Mutated hydroxyphenylpyruvate dioxygenase polypeptide, and coding gene and use thereof
Patent Information
- Application Number
- ZA202402731
- Authority / Receiving Office
- ZA · ZA
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-04-09
- Publication Date
- 2026-09-30
- Estimated Expiration
- 2041-12-15
AI Technical Summary
Currently, there is no known technology that suggests combining mutations at positions 372 and 383 of HPPD peptides from different species can confer synergistic tolerance to HPPD inhibitor herbicides, especially to pyrazolone, isoxazole, and triketone herbicides.
A mutant hydroxyphenylpyruvate dioxygenase polypeptide is provided, wherein amino acid mutations are made at positions 372 and 383 corresponding to the amino acid sequence of SEQ ID NO:1, specifically, position F372 is replaced by A or V and position F383 is replaced by W. It can also combine with other site mutations, such as A106G, A107 deletion, A111T or K351N, to retain catalytic activity and reduce sensitivity to HPPD inhibitor herbicides.
It achieved synergistic tolerance of plants to HPPD inhibitor herbicides such as pyrazolone, isoxazole and triketone, especially to soybean plants to bensulfuron-methyl, isoxazole and mesotrione, thereby improving plant tolerance to herbicides and yield.
Abstract
Description
Mutated hydroxyphenylpyruvate dioxygenase polypeptide, its encoding gene and use Technical Field
[0001] The present invention relates to a mutant hydroxyphenylpyruvate dioxygenase polypeptide, a coding gene and uses thereof, and in particular to a mutant hydroxyphenylpyruvate dioxygenase polypeptide tolerant to HPPD inhibitor herbicides, a coding gene and uses thereof. Background Art
[0002] Hydroxyphenylpyruvate dioxygenase (HPPD) is an enzyme that 2+ In the presence of oxygen and hydroxyphenylpyruvic acid (HPP), a degradation product of tyrosine, it catalyzes the conversion of homogentisate / homogenisate (HG), precursors of tocopherols and plastoquinone (PQ) in plants. Tocopherols act as membrane-associated antioxidants; PQ is not only an electron carrier between PS II and the cytochrome b6 / f complex but also an essential cofactor for phytoene desaturase in carotenoid biosynthesis.
[0003] Herbicides that work by inhibiting HPPD primarily fall into three chemical families: triketides, isoxazoles, and pyrazolones. In plants, these herbicides block the biosynthesis of tyrosine (PQ) by inhibiting HPPD, leading to PQ depletion and carotenoid deficiency. These HPPD-inhibiting herbicides act as phloem-mobile bleaching agents, causing new meristems and leaves exposed to light to appear white. Carotenoids are essential for photoprotection. In their absence, ultraviolet radiation and reactive oxygen intermediates disrupt chlorophyll synthesis and function, inhibiting plant growth and even causing plant death.
[0004] Methods for providing plants tolerant to HPPD inhibitor herbicides generally include: 1) overexpressing an HPPD to produce a large amount of HPPD in the plant that is sufficiently reactive with the HPPD inhibitor herbicide despite the presence of the HPPD inhibitor herbicide, thereby providing sufficient functional enzyme for use. 2) mutating the target HPPD into a functional HPPD that is less sensitive to the herbicide or its active metabolite but retains the property of converting to HG. Several mutant HPPD polypeptides have been reported in the prior art, which have amino acid mutations at one or more positions relative to the original wild-type sequence from which they were derived and exhibit enhanced tolerance to one or more HPPD inhibitor herbicides. The prior art further reports that mutant HPPD polypeptides obtained by combining two amino acid mutations exhibit greater tolerance to HPPD inhibitor herbicides than HPPD polypeptides having only one of the two amino acid mutations. However, there has been no report to date that combined mutations of HPPD polypeptides from different species at positions 372 and 383 corresponding to the wild-type HPPD polypeptide of oats can confer synergistic tolerance to HPPD inhibitor herbicides on plants.
[0005] Summary of the Invention
[0006] The present invention aims to provide a novel mutant hydroxyphenylpyruvate dioxygenase polypeptide, a gene encoding the same, and uses thereof. The mutant hydroxyphenylpyruvate dioxygenase polypeptide not only has HPPD enzyme activity, but also enables plants into which the mutant hydroxyphenylpyruvate dioxygenase polypeptide encoding gene is introduced to exhibit synergistic tolerance to HPPD inhibitor herbicides.
