Hypoimmunogenic cells and uses thereof

Abstract

The present disclosure provides compositions and methods for cell transplantation therapy based on forced expression of a panel of immunosuppressive proteins in donor cells to be transplanted into a subject. In some embodiments, the panel of immunosuppressive proteins is selected from the group consisting of a nonpolymorphic HLA class Ib protein, FASL, SERPINB9, CCL21, MFGE8, CD47, CD200, and a variant thereof.

Description

Attorney Docket No: 044903-8033W001HYPOIMMUNOGENIC CELLS AND USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. provisional patent application no. 63 / 790,006, filed April 16, 2025, the disclosure of which is incorporated herein by reference.SEQUENCE LISTING

[0002] An official copy of the sequence listing is submitted concurrently with the specification electronically via EFS-Web as an ASCI I formatted sequence listing with a file name of 044903-8033W001.xml, a creation date of April 16, 2026, and a size of 70,343 bytes. The sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.FIELD OF THE INVENTION

[0003] The present disclosure generally relates to cell biology, immunology and cell transplantation therapy. In particular, the present disclosure relates to immune evasive cells over-expressing a panel of immunosuppressive proteins.BACKGROUND

[0001] Regenerative medicine, particularly through cell transplantation or therapy, has been a major breakthrough in treating intractable conditions like blood cancer. Three FDA-approved CAR T-cell therapies — Yescarta (Gilead), Breyanzi (BMS), and Kymriah (Novartis) — have demonstrated significant success. However, these treatments rely on autologous cell therapy, where a patient’s own cells are extracted, modified ex vivo, and reinfused to prevent immune rejection. While effective, this approach is both costly (e.g., about half a million dollars for Kymriah per treatment) and time-consuming, sometimes with life-or-death consequences. Engineering donor cells to be hypoimmunogenic could enable “off-the-shelf’ allogeneic transplantation, expanding access to more patients while minimizing immune rejection. Most importantly, this advancement would allow for timely, life-saving treatment without the delays of individualized cell engineering. Therefore, there is a need to develop universal hypoimmunogenic donor cells that can be used for off-the-shelf allogeneic cell therapies.SUMMARY OF INVENTION

[0002] The present disclosure in one aspect provides a genetically modified mammalian cell suitable for being transplanted to a subject in need thereof. In someAttorney Docket No: 044903-8033W001embodiments, the genetically modified mammalian cell comprises an exogenous nucleic acid encoding a panel of immunosuppressive proteins expressed in the genetically modified mammalian cell, wherein the genetically modified mammalian cell has reduced immunogenicity and / or improved immunosuppression as compared to a mammalian cell of the same-type without said exogenous nucleic acid.

[0003] In some embodiments, the panel of immunosuppressive proteins is selected from the group consisting of a nonpolymorphic HLA class lb protein, FASL, SERPINB9, CCL21, MFGE8, CD47, CD200, and a variant thereof. In some embodiments, the nonpolymorphic HLA class lb protein is a HLA-F protein or a HLA-G protein. In some embodiments, the panel of immunosuppressive proteins comprises aHLA-F-b2M fusion protein and / or a HLA-G-b2M fusion protein. In some embodiments, the panel of immunosuppressive proteins comprises a HLA-F-b2M fusion protein and CD200. In some embodiments, the panel of immunosuppressive proteins comprises aHLA-F-b2M fusion protein, a HLA-G-b2M fusion protein and CD200. In some embodiments, the panel of immunosuppressive proteins comprises a HLA-F-b2M fusion protein, a HLA-G-b2M fusion protein, CD200 and CCL21. In some embodiments, the panel of immunosuppressive proteins comprises a HLA-F-b2M fusion protein, a HLA-G-b2M fusion protein, CD200, CCL21 and SERPINB9.

[0004] In some embodiments, the panel of immunosuppressive proteins is expressed from a nucleic acid inserted to the genome of the genetically modified mammalian cell. In some embodiments, the panel of immunosuppressive proteins is expressed from a nucleic acid comprising, sequentially, CAG promoter, a gene encoding the HLA-F-b2M fusion protein, IRES or 2A, CD200 gene, and polyA sequence. In some embodiments, the panel of immunosuppressive proteins is expressed from a nucleic acid comprising, sequentially, CAG promoter, a gene encoding the HLA-F-b2M fusion protein, IRES, a gene encoding the HLA-G-b2M fusion protein, IRES, CD200 gene, and polyA sequence. In some embodiments, the panel of immunosuppressive proteins is expressed from a nucleic acid comprising, sequentially, CAG promoter, a gene encoding the HLA-F-b2M fusion protein, IRES, a gene encoding the HLA-G-b2M fusion protein, IRES, CD200 gene, IRES, CCL21 gene and polyA sequence. In some embodiments, the panel of immunosuppressive proteins is expressed from a nucleic acid comprising, sequentially, CAG promoter, a gene encoding the HLA-F-b2M fusion protein, IRES, a gene encoding the HLA-G-b2M fusion protein, IRES, CD200 gene, IRES, CCL21 gene, IRES, Serpin B9 gene and polyA sequence. In some embodiments, the panel of immunosuppressive proteins is expressed from a nucleic acid comprising aAttorney Docket No: 044903-8033W001bidirectional promoter which controls, on one side, the expression of Serpin B9 gene, IRES, CCL21 gene, IRES, and a gene encoding the HLA-G-b2M fusion protein, and, on the other side, the expression of a gene encoding the HLA-F-b2M fusion protein, 2 A and CD200 gene. In some embodiments, the bidirectional promoter comprises two back-facing CAG promoters.

[0005] In some embodiments, the nucleic acid encoding the panel of immunosuppressive proteins is inserted to the genome of the genetically modified mammalian cell via an integrase system. In some embodiments, the nucleic acid encoding the panel of immunosuppressive proteins is inserted to the genome of the genetically modified mammalian cell at the Hl 1 locus.

[0006] In some embodiments, the genetically modified mammalian cell disclosed herein has deficiency of HLA-I expression / function and / or HLA-II expression. In some embodiments, the genetically modified mammalian cell further comprises a mutation of B2M gene and / or CIITA gene, which results in the deficiency of HLA-I expression / function and / or HLA-II expression.

[0007] In some embodiments, the modified mammalian cell is a human cell, a mouse cell, a rat cell, a monkey cell or a pig cell. In some embodiments, the modified mammalian cell is a human cell. In some embodiments, the modified mammalian cell is an embryonic stem cell or iPS cell. In some embodiments, the modified mammalian cell is a cell differentiated from a stem / progenitor cell. In some embodiments, the modified mammalian cell is a T cell or a NK cell.

[0008] In some embodiments, the genetically modified mammalian cell disclosed herein further comprises a chimeric antigen receptor (CAR). In some embodiments, the CAR is an anti-CD19 CAR.

[0009] In some embodiments, the reduced immunogenicity and / or improved immunosuppression of the genetically modified mammalian cell as compared to the mammalian cell without said exogenous nucleic acid is determined by a NK cell cytotoxicity assay.

[0010] In another aspect, the present disclosure provides a method of cell transplantation therapy comprising injecting, implanting, or grafting to a subject in need thereof a cellular or tissue composition comprising a population of genetically modified cells, wherein the genetically modified mammalian cell comprises an exogenous nucleic acid encoding a panel of immunosuppressive proteins expressed in the genetically modified mammalian cell, wherein the subject has at least one mismatched classical HLA class I orAttorney Docket No: 044903-8033W001HLA class II molecule as compared to the genetically modified cells, and wherein the population of genetically modified cells exhibit reduced immunogenicity and / or improved immunosuppression as compared to cells of the same-type without said exogenous nucleic acid.

[0011] In some embodiments, the modified mammalian cell further comprises a chimeric antigen receptor (CAR). In some embodiments, the modified mammalian cell is a CAR-T cell or a CAR-NK cell. In some embodiments, the CAR-T cell or the CAR-NK cell is differentiated from an iPS cell.

[0012] In some embodiments, the population of genetically modified cells are not rejected by the subject’s immune system for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 24, 36, 48 or 52 weeks.BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The accompanying drawings, which are incorporated herein, form part of the specification. Together with this written description, the drawings further serve to explain the principles of, and to enable a person skilled in the relevant art(s), to make and use the present disclosure.

[0014] FIG. 1 is a schematic that illustrates the interaction of HLA-F molecules with a diverse panel of receptors on immune cells such as NK cells. HLA-F molecules can have different conformation form and form different complexes, which can interact with both activating and inhibitory receptors on the immune cells.

[0015] FIG. 2 is a schematic that illustrates the interaction of the HLA molecules on the allograft cells and their respective potential receptors / partners on the immune cells (e.g., NK cells and T cells) of the recipient.

[0016] FIG. 3 is a schematic that illustrates the innate and adaptive immune modulation pathways involved in immune recognition and reactions to allografts.

[0017] is a schematic that illustrates a mode of peptide presentation of HLA-F molecule. Peptide-bound HLA-F and empty HLA-F open conformer (OC) molecules are recognized by distinct receptors on NK cells.

[0018] FIG. 4 is a schematic of the structure of HLA-F- P2m fusion protein. FIG. 4A shows the heterodimer of HLA-F non-covalently bound with P2m. FIG. 4B shows the HLA-F fused to P2m by a 15 amino acid linker. FIG. 4C shows the design of the HLA-F- P2m fusion protein comprising an HLA-F alpha 1 domain, an HLA-F alpha 2 domain, an HLA-F alpha 3 domain, linked to a P2m protein by a 15 amino acid linker followed by aAttorney Docket No: 044903-8033W001transmembrane domain and a cytoplasmic domain. FIG. 4D shows the HLA-F-b2M fusion protein structure. SP: signal peptide; GS linker: 15 amino acid linker.

[0019] FIG. 5 illustrates that the expression of exogenous chimeric HLA-F protein in HKE293 cells reduced NK cell mediated cytotoxicity.

[0020] FIG. 6 illustrates that overexpression of HLA-F has immune-repression activity in iPSCs. Similar NK-mediated toxicity assays were performed using iPSC that express HLA-F-P2M (HLA-FB) except that CD56+NK cells were used as effector cells instead of PBMC. Several ratios, including 1:1, 2:1 and 4:1 of effector (NK cells) versus target cells (iPSC) were used. Each group contain 3 samples. The ratio of effector: target=2:l showed lower cell death of 39% from 59% with a “p” value of 0.0231, indicating statistically significant immune protection from HLA-FB expression.

[0021] FIG. 7 illustrates the schematic design of TARGATT site-specific transgene integration mediated by integrase.

[0022] FIG. 8 illustrates the schematic of generating a genetically modified mammalian cell line, which includes two phases. In phase I, an initial cell line containing attBl and attB2 at Hl 1 locus is used to generate a B2M / CIITA double knockout cell line, which is HLA-I / II deficient. In phase II, the B2M / CIITA double knockout cell line is modified to insert an exogenous nucleic acid comprising HLA-F-B2M / CD200, CCL21 / Serpin B9 / HLA-G-B2M by integrase-mediated integration at the Hl 1 locus.DETAILED DESCRIPTION OF THE INVENTION

[0023] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.

[0024] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.

[0025] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to discloseAttorney Docket No: 044903-8033W001and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed.

[0026] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.Definition

[0027] The following definitions are provided to assist the reader. Unless otherwise defined, all terms of art, notations and other scientific or medical terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over the definition of the term as generally understood in the art.

[0028] As used herein, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.

[0029] “Antigen” refers to a molecule that provokes an immune response. This immune response may be either humoral, or cell-mediated response, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. It is readily apparent that the present disclosure includes autoantigens acting as antigen eliciting immune response.

[0030] “Allogeneic” cells refer to any cells derived from a different subject of the same species.

