNAzyme, which enable conditional, post-transcriptional regulation of miRNA biogenesis in living mammalian cells, by demonstrating metal ion-triggered cleavage of structured RNA substrates, including shRNAs and the oncogenic pre-miR-21. This approach allows precise, dose-dependent modulation of miRNA maturation and downstream phenotypes, such as cancer cell migration, in response to physiologically relevant concentrations of Zn2+or Mg2+. This study represents the first demonstration of intracellular, metal-ion-activated cleavage of pre-miRNAs, positioning DNAzymes as a new class of signal -integrated RNA regulators. This work establishes a new class of signal-integrated RNA regulators that bridge molecular sensing with gene control.

[0258] A key strength of this platform lies in its programmability and modularity. DNAzymes are compact, chemically stable, and easily reconfigured to target different RNA sequences or respond to distinct metal cofactors. These properties support the speedy development of customized regulators tailored to specific biological or therapeutic targets. Importantly, the use of endogenous metal ions as regulatory inputs introduces a layer of environmentally responsive gene control. Because metal ion concentrations vary across tissues and disease states, this system offers the potential for spatiotemporally precise regulation, particularly in microenvironments characterized by ion imbalances such as solid tumors, inflamed tissues, or metal-associated pathologies.

[0259] Beyond therapeutic relevance, this system enables applications in biosensing and synthetic biology. This study demonstrates that DNAzyme activity can be coupled with fluorescent reporters for quantitative readout of intracellular metal ion concentrations. Such DNAzyme-based sensors could be integrated into synthetic gene circuits that execute logic¬ based responses to environmental inputs, advancing the development of adaptive, decision¬ making cell systems.Attorney Docket No. 10046-678W01

[0260] To support intracellular performance, DNAzyme stabilization strategies were systematically evaluated. Protective chemical modifications, such as phosphorothioate linkages and 3'-inverted thymidine, that enhance RNA cleavage activity and resistance to nuclease degradation, while maintaining low cytotoxicity, were identified. These design principles provide a robust foundation for future engineering of functional nucleic acid devices in complex intracellular environments.

[0261] In summary, presented here is a modular, programmable, and metal-responsive platform for regulating RNA in living cells, enabling the conditional control of miRNA activity and gene expression. By integrating biochemical sensing with post-transcriptional regulation, this work establishes DNAzymes as versatile tools for dynamic, environment-responsive gene control. This capability opens new avenues for developing diagnostic and therapeutic systems that adapt to the cellular context in real time and lays the foundation for future applications in precision medicine, live-cell biosensing, and adaptive synthetic biology.Method and Materials

[0262] In vitro assay for evaluating DNAzyme-mediated cleavage of shRNA and pre-miRNA: Target sites for DNAzyme-mediated cleavage were identified by scanning the sequences of shRNA and pre-miRNA for critical dinucleotide motifs: 5'-AG-3' or 5'-GG-3' for the 8-17 DNAzyme, and 5'-GU-3' or 5'-AU-3' for the 10-23 DNAzyme. Based on these cleavage sites, DNAzyme sequences were designed with 9-10 nucleotide binding arms flanking the catalytic core to enable sequence-specific hybridization. All DNAzymes and their catalytically inactive mutant variants were synthesized by Integrated DNA Technologies (IDT). Where indicated, DNAzymes were chemically modified at both termini with phosphorothioate (PS) linkages, inverted dT, or other protective groups, as specified in TABLE 10. Unmodified and modified sequences were purified using 10% denaturing polyacrylamide gel electrophoresis (PAGE) before in vitro cleavage assays. Cleavage reactions were carried out in a 10 pL system containing 1 pM RNA substrate and DNAzyme at the desired molar ratio, in a buffer including 100 mM NaCl and 10 mM Tris-HCl (pH 7.5). For catalytic activation, 100 pM ZnCh was used for 8-17 DNAzyme reactions and 10 mM MgCl2was used for 10-23 DNAzyme reactions. The DNAzyme-RNA mixtures were incubated at room temperature for 1 hour. Reactions were quenched with gel loading buffer containing 8 M urea, 180mM Tris, 180 mM boric acid, 100 mM EDTA, 0.05%’ xylene cyanol, and 0.05% bromophenol blue. Samples were then resolved on a 12% denaturing PAGE gel and stained with SYBR™ Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific). Cleavage products were visualized and imaged using a Bio-Rad Gel Doc imaging system.Attorney Docket No. 10046-678W01

[0263] Cell Culture and Imaging: HEK293T cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. For imaging experiments, cells were seeded at a density of 3 x 104cells per well in an 8-well chamber slide (ibidi) and cultured overnight prior to transfection. Plasmid #12.273 from Addgene, encoding shEGFP, was used to induce EGFP knockdown in cells. To ensure consistency in total DNA across all experimental conditions, the quantities of mRuby-encoding plasmid and poly-T control oligonucleotide (T60) were adjusted accordingly. Plasmids and DNAzymes were mixed with 1 μL TurboFect (Thermo Fisher Scientific) in 150 μL Opti-MEM (Gibco), vortexed briefly, and incubated at room temperature for 15 minutes. The transfection mixture was then added to the cells in a serum-free medium. After 4 hours of incubation, transfection media were removed, and cells were washed twice with lx PBS. Cells were then cultured in complete DMEM containing the indicated concentrations of Zn²⁺ (for 8–17 DNAzyme experiments) or Mg2+(for 10-23 DNAzyme experiments). Imaging was performed at 10- or 24-hours post-transfection using a ZEISS LSM 710 confocal microscope or a ZEISS AXIO Imager fluorescence microscope, equipped with appropriate filter sets for EGFP and mRuby. Images were captured using ZEN software (Zeiss), using a 20x or 40x objective. All imaging parameters (laser intensity, gain, exposure) were kept constant within experiments.

[0264] Wound Healing Assays: To ensure uniform wound creation across wells, a Culture-Insert 2 Well (ibidi, Germany) was placed in each well of a 24-well tissue culture plate. MCF-7 cells were seeded into the inserts at 70 pL per well at a density of 9 x 105cells / mL and incubated at 37 °C in a humidified atmosphere with 5% CO₂, overnight to allow' cells to reach 100% confluence. The following day, 300 ng of phosphorothioate (PS)-modified DNAzyme or its mutant control was transfected into each well using 1 pL TurboFect (Thermo Fisher Scientific) in 50 pL Opti-MEM (Gibco), following the manufacturer’s protocol. After a 4-hour incubation, the transfection medium was removed and replaced with 300 pL of complete DMEM (10% FBS) supplemented with the desired concentration of Mg2+(for 10-23 DNAzyme experiments) or Zn²⁺ (for 8–17 DNAzyme experiments). Wounds were generated by carefully removing the Culture-Insert using sterile tweezers, leaving a defined cell-free gap. The wound area was monitored by bright-field microscopy over 2-3 days, with images acquired at designated time points. Wound area measurements were performed using Fiji (ImageJ, NIH) with a validated wound healing analysis plugin optimized for automated gap recognition. The wound closure rate was calculated using the equation:Attorney Docket No. 10046-678W01AO - Atwound closure rate % — ( - ) x 100%AOwhere Ao is the wound area at 0 hours and Atis the wound area at a given time point t after the initial scratch. This metric represents the percentage reduction in wound area over time relative to the initial wound gap.

[0265] Image Processing and Statistical Analysis: All figures were assembled using PowerPoint (Microsoft), Photoshop (Adobe), and GraphPad Prism (GraphPad Software). For visualization purposes, the brightness of fluorescence images acquired from the same experiment was uniformly adjusted across groups to enhance signal clarity, without altering contrast or relative intensity. Image quantification was performed using ZEN software (Zeiss). For each experimental condition, six images were analyzed, and fluorescence intensities were measured from five individual cells per image. All experiments were conducted with at least three independent biological replicates. Statistical analysis was performed using unpaired two-tailed Student’s t-tests to compare differences between the two groups. Data are presented as mean + standard error of the mean (SEM), unless otherwise specified. Statistical significance is denoted as follows: ns, not significant (p > 0.05); *, p<0.05; **, p<0.01; ***, p < 0.001. Graphs were generated using GraphPad Prism.Example 5: Metal-Responsive DNAzyme Systems for Programmable RNA Cleavage and Gene Regulation

[0266] The miRNA biogenesis pathway involves a multistep process that begins with the transcription of primary miRNAs (pri-miRNAs), which Drosha and DGCR8 process into precursor miRNAs (pre-miRNAs). These pre-miRNAs are exported to the cytoplasm, cleaved by Dicer, and incorporated into the RISC with Argonaute (AGO) proteins to guide mRNA silencing. Disruption in any part of this pathway — whether through transcriptional dysregulation, epigenetic alterations, or defects in processing— -can result in abnormal miRNA levels and contribute to pathogenesis. A well-documented example is miR-21, a highly conserved oncogenic miRNA frequently overexpressed in solid tumors. Its upregulation promotes cell proliferation, migration, and resistance to therapy, and has been mechanistically linked to hypomethylation at its genomic locus. As such, controlling miR-21 expression has become a model for evaluating RNA-targeting technologies in cancer and beyond.

[0267] Numerous strategies have been developed to modulate miRNA expression for both mechanistic studies and therapeutic applications, including transgenic models, synthetic miRNA mimics, viral overexpression systems, antisense oligonucleotides, CRISPR / Cas-based genome editing, miRNA sponges, and target protectors. While these technologies enable eitherAttorney Docket No. 10046-678W01up- or down-regulation of specific miRNAs, they are typically constitutive, non-tunable, and most lack responsiveness to endogenous cues, limiting their ability to respond to dynamic physiological contexts. In particular, existing approaches lack the ability to provide conditional, signal-responsive control over miRNA biogenesis or function, despite growing evidence that miRNA expression displays tissue-specific patterns and is modulated by local regulators. This limitation reduces their effectiveness in dynamic or spatially heterogeneous biological environments.

[0268] Metal ions such as zinc and magnesium function as key biochemical signals and are tightly regulated across different tissues and physiological states. Their concentrations can vary in response to developmental cues, metabolic activity, or disease-associated stress, offering a potential regulatory layer for dynamic gene control. While aberrant metal ion levels have been correlated with changes in miRNA expression in certain pathological contexts, the direct use of metal ions as programmable inputs to control miRNA activity remains underexplored. Notably, no existing system harnesses elevated physiological or engineered levels of metal ions to trigger RNA-level regulation of miRNA biogenesis. This gap presents an opportunity to develop synthetic regulatory platforms that leverage metal ion availability as a tunable and modular control signal.

[0269] A modular, synthetic platform for regulating gene expression was developed by using metal -responsive DNAzymes — short, catalytically active DNA oligonucleotides that cleave RNA in a sequence-specific and metal ion-dependent manner. These DNAzymes are rationally designed to target defined sites within structured RNA molecules, such as short hairpin RNAs (shRNAs) and precursor microRNAs (pre-miRNAs), enabling programmable cleavage of endogenous or engineered RNA transcripts inside living cells.

[0270] The platform is based on DNAzyme motifs (including the 8-17 and 10-23 families) that catalyze the cleavage of RNA at specific dinucleotide junctions in the presence of divalent metal ions such as zinc (Zn2+) or magnesium (Mg2+). The DNAzyme sequence includes a catalytic core flanked by short hybridization arms (typically 10-11 nucleotides), which guide the molecule to the intended RNA target via Watson-Crick base pairing.

[0271] Upon binding, the DNAzyme undergoes a conformational change that, when supported by the appropriate metal ion cofactor, activates cleavage of the RNA backbone at the target site. The reaction is catalytic, meaning that each DNAzyme can process multiple RNA molecules over time, enhancing efficiency at low concentrations.

[0272] To improve performance in mammalian cells, the DNAzymes are chemically modified at their terminal ends (e.g., with phosphorothioate linkages, inverted deoxythymidine,Attorney Docket No. 10046-678W01or hairpin loops) to resist degradation by nucleases and extend intracellular activity. These modifications maintain target specificity and catalytic activity while minimizing cytotoxicity.

[0273] The system supports both exogenous applications - such as modulating the function of synthetic RNA constructs like shRNAs or reporter transcripts (e.g., GFP) - and endogenous regulation, such as targeting oncogenic pre-miRNAs (e.g., pre-miR-21) to influence cellular phenotypes like proliferation and migration. Importantly, the activity of these DNAzymes can be switched on or tuned by changing the concentration of metal ions, offering an externally controllable mechanism to modulate gene expression in a conditional and reversible manner.

[0274] These DNAzymes thus provide a programmable, environmentally responsive, and enzymatically active RNA cleavage tool for applications in gene regulation, synthetic biology, therapeutic development, and molecular diagnostics.

[0275] This fully synthetic, metal-responsive DNAzyme platform allows for programmable, site-specific RNA cleavage and gene regulation. It uses short catalytic DNA sequences (8—17 or 10-23 motifs) that bind and cleave structured RNA targets — such as shRNAs and pre-miRNAs--in the presence of divalent metal ions (e.g., Zn2+or Mg2+). DNAzymes are designed with sequence-specific hybridization arms and exhibit catalytic turnover, allowing one molecule to cleave multiple RNA substrates. Their activity is tunable based on metal ion concentration, enabling conditional and reversible gene regulation. Chemical modifications such as phosphorothioate linkages and inverted nucleotides enhance intracellular stability without compromising function. The platform operates independently of protein cofactors and is adaptable to various RNA targets, offering advantages in therapeutic development, diagnostics, and synthetic biology.

[0276] This DNAzyme platform offers a set of unique and impactful benefits derived directly from its programmable, catalytic, and metal-responsive features. One example is precise environmental control, which enables conditional gene regulation based on metal ion concentration (e.g., Zn2+, Mg2+). The DNAzyme platform allows spatial, temporal, or disease-state-specific activation, which is ideal for targeted therapies or responsive biosystems.

[0277] Engineered DNAzymes enable conditional and programmable control of RNA processing and gene expression in response to specific metal ions. And have particular usefulness in many fields. For example, in synthetic biology, DNAzymes can act as metal-ion-responsive genetic switches for dynamic regulation of gene circuits. In terms of therapeutic, DNAzymes can be used for post-transcriptional silencing or activation of disease-associated noncoding RNAs (e.g., miR-21) in cancer or other pathologies. Additional clinical applications of DNAzymes include diagnostics; DNAzymes can be used as metal -ion-sensitive probes forAttorney Docket No. 10046-678W01RNA activity or gene expression readouts. In the lab, DNAzymes can be used as research tools to investigate RNA function, miRNA biogenesis, or gene regulation using catalytically active oligonucleotides.

[0278] DNAzymes were engineered to contain a conserved catalytic core (either 8—17 or 10-23 motif) flanked by sequence-specific hybridization arms (10-11 nt) complementary to the RNA target. Target sites were chosen based on consensus cleavage motifs: 5'-RG-3' for 8-17 DNAzymes and 5'-RY-3' (e.g., AU, GU) for 10-23 DNAzymes. DNAzymes remain catalytically inactive until exposed to specific metal ions (e.g., Zn2+, Mg2+), which are required as essential cofactors for cleavage activity. The concentration of metal ions can be used to tune or trigger RNA cleavage activity.