[0007] To achieve the above objectives, the present invention provides a mutant hydroxyphenylpyruvate dioxygenase polypeptide, which retains the activity of catalyzing the conversion of para-hydroxyphenylpyruvate to homogentisate or homogentisate and is less sensitive to HPPD inhibitor herbicides than wild-type HPPD, and comprises amino acid mutations at the following sites in the amino acid sequence corresponding to SEQ ID NO: 1: substitution of A, G or V at position F372 and substitution of W at position F383;
[0008] Preferably, the mutant hydroxyphenylpyruvate dioxygenase polypeptide comprises amino acid mutations at the following sites in the amino acid sequence corresponding to SEQ ID NO: 1: substitution of A at position F372 and substitution of W at position F383.
[0009] Based on the above technical solution, the mutant hydroxyphenylpyruvate dioxygenase polypeptide comprises a second mutation;
[0010] Preferably, the second mutation comprises an amino acid mutation at at least one of the following sites corresponding to the amino acid shown in SEQ ID NO: 1: A106G, A107 deletion, A111T or K351N.
[0011] Specifically, the mutant hydroxyphenylpyruvate dioxygenase polypeptide includes: a polypeptide having an amino acid sequence shown in SEQ ID NO: 173, SEQ ID NO: 182, SEQ ID NO: 185, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 194, SEQ ID NO: 197, SEQ ID NO: 200 or SEQ ID NO: 203.
[0012] Furthermore, the mutant hydroxyphenylpyruvate dioxygenase polypeptide is derived from a plant wild-type HPPD or a microbial wild-type HPPD;
[0013] Preferably, the plant includes monocots and dicots; more preferably, the plant is oat, wheat, barley, millet, corn, sorghum, Brachypodium distichum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato or Arabidopsis;
[0014] Preferably, the microorganism is Pseudomonas fluorescens.
[0015] To achieve the above object, the present invention also provides a polynucleotide encoding the mutated hydroxyphenylpyruvate dioxygenase polypeptide.
[0016] To achieve the above object, the present invention also provides an expression cassette or a recombinant vector comprising the polynucleotide under the control of an operably linked regulatory sequence.
[0017] To achieve the above objectives, the present invention also provides a method for expanding the range of herbicides tolerated by plants, comprising: expressing the mutant hydroxyphenylpyruvate dioxygenase polypeptide together with at least one herbicide-tolerant protein different from the mutant hydroxyphenylpyruvate dioxygenase polypeptide.
[0018] Furthermore, the herbicide-tolerant protein is 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, α-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, acetolactate synthase, cytochrome protein and / or protoporphyrinogen oxidase.
[0019] To achieve the above object, the present invention also provides a method for selecting transformed plant cells, comprising: transforming a plurality of plant cells with the polynucleotide, and culturing the cells under a concentration of an HPPD inhibitor herbicide that allows the growth of transformed cells expressing the polynucleotide and kills or inhibits the growth of untransformed cells;
[0020] Preferably, the plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oat, wheat, barley, millet, sorghum, Brachypodium distichum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato or Arabidopsis thaliana;
[0021] Preferably, the HPPD inhibitor herbicide includes a pyrazoline HPPD inhibitor herbicide, a triketone HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; more preferably, the pyrazoline HPPD inhibitor herbicide is pyrazoline, the isoxazole HPPD inhibitor herbicide is isoxaflutole, and the triketone HPPD inhibitor herbicide is mesotrione; specifically preferably, the method for selecting transformed soybean plant cells comprises: transforming a plurality of soybean plant cells with the polynucleotide, and culturing the cells under a concentration of the HPPD inhibitor herbicide that allows the growth of transformed cells expressing the polynucleotide and kills untransformed cells or inhibits the growth of untransformed cells, wherein the HPPD inhibitor herbicide is pyrazoline, mesotrione or isoxaflutole.
