Corynebacterium glutamicum variant having improved l-lysine production ability, and method for producing l-lysine by using same
Patent Information
- Application Number
- ZA202310403
- Authority / Receiving Office
- ZA · ZA
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-05-25
- Filing Date
- 2023-11-08
- Publication Date
- 2026-08-26
- Estimated Expiration
- 2041-05-26
AI Technical Summary
Current methods for enhancing L-lysine production in Corynebacterium glutamicum strains face challenges due to the complexity of proteins and enzymes involved in the biosynthetic pathway, requiring further research to determine effective increases in production capacity.
A Corynebacterium glutamicum mutant strain is developed with enhanced pyruvate carboxylase activity by modifying the nucleotide sequence in the promoter region of the pyc gene, specifically in the -90 to -30 region, to increase the expression of pyruvate carboxylase, leading to improved L-lysine production.
The mutant strain achieves increased L-lysine production by up to 40% compared to the parent strain, producing 65 to 75 g/L, with specific promoter mutations enhancing enzyme activity and precursor supply in the biosynthetic pathway.
Abstract
Description
Corynebacterium glutamicum mutant strain with improved L-lysine production ability and method for producing L-lysine using the same
[0001] The present invention relates to a Corynebacterium glutamicum mutant strain having improved L-lysine production ability and a method for producing L-lysine using the same.
[0002] L-lysine is an essential amino acid that cannot be synthesized in humans or animals, so it must be supplied externally. It is generally produced through fermentation using microorganisms such as bacteria or yeast. L-lysine can be produced using wild-type strains obtained in nature or mutant strains that have been modified to have improved L-lysine production ability. Recently, in order to improve the production efficiency of L-lysine, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances. Various recombinant strains or mutant strains with excellent L-lysine production ability and methods for producing L-lysine using them are being developed.
[0003] According to Korean Patent Nos. 10-0838038 and 10-2139806, L-lysine production can be improved by altering the base sequence or amino acid sequence of a gene encoding a protein, including an enzyme involved in L-lysine production, to increase the expression of the gene, or by removing unnecessary genes. Furthermore, Korean Patent Publication No. 10-2020-0026881 discloses a method for increasing the expression of a gene encoding an enzyme involved in L-lysine production by altering the existing promoter of the gene with a promoter having strong activity.
[0004] Although various methods for increasing L-lysine production are being developed, there are dozens of types of proteins, including enzymes, transcription factors, and transport proteins, that are directly or indirectly related to L-lysine production, so much research is still needed on whether L-lysine production increases according to changes in the activity of these proteins.
[0005] [Prior Art Literature]
[0006] [Patent Document]
[0007] Korean Patent No. 10-0838038
[0008] Korean Patent No. 10-2139806
[0009] Korean Patent Publication No. 10-2020-0026881
[0010] The purpose of the present invention is to provide a Corynebacterium glutamicum mutant strain having improved L-lysine production ability.
[0011] In addition, the present invention aims to provide a method for producing L-lysine using the mutant strain.
[0012] The present inventors conducted research to develop a new mutant strain with improved L-lysine production ability using a Corynebacterium glutamicum strain, and as a result, they confirmed that when the base sequence at a specific position in the promoter of the pyc gene encoding pyruvate carboxylase, which is involved in the supply of oxaloacetate, a lysine precursor in the L-lysine biosynthetic pathway, was replaced, the production of pyruvate-derived byproducts decreased while the production of L-lysine increased, thereby completing the present invention.
[0013]
[0014] One aspect of the present invention provides a Corynebacterium glutamicum mutant having enhanced L-lysine production ability due to enhanced activity of pyruvate carboxylase.
[0015] “Pyruvate carboxylase” used in the present invention refers to an enzyme that catalyzes a reaction that induces carboxylation of pyruvate in the L-lysine biosynthetic pathway to produce oxaloacetate (OAA), a lysine precursor.
[0016] According to one specific example of the present invention, the pyruvate carboxylase may be derived from a strain of the genus Corynebacterium. Specifically, the above Corynebacterium genus strains include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, and Corynebacterium. Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale,It may be, but is not limited to, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi or Corynebacterium flavescens.