[0279] Upon metal ion exposure, the engineered DNAzyme cleaves the target RNA at a specific phosphodiester bond, disrupting function of the RNA (e.g., inactivating shRNA or pre-miRNA). In model systems, cleavage of shRNAs restores gene expression of silenced reporters (e.g., GFP), and cleavage of pre-miR-21 impairs oncogenic cell behaviors. DNAzymes were delivered to mammalian cells via co-transfection with plasmid constructs. Cell lines used include HEK293T cells for reporter assays and MCF-7 cells for cancer-related proliferation and migration assays. Cleavage activity was monitored using fluorescence imaging (GFP / mRuby), and phenotypic outcomes such as cell proliferation and migration were assessed using wound-healing assays.

[0280] Engineered DNAzymes employ metal-dependent catalytic DNA molecules that remain inactive in the absence of specific divalent metal ions (e.g., Zn “+or Mg?+) and are selectively activated by their presence. This enables conditional, externally controllable RNA cleavage. Engineered DNAzymes have many advantages over other RNA-targeting tools. Conventional RNA-targeting tools — such as antisense oligonucleotides, small interfering RNAs (siRNAs), or CRISPR interference (CRISPRi) -- - are constitutively active once delivered and do not respond to environmental or intracellular chemical triggers. The DNAzyme platform introduces a metal-sensing layer of regulation, which allows on-demand gene regulation based on environmental metal ion concentrations.

[0281] Furthermore, engineered DNAzymes act enzymatically, meaning a single molecule can cleave multiple RNA targets over time, as demonstrated by cleavage efficiencies that exceed stoichiometric expectations under sub-stoichiometric conditions. In contrast, antisense oligonucleotides and siRNAs typically act in a stoichiometric or limited catalytic manner (via Ago2-mediated cleavage), and their efficiency depends heavily on sustained delivery and highAttorney Docket No. 10046-678W01local concentrations. DNAzymes provide a self-sustaining mechanism, enabling RNA regulation with lower doses and prolonged activity under the right conditions.

[0282] For engineered DNAzymes, target selection is based on short dinucleotide motifs (e.g., 5'-RG-3' for 8-17, 5'-RY-3' for 10—23), allowing precise, sequence-defined cleavage sites and enabling rational design against nearly any RNA of interest. RNA interference (RNAi) mechanisms like shRNA / siRNA generally require longer duplex regions (19-21 nt) with complex secondary structure considerations and positional biases within the transcript. Engineered DNAzymes enable precise, minimalistic targeting with high specificity and predictability based on known cleavage rules.

[0283] Engineered DNAzymes exhibit metal-specific and metal-concentration-dependent activity tuning. The level of gene regulation by DNAzymes can be tuned by adjusting metal ion concentrations, as shown with Zn2+and Mg2+in both in vitro and cellular contexts. This introduces the ability to quantitatively modulate gene expression using chemical inputs. Most current RNA-targeting technologies are binary (on / off) and lack the capacity for fine-tuning via simple environmental changes. While inducible promoters (e.g., doxycycline-regulated systems) exist, they act at the transcriptional level and require protein machinery. DNAzymes offer post-transcriptional, dose-responsive control using small molecule metal cofactors, without additional proteins or gene circuits.

[0284] The engineered DNAzyme platform offers broad compatibility with multiple DNAzyme classes and modifications. The developed platform supports multiple DNAzyme motifs (8-17, 10-23) that can be modified with phosphorothioate (PS) bonds, inverted nucleotides, and hairpin structures to enhance stability and minimize toxicity. Many RNA-targeting systems are limited to specific scaffold types or require the engineering of protein components (e.g., Cas9, Ago2). This system uses entirely nucleic acid-based components, which are modular, chemically synthesizable, and tunable without protein expression. The combined catalytic and structural adaptability offers distinct advantages over static hybridization-based methods.

[0285] Engineered DNAzymes have selectively downregulated endogenous oncogenic miRNAs (e.g., miR-21) in mammalian cells, leading to measurable phenotypic changes such as reduced cell proliferation and migration, in a metal-dependent manner. While antisense oligos and miRNA sponges can inhibit miRNAs, they often lack catalytic activity and do not provide conditional control. CRISPR / Cas-based miRNA editing is complex, permanent, and not reversible. Engineered DNAzymes offer a reversible, tunable, and catalytic approach toAttorney Docket No. 10046-678W01regulating noncoding RNA biology, potentially with fewer off-target or permanent genome editing risks.

[0286] Beyond the demonstrated applications in gene regulation, RNA cleavage, and modulation of cell behavior, engineered DNAzymes have broad and versatile potential across a variety of fields. For example, engineered DNAzymes could play a role in personalized cancer treatments. DNAzymes are able to target disease-specific microRNAs (e.g., miR-21, miR-155, miR-lOb) for tumor-type-specific therapy. Furthermore, DNAzymes can be used in tandem with chemotherapy or immunotherapy to sensitize tumors by downregulating resistance-associated noncoding RN As. Additionally, DNAzymes can work in responsive drug systems through integration of DNAzymes into metal-responsive drug delivery platforms where RNA cleavage activates or deactivates therapeutic payloads.

[0287] In addition to cancer therapeutics, engineered DNAzymes have relevance to biosensing and diagnostic devices. DNAzymes can be engineered into diagnostic devices that detect biologically or environmentally relevant metal ions (e.g., Zn2+, Pb2+, Cu2+) via changes in RNA cleavage or fluorescence readout. This method of biosensing allows the DNAzyme sensors to utilize known fluorescence proteins (e.g., GFP, RFP) and has the potential to achieve reversible sensing when expressed in cells. DNAzymes can also be used to cleave and detect disease-specific miRNAs in patient samples, such as blood or tissue biopsies, enabling early disease detection or monitoring.

[0288] Engineered DNAzymes can also serve as bioremediation tools and contamination-responsive gene switches in the context of the environment. DNAzyme systems that activate in response to heavy metals in polluted environments could be coupled with biological responses (e.g., reporter expression) to sense and detoxify contaminated systems. For example, the DNAzymes could cleave mRNA or miRNA in the presence of an environmental contaminant by sensing the environmental contaminant and regulate its expression or concentration by cleaving the mRNA or miRNA responsible for producing said environmental contaminant. Furthermore, synthetic organisms engineered with metal-sensitive DNAzymes could regulate gene expression in industrial bioreactors in response to contamination or stress. DNAzymes responsive to soil metals (e.g., Mg2+, Zn2+) could regulate plant gene expression during drought, nutrient deficiency, or pathogen exposure. DNAzymes could also benefit the environment by enabling conditional activation of resistance genes or growth regulators in plants based on environmental cues, for example, by cleaving a nucleic acid that suppresses expression of resistance genes or growth regulators.Attorney Docket No. 10046-678W01

[0289] Another field DNAzymes could influence is synthetic biology and logic circuits. DNAzymes integrated into synthetic gene networks could serve as logic gates responding to specific combinations of metal ions, enabling conditional control over engineered cell behavior. DNAzyme systems could participate in synthetic regulatory loops that mimic biological rhythms or switch-like behavior. An example of such a system which could incorporate the disclosed DNAzymes is Qian, R., et al. Rectifying artificial nanochannels with multiple interconvertible permeability states. Nat Commun 15, 2051 (2024), which is incorporated herein in its entirety.

[0290] Furthermore, engineered DNAzymes could play a role in controlled RNA editing and splicing. Future adaptations may enable DNAzyme cleavage near splicing sites or untranslated regions (UTRs) to modulate transcript isoforms or translation efficiency. DNAzymes could be integrated into RNA editing systems to remove or replace mutant sequences in genetic disorders, potentially in coordination with RNA ligases or trans-splicing tools.

[0291] Engineered DNAzymes have profound impacts on neurological research and therapeutics. DNAzymes can offer spatiotemporally controlled RNA regulation. DNAzyme activity could be guided by Zn2+or Mg2+gradients in the brain to regulate neuron-specific RNA targets. DNAzymes could be directed against pathogenic noncoding RNAs in diseases such as Alzheimer's, Huntington’s, or AL S.

[0292] The modularity, programmability, and environmental responsiveness of engineered DNAzymes make them a versatile platform that can extend far beyond its initial application in RNA cleavage. The all-nucleic acid composition and metal-dependent activity of the disclosed invention position DNAzymes well for adaptation to therapeutics, diagnostics, biosensing, synthetic biology, and agriculture.Example 6: Additional cfDNAzymes

[0293] Additional cfDNAzymes are provided in TABLE 12. An example activity assay for DZ6..2.2 cfDNAzyme is shown in FIGS. 33A-33B.TABLE 12. Additional cfDNzymes. DZ6_6.1 and DZ6_6.2 have the exact same 34nt sequence; however, they are from two distinct loci on chromosome 17. This means that they can be treated as one (DZ6..6.1-2), but the occurrence of this sequence is likely higher than the others in cfDNA. DZ6„8 and DZ6„9 have the exact same 34nt sequence (unique from DZ6_6.1-2) and can also be treated as one (DZ6„8-9). DZ6__8-9 occurs on chromosomes 20 and 21.Attorney Docket No. 10046-678W01Example 7: cfDNA and miRNA can both be found in blood plasma where cleavage could potentially occur

[0294] In the presence of the 8-17G cfDNAzyme, miR6865 is cleaved, ameliorating miR6865-induced suppression of its mRNA targets (CAMTAI, CHD5, CA7, GLO1). Since CAMTAI and CHD5 expression are positively correlated with survival in glioblastoma, 8-17G may play a protective role in glioblastoma. (GLO1 is prognostic in kidney and liver carcinoma; CA7 does not have any reported clinical significance).

[0295] A 10% denaturing PAGE-based cleavage assay was performed after incubation in either Tris buffer or human plasma mimic buffer at 37 C for 3 hours (FIG.34). 8-17G (active) DNAzyme cleaves miR6865 substrate in a human plasma mimic buffer in 3 hours, significantly decreasing the time required for cleavage compared to extracellular mimic buffer (24 - 48hr).Attorney Docket No. 10046-678W018-17GJE (inactive) DNAzyme does not cleave the miR6865 substrate under control (Iris) or plasma mimic conditions. The human plasma buffer mimic used is a commercial product.

[0296] 8-17G cfDz exists in plasma as uss-cfDNA. miR6865-5p exists, but no functional studies have been conducted. 8-17G cleaves miR6865 in an extracellular buffer mimic & plasma mimic. Extracellular miRNA is found complexed with AGO2, independent of EVs. miRNAs in AGO2:miRNA complexes can bind target oligonucleotides. NRP1 acts as a receptor to internalize extracellular AG02:miRNA complexes where miRNA can perform gene-regulatory function.

[0297] Target prediction tools include miRDB, miRTarBase, TargetScan, DIANA, and miRabel.TABLE 13. Revised miRNA target prediction strategy: utilization of multiple prediction tools. Ranked high (top) to low (bottom) according to each prediction tool.Attorney Docket No. 10046-678W01TABLE 14. Commonly occurring targets (occurs at least twice in TABLE 13).Example 8: Direct Metabolite Sensing by Genomic DNA Reveals a Deoxyriboswitch in Human Cells

[0298] Genomic DNA is generally viewed as a passive carrier of genetic information, with transcriptional regulation executed by proteins and regulatory RNAs. Although small -molecule metabolites influence gene expression, they are thought to act indirectly through these intermediaries. Here a study reports the discovery of a genome-encoded, metabolite-responsive DNA regulatory element in human cells. The study identifies an intronic sequence within the human SLC25A13 gene that binds adenosine with sequence specificity under physiological conditions. Biophysical measurements demonstrate direct ligand binding, while in vitro transcription assays show that adenosine binding represses transcription in a sequence- and orientation-dependent manner. In cells, this DNA element confers selective, adenosinedependent repression in an intron-containing reporter, and CRISPR-mediated disruption of the motif abolishes adenosine responsiveness at the endogenous SLC25A13 locus. These findings establish genomic DNA as a direct sensor of cellular metabolites and uncover a previously unrecognized mechanism by which metabolic state can be directly coupled to gene expressionAttorney Docket No. 10046-678W01

[0299] Transcriptional regulation of gene expression is a fundamental process in biology that has major impacts in almost all biological functions. Although small-molecule metabolites influence gene expression, they are widely regarded as acting indirectly through regulatory components rather than through direct interactions with genomic DNA itself. While proteins have long been known to serve as such regulators, riboswitches were discovered in 2002 that bind metabolites to control transcription, translation, or splicing, making RNA another class of transcriptional regulators. In contrast, no analogous DNA-based elements have been identified in vivo. This absence is particularly striking given that DNA aptamers, which are single-stranded DNA molecules capable of high- affinity and sequence-specific ligand binding, have been extensively generated in vitro through SELEX, shown to undergo target-induced conformational changes, and engineered to function in living systems for metabolite sensing and regulation. Despite these advances, whether comparable metabolite-responsive regulatory elements are encoded natively within genomic DNA remains unknown, and no such DNA-based regulatory elements have been identified in vivo. As a result, genomic DNA is still viewed as a passive carrier of genetic information.

[0300] A key barrier to genomic DNA serving as metabolite-responsive regulator is that genomic DNA exists predominantly in a double-stranded form, whereas many target-binding riboswitches and DNA aptamers are single-stranded. Despite this barrier, genomic DNA has been observed to adopt transient single-stranded conformations, such as G-quadruplexes and i-motifs during transcription and replication. These structures have been implicated in gene regulation by influencing transcriptional processes, demonstrating that genomic DNA can, in principle, form localized structures with regulatory consequences. Nevertheless, these effects are generally not sequence-encoded or target-specific, leaving unresolved whether genomic DNA itself can directly sense small molecules to control transcription. To address this issue, the study combines genome-wide homology searches of known DNA aptamers with biochemical and cellular analyses and report herein the identification of an intronic DNA element in the human SLC25A13 gene that binds adenosine with sequence specificity and represses transcription at its endogenous locus. This finding establishes genomic DNA as a direct metabolite sensor and reveals a metabolite-responsive, cis-acting regulatory mechanism encoded in the human genome, joining both proteins and riboswitches as a new class of gene regulators.