[0022] To achieve the above object, the present invention also provides a method for controlling weeds, comprising: applying an effective dose of an HPPD inhibitor herbicide to a field where target plants are grown, wherein the target plants contain the polynucleotide;
[0023] Preferably, the target plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the target plant is oat, wheat, barley, millet, sorghum, Brachypodium distichum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato or Arabidopsis thaliana; further preferably, the target plant is a glyphosate-tolerant plant, and the weed is a glyphosate-resistant weed;
[0024] Preferably, the HPPD inhibitor herbicide includes a pyrazoline HPPD inhibitor herbicide, a triketone HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; more preferably, the pyrazoline HPPD inhibitor herbicide is pyrazoline, the isoxazole HPPD inhibitor herbicide is isoxaflutole, and the triketone HPPD inhibitor herbicide is mesotrione; specifically preferably, the method for controlling weeds comprises: applying an effective dose of an HPPD inhibitor herbicide to a field planted with soybean plants, wherein the soybean plants contain the polynucleotide, and the HPPD inhibitor herbicide is pyrazoline, mesotrione or isoxaflutole.
[0025] To achieve the above objectives, the present invention also provides a method for protecting plants from damage caused by HPPD inhibitor herbicides or conferring tolerance to HPPD inhibitor herbicides on plants, comprising: introducing the polynucleotide, the expression cassette, or the recombinant vector into a plant, so that the introduced plant produces the mutant hydroxyphenylpyruvate dioxygenase polypeptide in an amount sufficient to protect the plant from damage by the HPPD inhibitor herbicide;
[0026] Preferably, the plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oat, wheat, barley, millet, sorghum, Brachypodium distichum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato or Arabidopsis thaliana;
[0027] Preferably, the HPPD inhibitor herbicide includes a pyrazoline HPPD inhibitor herbicide, a triketide HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; more preferably, the pyrazoline HPPD inhibitor herbicide is pyrazoline, the isoxazole HPPD inhibitor herbicide is isoxaflutole, and the triketide HPPD inhibitor herbicide is mesotrione; specifically preferably, the method for protecting soybean plants from damage caused by HPPD inhibitor herbicides or conferring tolerance to HPPD inhibitor herbicides on soybean plants comprises: introducing the polynucleotide or the expression cassette or the recombinant vector into a soybean plant, so that the introduced soybean plant produces the mutant hydroxyphenylpyruvate dioxygenase polypeptide in an amount sufficient to protect it from damage by the HPPD inhibitor herbicide, and the HPPD inhibitor herbicide is pyrazoline, mesotrione or isoxaflutole.
[0028] To achieve the above object, the present invention also provides a method for producing a plant tolerant to an HPPD inhibitor herbicide, comprising introducing the polynucleotide into the genome of the plant;
[0029] Preferably, the introduction method includes a genetic transformation method, a genome editing method or a gene mutation method;
[0030] Preferably, the plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oat, wheat, barley, millet, sorghum, Brachypodium distichum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato or Arabidopsis thaliana;
[0031] Preferably, the HPPD inhibitor herbicide includes a pyrazoline HPPD inhibitor herbicide, a triketone HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; more preferably, the pyrazoline HPPD inhibitor herbicide is benzopyrazone, the isoxazole HPPD inhibitor herbicide is isoxaflutole, and the triketone HPPD inhibitor herbicide is mesotrione; specifically preferably, the method for producing a soybean plant tolerant to HPPD inhibitor herbicides comprises: introducing the polynucleotide into the genome of the soybean plant, wherein the HPPD inhibitor herbicide is benzopyrazone, mesotrione or isoxaflutole.
[0032] To achieve the above object, the present invention also provides a method for cultivating plants tolerant to HPPD inhibitor herbicides, comprising:
[0033] planting at least one plant propagule comprising the polynucleotide in its genome;
[0034] allowing the plant propagules to grow into plants;
[0035] applying an effective amount of an HPPD inhibitor herbicide to a plant growth environment comprising at least the plant, and harvesting the plant having reduced plant injury and / or increased plant yield compared to other plants not having the polynucleotide;
[0036] Preferably, the plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oat, wheat, barley, millet, sorghum, Brachypodium distichum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato or Arabidopsis thaliana;
[0037] Preferably, the HPPD inhibitor herbicide comprises a pyrazoline HPPD inhibitor herbicide, a triketone HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; more preferably, the pyrazoline HPPD inhibitor herbicide is tolopram, the isoxazole HPPD inhibitor herbicide is isoxaflutole, and the triketone HPPD inhibitor herbicide is mesotrione; specifically preferably, the method for cultivating a soybean plant tolerant to HPPD inhibitor herbicides comprises: planting at least one soybean plant seed, the genome of which comprises the polynucleotide; growing the soybean plant seed into a soybean plant; applying an effective dose of the HPPD inhibitor herbicide to a plant growth environment comprising at least the soybean plant, and harvesting the soybean plant having reduced plant damage and / or increased plant yield compared to other soybean plants not having the polynucleotide, wherein the HPPD inhibitor herbicide is tolopram, mesotrione or isoxaflutole.