[0017] As used herein, “enhanced activity” means that the expression of a gene encoding a protein such as a desired enzyme, transcription factor, or transport protein is newly introduced or increased, thereby increasing the expression level compared to a wild-type strain or a strain prior to modification. This enhanced activity includes cases where the activity of the protein itself is increased compared to the activity of the protein originally possessed by the microorganism through nucleotide substitution, insertion, deletion, or a combination thereof encoding the gene, and cases where the overall level of enzyme activity within the cell is higher than that of a wild-type strain or a strain prior to modification due to increased expression or increased translation of the gene encoding the same, and combinations thereof.
[0018] According to one specific example of the present invention, the enhancement of the activity of the pyruvate carboxylase may be achieved by inducing a position-specific mutation in the promoter of a gene encoding pyruvate carboxylase.
[0019] According to one specific example of the present invention, the promoter of the gene encoding the pyruvate carboxylase may be represented by the base sequence of SEQ ID NO: 1.
[0020] The term “promoter” as used in the present invention refers to a specific region of DNA that controls the transcription of a gene, including a binding site for RNA polymerase that initiates mRNA transcription of the target gene, and is generally located upstream from the transcription start point. In prokaryotes, a promoter is defined as a region around the transcription start point where RNA polymerase binds, and is generally composed of two short base sequences located at a distance of -10 and -35 base pairs from the transcription start point. The promoter mutation in the present invention is improved to have higher activity than the wild-type promoter, and by inducing a mutation in the promoter region located upstream from the transcription start point, the expression of a gene located downstream can be increased.
[0021] According to one specific example of the present invention, the activity of the pyruvate carboxylase may be enhanced by substituting one or more bases in the region from -90 to -30 forward from the transcription start point in the promoter sequence of the gene encoding the pyruvate carboxylase.
[0022] More specifically, the promoter mutation in the present invention may be a sequential or non-sequential substitution of one or more bases in the -90 to -30 region, preferably one, two, three, four, five, six, seven, eight, nine, or ten bases in the -90 to -30 region, the -80 to -40 region, the -75 to -45 region, the -55 to -40 region, or the -75 to -60 region.
[0023] According to one embodiment of the present invention, in the promoter sequence of the pyc gene encoding pyruvate carboxylase of a Corynebacterium glutamicum strain, the base sequence in the region of -73 to -61 was replaced from ggggttacgatac to tgtggtatgatgg and the base sequence in the region of -51 to -38 was replaced from gtgactgctatcac to acagctgctactgt, thereby obtaining a Corynebacterium glutamicum mutant having a new promoter sequence of the pyc gene. This Corynebacterium glutamicum mutant may include a mutated promoter of the pyc gene represented by the base sequence of SEQ ID NO: 2.
[0024] In addition, according to one embodiment of the present invention, in the promoter sequence of the pyc gene encoding pyruvate carboxylase of a Corynebacterium glutamicum strain, the base sequence in the region of -73 to -61 was replaced from ggggttacgatac to tgttgtatgattg and the base sequence in the region of -51 to -38 was replaced from gtgactgctatcac to actgctgctactac, thereby obtaining a Corynebacterium glutamicum mutant having a new promoter sequence of the pyc gene. This Corynebacterium glutamicum mutant may include a mutated promoter of the pyc gene represented by the base sequence of SEQ ID NO: 3.
[0025] As used herein, “improved productivity” means increased productivity of L-lysine compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a strain that is directly the target of mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild type Corynebacterium glutamicum strain or a strain mutated from the wild type.
[0026] According to one specific example of the present invention, the parent strain may be a Corynebacterium glutamicum strain (hereinafter referred to as “Corynebacterium glutamicum DS1 strain”) deposited with the Korean Culture Center of Microorganisms on April 2, 2021 under the accession number KCCM12969P, as a mutant strain in which a mutation is induced in the sequence of a gene involved in lysine production (e.g., lysC, zwf, and hom genes).
[0027] The Corynebacterium glutamicum mutant strain of the present invention having improved L-lysine production ability may include a mutated promoter sequence of a gene encoding pyruvate carboxylase.