[0031] The term “chimeric antigen receptor” or “CAR” as used herein refers to an artificially constructed hybrid protein or polypeptide containing an antigen binding domain of an antibody (e.g., a single chain variable fragment (scFv)) linked to a domain or signaling, e.g., T-cell signaling or T-cell activation domains, that activates an immune cell, e.g., a T cell or a NK cell (see, e.g., Kershaw et al., supra, Eshhar et al., Proc. Natl. Acad. Sci. USA, 90(2): 720-724 (1993), and Sadelain et al., Curr. Opin. Immunol. 21(2): 215-223 (2009)). CARs areAttorney Docket No: 044903-8033W001capable of redirecting the immune cell specificity and reactivity toward a selected target in a non-MHC-restricted manner, taking advantage of the antigen-binding properties of monoclonal antibodies. The non-MHC-restricted antigen recognition confers immune cells expressing CARs on the ability to recognize an antigen independent of antigen processing, thus bypassing a major mechanism of tumor escape. In addition, when expressed in T-cells, CARs advantageously do not dimerize with endogenous T-cell receptor (TCR) alpha and beta chains.

[0032] “HLA” or “Human Leucocyte Antigen” refers to a group of related proteins that are encoded by the major histocompatibility complex (MHC) gene complex in humans, which are responsible for the regulation of the immune system. HLA genes can be classified into class I and class II genes. HLA class I genes include three major genes, i.e., HLA- A, HLA-B and HLA-C, and three minor genes, i.e., HLA-E, HLA-F and HLA-G genes. P2m protein binds with major and minor class I HLA protein to produce a heterodimer. HLA class II genes include three major genes, i.e., HLA-DP, HLA-DQ and HLA-DR genes, and two minor genes, i.e., HLA-DM and HLA-DO genes. The class II HLA proteins combine to form heterodimeric (aP) protein receptors that are typically expressed on the surface of antigen-presenting cells.

[0033] Percentage of “identity” or “sequence identity” in the context of polypeptide or polynucleotide is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[0034] “Operatively linked” refers to a functional relationship between two or more polynucleotide sequences. In the context of a polynucleotide encoding a protein, such as a polypeptide chain of an immunosuppressive protein of the disclosure, the term means that the two or more polynucleotide sequences are joined such that the amino acid sequences encoded by these segments remain in-frame. In the context of transcriptional or translational regulation, the term refers to the functional relationship of a regulatory sequence to a codingAttorney Docket No: 044903-8033W001sequence, for example, a promoter in the correct location and orientation to the coding sequence so as to modulate the transcription.

[0035] “Immunogenicity” or “immunogenic” refers to the ability of a foreign substance, such as an antigen, to provoke an immune response in the body of a subject. The immunogenic response typically includes both cell-mediated and antibody -mediated immune response.

[0036] “Polynucleotide” or “nucleic acid” refers to a chain of nucleotides. As used herein polynucleotides include all polynucleotide sequences which are obtained by any means available in the art, including, without limitation, recombinant means and synthetic means.

[0037] “Polypeptide,” and “protein” are used interchangeably, and refer to a chain of amino acid residues covalently linked by peptide bonds. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0038] T cell receptor” or “TCR” refers to a protein complex on the surface of T cells that is responsible for recognizing fragments of antigen as peptides bound to MHC molecules.

[0039] “Therapeutically effective amount” or “effective amount” refers to an amount of cells, composition, formulation or any material as described here effective to achieve a desirable biological result. Such results may include, without limitation, replacing damaged cell, allowing improvement in the overall condition of the subject, and stimulating tissue regeneration or repair.

[0040] A “variant” of a protein, e.g., an immunosuppressive protein, as used herein refers to a protein having an amino acid sequence different from its parent protein from which the variant is derived, but keeps the biological function as the parent protein.Examples of a variant include, without limitation, a fusion protein comprising the parent protein, and a mutant of the parent protein. In some embodiments, the variant has a sequence of at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% identity to the parent protein, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100 amino acid residue difference from the parent protein.

[0041] “Vector” refers to a vehicle into which a polynucleotide may be operably inserted so as to deliver, replicate or express the polynucleotide. A vector may contain a variety of regulatory elements including, without limitation, origin of replication, promoter, transcription initiation sequences, enhancer, selectable marker genes, and reporter genes. AAttorney Docket No: 044903-8033W001vector may also include materials to aid in its entry into a host cell, including but not limited to a viral particle, a liposome, or ionic or amphiphilic compounds.

[0042] It is noted that in this disclosure, terms such as “comprises”, “comprised”, “comprising”, “contains”, “containing” and the like have the meaning attributed in United States Patent law; they are inclusive or open-ended and do not exclude additional, un-recited elements or method steps. Terms such as “consisting essentially of’ and “consists essentially of’ have the meaning attributed in United States Patent law; they allow for the inclusion of additional ingredients or steps that do not materially affect the basic and novel characteristics of the claimed invention. The terms “consists of’ and “consisting of’ have the meaning ascribed to them in United States Patent law; namely that these terms are close ended.Genetically Modified Cells

[0043] Cell transplantation therapy is a promising therapeutic approach for the treatment of a variety of intractable disease or disorders such as cancer, diabetes, heart disease and neurodegenerative diseases. One of the major obstacles that prevent cell transplantation therapy from implementing in clinic is immune rejection of donor cells. The major immunological hurdle to the transplantation of allogeneic cells and tissues is the expression of the highly polymorphic human leukocyte antigen (HLA) genes, including HLA class I and II. The functions of HLA class I antigens are involved in presenting antigens to T cells and serving as ligands for a panel of immune receptors expressed on natural killer (NK) cells, T cells, and myeloid cells (Boudreau JE & Hsu KC 2018; Pecht I 2018.). HLA class I molecules play a central role in allogeneic rejection through their presentation of peptide antigens to CD8+ T cells. The heterodimeric structure of HLA class I molecules is with a common P2 microglobulin (P2M) subunit paired with different heavy chain molecules. The HLA class I family can be further grouped as the classical HLA-Ia, including HLA-A, -B, and -C molecules and non-classical antigens HLA-Ib, including HLA-E, -F, and -G molecules. In contrast to the highly polymorphic HLA-Ia antigens that are expressed on all nucleated cells, HLA-Ib molecules are characterized by particular tissue localizations, low genetic diversity, a limited peptide repertoire, and functional profile (Persson et al. 2017). Cells that downregulate HLA class I molecules can be detected and eliminated by NK cells, which is initiated when inhibitory receptors, such as CD94 / NKG2A, on NK cells fail to bind to HLA class I molecules (Bix et al.1991; Liao et al.1991).

[0044] To avoid or minimize transplantation rejection, it is generally required to match the type of classical HLA class I and class II molecules between donor and recipient.Attorney Docket No: 044903-8033W001However, finding a donor having a type of HLA molecules that well match the recipient is often difficult.

[0045] The present disclosure is in part based on the discovery that the need for autologous or carefully patient-matched cell lines could be circumvented by engineering a single iPSC (induced pluripotent stem cell) or ESC (embryonic stem cell) line that can escape allogeneic responses and lysis by NK cells. iPSCs have the potential to be differentiated to all cell types of the human body. In some embodiments, allogeneic donor cells can be made from hypoimmunogenic iPSCs generated by engineering a combination of HLA molecules and other immune genes. In some embodiments, the iPSCs are modifiable by engineering a landing pad for future gene insertion as disclosed in US11492613B2, which is incorporated herein via reference. These hypoimmunogenic iPS cells can then be differentiated to a specific cell type and provide off-the-shelf cell medicine.

[0046] Immune modulation is a complex process, and many factors are involved in immune recognition and reactions to allografts besides HLA molecules. The rejection of allogeneic cells involves both innate immune cells, such as macrophages and NK cells as well as adaptive immune cells such as CD4+ and CD8+T cells and B cells. One approach to creating immune evasive donor cells is to engineer the cells in such a way that they express specific nonpolymorphic HLA class I molecules, such as the class lb molecules HLA-E, HLA-F and HLA-G, which can inhibit NK cell-mediated lysis without stimulating an allogeneic response. Interactions of the HLA molecules, particularly HLA-F, G, and E, on the allograft cells and their prospective receptors / partners on the immune cells (e.g. T cells and NK cells) of the recipient plays a key role in immune activities, determining graft survival vs. graft rejection. Other immune genes such as the apoptosis-inducing tumor necrosis factor family member FASL (CD95L) can suppress or kill CD4+ and CD8+ lymphocytes.Intracellular molecules like SERPINB9, a serine protease inhibitor (the human orthologue of the Spi6 mouse gene) can inhibit granzyme B, and chemokines such as CCL21 can disrupt the migration of dendritic cells (DCs) and suppress their ability to prime adaptive immunity. Molecules like milk-fat globule EGF-factor 8 (MFGE8) and the surface molecules CD47 (also known as integrin-associated protein) and membrane glycoprotein CD200 can inhibit the phagocytosis of cells by monocytes and macrophages and impair the ability of monocytes and macrophages to produce proinflammatory molecules. Combination of inhibiting several immunogenicity pathways is likely to improve allogeneic engraftment. In some embodiments, the invention disclosed herein is to express a panel of these immune genes and screen for the best hypoimmunogenic cells that can be used for allogeneic cell therapies.Attorney Docket No: 044903-8033W001These genes include HLA-F-b2M fusion, HLA-G-b2M fusion, FASL, SERPINB9, CCL21, MFGE8, CD47, and CD200.Panel of Immunosuppressive Proteins

[0047] Immune modulation is a complex process, and many factors are involved in immune recognition and reactions to allografts besides HLA molecules. The rejection of allogeneic cells involves both innate immune cells, such as macrophages and NK cells as well as adaptive immune cells such as CD4+ and CD8+T cells and B cells (FIG. 1) (Lanza et al. 2019). Innate immune cells can attack allogeneic cells rapidly, whereas adaptive immune cells are primed and expanded in the peripheral lymph organs before migrating to the site of engraftment. Both innate and adaptive immune cells reject allogenic cells in situ using a variety of cytotoxic mechanisms. Immune cloaking strategies found in nature use specific immunomodulatory factors to inhibit these pathways and escape rejection. Non- polymorphic HLA class I molecules like HLA- E, F, and G can suppress NK cell activity and immune checkpoint molecules such as programmed cell death 1 ligand 1 (PD- LI) and the apoptosisinducing tumor necrosis factor family member FASL (CD95) can suppress or kill CD4+ and CD8+ lymphocytes. Intracellular molecules like SERPINB9, a serine protease inhibitor (the human orthologue of the Spi6 mouse gene) can inhibit granzyme B, and chemokines such as CCL21 can disrupt the migration of dendritic cells (DCs) and suppress their ability to prime adaptive immunity. Molecules like milk-fat globule EGF-factor 8 (MFGE8) and the surface molecules CD47 (also known as integrin-associated protein) and membrane glycoprotein CD200 can inhibit the phagocytosis of cells by monocytes and macrophages and impair the ability of monocytes and macrophages to produce proinflammatory molecules. Combination of inhibiting several immunogenicity pathways is likely to improve allogeneic engraftment.

[0048] As used herein, the immunosuppressive protein exogenously expressed in the genetically modified cell can be either a naturally occurring suppressive protein or an engineered immunosuppressive protein modified from the naturally occurring immunosuppressive protein.

[0049] A naturally occurring HLA class lb protein (HLA-F and HLA-G) comprises from N-terminus to C-terminus: an alpha 1 domain, an alpha 2 domain, an alpha 3 domain, a transmembrane domain and a cytoplasmic domain. The alpha 1 domain and alpha 2 domain form the groove of peptide binding. The alpha 3 domain associates with beta-2 microglobulin, which is necessary for the stability of HLA class lb protein complex. In someAttorney Docket No: 044903-8033W001embodiments, the naturally occurring human HLA-F protein has a sequence of SEQ ID NO: 1 or 2. In some embodiments, the naturally occurring human HLA-F protein is encoded by a polynucleotide sequence of SEQ ID NO: 3. In some embodiments, the naturally occurring human HLA-G protein has a sequence of SEQ ID NO: 4. In some embodiments, the naturally occurring human HLA-G protein is encoded by a polynucleotide sequence of SEQ ID NO: 5.