[0301] A genomic intronic SLC25A13 element binds adenosine: To identify human genomic sequences with the potential for sequence-encoded small-molecule recognition, the study performed a genome-wide homology search using a library of high-affinity DNAAttorney Docket No. 10046-678W01aptamers from established databases. Aptamer sequences were aligned to the human reference genome (hg38) with BLASTn, using an expectation threshold of 0.05. The study retained matches with >90% sequence identity across the aligned region as high-confidence candidates; genomic coordinates, alignment scores, and retained sequences are reported in TABLE 15.TABLE 15. Genome annotation of adenosine aptamer matched regions.Attorney Docket No. 10046-678W01Attorney Docket No. 10046-678W01Attorney Docket No. 10046-678W01Attorney Docket No. 10046-678W01

[0302] This screen identified multiple high-confidence genomic matches to the canonical adenosine-binding DNA aptamer (5’ ACCTGGGGGAGTATTGCGGAGGAAGGT 3’) (SEQ ID NO: 207), with the strongest matches mapping predominantly to noncoding regions. Based on the functional relevance of the associated genes to nucleotide metabolism, the study prioritized two representative candidates for further characterization. One candidate is an intronic element within SLC25A13 (5’ CTGGGGAAGTATTGCTGAGGAAGG 3’) (SEQ ID NO: 208), hereafter termed SLC25A1, and the other is an intergenic element located within MYO7A, hereafter termed MYO7AA. Both candidates share key features with the canonical aptamer, including similarity in the predicted stem-loop region and conservation of most nucleotides implicated in adenosine recognition (FIG. 37A). Mapping of these sequences to the hg38 reference genome and analysis of UCSC and ENCODE annotations revealed that both SLC25A13A and MYO7AA overlap regions annotated as candidate cis regulatory elements, consistent with a regulatory chromatin environment (FIGS. 38A-38B). This genomic location suggested that these aptamer like DNA elements could plausibly influence transcriptional activity, which motivated subsequent biochemical evaluation of their ligand-binding properties and further functional studies focused on candidates demonstrating measurable binding.

[0303] Because the sequence from neither candidate is identical to the full-length canonical aptamer, the study first examined whether they bind adenosine. Ligand binding was measured by isothermal titration calorimetry (ITC) under buffer conditions chosen to mimic the nuclear ionic concentrations containing 20 mM MOPS, 110 mM NaCl, 265 mM KC1, 10 mM MgCl₂, 0.01 mM CaCl₂, 9.5 mM Na2HPO4, and 0.01 mM ZnCl₂ at pH 7.4. As a positive control, the study measured adenosine binding by ITC using the canonical adenosine DNA aptamer (20 pM) titrated into adenosine (2 mM), yielding a dissociation constant Kd = 5.5 ± 1.7 pM (FIG.37B). This Kd is consistent with those reported in the literature. Under the same buffer condition, titration of 50 pM SLC25A13A DNA into 5 mM adenosine produced detectable adenosine binding with a dissociation constant of 16.0 ± 14.4 pM (FIG. 37C). In contrast, MY07AA showed no measurable binding to adenosine (FIG. 37D). To determine whether adenosine binding by SLC25A13A reflects sequence-defined recognition rather than nonspecific association, the study examined sequence specificity and ligand selectivity. PointAttorney Docket No. 10046-678W01mutations within the predicted binding region markedly reduced adenosine binding (FIGS.39A-39B), indicating a requirement for specific nucleotides within the motif, whereas guanosine failed to bind under identical conditions (FIG. 39C). Control titrations of adenosine into buffer alone produced no detectable signal, confirming that the observed interactions were not attributable to nonspecific heat effects (FIG. 39D). Together, these results demonstrate sequence- and ligand-specific adenosine binding by SLC25A13A, supporting its selection for subsequent functional analyses.

[0304] The SLC25A13 adenosine-binding element mediates ligand-dependent repression of in vitro transcription: To test whether the target binding at the SLC25A13A motif can modulate transcription, the study cloned a 500-bp genomic fragment containing the motif and flanking sequences downstream of a T7 promoter (FIG. 1A). The insert sequence and orientation were verified by Sanger sequencing (FIGS. 40A-40B), and the plasmid was digested with Xhol to generate a linearized transcription template for in vitro assays. A key experimental constraint is that ATP is required for T7 transcription but can also bind adenosine aptamers, potentially occupying the binding site during transcription. To decouple nucleotide requirements for transcription from aptamer-ligand recognition, the study substituted ATP with 7-deaza-ATP (FIG. IB), a nucleotide analog that supports RNA synthesis while not binding to adenosine -binding DNA aptamer. This strategy enabled titration of free adenosine without introducing competing ATP-dependent binding.

[0305] Using this 7-deaza-ATP system, the study tested whether adenosine modulates transcription from a template containing the SLC25A13A motif. Increasing adenosine concentrations reduced RNA yield in a concentration dependent manner (FIGS. 1C-1D, FIG.41A), consistent with target dependent repression. In contrast, inosine, a closely related nucleoside that does not measurably bind the motif, produced minimal changes in transcript yield under identical conditions (FIGS. 1C-1D, FIG. 3D), indicating that repression is selective for the cognate ligand. To test whether repression depends on the predicted aptamer-like binding determinants, the study introduced point mutations within the SLC25A13A region previously shown to disrupt adenosine-aptamer recognition (FIG. 1A, FIG. 39B). These mutations abolished the adenosine-dependent reduction in RNA yield (FIGS. lE-lF), demonstrating that transcriptional repression requires an intact binding site. The study further assessed sequence specificity using orientation and composition controls. A reverse-complement version of the SLC25A13A insert failed to show adenosine-dependent repression, and inosine again had minimal effect (FIG. 4IB), indicating that repression depends on the orientation of the binding motif. Similarly, a scrambled control template,Attorney Docket No. 10046-678W01matched for length and base composition, showed no reduction in RNA yield upon adenosine addition, with inosine remaining inactive across the tested concentration range (FIG. 41C). These experiments demonstrate that adenosine binding to the SLC25A13A motif represses transcription in vitro and that this effect depends on ligand identity, binding-site integrity, and sequence orientation.

[0306] The SLC25A13 adenosine-binding element mediates target-dependent repression in an intron-containing reporter: Motivated by the in vitro transcription results, the study next investigated whether the SLC25A13A motif can confer target dependent repression in cells and whether this activity is retained in an intronic context, consistent with its native location within an intron of SLC25A13. The study inserted a genomic fragment containing SLC25A13A, together with 500 bp of its upstream and downstream flanking sequence, into the intron of an EGFP reporter at nucleotide 105 of the EGFP coding sequence (FIG. 2A). This reporter architecture and insertion site have been previously used to assess intron dependent regulatory effects without disrupting EGFP expression through impaired splicing. Consistent with this design, transfection of the reporter into HEK293 cells produced robust EGFP fluorescence relative to the no-plasmid control (FIG. 2B, 0 mM compared with no plasmid panels).

[0307] The study then evaluated whether extracellular adenosine modulates reporter output. At 12 hrs after plasmid transfection, adenosine treatment reduced EGFP fluorescence in a concentration-dependent manner in cells transfected with the SLC25 Al 3A intronic reporter (FIGS. 2B-2C), indicating that the inserted element is sufficient to confer target-responsive repression in a cellular context. To test whether this response depends on the predicted aptamer-like binding determinants, the study introduced point mutations that disrupt adenosine recognition in vitro (FIG. 2A, Mutant) and compared wild-type and mutant reporters in HeLa cells. In the absence of exogenous adenosine, the mutant reporter exhibited higher baseline EGFP fluorescence than the wild-type reporter and showed a substantially attenuated response across the same adenosine concentration range (FIGS. 2D-2E), indicating that both basal repression and ligand responsiveness depend on an intact SLC25A13A motif.

[0308] To assess ligand selectivity and exclude nonspecific effects of nucleoside addition on reporter expression, the study compared adenosine with other nucleosides at a matched concentration (2 mM). Under these conditions, adenosine uniquely produced a substantial reduction in EGFP fluorescence, whereas cytidine, guanosine, and thymidine had minimal effects (FIGS. 2F-2G), consistent with selective adenosine recognition by the SLC25A13AAttorney Docket No. 10046-678W01element. Together, these data demonstrate that the SLC25A13A adenosine-binding element confers sequence- and ligand-dependent repression in an intron-containing reporter.

[0309] The intronic SLC25A13 adenosine-binding element mediates target-dependent regulation of endogenous gene expression: Having established target-dependent repression in biochemical and reporter systems, the study next examined whether SLC25A13 expression responds to adenosine under endogenous genomic conditions. To answer this question, the study quantified SLC25A13 mRNA abundance by RT-qPCR following exogenous nucleoside supplementation in mammalian cells. Accurate assessment of metabolite-dependent transcriptional responses requires stable normalization controls. Because adenosine participates in multiple cellular pathways, the study first established a normalization strategy by systematically evaluating 14 candidate reference genes across treatments with small metabolites, including ATP and adenosine. From this analysis, B2M, GAPDH, and ACTB emerged as the most stably expressed transcripts under all tested conditions. The geometric mean of these three genes was therefore used as the normalization factor for subsequent analyses. Using this normalization method, cells were incubated with 4 mM adenosine for 4 hours, and SLC25A13 mRNA levels were compared with those in control cells maintained in DMEM. Adenosine treatment resulted in a significant reduction in SLC25A13 transcript abundance (FIG. 42A), indicating that endogenous SLC25A13 expression is responsive to adenosine under these conditions. To assess ligand specificity, parallel experiments were performed using cytidine, guanosine, thymidine, and inosine. Among the nucleosides tested, only adenosine elicited a significant decrease in SLC25A13 mRNA (FIG. 42B), thereby confirming ligand selectivity.

[0310] The study next examined the dose dependence of this response. Across an adenosine titration, SLC25A13 mRNA levels decreased in a concentration-dependent manner, reaching a plateau at concentrations above 0.5 mM (FIG. 42C). This saturable dose-response is consistent with a target-dependent regulatory mechanism. To assess sequence specificity, the study analyzed MY07A and RAP1GAP2, which contain similar intronic sequences but do not bind adenosine (FIGS. 37A-37D, FIGS. 43A-43C). Neither gene showed significant changes in transcript abundance following adenosine treatment across the same concentration range (FIGS. 43D-43E). These findings identify SLC25A13 as a specific endogenous target of adenosine-dependent regulation.

[0311] To directly test locus causality, the study next investigated whether the intronic SLC25A1 A motif is required for adenosine responsiveness at the endogenous locus. Using CRISPR / Cas9, the study generated an edited cell line in which the endogenous motif wasAttorney Docket No. 10046-678W01replaced with the binding-disruptive substitutions used in earlier assays (FIG.3D). Under basal conditions, SLC25A13 mRNA levels were significantly higher in the edited cells than in wild-type cells (FIG. 42D), consistent with relief of motif-dependent repression from endogenous adenosine. The study then compared adenosine responsiveness between the edited cells and the wild-type cells. Incubation with 4 mM adenosine produced a significant reduction in SLC25A13 mRNA in wild-type cells, but no comparable reduction in the mutated cells (FIG. 42E). In contrast, inosine caused minimal changes in SLC25A1 expression in either genotype, supporting ligand specificity. Across an adenosine dose series, 0.5 mM adenosine was sufficient to reduce SLC25A13 expression in wild-type cells, whereas the edited cells showed little or no response at the same concentration (FIG.42F). At higher doses, SLC25A13 expression decreased further in wild-type cells but changed only modestly in the motif-mutant line. The modest residual response in the edited cells is consistent with incomplete disruption of adenosine recognition by the motif (FIG.38B). A two-way ANOVA confirmed a significant genotype and adenosine interaction, indicating that the dose-response relationship differs between wild-type and motif-mutant cells. These results demonstrate that endogenous adenosine responsiveness of SLC25A13 requires the integrity of the intronic SLC25A13A motif, supporting a sequence-encoded, cis-acting regulatory mechanism rather than an indirect consequence of adenosine treatment.Discussion

[0312] Small-molecule-responsive regulatory elements are central to cellular homeostasis, enabling direct coupling between metabolic state and gene expression. While proteins have long been known as such regulatory elements for gene expression, RNA riboswitches were discovered in 2002 that use target-induced conformational changes to regulate transcription, translation, or splicing without accessory proteins. In contrast, although DNA aptamers can be engineered to bind small molecules with high specificity, endogenous DNA elements with comparable metabolite-sensing and regulatory functions have not been demonstrated in the human genome. This work discovers a naturally existing intronic DNA element within the SLC25A13 gene, called SLC25A13A, that directly binds adenosine and mediates ligand-dependent transcriptional repression. Through biophysical binding assays, in vitro transcription tests, and cellular gene expression analyses, the study shows that this sequence exhibits the defining properties of a functional cis-regulatory element: it binds adenosine in a sequence-specific manner, requires intact binding determinants, and directly regulates transcription in a dose-dependent manner at its endogenous genomic locus. These effects are preserved across in vitro and in cellular experimental conditions and are abolished by targetedAttorney Docket No. 10046-678W01genome editing, establishing a direct mechanistic link between metabolite recognition by genomic DNA and gene regulation.

[0313] These results support a model in which adenosine binding to this intronic DNA element alters local DNA structure or accessibility, thereby inhibiting transcription. Although the precise molecular mechanism remains unresolved, these findings demonstrate that a double-stranded genomic DNA sequence can directly respond to a small -molecule ligand and modulate gene transcription. Conceptually, this work establishes genomic DNA as an active participant in small-molecule sensing, analogous to RNA riboswitches but operating at the level of genomic DNA. It is proposed that the SLC25A13A element functions as a deoxyriboswitch, directly linking intracellular adenosine levels to transcriptional output without intermediary RNA or protein factors. Given the central role of SLC25A13 in mitochondrial ATP metabolism, this mechanism suggests a direct feedback pathway connecting nucleotide abundance to metabolic flux.

[0314] Collectively, this work reveals a previously unrecognized regulatory capacity encoded within genomic DNA. These findings show that DNA can actively participate in sensing and responding to the metabolic state of the cell, beyond its role as a passive carrier of genetic information. The study identifies the existence of a deoxyriboswitch-like element within the human genome that directly regulates transcription in response to a specific metabolite. This discovery expands the current paradigm of gene regulation beyond protein-and RNA-based mechanisms and establishes genomic DNA as a direct contributor to metabolite-dependent transcriptional control in human cells.Materials and Methods

[0315] Cell Lines and Media: HEK293T, Hela, HCT, and HepG2 cell lines were used in this study. Similar results were observed with different cell lines. In the presented work, the plasmids assay was performed with HEK293T cells, while the qPCR assays were performed with HepGz cells. HCT cells were cultured with McCoy’s 5A media, Hela and HEK293T cells were cultured with DMEM media, and HepG2 cells were cultured with EMEM media. The cell culture maintenance followed the standard culturing protocol.127 Point mutated HepG2 cells were generated with CRISPR / Cas9 -based genome editing and a guide RNA with the sequence of 5’-TGACTGGGGAAGTATTGCTGAGG-3’ (SEQ ID NO: 33). Ribonucleoprotein (RNP) was transfected to cells to introduce a cut near the mutation site. After the cleavage, homology templates were provided to generate point mutations through homologous recombination. Mutations were identified with LongAmp Taq DNA polymerase with an annealing temperature of 60 °C. The amplicon is 1602 bp in size for wild-type cells and 1603 bp in size for the mutatedAttorney Docket No. 10046-678W01cell line. Sanger sequencing was performed with the sequencing primer to confirm the point mutations. PCR primers and sequencing primers are listed in TABLE 16. The top 10 potential off-target sites (TABLES 17-18) were validated and no off-target mutations were identified from these sites. The cell line before mutagenesis was used as wild-type control for the experiments.TABLE 16. Primers for identification of mutated cell line.TABLE 17. Potential off-target sites evaluated for the gRNA.TABLE 18. Potential off-target sites evaluated for the gRNA (continued).Attorney Docket No. 10046-678W01

[0316] Isothermal Titration Calorimetry (ITC): DNA sequences were ordered from IDT and purified with Amicon® Ultra Centrifugal Filter. Both adenosine and DNA were diluted in the nucleus environment mimicking buffer: 20 mM MOPS, 110 mM NaCl, 265 mM KC1, 10 mM MgCl2, 0.01 mM CaCl2, 9.5 mM Na2HPO4, and 0.01 mM ZnCl2at pH 7.4. A titration of adenosine into DNA sequences was performed, and the heat release was recorded. Data processing and calculations followed the standard protocol.128 When testing the binding of the double-stranded DNA, the forward and reverse strands are mixed at 1:1 ratio in the nucleus mimicking buffer, and incubated at 95 °C for 5 min, then cooled down with a speed of 0.5 °C per 30 s until reached 25 °C. After this annealing step, the DNA were diluted to desired concentration and a titration of adenosine into the double-stranded DNA were performed with nano ITC.