[0028] According to one specific example of the present invention, the mutant strain may include any one of the base sequences represented by SEQ ID NO: 2 or 3 as a promoter sequence of the pyruvate carboxylase gene.
[0029] According to one embodiment of the present invention, the mutant strain exhibits increased L-lysine production ability compared to the parent strain by including a promoter mutation of the pyc gene encoding pyruvate carboxylase, and in particular, compared to the parent strain, the L-lysine production is increased by 3% or more, specifically 3 to 40%, and more specifically 4 to 30%, so that 65 to 75 g of L-lysine can be produced per liter of the strain culture, and preferably 65 to 70 g of L-lysine can be produced.
[0030]
[0031] A Corynebacterium glutamicum mutant strain according to one specific example of the present invention can be implemented through a recombinant vector including a mutant strain in which the promoter sequence of a gene encoding pyruvate carboxylase is partially substituted in the parent strain.
[0032] “Some” as used in the present invention means not all of the base sequence or polynucleotide sequence, and may be 1 to 300, preferably 1 to 100, more preferably 1 to 50, but is not limited thereto.
[0033] The “variant” used in the present invention refers to a promoter variant in which one or more bases are substituted in the -90 to -30 region of the promoter sequence of the pyruvate carboxylase gene involved in the biosynthesis of L-lysine.
[0034] According to one specific example of the present invention, a mutant in which the base sequence in the -73 to -61 region of the promoter sequence of the pyruvate carboxylase gene is substituted with tgtggtatgatgg and the base sequence in the -51 to -38 region is substituted with acagctgctactgt may have the base sequence of SEQ ID NO: 2, and a mutant in which the base sequence in the -73 to -61 region is substituted with tgttgtatgattg and the base sequence in the -51 to -38 region is substituted with actgctgctactac may have the base sequence of SEQ ID NO: 3.
[0035] The term “vector” as used herein refers to a gene construct that is an expression vector capable of expressing a target protein in a suitable host cell and includes essential regulatory elements operably linked to enable expression of a gene insert. Here, “operably linked” means that a gene requiring expression and its regulatory sequence are functionally linked to each other to enable gene expression, and the “regulatory element” includes a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. Such vectors include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like.
[0036] The "recombinant vector" used in the present invention, after being transformed into a suitable host cell, can replicate independently of the host cell's genome or can be incorporated into the genome itself. In this case, the "suitable host cell" may include an origin of replication, a specific base sequence from which replication begins, as long as the vector is replicable.
[0037] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the desired gene can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof. The transformed gene can be included without limitation, whether it is integrated into the host cell's chromosome or located outside the chromosome, as long as it can be expressed within the host cell.
[0038] The above host cell includes a cell transfected, transformed, or infected with the recombinant vector or polynucleotide of the present invention in vivo or in vitro. A host cell comprising the recombinant vector of the present invention is a recombinant host cell, recombinant cell, or recombinant microorganism.
[0039] In addition, the recombinant vector according to the present invention may include a selection marker, which is used to select a transformant (host cell) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, kanamycin, streptomycin, chloramphenicol, etc.
[0040] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.
[0041] According to one specific example of the present invention, the host cell may be a strain of the genus Corynebacterium, for example, a strain of Corynebacterium glutamicum.
[0042]
[0043] In addition, another aspect of the present invention provides a method for producing L-lysine, comprising the steps of: a) culturing the Corynebacterium glutamicum mutant in a medium; and b) recovering L-lysine from the mutant or the medium in which the mutant is cultured.
[0044] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.
[0045] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for strains of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.
[0046] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.
[0047] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, an antifoaming agent such as fatty acid polyglycol ester may be used during cultivation to suppress bubble formation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20°C to 45°C, for example, 25°C to 40°C. The cultivation period may continue until a desired yield of useful substances is obtained, for example, 10 to 160 hours.
[0048] According to one specific example of the present invention, the step of recovering L-lysine from the cultured mutant strain and the medium in which the mutant strain is cultured may collect or recover the L-lysine produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.
[0049] According to one specific example of the present invention, the step of recovering lysine can include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.
[0050] According to one specific example of the present invention, the step of recovering L-lysine may include a process of purifying L-lysine.