[0050] In some embodiments, the HLA class lb protein is a chimeric protein. As used herein a chimeric HLA class lb protein refers to a protein modified from HLA class lb in which a second polypeptide (i) is fused or inserted to the HLA class lb protein or (ii) replaces a region of amino acids of HLA class lb protein. In some embodiments, the chimeric HLA class lb protein comprises an extracellular region comprising an alpha 1 domain, an alpha 2 domain, an alpha 3 domain, and a P2m protein. In some embodiments, the HLA-F alpha 1 domain has a sequence of SEQ ID NO: 6. In some embodiments, the HLA-F alpha 2 domain has a sequence of SEQ ID NO: 7. In some embodiments, the HLA-F alpha 3 domain has a sequence of SEQ ID NO: 8 or 9. In some embodiments, the HLA-G alpha 1 domain has a sequence of SEQ ID NO: 10. In some embodiments, the HLA-G alpha 2 domain has a sequence of SEQ ID NO: 11. In some embodiments, the HLA-G alpha 3 domain has a sequence of SEQ ID NO: 12. In some embodiments, the P2m protein has a sequence of SEQ ID NO: 13.

[0051] In some embodiments, the extracellular region of the chimeric HLA-F protein has an amino acid sequence of SEQ ID NO: 14 or 15, or a sequence having at least 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the extracellular region of the chimeric HLA-G protein has an amino acid sequence of SEQ ID NO: 16, or a sequence having at least 80%, 85%, 90%, 95%, or 99% identity thereto.

[0052] In some embodiments, the alpha 3 domain linked to the P2m protein (B2M) via a linker. In some embodiments, the linker comprises a glycine-serine (GS) doublet between 2 and 20 amino acid residues in length. Exemplary the linker comprises (G4S)s (SEQ ID NO: 17).

[0053] In some embodiments, the chimeric HLA class lb protein further comprises a transmembrane domain. In some embodiments, the transmembrane domain of the chimeric HLA class lb protein is the transmembrane domain of a naturally occurring HLA class lb protein. In some embodiments, the transmembrane domain of HLA-F has a sequence of SEQ ID NO: 18. In some embodiments, the transmembrane domain of HLA-G has a sequence of SEQ ID NO: 19.Attorney Docket No: 044903-8033W001

[0054] It can be understood that the transmembrane domain of the chimeric HLA class lb protein described herein may be derived from any membrane-bound or transmembrane protein including, but are not limited to, BAFFR, BLAME (SLAMF8), CD2, CD3 epsilon, CD4, CD5, CD8, CD9, CDlla (CD 18, ITGAL, LFA-1), CD 11b, CD 11c, CDlld, CD16, CD19, CD22, CD27, CD28, CD29, CD33, CD37, CD40, CD45, CD49a, CD49d, CD49f, CD64, CD80, CD84, CD86, CD96 (Tactile), CD 100 (SEMA4D), CD 103, CD134, CD137 (4-1BB), CD150 (IPO-3, SLAMF1, SLAM), CD154, CD160 (BY55), CD 162 (SELPLG), CD226 (DNAM1), CD229 (Ly9), CD244 (2B4, SLAMF4), CD278 (ICOS), CEACAM1, CRT AM, GITR, HYEM (LIGHTR), IA4, IL2R beta, IL2R gamma, IL7R a, ITGA1, ITGA4, ITGA6, ITGAD, ITGAE, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, KIR, LTBR, 0X40, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), PAG / Cbp, PSGL1, SLAMF6 (NTB-A, Lyl08), SLAMF7, an alpha, beta or zeta chain of a T-cell receptor, TNFR2, VLA1, and VLA-6. In certain embodiments, the transmembrane domain of the chimeric HLA class lb protein described herein is synthetic, e.g., comprising predominantly hydrophobic residues such as leucine and valine.

[0055] In some embodiments, the chimeric HLA class lb protein further comprises a cytoplasmic domain. In some embodiments, the cytoplasmic domain of the chimeric HLA-F protein described herein is the cytoplasmic domain of a naturally occurring HLA class lb protein. In some embodiments, the cytoplasmic domain of HLA-F has a sequence of SEQ ID NO: 20 or 21. In some embodiments, the cytoplasmic domain of HLA-G has a sequence of SEQ ID NO: 22.

[0056] In some embodiments, the chimeric HLA class lb protein comprises from the N-terminus to the C-terminus: an alpha 1 domain, an alpha 2 domain, an alpha 3 domain, linker, a P2m protein, a transmembrane domain and an intracellular domain. In some embodiments, the HLA-F-B2M fusion protein has a sequence of SEQ ID NO: 23 or 24. In some embodiments, the HLA-F-B2M fusion protein is encoded by a nucleic acid sequence of SEQ ID NO: 25. In some embodiments, the HLA-G-B2M fusion protein has a sequence of SEQ ID NO: 26. In some embodiments, the HLA-G-B2M fusion protein is encoded by a nucleic acid sequence of SEQ ID NO: 27.

[0057] Fas Ligand (FasL, also known as CD95L or Apo-IL) is a type II transmembrane protein and member of the tumor necrosis factor (TNF) family that binds to its death receptor, Fas (CD95 / APO-1), to initiate apoptosis (programmed cell death). It is crucial for maintaining immune homeostasis, regulating self-tolerance, and eliminating infected or cancer cells. It is primarily expressed on activated T-lymphocytes and NaturalAttorney Docket No: 044903-8033W001Killer (NK) cells to eliminate transformed cells, and on immune-privileged sites (e.g., eye, testis) to prevent inflammation. Besides inducing apoptosis, FasL can trigger pathways that promote tumor progression, metastasis, and angiogenesis in certain cancers. FasL occurs through two different forms which are membrane-bound and soluble. The membrane-bound protein exists as three identical subunits which serve as both the receptor activation mechanism and primary factor for complete apoptotic functionality. The soluble form of FasL (sFasL) results from metalloproteinase-mediated proteolytic cleavage of the membranebound FasL particularly through matrix metalloproteinase-7 (MMP-7). Despite its ability to attach with Fas receptors, the soluble form of FasL possesses much less potency for apoptosis induction while researchers assume it functions to modify immune system activities. In some embodiments, the human FasL protein and cDNA used to generate the hypoimmune cell of the present disclosure have a sequence of SEQ ID NO: 28 and 29, respectively.

[0058] Serpin B9 is a potent intracellular serine protease inhibitor (serpin) that acts as the primary defense against granzyme B (GzmB)-mediated apoptosis, protecting cells from cytotoxic T lymphocyte and NK cell-induced death. It is highly expressed in immune-privileged sites, immune cells, and often overexpressed in tumors to evade immune detection. In some embodiments, the human Serpin B9 protein and cDNA used to generate the hypoimmune cell of the present disclosure have a sequence of SEQ ID NO: 30 and 31, respectively.

[0059] CCL21 (CC Motif Chemokine Ligand 21) is a small cytokine belonging to the CC chemokine family, also known as 6Ckine, Exodus-2, or Secondary Lymphoid Tissue Chemokine (SLC). It acts as a homeostatic chemokine, playing a critical role in the recruitment and organization of immune cells, including T cells and dendritic cells, into secondary lymphoid organs (lymph nodes). CCL21 is expressed by high endothelial venules and stromal cells in secondary lymphoid organs, where it helps guide naive T-cells and mature dendritic cells to T-cell areas. It works primarily by binding to the CCR7 receptor, facilitating cell trafficking and immune response. It is characterized by an extended C-terminal tail that contributes to its ability to bind to glycosaminoglycans (GAGs), which helps anchor it to the surface of cells, allowing it to act as a gradient for chemotaxis. Beyond its lymphoid role, CCL21 is involved in chronic inflammation, such as in hepatitis C, where it helps structure lymphoid tissue in the liver. It also has a dual role in cancer, acting as a chemoattractant for tumor-infiltrating lymphocytes but also potentially aiding in tumor-associated lymphoid structures (sometimes linked to pro-tumor immune suppression). InAttorney Docket No: 044903-8033W001some embodiments, the human CCL21 protein and cDNA used to generate the hypoimmune cell of the present disclosure have a sequence of SEQ ID NO: 32 and 33, respectively.

[0060] Milk fat globule-EGF factor 8 (MFGE8), also known as lactadherin, is a secreted glycoprotein that plays a critical role in tissue homeostasis, immune regulation, and cell adhesion. It acts as a bridge between apoptotic cells (dying cells) and phagocytes (engulfing cells), facilitating their clearance, a process essential for reducing inflammation and maintaining tissue health. In some embodiments, the human MFGE8 protein and cDNA used to generate the hypoimmune cell of the present disclosure have a sequence of SEQ ID NO: 34 and 35, respectively.

[0061] CD47 is a transmembrane protein that binds to SIRPa receptors on macrophages to inhibit phagocytosis. It is often overexpressed in many cancers, allowing tumor cells to evade the immune system. Blocking CD47 is a key cancer immunotherapy strategy that triggers macrophages to destroy cancer cells. CD47 also plays a role in regulating cell adhesion, migration, and responses to stress, such as radiation. In some embodiments, the human CD47 protein and cDNA used to generate the hypoimmune cell of the present disclosure have a sequence of SEQ ID NO: 36 and 37, respectively.

[0062] CD200 (Cluster of Differentiation 200) is a type I membrane glycoprotein that functions as an immune checkpoint molecule, promoting self-tolerance and inhibiting inflammatory immune responses through its receptor, CD200R1. It is highly expressed in human neurons, endothelial cells, and various immune cells. Elevated CD200 levels are found in cancers like leukemia, melanoma, and ovarian cancer, often promoting immune evasion. CD200 binds to the inhibitory receptor CD200R, primarily expressed on myeloid cells, to dampen immune activation. It acts as a negative regulator of inflammation. In some embodiments, the human CD200 protein and cDNA used to generate the hypoimmune cell of the present disclosure have a sequence of SEQ ID NO: 38 and 39, respectively.Genetic Modified Cells Expressing the Panel of Immunosuppressive Proteins

[0063] As disclosed herein, a wide range of mammalian cells that express the panel of immunosuppressive proteins described herein can be generated. The cell types that can be used for such modification include, without limitation, totipotent cells, embryonic stem cells (e.g., human embryonic stem cells) and differentiated cells, induced pluripotent stem cells (iPS cells) and differentiated cells, multipotent stem cells, epidermal progenitor cells, mesenchymal stem cells, pancreatic P cell progenitors, pancreatic P cells, cardiac progenitors,Attorney Docket No: 044903-8033W001cardiomyocytes, hepatic progenitors, hepatocytes, muscle cell progenitors, muscle cells, kidney cells, osteoblasts, hematopoietic progenitors, dental follicle cells, hair follicle cells, retinal pigment epithelial cells, neural stem cells, neurons, astrocytes, oligodendrocytes, microglia, inner ear cells, and fibroblasts (e.g., dermal fibroblast). In some embodiments, the genetically modified cells are cells having an immune system cell type such as lymphocytes, natural killer cells, macrophage, and dendritic cells. Such mammalian cells can be derived from one of several species including, e.g., human, mouse, rat, monkey, or pig. In essence, any cell types can be modified to express the panel of immunosuppressive proteins, which has reduced immunogenicity and / or improved immunosuppression as compared to a mammalian cell of the same-type without expressing the panel of immunosuppressive proteins.

[0064] In some embodiments, to obtain a substantially enriched population of genetically modified cells of a desired cell type expressing the panel of immunosuppressive proteins, a genetically modified pluripotent stem cell line such as a human embryonic stem cell line, or a human induced pluripotent stem cell line, or any cell line that has multipotent traits including mesenchymal stem cells and immune system progenitor cells, that expresses the panel of immunosuppressive proteins is generated and then subjected to directed differentiation to obtain a cell population that expresses the panel of immunosuppressive proteins and that is substantially enriched for a desired cell type. In some embodiments, the substantially enriched cell population includes at least about 2% to about 100% of the desired cell type, e.g., at least about 3%, 4%, 5%, 7%, 8%, 10%, 20%, 22%, 25%, 35%, 40%, 45%, 50%, 60%, 70%, 75%, 80%, 85%, or another percentage of the desired cell type from at least about 2% to about 100%. Methods for enriching cells of a desired cell type are known in the art. See, e.g., U.S. Patent No. 8,647,871 to Hantash.