[0038] The present invention also provides a method for obtaining processed agricultural products, comprising processing the harvest of the HPPD inhibitor herbicide-tolerant plants obtained by the method to obtain the processed agricultural products.
[0039] To achieve the above object, the present invention also provides a planting system for controlling weed growth, comprising an HPPD inhibitor herbicide and a plant growth environment in which at least one target plant exists, wherein the target plant comprises the polynucleotide;
[0040] Preferably, the target plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the target plant is oat, wheat, barley, millet, sorghum, Brachypodium distichum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato or Arabidopsis thaliana; further preferably, the target plant is a glyphosate-tolerant plant, and the weed is a glyphosate-resistant weed;
[0041] Preferably, the HPPD inhibitor herbicide includes a pyrazolone HPPD inhibitor herbicide, a triketone HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; more preferably, the pyrazolone HPPD inhibitor herbicide is pyrazoline, the isoxazole HPPD inhibitor herbicide is isoxazolidinone, and the triketone HPPD inhibitor herbicide is mesotrione; specifically preferably, the planting system for controlling weed growth includes an HPPD inhibitor herbicide and a plant growth environment in which at least one soybean plant exists, the soybean plant contains the polynucleotide, and the HPPD inhibitor herbicide is pyrazoline, isoxazolidinone or mesotrione.
[0042] To achieve the above objectives, the present invention also provides a use of the mutated hydroxyphenylpyruvate dioxygenase polypeptide in conferring tolerance to HPPD inhibitor herbicides on plants;
[0043] Preferably, the plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oat, wheat, barley, millet, sorghum, Brachypodium distichum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato or Arabidopsis thaliana;
[0044] Preferably, the HPPD inhibitor herbicide includes a pyrazoline HPPD inhibitor herbicide, a triketide HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; more preferably, the pyrazoline HPPD inhibitor herbicide is pyrazoline, the isoxazole HPPD inhibitor herbicide is isoxazolidinone, and the triketide HPPD inhibitor herbicide is mesotrione; specifically preferably, the use of the mutant hydroxyphenylpyruvate dioxygenase polypeptide in conferring tolerance to HPPD inhibitor herbicides on soybean plants is pyrazoline, isoxazolidinone or mesotrione.
[0045] As used herein, the articles "a" and "an" refer to one or more than one (i.e., at least one). For example, "an element" means one or more elements (components). In addition, the term "comprises" or variations thereof such as "comprising" or "including" should be understood to mean the inclusion of one stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[0046] In the present invention, the term "hydroxyphenylpyruvate dioxygenase (HPPD)" is synonymous with "4-hydroxyphenylpyruvate dioxygenase (4-HPPD)" and "p-hydroxyphenylpyruvate dioxygenase (p-HPPD)".
[0047] The term "HPPD inhibitor herbicide" refers to herbicides that inhibit HPPD directly or indirectly. These herbicides are bleaching agents. The most commercially available HPPD inhibitor herbicides belong to one of three chemical families: (1) triketones, for example, sulcotrione (i.e., 2-[2-chloro-4-(methylsulfonyl)benzoyl]-1,3-cyclohexanedione), mesotrione (i.e., 2-[4-(methylsulfonyl)-2-nitrobenzoyl]-1,3-cyclohexanedione), and tembotrione (i.e., 2-[2-chloro-4-(methylsulfonyl)-3-[(2,2,2-trifluoroethoxy)methyl]benzoyl]-1,3-cyclohexanedione); (2) isoxazoles, for example, , isoxaflutole (i.e. 5-cyclopropyl-4-isoxazolyl[2-(methylsulfonyl)-4-(trifluoromethyl)phenyl]methanone); (3) pyrazolinates, for example, topramezone (i.e. [3-(4,5-dihydro-3-isoxazolyl)-2-methyl-4-(methylsulfonyl)phenyl](5-hydroxy-1-methylpyrazol-4-yl)methanone), pyrasulfotole (5-hydroxy-1,3-dimethylpyrazol-4-yl(2-methylsulfonyl-4-trifluoromethylphenyl)methanone).