[0051] The Corynebacterium glutamicum mutant according to the present invention can improve the production yield of L-lysine compared to the parent strain by increasing or strengthening the expression of a gene encoding pyruvate carboxylase.
[0052] FIG. 1 shows the structure of a pCGI (Pm1-pyc') vector including a promoter in which the base sequence in the -73 to -61 region of the promoter sequence of the pyruvate carboxylase gene is replaced with tgtggtatgatgg and the base sequence in the -51 to -38 region is replaced with acagctgctactgt according to one embodiment of the present invention.
[0053] Figure 2 shows the structure of a pCGI (Pm2-pyc') vector containing a promoter in which the base sequence in the -73 to -61 region of the promoter sequence of the pyruvate carboxylase gene is replaced with tgttgtatgattg and the base sequence in the -51 to -38 region is replaced with actgctgctactac.
[0054] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.
[0055]
[0056] Example 1. Production of Corynebacterium glutamicum mutant strains
[0057] To produce a Corynebacterium glutamicum mutant with enhanced pyruvate carboxylase activity, random mutagenesis was induced using the Corynebacterium glutamicum DS1 strain.
[0058]
[0059] 1-1. Mutation induction
[0060] Corynebacterium glutamicum DS1 strain was inoculated into a flask containing 50 ml of seed culture CM liquid medium (containing 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone, and 5.0 g of beef extract in 1 L of distilled water, pH 6.8), and N-methyl-N`-nitro-N-nitrosoguanidine (NTG), a mutagen, was added at a final concentration of 300 μg / ml, followed by shaking culture at 200 rpm at 30°C for 20 hours. After culturing, the culture medium was centrifuged at 12,000 rpm for 10 minutes to remove the supernatant, washed once with saline, and washed three more times with phosphate buffer. This was suspended in 5 ml of phosphate buffer, spread on a seed culture solid medium (agar 15 g / l added to the seed culture liquid medium), and cultured at 30°C for 30 hours to isolate 100 colonies.
[0061]
[0062] 1-2. Selection of mutant strains with enhanced L-lysine production and creation of mutant libraries.
[0063] The 100 colonies separated above were inoculated at 5% concentration into each flask containing 10 ml of the lysine production liquid medium in Table 1 below and cultured with shaking at 200 rpm at 30°C for 30 hours. The absorbance of each culture was measured at OD 610 nm, and the L-lysine production was compared. Ten colonies producing more than 75.0 g / ℓ of L-lysine were selected, and base sequence analysis was performed to confirm the promoter mutation location of the pyc gene.
[0064] Composition (per 1 L) Glucose 100 g Ammonium sulfate 55 g KH2PO4 1.1 g MgSO4ㆍH2O 1.2 g MnSO4ㆍH2O 180 mg FeSO4ㆍH2O 180 mg ThiamineㆍHCl 9 mg Biotin 1.8 mg CaCO 3 5% pH 7.0
[0065]
[0066] Example 2. Improvement of the pyc promoter
[0067] 2-1. Promoter Improvement: Introduction of Mutations
[0068] Thirty candidate sequences having variations of up to 15 base pairs including the mutation sites on the pyc promoter selected in Example 1 were synthesized by the method of [Sambrook, J. et al. (2001) "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press. volume 2. 13.36-13.39], and the pyc promoter sequence of Corynebacterium glutamicum ATCC13032 (see SEQ ID NO: 1) and the synthesized pyc promoter region were each cloned into the CAT (chloramphenicol acetyltransferase) reporter vector pSK1-CAT vector. The orientation and occurrence of mutations during DNA cloning were confirmed by DNA sequencing. The mutant libraries thus constructed were designated pSK1-pyc1 to pSK1-pyc30. Finally, the promoter activity was compared and examined by transforming Corynebacterium glutamicum ATCC13032.