[0065] Methods for obtaining human embryonic stem cells or induced pluripotent stem cells are known in the art, as described in, e.g., U.S. Patent Nos. 6,200,806 and 7,217,569 (for human embryonic stem cell derivation) and 8,048,999, 8,058,065, and 8,048,675 (for generation of human induced pluripotent stem cells).

[0066] The genetically modified mammalian cells, e.g., pluripotent or multipotent stem cell lines and also fully differentiated mammalian cells, that stably express the panel of immunosuppressive proteins encoded by an exogenous nucleic acid can be generated by any of a number of methods known in the art.

[0067] In some embodiments, the genetically modified cells can be generated by stable transfection with one or more nucleic acid expression vectors comprising the nucleicAttorney Docket No: 044903-8033W001acid encoding the panel of immunosuppressive proteins described herein. The nucleic acid encoding the panel of immunosuppressive proteins can be inserted into different types of vectors known in the art, for example, a plasmid, a phagemid, a phage variant, a viral vector derived from animal virus, a cosmid, transposon, a site directed insertion vector (e.g., CRISPR, Zinc finger nucleases, TALEN), or a suicide expression vector. In some embodiments, the vector is a DNA or RNA.

[0068] In some embodiment, the nucleic acid encoding the panel of immunosuppressive proteins s operatively linked to at least one regulatory polynucleotide element in the vector for expression of the panel of immunosuppressive proteins. Typical vectors contain various regulatory polynucleotide elements, for example, elements (e.g., transcription and translation terminators, initiation sequences, and promoters) regulating the expression of the inserted nucleic acid, elements (e.g., origin of replication) regulating the replication of the vector in a host cell, and elements (e.g., terminal repeat sequence of a transposon) regulating the integration of the vector into a host genome.

[0069] The expression of the panel of immunosuppressive proteins can be achieved by operably linking the nucleic acid encoding the panel of immunosuppressive proteins to a promoter, and incorporating the construct into a vector. Suitable promoters include, but are not limited to, the Chinese hamster elongation factor- 1 alpha (CHEF- la) promoter (see Running Deer et al (2004), Biotechnol. Prog., 20:880-889; and GenBank Accession No. AY 188393.1), the M-U3 / R- variant promoter of the Murine Stem Cell Virus (MSCV) promoter (as described in Swindle et al (2004), J Biol Chem, 279:34-41), the phosphoglycerate kinase (PGK) promoter, the human P-actin promoter, the ubiquitin C promoter, a CMV promoter, and a SV40 promoter, a CAG (CMV- P-actin-Globin intron) promoter, EFla (elongation factor 1 -alpha) promoter, and a MMTV promoter.

[0070] In some embodiments, the promoter used to drive expression of the panel of immunosuppressive proteins is expressed in one or more desired cell types at a level that is higher than in other cell types. One of ordinary skill in the art will appreciate that, for example, where a genetically modified stem cell is to be differentiated into a particular cell type, it may be advantageous to select a promoter that is active within or even selective for that particular cell type. For example, for a given tissue or cell type-selective promoter the expression level may be about two fold to 100 fold higher in the desired cell type compared to another cell type, e.g., about 3 fold, 4 fold, 5 fold, 10 fold, 20 fold, 25 fold, 30 fold, 40 fold, 50 fold, 70 fold, 80 fold, 90 fold, or another fold higher level of expression in the desired cell type compared to another cell type. Examples of tissue and / or cell type-selectiveAttorney Docket No: 044903-8033W001promoters include, but are not limited to, the promoters for: Neuron-Specific Enolase (neuronal), Synapsin (neuronal), CamKII (forebrain neurons), HB9 (motor neurons), and Dopamine Transporter (dopaminergic neurons); Glial Fibrillary Acidic Protein (astrocytes); Albumin (liver); a-Myosin Heavy Chain (a-MHC-cardiomyocytes); Neurogenin 3 and Pancreas-Duodenum Homeobox 1 (pancreas); Keratin 14 (skin); Albumin (hepatocytes), and Bestrophinl (retinal pigment epithelium).

[0071] In order to assess the expression of the panel of immunosuppressive proteins, the vector can also comprise a selectable marker gene or a reporter gene or both for identification and selection of the cells to which the vector is introduced. Examples of suitable selectable markers encoded by such vectors include proteins that confer resistance to a selection agent. Such proteins and their corresponding selection agents include, without limitation, puromycin N-acetyltransferase (puromycin), hygromycin phosphotransferase (hygromycin), blasticidin-S-deaminase (blasticidin), and neomycin phosphotransferase (neomycin). Useful reporters include, for example, luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, mCherry red fluorescent protein, or the green fluorescent protein gene.

[0072] In some embodiments, the vector is a viral vector. Viral vectors may be derived from, for example, retroviruses, adenoviruses, adeno-associated viruses (AAV), herpes viruses, and lentiviruses. Useful viral vectors generally contain an origin of replication functional in at least one organism, a promoter, restriction endonuclease sites, and one or more selectable markers. In some embodiments, the vector is a retrovirus vector, such as lentiviral vector. Lentiviral vector is particular useful for long-term, stable integration of the polynucleotide encoding the panel of immunosuppressive proteins into the genome of nonproliferating cells that result in stable expression of the panel of immunosuppressive proteins in the genetically modified cell.

[0073] In some embodiments, the vector is a transposon-based expression vector. A transposon is a DNA sequence that can change its position within a genome. In a transposon system, the nucleic acid encoding the panel of immunosuppressive proteins is flanked by terminal repeat sequences recognizable by a transposase which mediates the movement of the transposon. A transposase can be co-delivered as a protein, encoded on the same vector as the panel of immunosuppressive proteins, or encoded on a separate vector. Non-limiting examples of transposon systems include Sleeping Beauty, Piggyback, Frog Prince, and Prince Charming.Attorney Docket No: 044903-8033W001

[0074] In some embodiments, the vector is a recombinase or integrase-based expression vector. A recombinase or integrase is a highly specialized enzyme that promotes DNA rearrangement between specific target sites (Greindley et al., 2006; Esposito, D., and Scocca, J. J. Nucleic Acids Research (1997) 25, 3605-3614 ; Nunes-Duby, S. E., et al.Nucleic Acids Research (1998) 26, 391-406 ; Stark, W. M., et al. Trends in Genetics (1992) 8, 432-439 ). In a recombinase or integrase system, the nucleic acid encoding the panel of immunosuppressive proteins is operably linked to a first recombinase recognition site which facilitates the recombination between the first recombinase recognition site and a second recombinase recognition site at a target locus to which the nucleic acid encoding the panel of immunosuppressive proteins is inserted. A recombinase or integrase can be co-delivered as a protein or mRNA, or encoded on the same vector as the panel of immunosuppressive proteins, or encoded on a separate vector. Non-limiting examples of recombinase / integrase systems include Cre, Flp, phiC31, Bxbl, and Tn3.

[0075] A vector can be introduced into a mammalian cell by any method known in the art, for example, by physical, chemical or biological means. Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods include the use of viral vectors, and especially retroviral vectors, for inserting genes into mammalian, e.g., human cells. Chemical means include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, lipid nanoparticles, and liposomes. Other means include 3D bio-fabricated scaffolds embedded with cells, organoids, or mini-tissues.

[0076] The genetically modified mammalian cells expressing the panel of immunosuppressive proteins, as described herein, have reduced immunogenicity relative to corresponding mammalian cells that do not express the panel of immunosuppressive proteins. For example, immunogenicity may be reduced by at least about 5% to about 95%, relative to a corresponding cell type that does not express exogenous immunosuppressive proteins, e.g., about 6%, 7%, 10%, 12%, 15%, 20%, 30%, 40%, 50%, 65%, 70%, 80%, 85%, 90%, or another percent reduced immunogenicity relative to cells of the same cell type that do not express exogenous immunosuppressive proteins.

[0077] In some embodiments, the genetically modified mammalian cell disclosed herein has deficiency of HLA-I expression / function and / or HLA-II expression. Human Leukocyte Antigen Class I (HLA-I) molecules, in particular HLA-Ia molecules (HLA-A, -B,Attorney Docket No: 044903-8033W001-C) are essential surface proteins found on nearly all nucleated cells, presenting intracellular peptides to CD8+ T cells to trigger immune responses against viruses and tumors. They are crucial for self / non-self recognition and are a major cause of transplant rejection. HLA class II molecules (HLA-DR, -DQ, -DP) are specialized proteins on antigen-presenting cells (macrophages, B cells, dendritic cells) that present exogenous antigenic peptides to CD4+ T helper cells, initiating immune responses. HLA-II molecules play critical roles in self / non-self recognition, autoimmunity, and transplantation rejection.

[0078] In some embodiments, the genetically modified mammalian cell further comprises a mutation of B2M gene and / or CIITA gene, which results in the deficiency of HLA-I expression / function and / or HLA-II expression. The B2M gene encodes P2-microglobulin (P2m), a critical component of HLA-I molecules found on all nucleated cells. It is essential for immune surveillance, enabling cytotoxic T cells to recognize infected or cancerous cells. Mutations or loss of B2M allow tumors to evade immune detection, while elevated serum levels serve as biomarkers for kidney dysfunction and cancers like lymphoma. The CIITA gene (Class II MHC Transactivator) encodes the “master regulator” protein for HLA-II molecules. CIITA controls and aids in the expression of HLA-II genes. Mutating, e.g., knock-out, B2M gene and CIITA gene reduces the expression / function of HLA-I and HLA-II genes, respectively. Mutating both B2M and CIITA genes can greatly downregulate the expression / function of HLA-I and HLA-II molecules, thereby reducing immune response and transplantation rejection.

[0079] Methods for determining immunogenicity of cells are known in the art. For example, in some embodiments, genetically modified mammalian cells (e.g., human induced pluripotent stem cells, or differentiated cells from genetically modified induced pluripotent stem cells, or cells that are already fully differentiated prior to modification, etc.) or unmodified mammalian cells are cultured in the presence of an allogenic natural killer cell line (e.g., NK-92) and then cytotoxicity to the genetically modified versus unmodified cells by the NK-92 cells is determined by any of a number of standard cell viability assays.

[0080] In some embodiments, immunogenicity assays used herein include without limitation, T cell immunogenicity assays, NK cell cytotoxicity assays, dendritic cell assays, apoptosis assays, and macrophage immunogenicity assays. Examples of T cell immunogenicity assays include ELISpot (Enzyme-Linked ImmunoSpot) assay, Intracellular Cytokine Staining (ICS) with flow cytometry, proliferation assays, tetramer or multimer staining, Cytokine Release Assay (CRA), Allogeneic Mixed Lymphocyte Reaction (MLR) and in silico T cell epitope prediction.Attorney Docket No: 044903-8033W001

[0081] ELISpot (Enzyme-Linked ImmunoSpot) measures the frequency of cytokinesecreting T cells (usually IFN-y, IL-2) in response to an antigen. In an ELISpot assay, an ELISpot plat is coated with capture antibody (e.g., anti- IFN-y). Cells (e.g., PBMCs) are added to the plate and stimulated with antigen. The stimulated cells are incubated to allow cytokine secretion. Detection antibody (e.g., biotinylated antibody) are added to the cell, resulting the formation of cytokine spots on the plate, which can be visualized (e.g. with an enzymatic reaction). The number of spots on the plate indicate the number of reactive T cells.

[0082] Intracellular Cytokine Staining (ICS) with flow cytometry measures cytokine production (e.g., IFN-y, TNF-a) at a single-cell level and distinguishes CD4+ vs. CD8+ T cell responses. Typically, antigen-stimulated PBMCs are fixed and stained for intracellular cytokines, then analyzed by flow cytometry. The assay generates multiparametric data and is useful for profiling T cell subsets and activation states.

[0083] Proliferation assays (e.g., CFSE dilution) tracks T cell proliferation in response to antigen exposure. Typically, T cells are labeled with CFSE (Carboxyfluorescein Diacetate Succinimidyl Ester), a dye that dilutes upon cell division, which can be monitored via flow cytometry. The assay can assess the functional activation of T cells over time.