[0048] The topramezone described in this invention, also known as topramezone, refers to [3-(4,5-dihydro-3-isoxazolyl)-2-methyl-4-(methylsulfonyl)phenyl](5-hydroxy-1-methylpyrazol-4-yl)methanone, a white crystalline solid. It belongs to the pyrazolinate class of systemic HPPD inhibitor herbicides for post-emergence stem and foliar treatments, and is commonly formulated as a 30% suspension concentrate. Commercial topramezone formulations, such as Baowei, can control grass and broadleaf weeds. A dosage of 5.6-6.7g per acre effectively controls weeds including, but not limited to, crabgrass (Cockscomb), barnyard grass, goosegrass, wild millet, foxtail grass (Setaria officinalis), quinoa, polygonum, ramie, velvetleaf, wild amaranth, purslane, cocklebur, and nightshade. Baowei has a significant synergistic effect after adding atrazine. In addition to its excellent control effect on the above-mentioned weeds, it can also have a good control effect on malignant broad-leaved weeds such as prickly thistle, sonchus, amaranth, and dayflower (orchid weed). In particular, it can effectively control foxtail grass, crabgrass, goosegrass, and wild millet, which are not well controlled by mesotrione.
[0049] The effective dose of topyrazone in the present invention refers to 25-200 g ai / ha, including 25-50 g ai / ha, 50-100 g ai / ha, 100-150 g ai / ha or 150-200 g ai / ha.
[0050] The isoxaflutole described in this invention, also known as isoxaflutole, refers to 5-cyclopropyl-4-isoxazolyl[2-(methylsulfonyl)-4-(trifluoromethyl)phenyl]methanone, a white to grayish-yellow solid. It is a selective, systemic, pre-emergence HPPD inhibitor herbicide belonging to the organic heterocyclic isoxazole class, and its activity is primarily through absorption and conduction into weed rootlets. Isoxaflutole is primarily used in dryland crop fields to control a variety of annual broadleaf weeds, including velvetleaf, quinoa, Kochia scoparia, Salsola, Solanum nigrum, Amaranthus retroflexus, Polygonum aviculare, Bidens pilosa, Portulaca oleracea, Chickweed, Elsholtzia ciliata, Xanthium sibiricum, Amaranthus chinensis, Echinops sylvestris, Polygonum umbellatum, and Veronica officinalis. It also has good control effects on some annual grass weeds, including crabgrass, barnyard grass, goosegrass, Leptochloa chinensis, Setaria viridis, and Setaria officinalis.
[0051] The effective dose of isoxaflutole in the present invention refers to 35-280 g ai / ha, including 35-70 g ai / ha, 70-140 g ai / ha, 140-200 g ai / ha or 200-280 g ai / ha.
[0052] Mesotrione, as described in this invention, refers to 2-[4-(methylsulfonyl)-2-nitrobenzoyl]-1,3-cyclohexanedione, a brown or pale yellow solid. It is a triketone-based selective systemic HPPD inhibitor herbicide used pre- and post-emergence. It is absorbed by plant leaves and roots and transported downward from the top, causing yellowing of the plant's meristem after 3-5 days, followed by necrotic spots and ultimately the death of the entire plant. Mesotrione can be used to control annual broadleaf weeds and several grass weeds during pre- or post-emergence control. Among these, the main controllable annual broadleaf weeds include Xanthium sibiricum, Abutilon, Chenopodium album, Amaranth, Polygonum multiflorum, Solanum nigrum, and Ambrosia trifida. The main controllable grass weeds include young barnyardgrass, Crabgrass, Setaria viridis, and Brachiaria striata.
[0053] The effective dose of mesotrione in the present invention refers to 52.5-420 g ai / ha, including 52.5-105 g ai / ha, 105-210 g ai / ha, 210-300 g ai / ha or 300-420 g ai / ha.
[0054] As used herein, the term "resistance" is heritable and allows a plant to grow and reproduce despite treatment with a herbicide that is generally effective against a given plant. As will be appreciated by those skilled in the art, even if a given plant experiences some degree of damage from a herbicide treatment, such as minimal necrosis, dissolution, chlorosis, or other damage, but at least no significant effect on yield, the plant may still be considered "resistant," i.e., a given plant possesses an increased ability to resist various degrees of damage induced by a herbicide that would normally result in damage to wild-type plants of the same genotype at the same herbicide dose. As used herein, the terms "tolerance" or "tolerance" are broader than the term "resistance" and include "resistance."