[0317] Gel-based in vitro transcription assay: The aptamer sequence including 500 bp upstream and downstream was synthesized as gblocks, and cloned into PCRII Topo vector following the standard protocol. The plasmids were sequenced to confirm the sequence and the inserted direction. Plasmids with forward insertion were digested with Xhol to generate the linearized template for in vitro transcription. The in vitro transcriptions were performed with NEB standard protocol for RNA synthesis. 100 ng DNA templates were used, and ATP was replaced with the same amount of 7 -deaza- ATP. Master mixes were made for all the compounds without adenosine. 2x stock solution of Adenosine or analogous were made in water and adjusted to pH 7.0 with NaOH. Then the stock solution was mixed with other components for in vitro transcription. The systems were incubated at 37 degrees for 1.5 hr, then a 1% agarose gel was run with the same loading amount for visualizing the bands. The gels were stained with SYBR gold and imaged with a Biorad Gel Doc imaging system. The intensity of each band was quantified with Image Lab Software. The transcriptional products were normalized by dividing the intensity of the RNA product by the intensity of the DNA template and were used for the comparison between treatments.Attorney Docket No. 10046-678W01

[0318] In vitro transcription assay in living cells: A GFP plasmid, pEGFP-SLC23A13- intron, with an intron inserted at nucleotide 105 ol' EGFP cDNA124 was prepared by replacing the middle region of the P-globin intron with SLC25A13A sequence together with 445 bp of its upstream and downstream sequence. The artificial intron region kept 231 bp of the head and the tail regions of the P-globin intron, IVS2-654, to maintain the key compounds for splicing. The pEGFP-SLC25A13-intron plasmid was prepared in two steps. First, an intermediate plasmid was prepared by assembling two PGR fragments using the NEBuilder HiFi DNA Assembly Kit (NEB). The first PCR fragment was generated using F-EGFP105-vec, R-EGFP105-vec as primers, and pEGFP-Nl plasmid was used as the template (primer sequences see TABLE 16). The pEGFP-N 1 plasmid was assembled from EGFP-pBAD and dClover2-Nl plasmids. EGFP-pBAD was a gift from Michael Davidson (Addgene plasmid # 54762; RRID: Addgene_54762) and dClover2-Nl was a gift from Michael Davidson (Addgene plasmid # 54538; RRID: Addgene__54538). The second PCR fragment was generated using F-EGFP105-ins and R-EGFP105-ins as primers and slc25al3-intron-EGFP-2 as the template. Then, the full pEGFP-slc25al3-intron plasmid was prepared using the Q5 Site-Directed Mutagenesis Kit (NEB) on the intermediate plasmid using F-slc25al3-intron-EGFP-l and F-slc25al3-intron-EGFP-2 as primers to insert the high GC region. Mutated control plasmids were generated with an NEB Q5 site-directed mutagenesis kit, and the same mutation as the in-test tube in vitro transcriptional assay was generated. The sequence of the plasmids was confirmed with Sanger sequencing. The plasmids were then transfected into HEK293T cells with 4 hr incubation with TurboFect. The cells were changed into DMEM with different concentrations of Adenosine after transfection and imaged overnight. The fluorescence intensity of GFP-positive cells was quantified with Image J and compared between groups.

[0319] qPCR analysis: Cells were cultured in 24 well plates and incubated with different concentrations of adenosine or its analogous for 4 hrs before the RNA extraction. The pH of the chemicals was balanced into neutral pH according to the color of phenol red inside of the EMEM media. RNA extraction was performed with the magnetic mRNA isolation kit from NEB Company (S1550) and followed the standard protocol. The concentrations of RNA were detected with nanodrop. 10 ng RNA was used per well to serve as the template. The qPCR was performed with iTaqTM Universal SYBR® Green One-Step Kit and the BioRad CFX96 Touch Real-Time PCR machine with three technical replicates. Reference genes were selected from published primer pairsl30,131 according to their stability under different chemical treatments. Negative control was reverse -transcriptase-free mRNA prepared together with the cDNA and was used to observe the cross-contamination or genomic DNA contamination. A standard curveAttorney Docket No. 10046-678W01was performed before each experiment to decide the proper dilution for the cDNA template. At least three biological replicates were performed and quantified as the single data points on the graph for comparison between different genotypes and treatments. Relative expression of SLC25A13 was quantified as 2-AACt and normalized with the average expression of B2M, ACTB, and GAPDH were used as the reference. The PCR primers are listed in TABLE 19.TABLE 19. qPCR primers used.

[0320] Statistical analysis and imaging processing: To compare the differential expression between groups, the study used an unpaired student t- test to compare the differences between two individual groups. For the comparison between genotypes with different concentrations of treatment, the study used two-way ANOVA to estimate the differences and interactions between variations. *, p<0.05; **, pcO. Ol; ***, pcO. OOl. Individual figure panels were generated with GraphPad 5.EXAMPLE ASPECTS

[0321] Example 1: A method to identify naturally occurring DNAzymes and / or DNA aptamers, the method comprising: a) providing a first database comprising sequences of DNAzymes, DNA aptamers, or portions thereof; b) providing a second database comprising naturally occurring nucleic acid sequences; and c) searching the second database for a first match sequence comprising about 90% similarity or more to a sequence in the first database using an algorithm that finds regions of local similarity between sequences; wherein the local similarity has an expectation threshold of about 0.05 or less.Attorney Docket No. 10046-678W01

[0322] Example 2: The method of any examples herein, particularly Example 1, wherein the second database comprises mRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof.

[0323] Example 3: The method of any examples herein, particularly Example 1, wherein NCBI standard nucleotide BLAST blastn is used to find local similarity between sequences.

[0324] Example 4: The method of any examples herein, particularly Examples 1-3, wherein the first match sequence is a DNA aptamer comprising a binding nucleic acid which selectively binds to a target molecule.

[0325] Example 5: The method of any examples herein, particularly Example 4, wherein the target molecule is an amino acid, adenosine, xanthine, 4-HNE, methylglyoxal, cyclic AMP, NAD+, NADPH, SAM (S-adenosylmethionine), CoA, acetyl-CoA, 2-hydroxyglutarate, choline, phosphocholine, GSH (glutathione), thrombin, ATP, glutathione, sugar, or hemin.

[0326] Example 6: The method of any examples herein, particularly Examples 1-3, wherein the first match sequence is an enzyme strand of a DNAzyme.

[0327] Example 7: The method of any examples herein, particularly Example 6, wherein the enzyme strand is capable of cleaving a substrate strand in the presence of a target molecule

[0328] Example 8: The method of any examples herein, particularly Example 7, wherein the target molecule is Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+, or Cr3+.

[0329] Example 9: The method of any examples herein, particularly Examples 6-8, wherein the method further comprises: d) designing a substrate strand that is at least partially complementary to the enzyme strand; e) providing a third database comprising naturally occurring nucleic acid sequences; and f) searching the third database for a second match sequence comprising query coverage of about 60% or more, target coverage of about 60% or more, and / or sequence similarity of about 80% or more to the substrate strand using an algorithm that finds regions of local similarity between sequences.

[0330] Example 10: The method of any examples herein, particularly Example 9, wherein the second database comprises cfDNA and / or genomic DNA, and the third database comprises mRNA, pre-miRNA, miR A, siRNA, or any combination thereof.

[0331] Example 11: The method of any examples herein, particularly Examples 1-3, wherein the first match sequence is a substrate strand of a DNAzyme which can be cleaved by an enzyme strand.Attorney Docket No. 10046-678W01

[0332] Example 12: The method of any examples herein, particularly Example 11, wherein the substrate strand can be cleaved by an enzyme strand in the presence of a target molecule.

[0333] Example 13: 'Hie method of any examples herein, particularly Example 12, wherein the target molecule is Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+, or Cr3+.

[0334] Example 14: The method of any examples herein, particularly Examples 11-13, wherein the method further comprises: d) engineering an enzyme strand that is at least partially complementary to the substrate strand; e) providing a third database comprising naturally occurring nucleic acid sequences; and 1) searching the third database for a second match sequence comprising query coverage of about 60% or more, target coverage of about 60% or more, and / or sequence similarity of about 80% or more to the substrate strand using an algorithm that finds regions of local similarity between sequences.

[0335] Example 15: The method of any examples herein, particularly Example 14, wherein the second database comprises niRNA, pre-miRNA, miRNA, siRNA, or any combination thereof, and the third database comprises cfDNA and / or genomic nucleic acid.

[0336] Example 16: A DNAzyme or DNA aptamer identified by the method of any examples herein, particularly Examples 1-15 and further engineered to comprise a detectable signal.

[0337] Example 17: The DNAzyme or DNA aptamer of any examples herein, particularly Example 16, wherein the detectable signal is a fluorophore or fluorescent dye.

[0338] Example 18: A system comprising: a processor; and a memory having instructions stored thereon, wherein execution of the instructions by a processor causes the processor to perform the method of any examples herein, particularly Examples 1-15.

[0339] Example 19: The system of any examples herein, particularly Example 18, further comprising a data store comprising the first database, the second database, and / or the third database.

[0340] Example 20: A computer readable medium having instructions stored thereon, wherein execution of the instructions by a processor causes the processor to perform the method of any examples herein, particularly Examples 1-15.

[0341] Example 21: A DNA aptamer identified by the method of any examples herein, particularly Examples 4-5.

[0342] Example 22: A DNA aptamer comprising: a naturally occurring nucleic acid which selectively binds to a target molecule; and a signaling nucleic acid which is at least partiallyAttorney Docket No. 10046-678W01complementary to at least a portion of the naturally occurring nucleic acid; wherein, when the naturally occurring nucleic acid is bound to the target molecule, the signaling nucleic acid produces a detectable signal.

[0343] Example 23: The DNA aptamer of any examples herein, particularly Example 22, wherein the naturally occurring nucleic acid comprises mRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof.

[0344] Example 24: The DNA aptamer of any examples herein, particularly Examples 22- 23, wherein the target molecule is an amino acid, adenosine, xanthine, 4-HNE, methylglyoxal, cyclic AMP, NAD+, NADPH, SAM (S-adenosylmethionine), CoA, acetyl-CoA, 2-hydroxyglutarate, choline, phosphocholine, GSH (glutathione), thrombin, ATP, glutathione, sugar, or hemin.

[0345] Example 25: The DNA aptamer of any examples herein, particularly Examples 22- 24, wherein the signaling nucleic acid comprises one or more modifications selected from: one or more non-naturally occurring nucleotides; one or more non-naturally occurring linkages; a hairpin loop; and one or more spacers.

[0346] Example 26: The DNA aptamer of any examples herein, particularly Example 25, wherein the one or more non-naturally occurring nucleotides comprise locked nucleotides, 2’- O-Me-modified nucleotides, inverted nucleotides, peptide nucleotides, or any combination thereof; wherein the one or more non-naturally occurring linkages comprise phosphorothioate linkages, methylphosphonate linkages, oranophosphate linkages, morpholino linkages, or any combination thereof; and wherein the one or more spacers comprise Ci-6 alkyl.

[0347] Example 27: 'The DNA aptamer of any examples herein, particularly Examples 22-26, wherein the signaling nucleic acid is shorter than the naturally occurring nucleic acid.

[0348] Example 28: The DNA aptamer of any examples herein, particularly Example 27, wherein the signaling nucleic acid is from about 10% to less than 100% of the length of the binding nucleic acid.

[0349] Example 29: The DNA aptamer of any examples herein, particularly Examples 22- 28, wherein the target molecule and the signaling nucleic acid bind the naturally occurring nucleic acid in non-overlapping regions of the naturally occurring nucleic acid.

[0350] Example 30: The DNA aptamer of any examples herein, particularly Examples 22- 29, wherein, when the target molecule is bound to the naturally occurring nucleic acid, one or more properties in the naturally occurring nucleic acid change.

[0351] Example 31: The DNA aptamer of any examples herein, particularly Example 30, wherein the one or more properties of the naturally occurring nucleic acid comprise aAttorney Docket No. 10046-678W01conformational change, a difference in melting temperature, and / or a variation in sensitivity to pH or another environmental condition.

[0352] Example 32: The DNA aptamer of any examples herein, particularly Examples 30- 31, wherein the changes to one or more properties of the naturally occurring nucleic acid causes the signaling nucleic acid to dissociate from the naturally occurring nucleic acid.

[0353] Example 33: The DNA aptamer of any examples herein, particularly Examples 22- 32, wherein the detectable signal comprises a fluorophore or a fluorescent dye conjugated to the signaling nucleic acid.

[0354] Example 34: The DNA aptamer of any examples herein, particularly Example 33, wherein the fluorophore or fluorescent dye is Hydroxycoumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC, Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X-Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5 581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Cy5.5, LC red 705, Cy7, IRDye 800 CW, IRDye 700, Cy7.5, Dy780, Dy781, DyLight 800, IRDye 800 CW, Alexa Fluor 647, Alexa Fluor 488, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 750, Alexa Fluor 790, JOE, or MAX.

[0355] Example 35: The DNA aptamer of any examples herein, particularly Examples 22-34, wherein the detectable signal comprises a barcode sequence.

[0356] Example 36: The DNA aptamer of any examples herein, particularly Example 35, wherein the signaling nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the naturally occurring nucleic acid is bound to the target molecule.

[0357] Example 37: 'The DNA aptamer of any examples herein, particularly Example 36, wherein the naturally occurring nucleic acid comprises the barcode sequence, and wherein the barcode sequence is amplifiable when the naturally occurring nucleic acid is bound to the target molecule.

[0358] Example 38: A method of detecting a naturally occurring nucleic acid in a sample, the method comprising: providing to the sample the DNA aptamer of any examples herein, particularly Example 21 or the DNA aptamer of any examples herein, particularly Examples 22-37; and detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid.Attorney Docket No. 10046-678W01

[0359] Example 39: The method of any examples herein, particularly Example 38, wherein the sample is a cell, tissue, cell lysate, or biological fluid.

[0360] Example 40: The method of any examples herein, particularly Examples 38-39, wherein the method takes place in vitro, in vivo, or ex vivo.