[0084] Tetramer or multimer staining assay detects T cells that specifically recognize a given peptide-MHC complex. The assay use fluorescent-labeled MHC tetramers loaded with antigenic peptides to stain the T cells. The assay is highly specific and useful in tracking antigen-specific T cells ex vivo.

[0085] Cytokine Release Assay (CRA) measures cytokines (IFN-y, IL-2, IL-6, TNF-a, etc.) released into the supernatant. In the assay, PBMCs or T cells are exposed to the antigen and cytokines are measured by ELISA, Luminex, or MSD. The assay offers a broad screen of immune activation.

[0086] Allogeneic Mixed Lymphocyte Reaction (MLR) measures T cell activation by non-self antigens, often to predict alloimmunogenicity or response to biologies. The assay is often used as an immunogenicity testing for biologic drugs, especially mAbs.

[0087] In silico T cell epitope prediction can be performed using programs such as NetMHCpan, IEDB tools and SYFPEITHI, which predicts MHC class Eli binding peptides from a protein sequence. The assay is often used as an early-stage screening to flag potential immunogenic regions before lab testing.

[0088] Examples of test for macrophage immunogenicity assays include Cytokine Release Assay (CRA), phenotyping by flow cytometry, gene expression analysis, surfaceAttorney Docket No: 044903-8033W001marker upregulation assay, phagocytosis assay, ROS (Reactive Oxygen Species) production assay, and nitric oxide production assay.

[0089] Cytokine Release Assay (CRA) measures secretion of key pro-inflammatory cytokines such as TNF-a, IL-6, IL-ip, and IL-12. In the assay, macrophages (e.g., THP-1 derived or primary human macrophages) are treated with the test substance, and cytokines in the supernatant are quantified using ELISA, Luminex, or MSD platforms. CRA is teh gold-standard assay for detecting innate immune activation.

[0090] Phenotyping by flow cytometry detects surface markers and intracellular cytokines to distinguish activation states. Ml markers include CD80, CD86, and HLA-DR. M2 markers include CD206 (mannose receptor) and CD 163. The assay stain cells posttreatment and analyze by flow cytometry to identify shifts in polarization (pro- vs. antiinflammatory).

[0091] Gene expression analysis (qPCR or RNA-seq) detect transcriptional changes in inflammatory pathways (e.g., NF-KB, inflammasome genes, TLR pathway genes), common targets include TNFA, IL6, IL IB, CCL2, CXCL10, and NLRP3. The assay can provide a mechanistic insight into macrophage activation.

[0092] The upregulation of surface markers, e.g., TLR4, CD 14, MHC-II, CD1 lb, and CD40, can be detected by flow or western Blot to measure danger-associated molecular pattern (DAMP) or PAMP sensing and activation.

[0093] Phagocytosis assay measures functional impact on macrophage phagocytic activity. In the assay, macrophages are exposed to fluorescent beads or labeled particles, and uptake is measured by flow or microscopy. The assay can determine whether activation enhances or suppresses phagocytic function.

[0094] ROS (Reactive Oxygen Species) production assay assess oxidative burst, which is part of classical macrophage activation. ROS production can be measured by DCFDA assay using flow cytometry or plate reader.

[0095] Nitric oxide production assay (Griess Assay) measures the markers of Ml-type activation. The assay is particularly commonly used in murine macrophage models like RAW 264.7.Compositions Comprising Genetically Modified Cells

[0096] Also provided in the present disclosure are pharmaceutical compositions, topical compositions, cellular grafts, and artificial tissues comprising or generated using one or more genetically modified mammalian cells described herein.Attorney Docket No: 044903-8033W001

[0097] The stable and persistent expression of a panel of immunosuppressive proteins provided the genetically modified cells with reduced immunogenicity and / or improved immunosuppression. In addition, the modified mammalian cells can be differentiated from genetically modified stem / progenitor cells and also have stable and persistent expression of the panel of immunosuppressive proteins that provides reduced immunogenicity and / or improved immunosuppression. Thus, the genetically modified cells described herein can be used to generate universal donor cells of any type, whether from directed differentiation of a genetically modified pluripotent or multipotent cell, or from genetic modification of a fully differentiated cell.

[0098] In some embodiment, a therapeutic composition for cancer treatment is provided that comprises a genetically modified CAR-T or CAR-NK cells expressing the panel of immunosuppressive proteins as described herein. The expression of the CAR (e.g., a CAR directed to CD 19) in the genetically modified CAR-T or CAR-NK cells directed the CAR-T or CAR-NK cells specificity and reactivity toward a selected target in a non-MHC-restricted manner, while the expression of the panel of immunosuppressive proteins avoids or decreases the risk of transplantation rejection, making the composition a universal donor for allogeneic cancer immunotherapy. In some embodiments, the genetically modified CAR-T or CAR-NK cells are differentiated from stem / progenitor cells, such as iPS cells in vitro. In some embodiments, the stem / progenitor cells, such as iPS cells are genetically modified to express the CAR and the panel of immunosuppressive proteins.

[0099] In some embodiments, a topical composition for skin regeneration or repair is provided that comprises a genetically modified dermal fibroblast cell expressing the panel of immunosuppressive proteins as described herein. In another aspect, a pharmaceutical composition for injection is provided that comprises a genetically modified dermal fibroblast cell expressing the panel of immunosuppressive proteins as described herein. In another aspect, a skin graft composition is provided that comprises a genetically modified dermal fibroblast cell expressing the panel of immunosuppressive proteins as described herein. In another aspect, a permanent skin graft composition is provided that comprises a genetically modified embryonic epidermal progenitor cell expressing the panel of immunosuppressive proteins described herein.Method of Treatment

[0100] In one aspect, the present disclosure provides a method for cell transplantation therapy. As the genetically modified cells expressing the panel of immunosuppressiveAttorney Docket No: 044903-8033W001proteins described herein have reduced immunogenicity and / or increased immunosuppression, these traits allow the modified cell to serve as a universal or improved donor cell or tissue. This is because the panel of immunosuppressive proteins mediated reduction of immunogenicity and / or improvement in immunosuppression provided to the cell can reduce or eliminate the requirement of matching the type of classical human leukocyte antigen (HLA) class I and class II molecules between donor cells and the recipient for numerous injuries, diseases, or disorders. Thus, the genetically modified cells that stably express the panel of immunosuppressive proteins may be used as a universal donor cell for therapy.

[0101] The therapy may be directed at treating the cause of the disease; or alternatively, the therapy may be to treat the effects of the disease or condition. The genetically modified cells may be transferred to, or close to, an injured site in a subject; or the cells can be introduced to the subject in a manner allowing the cells to migrate, or home, to the injured site. The transferred cells may advantageously replace the damaged or injured cells and allow improvement in the overall condition of the subject. In some instances, the transferred cells may stimulate tissue regeneration or repair, including skin regeneration or skin repair. In some instances, the transferred cells carry therapeutic molecules targeting and eliminating disease causing cells, for example, cancer cells.

[0102] In some embodiments, the genetically modified mammalian cells described herein are administered to a subject suffering from any of a number of conditions including, but not limited to cancer, cardiovascular disease, eye disease (e.g., macular degeneration), auditory disease, (e.g., deafness), diabetes, neurodegenerative disease, Alzheimer's Disease, Parkinson's Disease, multiple sclerosis, osteoporosis, liver disease, kidney disease, autoimmune disease, arthritis, gum disease, a dental condition, or a proliferative disorder (e.g., a cancer). In other cases, the subject is suffering from, or at high risk of suffering from, an acute health condition, e.g., stroke, spinal cord injury, burn, or a wound. In other cases, the subject is suffering from loss of tissue such as lipoatrophy or aging-related losses in collagen. In other cases, the subject suffers from a non-healing ulcer, or is need for an agent to assist in closure of defects like hypospadias. In other cases, the subject is need for a permanent or temporary skin graft for wound healing or for skin substitutes.

[0103] In one aspect, the present disclosure provides a universal method of cellular or tissue grafting to a subject in need thereof, the method comprising injecting or grafting to the subject a cellular or tissue composition comprising a population of the genetically modified cells described herein, wherein the subject has at least one mismatched classical HLA class IAttorney Docket No: 044903-8033W001or HLA class II molecule as compared to the population of genetically modified cells, and wherein the population of genetically modified cells exhibits reduced immunogenicity and / or improved immunosuppression as compared to cells of the same-type without the genetical modification. The reduced immunogenicity and / or improved immunosuppression can be determined, for example, by comparing the genetically modified cell to a control cell of the same type without the genetic modification in an NK-92 cytotoxicity assay, a humanized NSG tumor growth assay, and / or a PBMC proliferation assay.

[0104] In another aspect, the present disclosure provides a method for regenerating skin to a subject in need thereof, the method comprising injecting a population of the genetically modified dermal fibroblasts and / or immunosuppresor modified epidermal progenitors to a site of skin injury on the subject, wherein the subject has at least one mismatched classical HLA class I or HLA class II molecule as compared to the population of genetically modified dermal fibroblasts and or genetically modified epidermal progenitors,

[0105] In another aspect, the present disclosure provides a method for treating cancer in a subject in need thereof, the method comprising administering a population of genetically modified CAR-T or CAR-NK cell to the subject. The CAR (e.g., a CAR directed to CD19) is capable of re-directing the specificity and reactivity of the T cells or NK cells toward a selected cancer cell. The expression of a panel of immunosuppressive proteins makes the modified CAR-T or CAR-NK universal donors in an allogeneic cancer immunotherapy, i.e., the subject may have at least one mismatched classical HLA class I or HLA class II molecule as compared to the genetically modified CAR-T or CAR-NK cells. In some embodiments, the genetically modified CAR-T or CAR-NK cells are differentiated in vitro from iPS cells which are genetically modified to express the CAR and the panel of immunosuppressive proteins.

[0106] Genetically modified cell types to be administered to a subject in need thereof include, but are not limited to, lymphocytes, natural killer cells, macrophage, dendritic cells, epidermal progenitor cells, mesenchymal stem cells, pancreatic P cell progenitors, pancreatic P cells, islet organoids, cardiac progenitors, cardiomyocytes, hepatic progenitors, hepatocytes, muscle cell progenitors, muscle cells, kidney cells, osteoblasts, hematopoietic progenitors, dental follicle cells, hair follicle cells, retinal pigment epithelial cells, neural stem cells, neurons, astrocytes, oligodendrocytes, microglia or any combination thereof, or organoids / mini-tissues thereof . Such mammalian cells can be derived from one of several species including, e.g., human, mouse, rat, monkey, or pig.Attorney Docket No: 044903-8033W001

[0107] The therapy may be directed at treating the cause of the disease; or alternatively, the therapy may be to treat the effects of the disease or condition. The genetically modified cells may be transferred to, or close to, an injured site in a subject; or the cells can be introduced to the subject in a manner allowing the cells to migrate, or home, to the injured site. The transferred cells may advantageously replace the damaged or injured cells and allow improvement in the overall condition of the subject. In some instances, the transferred cells may stimulate tissue regeneration or repair. In some instances, the transferred cells carry therapeutic molecules targeting and eliminating disease causing cells, for example, cancer cells.

[0108] The transferred cells may be cells differentiated from genetically modified pluripotent (or totipotent) stem cells. The transferred cells also may be multipotent stem cells differentiated from pluripotent, genetically modified cells.

[0109] The number of administrations of treatment to a subject may vary. Introducing the genetically modified and / or differentiated cells into the subject may be a one-time event; but in certain situations, such treatment may elicit improvement for a limited period of time and require an on-going series of repeated treatments. In other situations, multiple administrations of the cells may be required before an effect is observed. As will be appreciated by those of ordinary skill in the art, the exact treatment protocols will depend upon the disease or condition, and the stage of the disease and parameters of the individual subject being treated.

[0110] The genetically modified cells may be introduced to the subject via any of the following routes: parenteral, intravenous, intraarterial, intramuscular, subcutaneous, transdermal, intratracheal, intraperitoneal, portal vein, hepatic artery, intrahepatic, intra-biliary, intracerebral, intraventricular, intrathecal, intraci sternal, or into spinal fluid.