[0055] The term "confer" as used herein refers to providing a characteristic or trait to a plant, such as herbicide tolerance and / or other desired traits.
[0056] As used herein, the term "heterologous" means derived from another source. In the context of DNA, "heterologous" refers to any foreign, "non-self" DNA, including DNA from another plant of the same species. For example, in the present invention, a soybean HPPD gene can be expressed in a soybean plant using transgenic methods, and the soybean HPPD gene is still considered "heterologous" DNA.
[0057] The term "nucleic acid" as used herein includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the essential properties of wild-type nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to wild-type occurring nucleotides.
[0058] As used herein, the term "encoding" or "encoded" when used in the context of a specific nucleic acid means that the nucleic acid contains the necessary information to direct the translation of the nucleotide sequence into a specific protein. The information used to encode the protein is specified using codons. A nucleic acid encoding a protein may contain non-translated sequences (e.g., introns) within the translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., in cDNA).
[0059] The proteins of the present invention can be altered in various ways using methods well known in the art, including amino acid substitutions, deletions, truncations, and insertions. For example, amino acid sequence variants and fragments of mutant HPPD proteins can be prepared by mutations in the DNA. Methods for inducing polynucleotide mutations are well known in the art and are described, for example, by Kunkel in Proc. Natl. Acad. Sci., Vol. 82, pp. 488-492 (1985), Kunkel et al. in Methods in Enzymol., Vol. 154, pp. 367-382 (1987), and Walker and Gaastra eds. in U.S. Pat. No. 4,873,192 (1987) and references cited therein. The protein sequence and structural map model published by Dayhoff et al. in Natl. Biomed. Res. Found. (1978) describes methods for appropriate amino acid substitutions that do not affect the biological activity of the protein of interest. Conservative substitutions (e.g., replacing one amino acid with another with similar properties) may be the best approach to not affect the biological activity of the target protein.
[0060] The mutant hydroxyphenylpyruvatedioxygenase polypeptides and variants and fragments thereof described herein have HPPD enzyme activity and confer tolerance to certain classes of HPPD inhibitor herbicides in plants. The mutant hydroxyphenylpyruvatedioxygenase polypeptides have amino acid changes at one or more positions relative to the original wild-type sequence from which they are derived and exhibit enhanced tolerance to one or more HPPD inhibitor herbicides. The enhanced tolerance to at least one HPPD inhibitor herbicide is exhibited relative to the original, unmutated enzyme.
[0061] DNA sequences encoding the mutated hydroxyphenylpyruvatedioxygenase polypeptides are used to provide plants, plant cells, and seeds of the invention that provide enhanced tolerance to one or more HPPD inhibitor herbicides compared to the same plants expressing the non-mutated original enzyme.
[0062] The plant HPPD gene encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide is useful for producing plants tolerant to HPPD inhibitor herbicides. The plant HPPD gene thus modified is particularly suitable for expression in plants to confer herbicide tolerance to the plants.
[0063] Many HPPD sequences are known in the art, and mutant HPPD sequences are generated by replacing, deleting, and / or adding corresponding amino acids. The 372 position and the 383 position described in the present invention are calculated based on the amino acid position 372 or the amino acid position 383 of the wild-type HPPD amino acid sequence of the genus Avena shown in SEQ ID NO: 1. The mutant hydroxyphenylpyruvate dioxygenase polypeptide described in the present invention has a combined mutation of the amino acids at positions 372 and 383 corresponding to SEQ ID NO: 1. The combined mutation includes substitution of A, G, or V at position F372 and substitution of W at position F383. The preferred mutation is substitution of A at position F372 and substitution of W at position F383. Therefore, a known or inferred HPPD sequence can be aligned with the amino acid sequence shown in SEQ ID NO: 1 using standard sequence alignment tools, and the corresponding amino acids described herein relative to the amino acid sequence shown in SEQ ID NO: 1 can be substituted or deleted in the known or inferred HPPD sequence.