[0361] Example 41: The method of any examples herein, particularly Examples 38-40, further comprising providing the target molecule to the sample.

[0362] Example 42: A method of determining presence, location, and / or severity of a disease or disorder in a subject, the method comprising: providing the DNA aptamer of any examples herein, particularly Example 21 or the DNA aptamer of any examples herein, particularly Examples 22-37 to the subject or a sample taken from the subject; and detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid; wherein overexpression of the naturally occurring nucleic acid indicates presence of a disease or disorder and / or increased severity of a disease or disorder.

[0363] Example 43: A method of treating and / or preventing a disease or disorder in a subject in need thereof, the method comprising: providing the DNA aptamer of any examples herein, particularly Example 21 or the DNA aptamer of any examples herein, particularly Examples 22-37 to the subject or a sample taken from the subject; detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid; wherein overexpression of the naturally occurring nucleic acid indicates presence of a disease or disorder and / or increased severity of a disease or disorder; and if presence of the disease or disorder is detected, administering one or more therapeutic agents to die subject.

[0364] Example 44: The method of any examples herein, particularly Example 43, wherein location of the disease or disorder is determined by distribution of the detectable signal within the subject, and the one or more therapeutic agents are delivered to the location of the disease or disorder.

[0365] Example 45: The method of any examples herein, particularly Examples 43-44, wherein a higher amount of the detectable signal indicates higher expression of the naturally occurring nucleic acid, thereby indicating increased severity of the disease or disorder.

[0366] Example 46: The method of any examples herein, particularly Examples 43-45, wherein overexpression of the naturally occurring nucleic acid is associated with overexpression of the target molecule.noAttorney Docket No. 10046-678W01

[0367] Example 47: The method of any examples herein, particularly Examples 43-46, wherein the disease or disorder is cancer or a tumor; and wherein the naturally occurring nucleic acid is an oncogenic miRNA, or a pre-miRNA associated with an oncogenic miRNA.

[0368] Example 48: The method of any examples herein, particularly Example 47, wherein the naturally occurring nucleic acid is miR-21, miR-155, miR-lOb, pre-miR-21, pre-miR-155, or pre-miR-lOb.

[0369] Example 49: The method of any examples herein, particularly Examples 43-48, wherein the disease or disorder is Alzheimer’s, Huntington’s, ALS, or another neurological disease or disorder, and wherein the naturally occurring nucleic acid is miR-29a, miR-29b, miR-7, miR-132, miR-218, miR-9 / 9*. or miR-124a; wherein the disease or disorder is myocardial infarction or another cardiac disease or disorder, and wherein the naturally occurring nucleic acid is miR-1; wherein the disease or disorder is systemic lupus erythematosus (SEE), psoriasis, or another autoimmune disease or disorder, and wherein the naturally occurring nucleic acid is niiR-146a or miR-31; or wherein the disease or disorder is hepatis C virus (HCV) infection or another viral, bacterial, fungal, or parasitic infection, and wherein the naturally occurring nucleic acid is miR-122.

[0370] Example 50: The method of any examples herein, particularly Examples 43-49, further comprising providing the target molecule to the subject or the sample.

[0371] Example 51: The method of any examples herein, particularly Examples 43-50, wherein the sample is a cell, tissue, cell lysate, or biological fluid.

[0372] Example 52: A DNAzyme identified by the method of any examples herein, particularly Examples 11-13.

[0373] Example 53: A DNAzyme comprising: an enzyme strand comprising two arms and a catalytic core disposed between the two arms; wherein at least one of the two arms is at least partially complementary to a naturally occurring nucleic acid; and wherein the catalytic core is capable of cleaving the naturally occurring nucleic acid.

[0374] Example 54: The DNAzyme of any examples herein, particularly Example 53, wherein the naturally occurring nucleic acid comprises niRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof.

[0375] Example 55: The DNAzyme of any examples herein, particularly Examples 53-54, wherein the two arms have a same or different lengths.

[0376] Example 56: The DNAzyme of any examples herein, particularly Examples 53-55, wherein each of the two binding arms independently is from about 5 to about 1 nucleotides in length.Attorney Docket No. 10046-678W01

[0377] Example 57: The DNAzyme of any examples herein, particularly Examples 53-56, wherein both of the two arms are at least partially complementary to the naturally occurring nucleic acid.

[0378] Example 58: The DNAzyme of any examples herein, particularly Examples 53-57, wherein one or both of the two arms is about 60% or more complementary to the naturally occurring nucleic acid.

[0379] Example 59: The DNAzyme of any examples herein, particularly Examples 53-58, wherein the enzyme strand comprises one or more modifications selected from: one or more non-naturally occurring nucleotides; one or more non-naturally occurring linkages; a hairpin loop; and one or more spacers.

[0380] Example 60: The DNAzyme of any examples herein, particularly Example 59, wherein the one or more non-naturally occurring nucleotides comprise locked nucleotides, 2’-O-Me-modified nucleotides, inverted nucleotides, peptide nucleotides, or any combination thereof; wherein the one or more non-naturally occurring linkages comprise phosphorothioate linkages, methylphosphonate linkages, oranophosphate linkages, morpholino linkages, or any combination thereof; and wherein the one or more spacers comprise Ci-6 alkyl.

[0381] Example 61: The DNAzyme of any examples herein, particularly Examples 53-60, wherein the naturally occurring nucleic acid is pre-miR-21, and the enzyme strand comprises about 80% sequence similarity or more to any one of SEQ ID NOS: 3-32; or wherein the naturally occurring nucleic acid is hsa-miR-6865-5p, hsa-miR-4740-3p, hsa-miR-892c-5p, hsa-miR-147b-3p, or hsa-miR-6827-5p and the enzyme strand comprises about 80% sequence similarity or more to SEQ ID NO: 125 or any one of SEQ ID NOS: 165-170.

[0382] Example 62: The DNAzyme of any examples herein, particularly Examples 53-61, wherein the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule.

[0383] Example 63: The DNAzyme of any examples herein, particularly Example 62, wherein the target molecule is Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+, or Cr3+.

[0384] Example 64: The DNAzyme of any examples herein, particularly Examples 62-63, wherein the target molecule is Mg2+, and the catalytic core comprises SEQ ID NO: 1 or a variant thereof.

[0385] Example 65: The DNAzyme of any examples herein, particularly Example 64, wherein the naturally occurring nucleic acid comprises a5’-AG-3’ motif or a5’-GG-3’ motif; and wherein the catalytic core cleaves the naturally occurring acid at said motif.Attorney Docket No. 10046-678W01

[0386] Example 66: The DNAzyme of any examples herein, particularly Examples 62-63, wherein the target molecule is Zn2+, and the catalytic core comprises SEQ ID NO: 2 or a variant thereof.

[0387] Example 67: The DNAzyme of any examples herein, particularly Example 66, wherein the naturally occurring nucleic acid comprises a 5’-GU-3’ motif or a 5’-AU-3’ motif; and wherein the catalytic core cleaves the naturally occurring acid at said motif.

[0388] Example 68: A method of cleaving a naturally occurring nucleic acid in a sample, the method comprising providing to the sample the DNAzyme of any examples herein, particularly Example 52 or the DNAzyme of any examples herein, particularly Examples 53-67; wherein the DNAzyme is capable of cleaving the naturally occurring nucleic acid.

[0389] Example 69: The method of any examples herein, particularly Example 68, wherein the sample is a cell, tissue, cell lysate, or biological fluid.

[0390] Example 70: The method of any examples herein, particularly Examples 68-69, wherein the method occurs in vitro, in vivo, or ex vivo.

[0391] Example 71: The method of any examples herein, particularly Examples 68-70, wherein the DNAzyme cleaves multiple copies of the naturally occurring nucleic acid.

[0392] Example 72: The method of any examples herein, particularly Examples 68-71, wherein the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule; and wherein the method further comprises providing the target molecule to the sample.

[0393] Example 73: A method of decreasing levels of a naturally occurring nucleic acid in a cell or tissue, the method comprising: providing to the cell or tissue the DNAzyme of any examples herein, particularly Example 52 or the DNAzyme of any examples herein, particularly Examples 53-67; wherein the DNAzyme is capable of cleaving the naturally occurring nucleic acid; and wherein the naturally occurring nucleic acid is overexpressed in the cell or tissue.

[0394] Example 74: The method of any examples herein, particularly Example 73, wherein overexpression of the naturally occurring nucleic acid indicates presence of a disease or disorder and / or increased severity of a disease or disorder.

[0395] Example 75: The method of any examples herein, particularly Example 74, wherein the disease or disorder is cancer or a tumor; and wherein the naturally occurring nucleic acid is an oncogenic miRNA, or a pre-miRNA associated with an oncogenic miRNA.Attorney Docket No. 10046-678W01

[0396] Example 76: The method of any examples herein, particularly Example 75, wherein the naturally occurring nucleic acid is miR-21, miR-155, miR-lOb, pre-miR-21, pre-miR-155, or pre-miR-lOb.

[0397] Example 77: The method of any examples herein, particularly Example 74, wherein the disease or disorder is Alzheimer’s, Huntington’s, ALS, or another neurological disease or disorder, and wherein the naturally occurring nucleic acid is miR-29a, miR-29b, niiR-7, miR-132, miR-218, miR-9 / 9*, or miR-124a; wherein tire disease or disorder is myocardial infarction or another cardiac disease or disorder, and wherein the naturally occurring nucleic acid is miR-1; wherein the disease or disorder is systemic lupus erythematosus (SEE), psoriasis, or another autoimmune disease or disorder, and wherein the naturally occurring nucleic acid is miR-146a or miR-31; or wherein the disease or disorder is hepatis C virus (HCV) infection or another viral, bacterial, fungal, or parasitic infection, and wherein the naturally occurring nucleic acid is miR-122.

[0398] Example 78: The method of any examples herein, particularly Examples 73-77, wherein the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule; and wherein overexpression of the naturally occurring nucleic acid is associated with overexpression of the target molecule.

[0399] Example 79: The method of any examples herein, particularly Example 78, further comprising providing the target molecule to the cell or tissue.

[0400] Example 80: A method of treating and / or preventing cancer or a tumor in a subject in need thereof, the method comprising: providing to the subject the DNAzyme of any examples herein, particularly Example 52 or the DNAzyme of any examples herein, particularly Examples 53-67; wherein the DNAzyme is capable of cleaving an oncogenic miRNA or a pre-miRNA associated with an oncogenic miRNA.

[0401] Example 81: Hie method of any examples herein, particularly Example 80, wherein the naturally occurring nucleic acid is miR-21, miR-155, miR-lOb, pre-miR-21, pre-miR-155, or pre-miR-lOb.

[0402] Example 82: The method of any examples herein, particularly Examples 80-81, wherein the catalytic core is capable of cleaving the naturally occurring nucleic acid in the presence of a target molecule; and wherein overexpression of the naturally occurring nucleic acid is associated with overexpression of the target molecule.

[0403] Example 83: The method of any examples herein, particularly Example 82, further comprising administering the target molecule to the subject.Attorney Docket No. 10046-678W01

[0404] Example 84: The method of any examples herein, particularly Examples 80-83, wherein the method decreases tumor cell proliferation and / or migration.

[0405] Example 85: The method of any examples herein, particularly Examples 80-84, further comprising administering one or more anti-cancer treatments to the subject.

[0406] Example 86: A method of gene editing in a cell or tissue, the method comprising: providing to the subject the DNAzyme of any examples herein, particularly Example 52 or the DNAzyme of any examples herein, particularly Examples 53-67; wherein the DNAzyme is capable of cleaving genomic DNA.

[0407] Example 87: A DNAzyme comprising: a substrate strand comprising a cleavage site; and an enzyme strand at least partially complementary to the substrate strand; wherein the enzyme strand is capable of cleaving the substrate strand at the cleavage site; wherein, when the substrate strand is cleaved, the cleaved substrate strand triggers upregulation or downregulation of expression of a nucleic acid encoding a target protein.

[0408] Example 88: The DNAzyme of any examples herein, particularly Example 87, wherein the nucleic acid encoding the target protein is a naturally occurring gene.

[0409] Example 89: The DNAzyme of any examples herein, particularly Example 87, wherein the nucleic acid encoding the target protein is a non-naturally occurring vector.

[0410] Example 90: The DNAzyme of any examples herein, particularly Examples 87-89, wherein the substrate strand comprises shRNA targeting the nucleic acid sequence encoding the target protein; and wherein cleavage of the substrate strand deactivates the shRNA such that said shRNA can no longer block expression of the target protein.

[0411] Example 91: 'The DNAzyme of any examples herein, particularly Examples 87-90, wherein the target protein provides a detectable signal.

[0412] Example 92: The DNAzyme of any examples herein, particularly Example 91, wherein the target protein is fluorescent.

[0413] Example 93: The DNAzyme of any examples herein, particularly Examples 87-92, wherein the enzyme strand is capable of cleaving the substate strand at the cleavage site in presence of a target molecule.

[0414] Example 94: 'The DNAzyme of any examples herein, particularly Examples 87-93, wherein the target protein has a therapeutic effect.

[0415] Example 95: The DNAzyme of any examples herein, particularly Examples 87-94, wherein the target molecule is Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+, or Cr3+.Attorney Docket No. 10046-678W01

[0416] Example 96: A method of upregulating or downregulating expression of a target protein in a sample, subject, or system, the method comprising: providing to the sample, subject, or system the DNAzyme of any examples herein, particularly Examples 87-95; wherein the DNAzyme is capable of triggering upregulation or downregulation of expression of a nucleic acid encoding the target protein; and wherein the sample, subject, or system comprises a nucleic acid encoding the target protein.

[0417] Example 97: The method of any examples herein, particularly Example 96, wherein the sample is a cell, tissue, cell lysate, or a biological fluid.

[0418] Example 98: The method of any examples herein, particularly Example 96, wherein the subject is a human, animal, or plant.

[0419] Example 99: The method of any examples herein, particularly Example 96, wherein the system is an environmental system or an industrial system.

[0420] Example 100: The method of any examples herein, particularly Examples 96-99, further comprising administering a non-naturally occurring vector encoding the target protein to the sample, subject, or system.

[0421] Example 101: The method of any examples herein, particularly Examples 96-100, wherein the enzyme strand is capable of cleaving the substate strand at the cleavage site in presence of a target molecule; and wherein the method further comprises administering the target molecule to the sample, subject, or system.

[0422] Example 102: The method of any examples herein, particularly Example 101, wherein the method is used to express the target protein only upon administration of the target molecule.

[0423] Example 103: The method of any examples herein, particularly Examples 96-102, wherein the enzyme strand is capable of cleaving the substate strand at the cleavage site in presence of a target molecule; and wherein the sample, subject, or system comprises the target molecule before the DNAzyme is provided.

[0424] Example 104: The method of any examples herein, particularly Example 103, wherein the subject is a human or animal, and wherein the method is used to express the target protein only if the target molecule is present.

[0425] Example 105: The method of any examples herein, particularly Example 103, wherein the subject is a plant in soil, and wherein the method is used to express the target protein only if the target molecule is present in the soil.