[0111] The genetically modified cells may be differentiated into cells and then transferred to subjects suffering from a wide range of diseases or disorders.

[0112] CAR-T or CAR-NK cells have been used to treat cancer (see, e.g., Kershaw et al., supra, Eshhar et al., supra, and Sadelain et al., supra). In some embodiments, genetically modified CAR-T or CAR-NK cells derived from the genetically modified iPS cells expressing a CAR are administered to a subject suffering from cancer.

[0113] Pancreatic islet cells (or primary cells of the islets of Langerhans) may be transplanted into a subject suffering from diabetes (e.g., diabetes mellitus, type 1), see e.g., Burns et al, (2006) Curt Stem Cell Res. Ther., 2:255-266. Thus, in some embodiments,Attorney Docket No: 044903-8033W001pancreatic beta cells or islet organoids derived from genetically modified cells are transplanted into a subject suffering from diabetes (e.g., diabetes mellitus, type 1).

[0114] In other examples, hepatic cells or 3D bio-fabricated hepatic cells derived from genetically modified cells are transplanted into a subject suffering from a liver disease, e.g., hepatitis, cirrhosis, or liver failure.

[0115] Degenerative heart diseases such as ischemic cardiomyopathy, conduction disease, and congenital defects could benefit from stem cell therapies. See, e.g., Janssens et al, (2006), Lancet, 367: 1 13- 121.

[0116] Hematopoietic cells or hematopoietic stem cells (HSCs) derived from genetically modified cells may be transplanted into a subject suffering from cancer of the blood, or other blood or immune disorder. Examples of cancers of the blood that are potentially treated by hematopoietic cells or HSCs include: acute lymphoblastic leukemia, acute myeloblastic leukemia, chronic myelogenous leukemia (CML), Hodgkin's disease, multiple myeloma, and non-Hodgkin’s lymphoma. Often, a subject suffering from such disease must undergo radiation and / or chemotherapeutic treatment in order to kill rapidly dividing blood cells. Introducing HSCs derived from the genetically modified cells to these subjects may help to repopulate depleted reservoirs of cells.

[0117] Subjects suffering from neurological diseases or disorders could especially benefit from the genetically modified cell therapy, especially when the blood brain barrier may have been compromised. In some approaches, the genetically modified cells described herein may be differentiated into neural stem cells or neurons or microglia and then transplanted to an injured site to treat a neurological condition, e.g., Alzheimer's disease, Parkinson's disease, multiple sclerosis, cerebral infarction, spinal cord injury, or other central nervous system disorder, see, e.g., Morizane et al, (2008), Cell Tissue Res., 33 1(1):323 -326; Coutts and Keirstead (2008), Exp. Neurol., 209(2):368-377; Goswami and Rao (2007), Drugs, 10(10):713-719.

[0118] For the treatment of Parkinson's disease, the genetically modified cells described herein may be differentiated into dopamine-acting neurons and then transplanted into the striate body of a subject with Parkinson's disease. For the treatment of multiple sclerosis (MS), neural stem cells may be differentiated into oligodendrocytes or progenitors of oligodendrocytes, which are then transferred to a subject suffering from MS.

[0119] For the treatment of any neurologic disease or disorder, a successful approach may be to introduce neural stem cells to the subject. For example, in order to treat Alzheimer's disease, cerebral infarction or a spinal injury, the genetically modified cellsAttorney Docket No: 044903-8033W001described herein may be differentiated into neural stem cells followed by transplantation into the injured site. The genetically modified cells described herein may also be engineered to respond to cues that can target their migration into lesions for brain and spinal cord repair, e.g., Chen et ah, (2007), Stem Cell Rev,, 3(4):280-288.

[0120] Optionally, the genetically modified cells used in the cell transplantation therapies also express a reporter protein as described herein. In some embodiments, the reporter protein to be used is one that facilitates in vivo detection (e.g., imaging) of the introduced cells. For example, the cells may express a far-red emitting fluorescent protein such as Katushka, whose long excitation and emission wavelengths are well suited to imaging in tissues. Katushka is commercially available under the tradename “TurboFP635” (Evrogen, Moscow, Russia),EXAMPLE

[0121] While the disclosure has been particularly shown and described with reference to specific embodiments (some of which are preferred embodiments), it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present disclosure as disclosed herein.

[0122] Example 1

[0123] This example illustrates the expression level of HLA-F in iPS cells.

[0124] Before overexpressing HLA genes, we measured the basal mRNA level of HLA-E, HLA-F and HLA-G in iPS cells by qRT-PCR. PBMC was included as a comparison. We did qRT-PCR in two clones, iPSC-9211-1 and iPSC-9211-2, as well as in iPSC-differentiated-cells (20 days of differentiation). Four separate experiments were conducted.Table 2 shows that basal level expression of HLA-E, F and G is generally low in ASE-9211 iPSC or its differentiated cells compared to PBMC.

[0125] Table 1. Primers for detecting HLA-E, F and G.Primer Sequence SEQ ID NOHuHLA-E-F TTCGCCTACGACGGCAAGGA 40HuHLA-E-R CCCTTCTCCAGGTATTTGTG 41HuHLA-F-F GGCAGAGGAATATGCAGAGGAGTT 42HuHLA-F-R CTCTGTGTCCTGGGTCTGTTC 43HuHLA-G-F TTGGGAAGAGGAGACACGGAACA 44HuHLA-G-R AGGTCGCAGCCAATCATCCAC 45XC423-HLA-G-F-1 GAGCGAGGCCAGTGAGTAA 46XC424-HLA-G-R-1 TCTCCCAGGTAGAGGGTCTG 47XC425-HLA-G-F-2 GCCTCCCTGATCTCCTGTAG 48XC426-HLA-G-R-2 GACGGACCCTCAGAATCACT 49Attorney Docket No: 044903-8033W001XC427-HLA-E-F-1 CTCCGAGCAAAAGTCAAATG 50XC428-HLA-E-R-1 CCTAGCCCAAGAAGGAGATG 51XC429-HLA-E-F-2 TAAGTCCAGGCTGGTGTCAA 52

[0126] Table 2. HLA-E, F and G expression in iPSC lines.Fold difference in mRNA level to control Taget Cells Experiment #1 Experiment #2 Experiment #3 Experiment #49211-1 23 14 27 5 9211-2 7 6 29 3 HLA-E9211-Diff(20 d) 29 62 13 PBMC 917 906 2196 616 HILA-F 9211-1 1 89 257 379211-2 1 93 217 35 9211-Diff(20 d) 8 1 1 PBMC 1068 347 1559 2695 HLA-G 9211-1 358 1 4 4689211-2 147 0 2 592 9211-Diff(20 d) 11 45 347PBMC 1206 919 1894 7128

[0127] Example 2

[0128] This example illustrates the expression of HLA-F in modified and unmodified HEK293 cells.

[0129] We generated modified HEK293 cells that contain a single copy insertion of HLA-F or HLA-G at the safe genomic Hl 1 locus using our TARGATT technology (Chi et al.2019) and conducted qRT-PCR. Data in Table 3 shows that HEK293 cells have higher basal level HLA expression compared to iPS cells, with HLA-F and G being expressed much higher than HLA-E (Table 3). One copy of exogenous HLA-F and HLA-G increased HLA-F and HLA-G expression by 10-fold and 7-fold, respectively.

[0130] Table 3. HLA-E, F and G expression in modified or unmodified HEK293 cells. iPSC was included in the same experiment for comparison purposes.Cell Fold difference in mRNA9211-1 59211-2 39211 -differentiated 13HLA-E HEK 102HEK-HLA-F 37HEK-HLA-G 47PBMC 6169211-1 37HLA-F9211-2 35Attorney Docket No: 044903-8033W0019211 -differentiated 1HEK 3393HEK-HLA-F 33865HEK-HLA-G 1565PBMC 26959211-1 4689211-2 5929211 -differentiated 347HLA-G HEK 22011HEK-HLA-F 5682HEK-HLA-G 148496PBMC 7128

[0131] Example 3

[0132] This example illustrates the expression of HLA-F variants in HEK293 cells.

[0133] Besides the “canonical” isoform 1 with 346 amino acids (SEQ ID NO: 1 or 2) (designated as “HLA-F-S” for HLA-F short form in Tables 4), HLA-F exists in several isoforms, mainly isoform 3, which is the longest isoform with an extra 96 amino acid sequence in its cytoplasmic region (designated as “HLA-F-L” for HLA-F long form, SEQ ID NO: 3 or 4). A naturally occurring HLA-F comprises from N-terminus to C-terminus: an HLA-F alpha 1 domain, an alpha 2 domain, an alpha 3 domain, a transmembrane domain and a cytoplasmic domain. The HLA-F alpha 1 domain and alpha 2 domain form the groove of peptide binding. The HLA-F alpha 3 domain associates with beta-2 microgloblin (P2M), which is necessary for the stability of HLA-F complex.

[0134] We generated a HLA-F-P2M fusion (FIG. 5C and 5D), which contains from N to C terminus, a signal peptide, alphal, 2 and 3 domains, 15-amino acid (GGGGS)3 linker, P2M, transmembrane and cytoplasmic domain. We further generated HEK293 cells contain the fusion either in HLA-F short or long form.

[0135] Data in Table 4 shows that (i) one copy of exogenous gene insertion increased HLA-F and HLA-F-P2M mRNA expression level by over 100-fold in HEK293 cells; (ii) mRNA expression level is similar for all three HLA-F variants tested. The higher gene expression level in this round of experiments compared to Table 3 data is probably due to the different promoters used in the two experiments. Table 3 experiment used CAG promoter, whereas Table 4 used CEF (CHO EFl alpha) promotor.

[0136] Table 4. Expression of HLA-E, F and G in modified HEK293 cells.Cells Fold difference in mRNAHLA-E iPSC (ASE9-9211) 3Attorney Docket No: 044903-8033W001HEK-HLA-F-S 18HEK-HLA-F-S-P2M 23HEK-HLA-F-S-P2M 11PBMC 616iPSC (ASE9-9211) 104HEK-HLA-F-S 251998HLA-F HEK-HLA-F-S-P2M 389922HEK-HLA-F-S-P2M 243664PBMC 2695iPSC (ASE9-9211) 780HEK-HLA-F-S 8508HLA-G HEK-HLA-F-S-P2M 7776HEK-HLA-F-S-P2M 8225PBMC 7128

[0137] Example 4

[0138] This example illustrates that the expression of exogenous HLA-F protein reduces immunogenicity of HEK-293 cells in aNK cytotoxicity assay.

[0139] To perform cytotoxicity assay, 5X104HEK-293 cells detached using EDTA were co-cultured with 2.5X106PBMC cells for 4 hours. The cells were then collected, washed 2 times in PBS, and stained with Green Dye (Thermo Fisher L23101) for 30 mins in 4°C with light protection. Afterwards, the cells were spun down, washed 2 times in 2% FBS + PBS, and subjected to FACS analysis. Three groups of cells were used in the assay:HEK293 cells expressing control mCherry gene; HEK293 cells expressing HLA-G gene regulated by CEF promoter, CHO EFlalpha promoter (CEF-HLA-G) (Zhao et al. 2014; Hantash 2017); HEK293 cells expressing HLA-F-P2M fusion gene regulated by CEF promoter (CEF-HLA-F-P2M). As shown in FIG. 6 and Table 5 from 3 independent experiments, expression of exogenous HLA-G and HLA-F-P2M protein significantly reduced NK cell mediated cytotoxicity, with HLA-G being slightly more effective than HLA-F. The inventors decided to use HLA-F long form fusion because the long form fusion had given more consistent immune protection result than the short form fusion.

[0140] Table 5. Exogenous expression of HLA-G and HLA-F-piM protein reduce NK cell mediated cytotoxicityCell Death RatioStandardExp # 1 Exp # 2 Exp # 3 Average Error mCherry HEK 1.000 1.000 1.000 1.000 0.000CEF-HLA-G 0.719 0.768 0.711 0.733 0.025Attorney Docket No: 044903-8033W001CEF-HLA-F-P2M 0.762 0.873 0.752 0.795 0.055

[0141] Example 5

[0142] This example illustrates the generation of starting iPSC cell line for rapid, efficient, site-specific gene insertion.