[0069]
[0070] 2-2. Transfection of the pSK1-CAT construct into Corynebacterium glutamicum ATCC13032
[0071] To transform each of the above-mentioned pSK1-pyc1 to pSK1-pyc30 constructed through sequence analysis into Corynebacterium glutamicum ATCC13032, soluble cells were prepared. 10 ml of cultured Corynebacterium glutamicum ATCC13032 was inoculated into 100 ml of BHIS medium and cultured overnight at 30°C. Then, the cells were inoculated into 100 ml of CM liquid medium to an OD 600 of 0.3 and cultured at 18°C and 120 rpm for about 28 hours until the OD 600 became 0.8. The culture solution was centrifuged at 6000 rpm at 4°C for 10 minutes to recover the cells, suspended in 20 ml of 10% glycerol solution, and centrifuged. This process was repeated three times. The harvested cells were resuspended in 10% glycerol solution and 100 μl each was dispensed into E-tubes and stored in a -70°C deep freezer until use. 1 μg of DNA was added to 100 μl of Corynebacterium glutamicum ATCC13032 soluble cells, placed in a cooled electroporation cuvette, and electroporation was performed using a MicroPulser from Bio-Rad. Immediately after pulsing, 1 ml of CM liquid medium pre-warmed at 46°C was added to harvest the cells, and the cells were incubated on ice for 2 minutes and then cultured in an incubator at 30°C at 180 rpm. 100 μl was then spread on a BHIS agar plate supplemented with kanamycin (50 μg / ml) and cultured in an incubator at 30°C.
[0072]
[0073] 2-3. CAT Analysis
[0074] CAT analysis (chloramphenicol acetyltransferase assay) of the pyc promoter region mutant was performed using the Shaw method (Shaw et al., 1991. Biochemistry. 30(44):10806). Briefly, the transformed Corynebacterium glutamicum strain was cultured in CM liquid medium supplemented with kanamycin (50 μg / ml), and the cells were harvested to obtain protein lysates. 5 μg of each protein was added to 0.1 M Tris-HCl buffer (pH 7.8), 0.4 mg / ml 5,5'-dithiobis-2-nitrobenzoic acid (DTNB; Sigma D8130), 0.1 mM Acetyl CoA (Sigma A2056), and 0.1 mM chloramphenicol, and the reaction was incubated at RT for 15 min, and the absorbance was measured at OD 412 nm. Through this, two strains, pSK-pyc3 and psk-pyc23, which showed the greatest improvement in CAT activity compared to the wild-type pyc promoter sequence of Corynebacterium glutamicum, were selected.
[0075] In pSK-pyc3, the base sequence in the -73 to -61 region of the promoter sequence, which is the region upstream of the start codon of the pyruvate carboxylase gene, was replaced with tgtggtatgatgg, and the base sequence in the -51 to -38 region was replaced with acagctgctactgt. In pSK-pyc23, the base sequence in the -73 to -61 region was replaced with tgttgtatgattg, and the base sequence in the -51 to -38 region was replaced with actgctgctactac. Afterwards, an experiment was performed to verify the increase in L-lysine productivity due to the promoter mutation of the pyc gene using the Corynebacterium glutamicum DS1 strain.
[0076]
[0077] Example 3. Production of Corynebacterium glutamicum mutant strains
[0078] To produce a Corynebacterium glutamicum mutant with enhanced pyruvate carboxylase activity, Corynebacterium glutamicum DS1 strain and E. coli DH5a (HIT Competent cells™, Cat No. RH618) were used.
[0079] The above Corynebacterium glutamicum DS1 strain was cultured at 30°C in CM-broth medium (pH 6.8) containing 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone, and 5.0 g of beef extract in 1 L of distilled water.
[0080] E. coliDH5a was cultured at 37°C on LB medium containing 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water.
[0081] Kanamycin and streptomycine were products of Sigma, and DNA sequencing analysis was performed by Macrogen.
[0082]
[0083] 3-1. Production of recombinant vectors
[0084] To increase lysine productivity by enhancing the supply of oxaloacetate, a lysine precursor, to the strain, enhancement of pyruvate carboxylase was introduced. The method used in this example induced specific mutations in the promoter of the pyc gene, which encodes pyruvate carboxylase, to increase expression of the gene. In order to substitute the base sequence from positions -73 to -61 of the pyc gene promoter from ggggttacgatac to tgtggtatgatgg and from positions -51 to -38 from gtgactgctatcac to acagctgctactgt, primers containing the mutant sequences were prepared, and a 735 bp portion on the left arm and a 730 bp portion on the right arm were amplified by PCR from both mutant regions of the pyc gene promoter on the genome of the Corynebacterium glutamicum DS1 mutant selected in Example 1, and then linked by overlap PCR and cloned into the recombinant vector pCGI (see literature [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130]). The prepared recombinant plasmid was named pCGI(Pm1-pyc') (see Fig. 1). To produce the above plasmid, the pyc promoter variant 1 amplification primer and pCGI vector amplification primer in Table 2 below were used to amplify each DNA fragment.