[0426] Example 106: The method of any examples herein, particularly Example 103, wherein the system is an environmental system or an industrial system, and wherein the methodAttorney Docket No. 10046-678W01is used to express the target protein only if the target molecule is present in the environmental system or industrial system.

[0427] Example 107: The method of any examples herein, particularly Examples 96-106, wherein the method occurs in vivo, in vitro, or ex vivo.

[0428] Example 108: A method of detecting a target molecule in a sample, the method comprising: providing to the sample the DNAzyme of any examples herein, particularly Examples 87-95; wherein the enzyme strand is capable of cleaving the substate strand at the cleavage site in presence of a target molecule; wherein the DNAzyme is capable of triggering upregulation or downregulation of expression of a nucleic acid encoding a target protein; wherein the sample comprises the nucleic acid encoding the target protein; wherein the target protein provides a detectable signal upon cleavage of the substrate strand; and detecting presence or absence of the detectable signal, thereby indicating presence or absence of the target molecule in the sample.

[0429] Example 109: The method of any examples herein, particularly Example 108, wherein the target protein is eGFP or mRuby.

[0430] Example 110: The method of any examples herein, particularly Examples 108-109, wherein the sample is a cell, tissue, cell lysate, biological fluid, an environmental sample, or an industrial sample.

[0431] Example 111: The method of any examples herein, particularly Examples 108-110, further comprising administering a non-naturally occurring vector encoding the target protein to the sample.

[0432] Example 112: The method of any examples herein, particularly Examples 108-111, wherein the method occurs in vivo, in vitro, or ex vivo.

[0433] The following patents, applications and publications as listed below and throughout this document are hereby incorporated by reference in their entirety herein.Reference ListAbou Assi, H.; et al. I-Motif DNA: Structural Features and Significance to Cell Biology. Nucleic Acids Res. 2018, 46 (16), 8038-8056.Adams, L. Pri-miRNA processing: structure is key. Nat Rev Genet 18, 145-145 (2.017). Ali Syeda, Z., et al. Regulatory Mechanism of MicroRNA Expression in Cancer. Int J Mol Sci 21, 1723 (2020).Attorney Docket No. 10046-678W01Alkliamis, O. et al., Innovative engineering and sensing strategies for aptamer- based small¬ molecule detection. TrAC Trends Anal. Chem. 121, 115699 (2019).Alkhamis, O. et al., Label-free profiling of DNA aptamer-small molecule binding using T5 exonuclease. Nucleic Acids Res. 48, e!20 (2020).Altschul, S. F.; et al. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215 (3), 403- 410.Amable, P. R.; et al. Identification of Appropriate Reference Genes for Human Mesenchymal Cells during Expansion and Differentiation. PLOS ONE 2013, 8 (9), e73792.Amato, J.; et al. Noncanonical DNA Secondary Structures as Drug Targets: The Prospect of the i-Motif. ChemMedChem 2014, 9 (9), 2026-2030.Andersson, R.; Sandelin, A. Determinants of Enhancer and Promoter Activities of Regulatory Elements. Nat. Rev. Genet. 2020, 21 (2), 71-87.Apta-IndexTM (Aptamer Database) - Library of 800+ Aptamers. APTAGEN Labs.Ardekani, A. M. & Naeini, M. M. The Role of MicroRNAs in Human Diseases. Avicenna J Med Biotechnol 2, 161-179 (2010).Arroyo, J. D. et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc. Natl. Acad. Sci., 2011, 108(12), 5003-5008. Askari, A.; et al. UTexas Aptamer Database: The Collection and Long-Term Preservation of Aptamer Sequence Information. Nucleic Acids Res. 2024, 52 (DI ), D351-D359.Bahai, R.; et al. In vivo Correction of Anaemia in P-Thalassemic Mice by yPNA-Mediated Gene Editing with Nanoparticle Delivery. Nat. Commun. 2016, 7, 13304.Banik, M. et al., Delivering DNA Aptamers Across the Blood-Brain Barrier Reveals Heterogeneous Decreased ATP in Different Brain Regions of Alzheimer’s Disease Mouse Models. ACS Cent. Sci. 10, 1585-1593 (2.024).Barrick, J. E.; Breaker, R. R. The Distributions, Mechanisms, and Structures of Metabolite- Binding Riboswitches. Genome Biol. 2007, 8 (11), R239.Bartel, D. P. Metazoan MicroRNAs. Cell 173, 20-51 (2018).Attorney Docket No. 10046-678W01Bautista-Sanchez, D. et al. The Promising Role of miR-2.1 as a Cancer Biomarker and Its Importance in RNA-Based Therapeutics. Molecular Therapy - Nucleic Acids 20, 409-420 (2020).Bedard, A.-S. V.; et al. Riboswitch Regulation Mechanisms: RNA, Metabolites and Regulatory Proteins. Biochim. Biophys. Acta BBA - Gene Regul. Meeh. 2020, 1863 (3), 194501.Benabdallah, N. S.; Bickmore, W. A. Regulatory Domains and Their Mechanisms. Cold Spring Harb. Symp. Quant. Biol. 2015, 80, 45-51.Bjursell, G.; et al. Long Regions of Single-Stranded DNA in Human Cells. Nature 1979, 280 (5721), 420-423.Bochman, M. L.; et al. DNA Secondary Structures: Stability and Function of G-Quadruplex Structures. Nat. Rev. Genet. 2012, 13 (11), 770-780.Bock, L. C. et al., Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564-566 (1992).Bocobza, S.; et al. Riboswitch-Dependent Gene Regulation and Its Evolution in the Plant Kingdom. Genes Dev. 2007, 21 (22), 2874-2879.Bonaccio, M., et al. Kinetic and thermodynamic characterization of the RNA-cleaving 8-17 deoxyribozyme. Nucleic acids research 32, 916-925 (2004).Boots, J. L.; et al. Genomic SELEX. In Handbook of RNA Biochemistry: John Wiley & Sons, Ltd, 2014; pp 1185-1206.Boratyn, G. M.; et al. BLAST: A More Efficient Report with Usability Improvements.Nucleic Acids Res. 2013, 41 (Web Server issue), W29-33.Breaker, R. R. & Joyce, G. F. A DNA enzyme that cleaves RNA. Chem. Biol. 1, 223-229 (1994).Breaker, R. R. DNA Aptamers and DNA Enzymes. Curr. Opin. Chem. Biol. 1997, 1 (1), 26-31.Breaker, R. R. Riboswitches and Translation Control. Cold Spring Harb. Perspect. Biol. 2018, 10 (11), a032797.Attorney Docket No. 10046-678W01Brown, A. et al., Development of Better Aptamers: Structured Library Approaches, Selection Methods, and Chemical Modifications. Angew. Chem. 63, e202318665 (2024).Brown, S. L. et al., The i-Motif as a Molecular Target: More Than a Complementary DNA Secondary Structure. Pharmaceuticals 14, 96 (2021).Bruesehoff, P., et al. Improving metal ion specificity during in vitro selection of catalytic DNA. Combinatorial chemistry & high throughput screening 5, 327-335 (2002).Brunderova, M.; et al. Chloroacetamide-Modified Nucleotide and RNA for Bioconjugations and Cross-Linking with RNA-Binding Proteins. Angew. Chem. 2023, 135 (7), e202213764. Buccitelli, C.; Selbach, M. mRNAs, Proteins and the Emerging Principles of Gene Expression Control. Nat. Rev. Genet. 2020, 21 (10), 630-644.Burgstaller, P.; Faniulok, M. Synthetic Ribozymes and the First Deoxyribozyme.AngewChem IntEdEngl 1995, 34 (11), 1189-1192.Buscaglia, L. E. B. & Li, Y. Apoptosis and the target genes of microRNA-21. Chin J Cancer 30, 371-380 (2011).Cairns, M. J., et al. Optimisation of the 10-23 DNAzyme-substrate pairing interactions enhanced RNA cleavage activity at purine-cytosine target sites. Nucleic Acids Research 31, 2883-2889 (2003).Cancer Cell Culture: Methods and Protocols; Langdon, S. P., Ed.; Methods in Molecular Medicine; Humana Press, 2004.Carmi, N., et al. In vitro selection of self-cleaving DNAs. Chem. Biol. 3, 1039-1046 (1996). Carthew, R. W. Gene Regulation and Cellular Metabolism: An Essential Partnership. Trends Genet. TIG 2021, 37 (4), 389-400.Chang, FL et al. CRISPR / cas9, a novel genomic tool to knock down microRNA in vitro and in vivo. Sci Rep 6, 22312 (2016).Chaudhuri, R.; et al. Recent Update on Targeting C-MYC G-Quadruplexes by Small Molecules for Anticancer Therapeutics. J. Med. Chem. 2021, 64 (1), 42-70.Chen, L.; et al. Genomic Selection Identifies Vertebrate Transcription Factor Fezf2 Binding Sites and Target Genes. J. Biol. Chem. 2011, 286 (21), 18641-18649.Attorney Docket No. 10046-678W01Chen, Y.; et al. An Upstream G-Quadruplex DNA Structure Can Stimulate Gene Transcription. ACS Chem. Biol. 2024, 19 (3), 736–742.Cheng, J. et al. Plasma contains ultrashort single-stranded DNA in addition to nucleosomal cell-free DNA. iScience, 2022, 25(7), 104554.Conaway, R. C; Conaway, J. W. ATP Activates Transcription Initiation from Promoters by RNA Polymerase II in a Reversible Step Prior to RNA Synthesis. J. Biol. Chem. 1988, 263 (6), 2962–2968.Condrat, C. E. et al. miRNAs as Biomarkers in Disease: Latest Findings Regarding Their Role in Diagnosis and Prognosis. Cells 9, 276 (2020).Cousins, R. J. Metal Elements and Gene Expression. Annu. Rev. Nutr. 1994, 14 (1), 449–469.Cozma, I., et al. DNAzymes as key components of biosensing systems for the detection of biological targets. Biosensors and Bioelectronics 177, 112972 (2021).Cramer, P. Organization and regulation of gene transcription. Nature 573, 45–54 (2019). Curtis, E. A.; Liu, D. R. Discovery of Widespread GTP-Binding Motifs in Genomic DNA and RNA. Chem. Biol. 2013, 20 (4), 521–532.Davis, J. T. G-Quartets 40 Years Later: From 5’-GMP to Molecular Biology and Supramolecular Chemistry. Angew. Chem. Int. Ed Engl. 2004, 43 (6), 668–698.Dell’Oca, M. C. et al., Spotlight on G-Quadruplexes: From Structure and Modulation to Physiological and Pathological Roles. Int. J. Mol. Sci. 25, 3162 (2024).DeRisi, J. L.; et al. Exploring the Metabolic and Genetic Control of Gene Expression on a Genomic Scale. Science 1997, 278 (5338), 680–686.DeRosa, M. C.; et al. In vitro Selection of Aptamers and Their Applications. Nat. Rev.Methods Primer 2023, 3 (1), 1–20.Ding, Y., et al., Pushing Adenosine and ATP SELEX for DNA Aptamers with Nanomolar Affinity. I. Am. Chem. Soc. 145, 7540–7547 (2023).Doane, A. S.; Elemento, O. Regulatory Elements in Molecular Networks. WIREs Syst. Biol. Med. 2017, 9 (3), e1374.Attorney Docket No. 10046-678W01Dong, Z. et al. Effect of microRNA-21 on multidrug resistance reversal in A549 / DDP human lung cancer cells. Mol Med Rep 11, 682–690 (2015).Du, Z.; et al. Genome-Wide Analysis Reveals Regulatory Role of G4 DNA in Gene Transcription. Genome Res. 2008, 18 (2), 233–241.Duff, M. R.; et al. Isothermal Titration Calorimetry for Measuring Macromolecule-Ligand Affinity. J. Vis. Exp. JoVE 2011, No. 55, 2796.Edwardsm, A. L.; Batey, R. T. Riboswitches: a common RNA regulatory element. Nature Education.Ellington, A. D. et al., In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818–822 (1990).Ellington, A. D. et al., Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures. Nature 355, 850–852 (1992).Ergin, K. & Cetinkaya, R. Regulation of MicroRNAs. Methods Mol Biol 2257, 1–32 (2022). Fellizar, A., et al. Expression of specific microRNAs in tissue and plasma in colorectal cancer. J Pathol Transl Med 57, 147–157 (2022).Feng, Y.-H. & Tsao, C.-J. Emerging role of microRNA-21 in cancer (Review). Biomedical Reports 5, 395–402 (2016).Ferre-D’Amare, A.; Winkler, W. C. THE ROLES OF METAL IONS IN REGULATION BY RIBOSWITCHES. Met. Ions Life Sci. 2011, 9, 141–173.Figlia, G.; et al. Metabolites Regulate Cell Signaling and Growth via Covalent Modification of Proteins. Dev. Cell 2020, 54 (2), 156–170.Fiorentini, D., et al. Magnesium: Biochemistry, Nutrition, Detection, and Social Impact of Diseases Linked to Its Deficiency. Nutrients 13, 1136 (2021).Garst, A. D.; et al. Riboswitches: Structures and Mechanisms. Cold Spring Harb. Perspect. Biol. 2011, 3 (6), a003533.Geekiyanage, H. et al. Extracellular microRNAs in human circulation are associated with miRISC complexes that are accessible to anti-AGO2 antibody and can bind target mimic oligonucleotides. Proc. Natl. Acad. Sci., 2020, 117(39), 24213–24223.Attorney Docket No. 10046-678W01Gehring, K.; et al. A Tetrameric DNA Structure with Protonated Cytosine. Cytosine Base Pairs. Nature 1993, 363 (6429), 561–565.Gellert, M.; et al. Helix Formation by Guanylic Acid. Proc. Natl. Acad. Sci. U. S. A. 1962, 48 (12), 2013–2018.Georgiades, S. N.; et al. Interaction of Metal Complexes with G-Quadruplex DNA. Angew. Chem. Int. Ed. 2010, 49 (24), 4020–4034.Godden, A. M. et al. An efficient miRNA knockout approach using CRISPR-Cas9 in Xenopus. Dev Biol 483, 66–75 (2022).Gold, L.; et al. From Oligonucleotide Shapes to Genomic SELEX: Novel Biological Regulatory Loops. Proc. Natl. Acad. Sci. 1997, 94 (1), 59–64.Gulyaeva, L. F. & Kushlinskiy, N. E. Regulatory mechanisms of microRNA expression. Journal of Translational Medicine 14, 143 (2016).Guo, W., et al., Sialic acid aptamer and RNA in situ hybridization-mediated proximity ligation assay for spatial imaging of glycoRNAs in single cells. Nat. Protoc. 20, 1930–1950 (2025).Guo, Z. et al. Genome-wide survey of tissue-specific microRNA and transcription factor regulatory networks in 12 tissues. Sci Rep 4, 5150 (2014).Halbeisen, R. E.; et al. Post-Transcriptional Gene Regulation: From Genome -Wide Studies to Principles. Cell. Mol. Life Sci. CMLS 2008, 65 (5), 798–813.Hamula, C. L. A.; et al. Selection and Analytical Applications of Aptamers Binding Microbial Pathogens. TrAC - Trends Anal. Chem. 2011, 30 (10), 1587–1597.Han, J. et al. The Drosha-DGCR8 complex in primary microRNA processing. Genes Dev 18, 3016–3027 (2004).Hansel-Hertsch, R.; et al. DNA G-Quadruplexes in the Human Genome: Detection, Functions and Therapeutic Potential. Nat. Rev. Mol. Cell Biol. 2017, 18 (5), 279–284.Hansel-Hertsch, R.; et al. Quadruplex Structures Mark Human Regulatory Chromatin. Nat. Genet. 2016, 48 (10), 1267–1272.Attorney Docket No. 10046-678W01Hansel-Hertsch, R.; et al.; Genome-wide mapping of endogenous G-quadruplex DNA structures by chromatin immunoprecipitation and high-throughput sequencing. Nature Protocols 2018, 13, 551–564.Hashemi, M. et al. Pre-clinical and clinical importance of miR-21 in human cancers:Tumorigenesis, therapy response, delivery approaches and targeting agents. Pharmacological Research 187, 106568 (2023).Henkin, T. M. Riboswitch RNAs: Using RNA to Sense Cellular Metabolism. Genes Dev. 2008, 22 (24), 3383-3390Holmes, Z. E.; et al. The Sox2 Transcription Factor Binds RNA. Nat. Commun. 2020, 11, 1805.Hong, S. et al., A photo-regulated aptamer sensor for spatiotemporally controlled monitoring of ATP in the mitochondria of living cells. Chem. Sci. 11, 713–720 (2020).Huang, P.-J. J. & Liu, J. Rational evolution of Cd2+-specific DNAzymes with phosphorothioate modified cleavage junction and Cd2+ sensing. Nucleic Acids Res 43, 6125–6133 (2015).Huizenga, D. E.; Szostak, J. W. A DNA Aptamer That Binds Adenosine and ATP.Biochemistry 1995, 34 (2), 656–665.Hussen, B. M. et al. Targeting miRNA by CRISPR / Cas in cancer: advantages and challenges. Military Medical Research 10, 32 (2023).Javanmard, S. H. et al. Therapeutic inhibition of microRNA-21 (miR-21) using locked- nucleic acid (LNA)-anti-miR and its effects on the biological behaviors of melanoma cancer cells in preclinical studies. Cancer Cell International 20, 384 (2020).Jonas, S. & Izaurralde, E. Towards a molecular understanding of microRNA-mediated gene silencing. Nat Rev Genet 16, 421–433 (2015).Jonkman, J. E. N. et al. An introduction to the wound healing assay using live-cell microscopy. Cell Adh Migr 8, 440–451 (2014).Jordan, S. D. et al. Obesity-induced overexpression of miRNA- 143 inhibits insulin-stimulated AKT activation and impairs glucose metabolism. Nat Cell Biol 13, 434–446 (2011).Joyce, G. F. RNA evolution and the origins of life. Nat. Lond. 338, 217-224 (1989).Attorney Docket No. 10046-678W01Kavita, K.; Breaker, R. R. Discovering Riboswitches: The Past and the Future. Trends Biochem. Sci. 2023, 48 (2), 119–141.Keefe, A. D.; et al. Aptamers as Therapeutics. Nat. Rev. Drug Discov. 2010, 9 (7), 537–550. Kim, N. G4-interacting proteins endangering genomic stability at G4 DNA-forming sites. Biochem. Soc. Trans. 51, 403–413 (2023).Kim, S.; et al. Specific SR Protein-Dependent Splicing Substrates Identified through Genomic SELEX. Nucleic Acids Res. 2003, 31 (7), 1955–1961.Klemm, R. D.; et al. Coordinate Binding of ATP and Origin DNA Regulates the ATPase Activity of the Origin Recognition Complex. Cell 1997, 88 (4), 493–502.Knauss, J., et al. Plasmid-based target protectors allow specific blockade of miRNA silencing activity in mammalian developmental systems. Frontiers in Cellular Neuroscience 7, (2013). Ladewig, E. et al. Discovery of hundreds of mirtrons in mouse and human small RNA data. Genome Res. 2012, 22, 1634-1645.Lake, R. J., et al. DNAzymes as Activity-Based Sensors for Metal Ions: Recent Applications, Demonstrated Advantages, Current Challenges, and Future Directions. Acc. Chem. Res. 52, 3275–3286 (2019).Lakhin, A. V.; et al. Aptamers: Problems, Solutions and Prospects. Acta Naturae 2013, 5 (4), 34–43.Lauhon, C. T.; Szostak, J. W. RNA Aptamers That Bind Flavin and Nicotinamide Redox Cofactors. J. Am. Chem. Soc. 1995, 117 (4), 1246–1257.Lee, M., et al. Advances and Trends in miRNA Analysis Using DNAzyme-Based Biosensors. Biosensors (Basel) 13, 856 (2023).Lee, T.-S. et al. Role of Mg2+ in hammerhead ribozyme catalysis from molecular simulation. J Am Chem Soc 130, 3053–3064 (2008).Lempp, M.; et al. Systematic Identification of Metabolites Controlling Gene Expression in E. Coli. Nat. Commun. 2019, 10 (1), 4463.Li, J., et al. In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. Nucleic Acids Res. 28, 481–488 (2000).Attorney Docket No. 10046-678W01Li, X.; et al. Guanine-Vacancy -Bearing G-Quadruplexes Responsive to Guanine Derivatives. Proc. Natl. Acad. Sci. 2015, 112 (47), 14581–14586.Li, Y., et al., Aptamer-based strategies for recognizing adenine, adenosine, ATP and related compounds. Analyst 145, 6753–6768 (2020).Lipps, H. J.; Rhodes, D. G-Quadruplex Structures: In vivo Evidence and Function. Trends Cell Biol. 2009, 19 (8), 414–422.Liu, J. et al. A catalytic beacon sensor for uranium with parts-per-trillion sensitivity and millionfold selectivity. Proc, Natl. Acad. Sci. U. S. A. 104, 2056–2061 (2007).Lorenz, C.; et al. Genomic Systematic Evolution of Ligands by Exponential Enrichment (Genomic SELEX) for the Identification of Protein-Binding RNAs Independent of Their Expression Levels. Nat, Protoc. 2006, 1 (5), 2204–2212.Lu, Y.; et al. CHEX-Seq Detects Single-Cell Genomic Single-Stranded DNA with Catalytical Potential. Nat. Commun. 2023, 14 (1), 7346.Lyu, M.; et al. PN A- Assisted DNAzymes to Cleave Double-Stranded DNA for Genetic Engineering with High Sequence Fidelity. J. Am. Chem. Soc. 2021, 143 (26), 9724–9728. Lyu, R.; et al. KAS-Seq: Genome- Wide Sequencing of Single-Stranded DNA by N3- Kethoxal-Assisted Labeling. Nat. Protoc. 2022, 17 (2), 402–420.Ma, Y. et al., Spatial imaging of glycoRNA in single cells with ARPLA. Nat. Biotechnol. 42, 608–616 (2024).MacFarlane, L.-A. & Murphy, P. R. MicroRNA: Biogenesis, Function and Role in Cancer. Curr Genomics 11, 537–561 (2010).Maier, K. E.; Levy, M. From Selection Hits to Clinical Leads: Progress in Aptamer Discovery. Mol. Ther. - Methods Clin. Dev. 2016, 3.Mandal, M.; Breaker, R. Gene Regulation by Riboswitches. Nat. Rev. Cell Biol. 2004, 5 (6), 451–63.Marsico, G.; et al Whole Genome Experimental Maps of DNA G-Quadruplexes in Multiple Species. Nucleic Acids Res. 2019, 47 (8), 3862–3874.Maston, G. A.; et al. Transcriptional Regulatory Elements in the Human Genome. Annu. Rev. Genomics Hum. Genet, 2006, 7 (1), 29–59.Attorney Docket No. 10046-678W01McConnell, E. M. et al. Biosensing with DNAzymes. Chem. Soc. Rev. 50, 8954–8994 (2021).McConnell, E. M.; et al. Aptamer-Based Biosensors for Environmental Monitoring. Front. Chem. 2020, 8.McGhee, C. E. et al. DNAzyme-Based Lithium-Selective Imaging Reveals Higher Lithium Accumulation in Bipolar Disorder Patient-Derived Neurons. ACS Cent. Sci. 7, 1809–1820 (2021).Mencía, A. et al. Mutations in the seed region of human miR-96 are responsible for nonsyndromic progressive hearing loss. Nat Genet 41, 609–613 (2009).Menichelli, E. et al., Discovery of small molecules that target a tertiary-structured RNA. Proc. Natl. Acad. Sci. U. S. A. 119, e2213117119 (2022).Miglietta, G.; et al. G-Quadruplex-R-Loop Interactions and the Mechanism of Anticancer G- Quadruplex Binders. Nucleic Acids Res. 2020, 48 (21), 11942–11957.Misiewicz-Krzeminska, I. et al. Factors Regulating microRNA Expression and Function in Multiple Myeloma. Noncoding RNA 5, 9 (2019).Moore, C. B., et al. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown. Methods Mol Biol 629, 141–158 (2010).Mou, Q. et al., Efficient delivery of a DNA aptamer-based biosensor into plant ceils for glucose sensing through thiol-mediated uptake. Sci. Adv. 8, eabo0902 (2022).Mu, Y. et al., Recent Advances in Aptamer-Based Sensors for In Vitro Detection of Small Molecules. Anal. Sens. 4, e202400027 (2024).Nakatsuka, N. et al., Aptamer-field-effect transistors overcome Debye length limitations for small-molecule sensing. Science 362, 319–324 (2018).Nelson, K. E., et al. In vitro Selection of High Temperature Zn2+-Dependent DNAzymes. Journal of Molecular Evolution 61, 216–225 (2005).Nguyen, G. H.; et al. Regulation of Gene Expression by the BLM Helicase Correlates with the Presence of G-Quadruplex DNA Motifs. Proc. Natl. Acad. Sci. U. S. A. 2014, 111 (27), 9905–9910.Attorney Docket No. 10046-678W01Nieland, L. et al. CRISPR-Cas knockout of miR21 reduces glioma growth. Molecular Therapy - Oncolytics 25, 121–136 (2022).Ning, Y.; et al. Aptamers Used for Biosensors and Targeted Therapy. Biomed. Pharmacother.2020, 132, 110902.Nucleic Acid Aptamers: Selection, Characterization, and Application; Mayer, G., Ed.;Methods in molecular biology; Humana Press: New York, 2016.Nutiu, R. et al., Structure- Switching Signaling Aptamers. J. Am. Chem. Soc. 125, 4771–4778 (2003).O’Brien, J., et al. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front Endocrinol (Lausanne) 9, 402 (2018).Ogasawara, H.; et al. Genomic SELEX Search for Target Promoters under the Control of the PhoQP-RstBA Signal Relay Cascade. J. Bacteriol. 2007, 189 (13), 4791–4799.Oudelaar, A. M.; Higgs, D. R. The Relationship between Genome Structure and Function. Nat. Rev. Genet. 2021, 22 (3), 154–168.