[0143] We used Applied StemCeH’s TARGATT™ iPSC line that contains a “landing pad” to establish hypoimmune iPSC line. TARGATT™ uses a serine integrase, such as phiC31 or Bxbl integrase, that allows stable high-efficiency gene insertion into a safe harbor genomic locus. The phiC31 and Bxbl integrase catalyze irreversible recombination between two non-identical sites, attB and attP. The result is an improvement in integration efficiency compared with other recombinase or nuclease system including CRISPR / Cas9. The strategy of TARGATT™ site-specific transgene integration is illustrated in FIG. 7. We have proven that TARGATT™ works in gene insertion at up to 45% efficiency both in cells and in animals, and over 90% with drug selection / enrichment.

[0144] The TARGATT™ iPSC master cell line, AST-9450, was engineered from our well-characterized, karyotype normal iPSC line, ASE-9280 (GMP -grade) to contain a landing pad with attB sites at the Hl 1 locus on human chromosomes 22. The line was reprogrammed using episomal factors from CD34+ umbilical cord blood cells. Both AST-9450 and ASE-9280 have been fully characterized for pluripotency biomarkers, normal karyotype, and directed differentiation to three germ layers. ASE-9280 has a drug master file with the US FDA for clinical use.

[0145] Example 6

[0146] This example illustrates the generation of hypoimmune iPSC line using MAD7 gene editing system to generate B2M (HLA I) / CIIGA (HLA II) double knockout (dKO) iPSC line.

[0147] To knock-out B2M gene, two Mad7 guide RNAs were designed to target Exon2 of B2M gene to generate out-of-frame INDEL that would cause early stop codon:

[0148] B2M gRNA 1 : 5’- CTCACGTCATCCAGCAGAGAATG -3’ (SEQ ID NO: 53)

[0149] B2M gRNA 2: 5’- CATTCTCTGCTGGATGACGTG -3’ (SEQ ID NO: 54)

[0150] To knock-out CIITA gene, a Mad7 gRNA was designed to target Exonl of CIITA gene to generate out-of-frame INDEL that would cause early stop codon:

[0151] CIITA gRNA: 5’- CCTTGGGGCTCTGACAGGTA -3’ (SEQ ID NO: 55)Attorney Docket No: 044903-8033W001

[0152] The gRNAs were ordered from IDT, and we used RNP format (Aldevron’s Eureca-V™ MAD7) to perform CRISPR knock-out of B2M and CIITA on TARGATT iPSC line (AST-9450).

[0153] The generated dKO cell clones were cultured and identified for the knock-out of B2M and CIITA genes by sequencing. The selected clones were then propagated and detected for the expression of OCT4, SOX2, SSEA4 and TRA1 by FACS. The selected clones were also measured for the expression of B2M.

[0154] Cytogenetic analysis was performed on twenty G-banded metaphase spreads of the human cell line PD035 Cl 7. Every spread displayed an apparently normal male karyotype.

[0155] Example 7

[0156] This example illustrates generation of hypoimmune iPSC line using TARGATT gene insertion.

[0157] To further improve allograft in a meaningful way for clinical applications, we use a combination of HLA-F-b2M, HLA-G-b2M and other immune cloaking genes to inhibit multiple immune rejection pathways, thus improving immune cloaking function of the donor cells. HLA molecules act through NK cells, whereas CD95L (FASL) suppresses or kills CD4+ and CD8+ lymphocytes. CD95L is predominantly expressed in activated T lymphocytes and natural killer cells, and is constitutively expressed in tissues of ‘immune-privilege sites’ such as the testis and eye, suggesting its function in immune protection. SERPINB9 inhibits granzyme B and CCL21 disrupts the migration of dendritic cells (DCs). MFGE8, CD47, and CD200 can inhibit the phagocytosis of cells by monocytes and macrophages.

[0158] Design of immune gene combination and vector constructs

[0159] To improve immune protective activity, we combine gene(s) from different immune rejection pathways and then add additional gene(s) for potential synergistic effects.Table 6 shows the design of genes and donor constructs for generating 4 cell lines. In the construct design, each expression cassette expresses two to five genes separated by 2A or IRES sequences under one CAG promoter, with an attP site for subsequent gene insertion purposes. The starting iPSC line is all the same, which is iPSC-B2M / CIITA double knockout illustrated in Example 6.

[0160] Table 6. Design of Genes and Donor ConstructsCell Line Additional genes Construct design Final knockin lineAttorney Docket No: 044903-8033W0011 CAG promoter]-[HLA-FB]- HLA-FB-CD200 HLA-F-b2M, CD200[IRES / 2A]-[CD2001-[polyAl-attP2 HLA-FB-GB-CD200 HLA-F-b2M, HLA-G- CAG promoter]-[HLA-FB]-[IRES]- b2M, CD200 [HLA-GB] -[IRES] - [CD200]- [polyA]-attP3 HLA-FB-GB-CD200- HLA-F-b2M, HLA-G- CAG promoter]-[HLA-FB]-[IRES]- b2M, CD200, CCL21 [HLA-GB] -[IRES] - [CD200]- CCL21fIRES]-[CCL21] [polyAl-attP4 HLA-FB-GB-CD200- HLA-F-b2M, HLA-G- CAG promoter]-[HLA-FB]-[IRES]- b2M, CD200, CCL21 [HLA-GB] -[IRES] - [CD200]- CCL21-SERPIN,[IRES]-[CCL21]-[IRES]- SERPINB9[SERPIN]-[polyA]-attP

[0161] FIG. 8 shows the design of a donor construct for generating a cell line that expresses HLA-F-B2M, CD200, CCL21, SERB INB 9 and HLA-G1-B2M. As shown in FIG.8, a bidirectional promoter (2 back-facing CAG promoters) is used to drive the expression of SERBINB9, CCL21 and HLA-G1-B2M in one direction, and HLA-F-B2M and CD200 in the other direction. The SERBINB9, CCL21 and HLA-G1-B2M genes are operably linked and separated by IRES sequences. The HLA-F-B2M and CD200 genes are separated by 2A sequence.

[0162] Additional immune genes, including but not limited to, HLA-E, CD95L (FASL), CD47, PDL1, MFGE8 may be expressed to improve immune cloaking.

[0163] Expression of inserted immune genes

[0164] Transgene expression is measured by quantitative RT-PCR. Briefly, total RNA is extracted from the cells using Quick-RNA Microprep Kit (Zymo Research). cDNA is prepared from the total RNA extraction using i Script cDNA Synthesis Kit (Bio-Rad). The level of each transgene is assayed by real time PCR using go-Tag green polymerase (Promega) with primers specific to each gene. Parental iPSC line and PBMC are used as controls.

[0165] NK-mediated cytotoxicity assay

[0166] Immune protective activities are measured by NK-mediated cytotoxicity assay. The assay is carried out using the LIVE / DEAD® Cell-Mediated Cytotoxicity Kit (Molecular probe, L7010) (ThermoFisher). Briefly, NK cells (purchased from ReachBio) activated by IL2 (effector cells) are mixed with target cells (iPSC and / or its differentiated cells in single cell suspension) at a ratio of 1:1, 2:1, 4:1, and 10:1 and incubate for 4 hours at 37 TEC in a humidified 5% CO2 incubator. Live / dead cells were determined by FACS analysis according to manufacturer’s instruction. Each assay condition is done in triplicates.Attorney Docket No: 044903-8033W001Percentage of cell death of each cell line is compared and analyzed. Cell lines with improved immune compatibility had less cell death.