[0085] Primer (5' - 3') Sequence number pyc promoter variant 1 amplification primer pycP-F1 CATGTATCACGCACTCGGTGAAGGCGTGAGCCC4 pycP-R1 GACCGCCAAGGACAGTAGCAGCTGTTGCGTCCTACCATCATACCACACGATTCCC5 pycP-F2 GGGAATCCGTGTGGTATGATGGTAGGACGCAACAGCTGCTACTGTCCTTGGCGGTC6 pycP-R2 AACTTCTCCAGTGTGATCGCCAAGGATCTGCAC7 pycP-F3 TGATTACGCCATGTATCACGCACTCGGTG8 pycP-R3 GTGTGATCGCCAAGGATCTGCACTTC9 pCGI vector Amplification primerpCGI-F1ACTGGCCGTCGTTTTACAAC10pCGI-R1GGCGTAATCATGGTCATAGC11pCGI(pyc)-F2TGGAGAAGTTACTGGCCGTCGTTTTACAAC12pCGI-R2TGGTCATAGCTGTTTCCTGTG13
[0086]
[0087] The detailed description is as follows. PCR was performed using the corresponding primers from the genomic DNA of Corynebacterium glutamicum DS1 strain under the conditions below.
[0088] Using a thermocycler (TP600, TAKARA BIO Inc., Japan), 1 pM of oligonucleotides and 10 ng of the chromosomal DNA of the Corynebacterium glutamicum DS1 mutant identified in Example 1 or the pCGI vector were used as templates in a reaction solution containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), and 25 to 30 cycles were performed in the presence of 1 unit of pfu-X DNA polymerase mixture (Solgent). PCR was performed under the following conditions: (i) denaturation step: 94°C for 30 seconds, (ii) annealing step: 58°C for 30 seconds, and (iii) extension step: 72°C for 1 to 2 minutes (giving a polymerization time of 2 minutes per 1 kb).
[0089] The gene fragment thus produced was cloned into the pCGI vector using self-assembly cloning. The vector was transformed into E. coliDH5a, plated on LB agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The resulting colonies were isolated to confirm that the insert was precisely present in the vector. The vector was then isolated and used for recombination in the Corynebacterium glutamicum DS1 strain.
[0090] For genetic manipulation, Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR amplification enzymes, and various restriction enzymes and DNA modifying enzymes were used from NEB products, and were used according to the supplied buffers and protocols.
[0091]
[0092] 3-2. Manufacturing of mutants
[0093] The DS5 strain was constructed using the above pCGI (Pm1-pyc') vector. The vector was prepared at a final concentration of 1 μg / μl or higher, and the first recombination was induced in the Corynebacterium glutamicum DS1 strain using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). At this time, the electroporated strain was spread on a CM-agar plate containing 20 μg / μl of kanamycin, and a colony was isolated. Then, whether it was properly inserted into the induced site in the genome was confirmed through PCR and base sequence analysis. To induce the second recombination, the isolated strain was inoculated into a CM-agar liquid medium containing streptomycin, cultured for more than one night, and spread on an agar medium containing the same concentration of streptomycin to isolate a colony. After confirming the resistance to kanamycin among the finally isolated colonies, the presence of mutations in the promoter of the pyc gene was confirmed through base sequence analysis among the strains without antibiotic resistance (see literature [Schafer et al., Gene 145 (1994) 69-73]). Finally, a Corynebacterium glutamicum mutant strain DS5 with a mutation in the promoter of the pyc gene was obtained.
[0094]
[0095] Example 4. Production of Corynebacterium glutamicum mutant strains
[0096] A Corynebacterium glutamicum mutant was prepared in the same manner as in Example 3, except that the base sequence at positions -73 to -61 of the pyc gene promoter was replaced from ggggttacgatac to tgttgtatgattg, and the base sequence at positions -51 to -38 was replaced from gtgactgctatcac to actgctgctactac.