[0011] Paddison, P. J., et al. Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 16, 948–958 (2002).Palmer, L. G. et al., Distribution of Na+, K+ and Cl- between nucleus and cytoplasm in Chironomus salivary gland cells. J. Membr. Biol. 33, 41–61 (1977).Pelosi, L. et al. MicroRNAs modulated by local mIGF-1 expression in mdx dystrophic mice. Front Aging Neurosci 7, 69 (2015).Peng, H., et al. A microRNA-initiated DNAzyme motor operating in living cells. Nat Commun 8, 14378 (2017).Peracchi, A., et al. A Mutational Analysis of the 8-17 Deoxyribozyme Core. Journal of Molecular Biology 352, 783–794 (2005).Pham, P.; et al. Genomic Landscape of Single-Stranded DNA Gapped Intermediates in Escherichia Coli. Nucleic Acids Res. 2022, 50 (2), 937–951.Preissl, S.; et al. Characterizing Cis-Regulatory Elements Using Single-Cell Epigenomics. Nat. Rev. Genet. 2023, 24 (1), 21–43.Attorney Docket No. 10046-678W01Prud’homme, G. J. et al. Neuropilin- 1 is a receptor for extracellular miRNA and AG02 / miRNA complexes and mediates the internalization of miRNAs that modulate cell function. Oncotarget, 2016, 7, 68057–68071.Research, I. of M. (US) C. on M. N.; Carlson-Newberry, S. J.; Costello, R. B. The Role of Metals in Gene Expression. In Emerging Technologies for Nutrition Research: Potential for Assessing Military Performance Capability; National Academies Press (US), 1997.Rhim, J., et al. From Molecular Mechanisms to Therapeutics: Understanding MicroRNA-21 in Cancer. Cells 11, 2791 (2022).Robinson, J.; et al. DNA G-Quadruplex Structures: More than Simple Roadblocks to Transcription? Nucleic Acids Res. 2021, 49 (15), 8419-8431.Rodriguez, L. G., et al. Wound-healing assay. Methods Mol Biol 294, 23-29 (2005).Sahu, B.; et al. Sequence Determinants of Human Gene Regulatory Elements. Nat. Genet. 2022, 54 (3), 283–294.Santoro, S. W. & Joyce, G. F. A general purpose RNA-cleaving DNA enzyme. PNAS 94, 4262–4266 (1997).Santoro, S. W., et al. RNA Cleavage by a DNA Enzyme with Extended Chemical Functionality. J. Am. Chem. Soc. 122, 2433–2439 (2000).Saran, R. & Liu, J. A Silver DNAzyme. Analytical Chemistry 88, 4014–4020 (2016).Sayers, E. W. et al., Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 50, D20-D26 (2021).Sazani, P.; et al. Nuclear Antisense Effects of Neutral, Anionic and Cationic Oligonucleotide Analogs. Nucleic Acids Res. 2001, 29 (19), 3965–3974.Schlosser, K., et al. Sequence-function relationships provide new insight into the cleavage site selectivity of the 8-17 RNA-cleaving deoxyribozyme. Nucleic Acids Res 36, 1472–1481 (2008).Scull, C. E.; et al. Transcriptional Riboswitches Integrate Timescales for Bacterial Gene Expression Control. Front. Mol. Biosci. 2021, 7.Sen, D.; Gilbert, W. Formation of Parallel Four-Stranded Complexes by Guanine-Rich Motifs in DNA and Its Implications for Meiosis. Nature 1988, 334 (6180), 364–366.Attorney Docket No. 10046-678W01Serganov, A.; et al. Structural Basis for Gene Regulation by a Thiamine Pyrophosphate- Sensing Riboswitch. Nature 2006, 441 (7097), 1167–1171.Shah, V. & Shah, J. Recent trends in targeting miRNAs for cancer therapy. Journal of Pharmacy and Pharmacology 72, 1732–1749 (2020).Sherwood, A. V.; Henkin, T. M. Riboswitch-Mediated Gene Regulation: Novel RNA Architectures Dictate Gene Expression Responses. Annu. Rev. Microbiol. 2016, 70 (1), 361–374.Shimada, et al. Genomic SELEX Screening of Regulatory Targets of Escherichia Coli Transcription Factors. In Bacterial Chromatin: Methods and Protocols; Dame, R. T., Ed.; Methods in Molecular Biology; Springer: New York, NY, 2018; pp 49-69.Shimada, T.; et al. Systematic Search for the Cra-Binding Promoters Using Genomic SELEX System. Genes Cells 2005, 10 (9), 907–918.Siasos, G. et al. MicroRNAs in cardiovascular disease. Hellenic Journal of Cardiology 61, 165–173 (2020).Singer, B. S.; et al. Libraries for Genomic SELEX. Nucleic Acids Res. 1997, 25 (4), 781–786.Spiegel, J.; et al. G-Quadruplexes Are Transcription Factor Binding Hubs in Human Chromatin. Genome Biol. 2021, 22 (1), 117.Spiegel, J.; et al. The Structure and Function of DNA G-Quadruplexes. Trends Chem. 2020, 2 (2), 123–136.Spiegelaere, W. D., et al., Reference Gene Validation for RT-qPCR, a Note on Different Available Software Packages. PLOS ONE 10, e0122515 (2015).Staton, A. A. & Giraldez, A. J. Use of target protector morpholinos to analyze the physiological roles of specific miRNA-mRNA pairs in vivo. Nat Protoc 6, 2035–2049 (2011).Suarez- Arnedo, A. et al. An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS One 15, e0232565 (2020).Tang, D.-J.; et al. A SAM-I Riboswitch with the Ability to Sense and Respond to Uncharged Initiator tRNA. Nat. Commun. 2020, 11 (1), 2794.Attorney Docket No. 10046-678W01Tian, T.; et al. G-Quadruplex: A Regulator of Gene Expression and Its Chemical Targeting. Chem 2018, 4 (6), 1314-1344.Tomari, Y. & Zamore, P. D. MicroRNA Biogenesis: Drosha Can’t Cut It without a Partner. Current Biology 15, R61-R64 (2005).Torabi, S.-F. & Lu, Y. Identification of the Same Na+-Specific DNAzyme Motif from Two In vitro Selections Under Different Conditions. J Mol Evol 81, 225-234 (2015).Torabi, S.-F. et al. In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing. PNAS 112, 5903-5908 (2015).Tribolet, L. et al. MicroRNA Biomarkers for Infectious Diseases: From Basic Research to Biosensing. Frontiers in Microbiology 11, (2020).Tu, J.; et al. Direct Genome-Wide Identification of G-Quadruplex Structures by Whole-Genome Resequencing. Nat. Commun. 2021, 12 (1), 6014.Tuerk, C. et al., Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 249, 505- 10 (1990).Umezawa, Y.; et al. The Uncharacterized Transcription Factor YdhM Is the Regulator of the nemA Gene, Encoding N-Ethylmaleimide Reductase. J. Bacteriol. 2008, 190 (17), 5890- 5897.Vermunt, M. W.; et al. The Interdependence of Gene-Regulatory Elements and the 3D Genome. J. Cell Biol. 2018, 218 (I), 12-26.Voltan, G.; et al. Vitamin D: An Overview of Gene Regulation, Ranging from Metabolism to Genomic Effects. Genes 2023, 14 (9), 1691.Voss, T. C. et al., Dynamic regulation of transcriptional states by chromatin and transcription factors. Nat. Rev. Genet. 15, 69-81 (2014).Wachter, A. Riboswitch-mediated control of gene expression in eukaryotes. RNA Biol. 7, 67-76 (2010).Wada, A.; Suyama, A. Local Stability of DNA and RNA Secondary Structure and Its Relation to Biological Functions. Prog. Biophys. Mol. Biol. 1986, 47 (2), 113-157.Wadkins, R. M. Targeting DNA Secondary Structures. Curr. Med. Chem. 2000, 7 (1), 1-15.Attorney Docket No. 10046-678W01Waller, Z. A. E. et al., A Small Molecule That Disrupts G-Quadruplex DNA Structure and Enhances Gene Expression. J. Am. Chem. Soc. 131, 12628-12633 (2009).Wang, G.; et al. Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites. BioMed Res. Int. 2015, 2015, 757530.Wang, H. et al. A DNAzyme-amplified DNA circuit for highly accurate microRNA detection and intracellular imaging. Chem. Sci. 10, 9597–9604 (2019).Wang, H. et al. microRNA-21 promotes breast cancer proliferation and metastasis by targeting LZTFL1. BMC Cancer 19, 738 (2019).Wang, T.; et al. Three Decades of Nucleic Acid Aptamer Technologies: Lessons Learned, Progress and Opportunities on Aptamer Development. Biotechnol. Adv. 2019, 37 (1), 28-50. Watrin, M.; et al. In vitro Selection of RNA Aptamers Derived from a Genomic Human Library against the TAR RNA Element of HIV-1. Biochemistry 2009, 48 (26), 6278–6284. Wei, J. et al. Identification of plasma microRNA-21 as a biomarker for early detection and chemosensitivity of non-small cell lung cancer. Chin J Cancer 30, 407-414 (2011).Winge, D. R. Copper-Regulatory Domain Involved in Gene Expression. In Progress in Nucleic Acid Research and Molecular Biology; Moldave, K., Ed.; Academic Press, 1997; Vol. 58, pp 165-195.Winge, D. R.; et al. Metal-Ion Regulation of Gene Expression in Yeast. Curr. Opin. Chem. Biol. 1998, 2 (2), 216-221.Winkler, W. C.; et al. An mRNA Structure That Controls Gene Expression by Binding S- Adenosylmethionine. Nat. Struct. Mol. Biol. 2003, 10 (9), 701-707.Winkler, W.; et al. Thiamine Derivatives Bind Messenger RNAs Directly to Regulate Bacterial Gene Expression. Nature 2002, 419 (6910), 952-956.Wu, F.; et al. Genome- Wide Analysis of DNA G-Quadruplex Motifs across 37 Species Provides Insights into G4 Evolution. Commun. Biol. 2021, 4 (1), 1-11.Wu, T.; et al. Kethoxal- Assisted Single-Stranded DNA Sequencing Captures Global Transcription Dynamics and Enhancer Activity in situ. Nat. Methods 2020, 17 (5), 515-523.Attorney Docket No. 10046-678W01Wu, Y. et al. MicroRNA-21 (Mir-21) Promotes Cell Growth and Invasion by Repressing Tumor Suppressor PTEN in Colorectal Cancer. Cellular Physiology and Biochemistry 43, 945-958 (2017).Wu, Y. et al. Simultaneous Fe2+ / Fe3+ imaging shows Fe3+ over Fe2+ enrichment in Alzheimer’s disease mouse brain. Science Advances 9, eade7622 (2023).Wu, Y. et al., Genetically Encoded Fluorogenic DNA Aptamers for Imaging Metabolite in Living Cells. J. Am. Chem. Soc. 147, 1529-1541 (2025).Xing, H.; et al. DNA Aptamer Technology for Personalized M...