[0167] INF-Gamma and Granzyme-B ELISpot assay

[0168] Immune compatibility is further assessed by INF-Gamma and Granzyme-B secretion due to immune reactions using ELISpot assays. Briefly, each of the 8 gene modified iPSC lines and control lines is treated for 2 days with INF-Gamma to stimulate MHC-1 expression and then incubated with PBMC from two non-HLA-matched healthy donors in fresh media supplemented with IL-2 (to amplify cytotoxic T and NK cell response). ELISpots are performed according to manufacturer’s instruction (R&D System). Plates are scanned and spots, directly related to INF-gamma and Granzyme release, are counted. Cell lines with improved immune compatibility has reduced INF-Gamma and Granzyme secretion.Attorney Docket No: 044903-8033W001ReferencesAfroz S, Giddaluru J, Vishwakarma S, Naz S, Khan AA, Khan N. (2017). A comprehensive gene expression meta-analysis identifies novel immune signatures in rheumatoid arthritis patients. Front Immunol.8:74.Bertoni C, Jarrahian S, Wheeler TM, Li Y, Olivares EC, Calos MP, Rando TA.Enhancement of plasmidmediated gene therapy for muscular dystrophy by directed plasmid integration. Proc Natl Acad Sci U S A. 2006 Jan 10;103(2):419-24.Bix, M. et al. (1991). Rejection of class I MHC- deficient haemopoietic cells by irradiated MHC- matched mice. Nature 349, 329-331.Boudreau JE, Hsu KC. (2018). Natural killer cell education and the response to infection and cancer therapy: stay tuned. Trends Immunol. 39:222-39. doi:10.1016 / j .it.2017.12.001Braud, V. M. et al. (1998). HLA- E binds to natural killer cell receptors CD94 / NKG2A, B and C. Nature 391, 795-799.Burrows CK, Kosova G, Herman C, Patterson K, Hartmann KE, Velez Edwards DR, Stephenson MD, Lynch VJ, Ober C. (2016). Expression Quantitative Trait Locus Mapping Studies in Mid-secretory PhaseEndometrial Cells Identifies HLA-F and TAP2 as Fecundability -Associated Genes. PLoS Genet. 2016 Jul 22;12(7):el005858.Calos M (2006). The phiC31 integrase system for gene therapy. Curr Gene Ther. 2006 Dec;6(6):633-45.Chavez CL and Calos MP (2011). Therapeutic applications of the phiC31 integrase system. Curr Gene Ther. 2011 Oct;l 1(5):375-81.Chen-Tsai RY. (2019). Using TARGATTTM technology to generate site-specific transgenic mice. Methods Mol Biol. 2019; 1874:71-86. Book chapter.Chen-Tsai, RY. (2020) Integrase-mediated targeted transgenics through pronuclear microinjection. Methods Mol Biol. 2020; 2066-35-46. Book chapter.Chi X, Zheng Q, Jiang R, Chen-Tsai RY, Kong LJ. A system for site-specific integration of transgenes in mammalian cells. PLoS One. 2019 Jul 25;14(7):e0219842.Burian A, Wang KL, Finton KA, LeeN, Ishitani A, Strong RK, et al. (2016). HLA-F and MHC-I open conformers bind natural killer cell Ig-like receptor KIR3DS1. PLoS ONE.ll:e0163297.Dulberger CL, McMurtrey CP, Holzemer A, Neu KE, Liu V, Steinbach AM, et al. (2017). Human leukocyte antigen F presents peptides and regulates immunity through interactions withNK cell receptors. Immunity.46: 1018-29e7.Attorney Docket No: 044903-8033W001Farruggio AP, Bhakta MS, du Bois H, Ma J, P Calos M. Genomic integration of the full-length dystrophin coding sequence in Duchenne muscular dystrophy induced pluripotent stem cells. Biotechnol J. 2017 Apr; 12(4). doi: 10.1002 / biot.201600477. Epub 2017 Mar 15. PMID: 28139886.Farruggio AP, Chavez CL, Mikell CL, Calos MP. Efficient reversal of phiC31 integrase recombination in mammalian cells. Biotechnol J. 2012 Nov;7(l 1): 1332-6.Geraghty DE, Wei XH, Orr HT, Koller BH. (1990). Human leukocyte antigen F (HLA-F). An expressed HLA gene composed of a class I coding sequence linked to a novel transcribed repetitive element. J Exp Med.171: 1-18Godeau F, Luescher IF, Ojcius DM, Saucier C, Mottez E, Cabanie L, Kourilsky P.(1992). Purification and ligand binding of a soluble class I major histocompatibility complex molecule consisting of the first three domains of H-2Kd fused to beta 2-microglobulin expressed in the baculovirus-insect cell system. J Biol Chem. 1992 Dec 5;267(34):24223-9. PMID: 1447172.Goodridge JP, Burian A, Lee N, Geraghty DE. (2013). HLA-F and MHC class I open conformers are ligands for NK cell Ig-like receptors. J Immunol.191 :3553-62.Gornalusse, G. G. et al. (2017). HLA- E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells. Nat. Biotechnol. 35, 765-772.Groth AC and Calos MP. (2004) Phage integrases: biology and applications. J Mol Biol.2004; 335(3): 667-78. PMID: 14687564.Hackmon R, Pinnaduwage L, Zhang J, Lye SJ, Geraghty DE, Dunk CE. (2017).Definitive class I human leukocyte antigen expression in gestational placentation: HLA-F, HLA-E, HLA-C, and HLA-G in extravillous trophoblast invasion on placentation, pregnancy, and parturition. Am J Reprod Immunol. 77:el2643.Hantash BM. (2017). Patent No.: US 9,714.280 B2. HLA-G modified cells and methods. Hermanson DL, Bendzick L, Pribyl L, McCullar V, Vogel RI, Miller JS, Geller MA, Kaufman DS. (2016). Induced Pluripotent Stem Cell-Derived Natural Killer Cells for Treatment of Ovarian Cancer. Stem Cells. 2016; 34:93-101Hicklin, D. J. et al. (1998). P2-Microglobulin mutations, HLA class I antigen loss, and tumor progression in melanoma. J. Clin. Invest. 101, 2720-2729.Iriguchi, S. Y. (2021). A clinically applicable and scalable method to regenerate T-cells from iPSCs for off-the-shelf T-cell immunotherapy. Nature Communications. 2021; 12: 430.Attorney Docket No: 044903-8033W001Jucaud V, Ravindranath MH, Terasaki PI (2015) Immunobiology of HLA Class-Ib Molecules in Transplantation. SO J Immunol 3(4): 1-15.Karow M, Chavez CL, Farruggio AP, Geisinger JM, Keravala A, Jung WE, Lan F, Wu JC, Chen-Tsai Y, Calos MP. (2011). Site-specific recombinase strategy to create induced pluripotent stem cells efficiently with plasmid DNA. Stem Cells. 2011 Nov;29(l 1): 1696-704. PMID: 21898697.Keravala A, Groth AC, Jarrahian S, Thyagarajan B, Hoyt JJ, Kirby PJ, Calos MP. (2006) A diversity of serine phage integrases mediate site-specific recombination in mammalian cells. Mol Gen Genomics (2006) 276:135-146. PMID: 16699779.Laaribi AB, Hannachi N, Ben Yahia H,MarzoukM,Mehri A, BelhadjM, et al. (2018). Human leukocyte antigen (HLA-F) polymorphism is associated with chronic HBV infection. Biotech.8:49.Lanza R, Russell DW, Nagy A. (2019). Engineering universal cells that evade immune detection. Nat Rev Immunol 19, 723-733 (2019) doi : 10.1038 / s41577-019-0200-1 Lee, N. et al. (1998). HLA- E is a major ligand for the natural killer inhibitory receptor CD94 / NKG2A. Proc. Natl Acad Sci. USA 95, 5199-5204.Liang Q, Monetti C, Shutova MV, Neely EJ, Hacibekiroglu S, Yang H, Kim C, Zhang P, Li C, Nagy K, Mileikovsky M, Gyongy I, Sung H-K & Nagy A. (2018). Linking a celldivision gene and a suicide gene to define and improve cell therapy safety. Nature.2018 Nov;563(7733):701-704.Liao, N. S., Bix, M., Zijlstra, M., Jaenisch, R.& Raulet, D. (1991). MHC class I deficiency: susceptibility to natural killer (NK) cells and impaired NK activity. Science 253, 199-202.Lunemann S, Schobel A, Kah J, Fittje P, Holzemer A, Langeneckert AE, et al. (2018). Interactions between KIR3DS1 and HLA-F activate natural killer cells to control HCV replication in cell culture. Gastroenterology.155:1366-71e3.Maleki AF, Sekhavati MH (2017). Application of phiC31 integrase system in stem cells biology and technology: a review. Fronters in Life Science vol 11, pl-10.Olivares EC, Hollis RP, Chalberg TW, Meuse L, Kay MA, Calos MP. (2002). Sitespecific genomic integration produces therapeutic Factor IX levels in mice. Nature Biotechnology, 2002; 20: 1124-112.Pazmany, L. et al. (1996). Protection from natural killer cell mediated lysis by HLA- G expression on target cells. Science 274, 792-795.Attorney Docket No: 044903-8033W001Pecht I. (2018). Immuno-receptors: from recognition to signaling and function. Eur Biophys J. 47:363-71.Persson G, Melsted WN, Nilsson LL, Hviid TVF. (2017). HLA class lb in pregnancy and pregnancy -related disorders. Immunogenetics.69:581-95.Santos MR, Couto AR, Foroni I, Bettencourt BF, Li Z, Meneses R, et al. (2018). Non-classical human leucocyte antigens in ankylosing spondylitis: possible association with HLA-E and HLA-F. RMD 0pen.4:e000677.Shobu T, SageshimaN, Tokui H, OmuraM, Saito K, Nagatsuka Y, et al. (2006). The surface expression of HLA-F on decidual trophoblasts increases from mid to term gestation. J Reprod Immunol. 72:18-32.Song S, Miranda CJ, Braun L, Meyer K, Frakes AE, Ferraiuolo L, Likhite S, Bevan AK, Foust KD, McConnell MJ, Walker CM, Kaspar BK. (2016). Major histocompatibility complex class I molecules protect motor neurons from astrocyte-induced toxicity in amyotrophic lateral sclerosis. Nat Med. 2016 Apr; 22(4): 397-403. Epub 2016 Feb 29. PMID: 26928464.Tang M, Lautenberger JA, Gao X, Sezgin E, Hendrickson SL, Troyer JL, et al. (2012). The principal genetic determinants for nasopharyngeal carcinoma in China involve the HLA class I antigen recognition groove. PLoS Genet.8 :el 003103.Tasic B, Hippenmeyer S, Wang C, Gamboa M, Zong, H, Chen-Tsai Y, Luo L. (2011). Site-specific integrase-mediated transgenesis in mice via pronuclear injection. Proc Natl Acad Sci U S A. 2011 May 10;108(19):7902-7. Epub 2011 Apr 4. PMID: 21464299. Vely F, Golub R, Vivier E. (2016). HLA-fatal attraction. Nat Immunol.17: 1012-4.Venken KJ, He Y, Hoskins RA, Bellen HJ. Pfacman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science. 2006 Dec 15;314(5806): 1747-51Wu B, Yang H, Ying S, Lu H, Wang W, Lv J, et al. (2018). High HLA-F expression is a poor prognosis factor in patients with nasopharyngeal carcinoma. Anal CellPathol.2018:7691704.Wu MY, Huang SJ, Yang F, Qin XT, Liu D, Ding Y, et al. (2017). Detection of nasopharyngeal carcinoma susceptibility with single nucleotide polymorphism analysis using next-generation sequencing technology. Oncotarget.8: 52708-23.Zhang X, Lin A, Zhang JG, Bao WG, Xu DP, Ruan YY, et al. (2013). Alteration of HLA-F and HLA I antigen expression in the tumor is associated with survival in patients with esophageal squamous cell carcinoma. Int J Cancer.132:82-9.Attorney Docket No: 044903-8033W001Zhao L, Teklemariam T, Hantash BM. (2014). Heterelogous expression of mutated HLA-G decreases immunogenicity of human embryonic stem cells and their epidermal derivatives. Stem Cell Research (2014) 13, 342-354Zhu F, Gamboa M, Farruggio AP, Hippenmeyer S, Tasic B, Shule B, Chen-Tsai Y, Calos MP. (2013) Dice, an efficient system for iterative genomic editing in human pluripotent stem cells. Nucleic Acid Res. 2014 Mar;42(5):e34. Epub 2013 Dec 4.

Claims

Attorney Docket No: 044903-8033W001WHAT IS CLAIMED IS:

1. A genetically modified mammalian cell comprising an exogenous nucleic acid encoding a panel of immunosuppressive proteins expressed in the genetically modified mammalian cell, wherein the genetically modified mammalian cell has reduced immunogenicity and / or improved immunosuppression as compared to a mammalian cell of the same-type without said exogenous nucleic acid, wherein the panel of immunosuppressive proteins is selected from the group consisting of a nonpolymorphic HLA class lb protein, FASL (CD95L), SERPINB9, CCL21, MFGE8, CD47, CD200, and a variant thereof.

2. The genetically modified mammalian cell of claim 1, wherein the nonpolymorphic HLA class lb protein is a HLA-F protein or a HLA-G protein.

3. The genetically modified mammalian cell of claim 2, wherein the panel of immunosuppressive proteins comprises a HLA-F-b2M fusion protein and / or a HLA-G- b2M fusion protein.

4. The genetically modified mammalian cell of claim 1, which has deficiency of HLA-I expression / function and / or HLA-II expression.

5. The genetically modified mammalian cell of claim 4, further comprising a mutation of B2M gene and / or CIITA gene.

6. The genetically modified mammalian cell of claim 1, wherein the modified mammalian cell is a human cell.

7. The genetically modified mammalian cell of claim 1, wherein the modified mammalian cell is an embryonic stem cell or iPS cell.

8. The genetically modified mammalian cell of claim 1, wherein the modified mammalian cell is a cell differentiated from a stem / progenitor cell.

9. The genetically modified mammalian cell of claim 1, wherein the modified mammalian cell is a T cell or a NK cell.

10. The genetically modified mammalian cell of claim 1, further comprising a chimeric antigen receptor (CAR).Attorney Docket No: 044903-8033W00111. The genetically modified mammalian cell of claim 1, wherein the reduced immunogenicity and / or improved immunosuppression of the genetically modified mammalian cell as compared to the mammalian cell without said exogenous nucleic acid is determined by an immunogenicity assay.

12. The genetically modified mammalian cell of claim 11, wherein the immunogenicity assay is a T cell immunogenicity assay, a NK cell cytotoxicity assay, a dendritic cell assay, an apoptosis assay, or a macrophage immunogenicity assay.

13. A method of cell transplantation therapy comprising injecting, implanting, or grafting to a subject in need thereof a cellular or tissue composition comprising a population of genetically modified cells, wherein the genetically modified cells comprises an exogenous nucleic acid encoding a panel of immunosuppressive proteins expressed in the genetically modified mammalian cell, wherein the subject has at least one mismatched classical HLA class I or HLA class II molecule as compared to the genetically modified cells, and wherein the population of genetically modified cells exhibit reduced immunogenicity and / or improved immunosuppression as compared to cells of the same-type without said exogenous nucleic acid.

14. The method of claim 13, wherein the panel of immunosuppressive proteins is selected from the group consisting of a nonpolymorphic HLA class lb protein, FASL, SERPINB9, CCL21, MFGE8, CD47, CD200, and a variant thereof.

15. The method of claim 13, wherein the at least one mismatched classical HLA class I or HLA calls II molecule is selected from the group consisting of HLA- A, HLA-B, HLA- C, HLA-DP, HLA-DQ and HLA-DR.

16. The method of claim 13, wherein the reduced immunogenicity and / or improved immunosuppression is determined by an immunogenicity assay.

17. The method of claim 13, wherein the population of genetically modified cells are differentiated from embryonic stem cells or iPS cells in vitro.

18. The method of claim 13, wherein the population of genetically modified cells are T cells or NK cells.

19. The method of claim 13, wherein the population of genetically modified cells are CAR-Attorney Docket No: 044903-8033W001T cells or CAR-NK cells.

20. The method of claim 13, wherein the population of genetically modified cells are not rejected by the subject’s immune system for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 24, 36, 48 or 52 weeks.

Images