[0097] Here, to construct a plasmid, the pyc promoter mutant 2 amplification primer and the pCGI vector amplification primer in Table 3 below were used to amplify each DNA fragment, and the constructed plasmid pCGI (Pm2-pyc') vector (see Fig. 2) was used. Finally, a Corynebacterium glutamicum mutant strain DS5-1 with a mutant pyc gene introduced was obtained.
[0098] Primer (5' - 3') Sequence number pyc promoter variant 2 amplification primer pycP-F1CATGTATCACGCACTCGGTGAAGGCGTGAGCCC4pycP-R4GACCGCCAAGGGTAGTAGCAGCAGTTGCGTCCTACAATCATACAACACGATTCCC14pycP-F4GGGAATCGTGTTGTATGATTGTAGGACGCAACTGCTGCTACTACCCTTGGCGGTC15pycP-R2AACTTCTCCAGTGTGATCGCCAAGGATCTGCAC7pycP-F3TGATTACGCCCATGTATCACGCACTCGGTG8pycP-R3GTGTGATCGCCAAGGATCTGCACTTC9pCGI vector Amplification primerpCGI-F1ACTGGCCGTCGTTTTACAAC10pCGI-R1GGCGTAATCATGGTCATAGC11pCGI(pyc)-F2TGGAGAAGTTACTGGCCGTCGTTTTACAAC12pCGI-R2TGGTCATAGCTGTTTCCTGTG13
[0099]
[0100] Experimental Example 1. Comparison of L-lysine Productivity of Mutants
[0101] The L-lysine productivity of the parent strain Corynebacterium glutamicum DS1 and the lysine-producing mutant strains DS5 and DS5-1 prepared in Examples 3 and 4 was compared.
[0102] Each strain was inoculated into a 100 ml flask containing 10 ml of lysine medium having the composition shown in Table 1 above, and cultured with shaking at 30°C for 28 hours at 180 rpm. After completion of culture, lysine analysis was performed to measure the amount of L-lysine produced using HPLC (Shimazu, Japan), and the results are shown in Table 4.
[0103] Strain name pyc gene promoter mutation location and sequence L-lysine (g / L) L-lysine production per cell (g / gDCW) -73 ~ -61 -51 ~ -38 Parent strain (DS1) ggggttacgatacgtgactgctatcac 64.26.88 Mutant strain (DS5) tgtggtatgatggacagctgctactgt 69.58.43 Mutant strain (DS5-1) tgttgtatgattgactgctgctactac 67.27.51
[0104]
[0105] As shown in Table 4 above, the Corynebacterium glutamicum mutant strains DS5 and DS5-1 were confirmed to have increased L-lysine productivity by approximately 8.3% and 4.7%, respectively, compared to the parent strain Corynebacterium glutamicum DS1, by substituting specific positions (-73 to -61 region and -51 to -38 region) of the promoter sequence of the pyc gene with optimal base sequences to enhance the supply of oxaloacetate, a lysine precursor. These results indicate that enhanced expression of the pyc gene enhances the L-lysine production ability of the strains by enhancing the supply of lysine precursors.
[0106]
[0107] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.
Claims
1. A mutant strain of Corynebacterium glutamicum with enhanced pyruvate carboxylase activity and improved L-lysine production.
2. In claim 1, A Corynebacterium glutamicum mutant strain in which the activity of the above pyruvate carboxylase is enhanced by inducing a position-specific mutation in the promoter of a gene encoding pyruvate carboxylase.
3. In claim 2, A Corynebacterium glutamicum mutant having a gene encoding the above pyruvate carboxylase represented by the base sequence of sequence number 1.
4. In claim 1, The above mutant strain is a Corynebacterium glutamicum mutant strain comprising any one of the base sequences represented by sequence number 2 or 3. 5.a) A step of culturing the mutant strain of claim 1 in a medium; and b) A method for producing L-lysine, comprising a step of recovering L-lysine from the mutant strain or the medium in which the mutant strain is cultured.