Claims

Attorney Docket No. 10046-678W01CLAIMS1. A method to identify naturally occurring DNAzymes and / or DNA aptamers, the method comprising:a) providing a first database comprising sequences of DNAzymes, DNA aptamers, or portions thereof;b) providing a second database comprising naturally occurring nucleic acid sequences; andc) searching the second database for a first match sequence comprising about 90% similarity or more to a sequence in the first database using an algorithm that finds regions of local similarity between sequences;wherein the local similarity has an expectation threshold of about 0.05 or less.

2. The method of claim 1, wherein the second database comprises mRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof.

3. The method of claim 1, wherein NCBI standard nucleotide BLAST blastn is used to find local similarity between sequences.

4. The method of claim 1, wherein the first match sequence is a DNA aptamer comprising a binding nucleic acid which selectively binds to a target molecule.

5. The method of claim 4, wherein the target molecule is an amino acid, adenosine, xanthine, 4-HNE, methylglyoxal, cyclic AMP, NAD+, NADPH, SAM (S-adenosylmethionine), CoA, acetyl-CoA, 2-hydroxyglutarate, choline, phosphocholine, GSH (glutathione), thrombin, ATP, glutathione, sugar, or hemin.

6. The method of any one of claims 1-3, wherein the first match sequence is an enzyme strand of a DNAzyme.

7. The method of claim 6, wherein the enzyme strand is capable of cleaving a substrate strand in the presence of a target molecule8. The method of claim 7, wherein the target molecule is Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Lr, or Cr3+.Attorney Docket No. 10046-678W019. The method of claim 6, wherein the method further comprises:d) designing a substrate strand that is at least partially complementary to the enzyme strand;e) providing a third database comprising naturally occurring nucleic acid sequences; andf) searching the third database for a second match sequence comprising query coverage of about 60% or more, target coverage of about 60% or more, and / or sequence similarity of about 80% or more to the substrate strand using an algorithm that finds regions of local similarity between sequences.

10. The method of claim 9, wherein the second database comprises cfDNA and / or genomic DNA, and the third database comprises mRNA, pre-miRNA, miRNA, siRNA, or any combination thereof.

11. The method of claim 1, wherein the first match sequence is a substrate strand of a DNAzyme which can be cleaved by an enzyme strand.

12. The method of claim 11, wherein the substrate strand can be cleaved by an enzyme strand in the presence of a target molecule13. The method of claim 12, wherein the target molecule is Mg2+, Zn2+, Ca2+, Na+, K+, Fe2+, Fe3+, Cu+, Cu2+, Pb2+, Mn2+, Ni2+, La3+, Li+. or Cr3+.

14. The method of claim 11, wherein the method further comprises:d) engineering an enzyme strand that is at least partially complementary to the substrate strand;e) providing a third database comprising naturally occurring nucleic acid sequences; andf) searching the third database for a second match sequence comprising query coverage of about 60% or more, target coverage of about 60% or more, and / or sequence similarity of about 80% or more to the substrate strand using an algorithm that finds regions of local similarity between sequences.Attorney Docket No. 10046-678W0115. The method of claim 14, wherein the second database comprises mRNA, pre-miRNA, miRNA, siRNA, or any combination thereof, and the third database comprises cfDNA and / or genomic nucleic acid.

16. A DNAzyme or DNA aptamer identified by the method of any one of claims 1-15 and further engineered to comprise a detectable signal.

17. The DNAzyme or DNA aptamer of claim 16, wherein the detectable signal is a fluorophore or fluorescent dye.

18. A system comprising:a processor; anda memory having instructions stored thereon, wherein execution of the instructions by a processor causes the processor to perform the method of claim 1.

19. The system of claim 18, further comprising a data store comprising the first database, the second database, and / or the third database.

20. A computer readable medium having instructions stored thereon, wherein execution of the instructions by a processor causes the processor to perform the method of claim 1.

21. A DNA aptamer comprising:a naturally occurring nucleic acid which selectively binds to a target molecule; and a signaling nucleic acid which is at least partially complementary to at least a portion of the naturally occurring nucleic acid;wherein, when the naturally occurri ng nucleic acid is bound to the target molecule, the signaling nucleic acid produces a detectable signal.

22. The DNA aptamer of claim 21, wherein the naturally occurring nucleic acid comprises mRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof.

23. A method of detecting a naturally occurring nucleic acid in a sample, the method comprising:Attorney Docket No. 10046-678W01providing to the sample the DNA aptamer of claim 22; anddetecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid.

24. A method of treating and / or preventing a disease or disorder in a subject in need thereof, the method comprising:providing the DNA aptamer of claim 22 to the subject or a sample taken from the subject;detecting presence or absence of the detectable signal, thereby determining presence or absence of the naturally occurring nucleic acid; wherein overexpression of the naturally occurring nucleic acid indicates presence of a disease or disorder and / or increased severity of a disease or disorder; andif presence of the disease or disorder is detected, administering one or more therapeutic agents to the subject.

25. The method of claim 24, wherein the disease or disorder is cancer or a tumor, and wherein the naturally occurring nucleic acid is an oncogenic miRNA, or a pre-miRNA associated with an oncogenic miRNA;wherein the disease or disorder is Alzheimer’s, Huntington’s, ALS, or another neurological disease or disorder, and wherein the naturally occurring nucleic acid is miR-29a, miR-29b, miR-7, miR-132, miR-218, miR-9 / 9*, or miR-124a;wherein the disease or disorder is myocardial infarction or another cardiac disease or disorder, and wherein the naturally occurring nucleic acid is miR-1;wherein the disease or disorder is systemic lupus erythematosus (SLE), psoriasis, or another autoimmune disease or disorder, and wherein the naturally occurring nucleic acid is miR-146a or miR- 1; orwherein the disease or disorder is hepatis C virus (HCV) infection or another viral, bacterial, fungal, or parasitic infection, and wherein the naturally occurring nucleic acid is miR-122.

26. A DNAzyme comprising:an enzyme strand comprising two arms and a catalytic core disposed between the two arms;Attorney Docket No. 10046-678W01wherein at least one of the two arms is at least partially complementary to a naturally occurring nucleic acid; andwherein the catalytic core is capable of cleaving the naturally occurring nucleic acid.

27. The DNAzyme of claim 26, wherein the naturally occurring nucleic acid comprises mRNA, pre-miRNA, miRNA, siRNA, cell free DNA (cfDNA), genomic DNA, or any combination thereof.

28. A method of decreasing levels of a naturally occurring nucleic acid in a cell or tissue, the method comprising:providing to the cell or tissue the DNAzyme of claim 26;wherein the DNAzyme is capable of cleaving the naturally occurring nucleic acid; and wherein the naturally occurring nucleic acid is overexpressed in the cell or tissue.

29. The method of claim 28, wherein the disease or disorder is cancer or a tumor, and wherein the naturally occurring nucleic acid is an oncogenic miRNA, or a pre-miRNA associated with an oncogenic miRNA;wherein the disease or disorder is Alzheimer’s, Huntington’s, ALS, or another neurological disease or disorder, and wherein the naturally occurring nucleic acid is miR-29a, miR-29b, miR-7, miR-132, miR-218, miR-9 / 9*, or miR-124a;wherein the disease or disorder is myocardial infarction or another cardiac disease or disorder, and wherein the naturally occurring nucleic acid is miR-1;wherein the disease or disorder is systemic lupus erythematosus (SLE), psoriasis, or another autoimmune disease or disorder, and wherein the naturally occurring nucleic acid is miR-146a or miR-31; orwherein the disease or disorder is hepatis C vims (HCV) infection or another viral, bacterial, fungal, or parasitic infection, and wherein the naturally occurring nucleic acid is miR-122.

30. A method of treating and / or preventing cancer or a tumor in a subject in need thereof, the method comprising:providing to the subject the DNAzyme of claim 26;wherein the DNAzyme is capable of cleaving an oncogenic miRNA or a pre-miRNA associated with an oncogenic miRNA.Attorney Docket No. 10046-678W0131. A method of gene editing in a cell or tissue, the method comprising:providing to the subject the DNAzyme of claim 26;wherein the DNAzyme is capable of cleaving genomic DNA.

Images