[0064] The present invention includes a mutant HPPD polypeptide derived from a plant HPPD or a microbial HPPD, exhibiting HPPD enzyme activity and comprising at least one combined mutation at amino acid positions 372 and 383 corresponding to SEQ ID NO: 1, optionally further combined with mutations at other positions (where the HPPD polypeptide exists), for example, one or more of the following corresponding mutations: A106G, A107 deletion, A111T, or K351N in the oat HPPD amino acid sequence. In various embodiments, the combined mutations at positions 372 and 383 can be F372A+F383W, F372G+F383W, or F372V+F383W. The combined mutation forms of sites 372 and 383 combined with mutations at other sites include F372A+F383W+A107 deletion, F372A+F383W+A111T, F372A+F383W+A106G, F372A+F383W+A106G+K351N, F372A+F383W+A107 deletion+K351N or F372A+F383W+A111T+K351N.Furthermore, the present invention includes a mutant HPPD polypeptide, which is derived from (replacement, deletion and / or addition) a different species of plant or microorganism or a different ecotype HPPD of the same species. Exemplary, different ecotype HPPDs of the same species include but are not limited to the following species ecotype HPPDs: Accession Nos. XP_003617391.2, AAX59006.1, XP_003617384.1, XP_01 3466115.1, AET00342.2 or A0A396HWH5 of different ecotypes of alfalfa HPPD; accession number A0A0D2PWQ6, A0A2P5SI66, A0A0D2LWN1 or A0A0D2N7F6 of different ecotypes of cotton HPPD; accession number VDC64417.1, CDY10210.1, AFB74208.1, XP_013695640.1, XP_ Different ecotype rapeseed HPPDs with accession numbers A013695641.1, RID40406.1, RID48932.1, XP_009118533.1, XP_009119049.1, XP_013723237.1, AFB74218.1, or AFB74207.1; Different ecotype soybean HPPs with accession numbers A5Z1N7, I1M6Z4, A0A088MGH9, or I1M6Z5 D; HPPD of different ecotypes of tobacco with accession numbers XP_009770088.1 or XP_009587203.1; HPPD of different ecotypes of rice with accession numbers A3A3J1, B8AIH6 or A0A0E0G1W2; HPPD of different ecotypes of barley with accession numbers BAJ86732.1, BAJ95714.1 or F2E412 (the above accession numbers are from the GenBank database or the UniProt Knowledgebase database).
[0065] The term "position 372" or "position 372" or "unit site 372" not only refers to the 372th amino acid (phenylalanine) of the amino acid sequence shown in SEQ ID NO: 1 in a narrow sense, but also broadly includes a known or inferred HPPD amino acid sequence that can be aligned with the amino acid sequence shown in SEQ ID NO: 1 using a standard sequence alignment tool (such as CLUSTAL software, etc.), and a position corresponding to the 372th amino acid of the amino acid sequence shown in SEQ ID NO: 1 can be obtained in the known or inferred HPPD amino acid sequence, which may not be the 372nd amino acid of the HPPD amino acid sequence.
[0066] The term "position 383" or "position 383" or "unit site 383" not only refers in a narrow sense to the 383rd amino acid (phenylalanine) of the amino acid sequence shown in SEQ ID NO: 1, but also in a broad sense includes a known or inferred HPPD amino acid sequence that can be aligned with the amino acid sequence shown in SEQ ID NO: 1 using a standard sequence alignment tool (such as CLUSTAL software, etc.), and a position corresponding to the 383rd amino acid of the amino acid sequence shown in SEQ ID NO: 1 can be obtained in the known or inferred HPPD amino acid sequence, which may not be the 383rd amino acid of the HPPD amino acid sequence.
[0067] The term "position 415" or "position 415" or "unit site 415" not only refers in a narrow sense to the 415th amino acid (phenylalanine) of the amino acid sequence shown in SEQ ID NO: 1, but also in a broad sense includes a known or inferred HPPD amino acid sequence that can be aligned with the amino acid sequence shown in SEQ ID NO: 1 using a standard sequence alignment tool (such as CLUSTAL software, etc.), and a position corresponding to the 415th amino acid of the amino acid sequence shown in SEQ ID NO: 1 can be obtained in the known or inferred HPPD amino acid sequence, which may not be the 415th amino acid of the HPPD amino acid sequence.
[0068] Similarly, the interpretation of other sites is the same as the above interpretation of "site 372" or "site 372".
[0069] The term "corresponding to" means that the HPPD amino acid sequences from different species or different ecotypes of the same species are aligned with the amino acid sequence shown in SEQ ID NO: 1 using standard sequence alignment tools to obtain the positions corresponding to the amino acids at specific positions in the amino acid sequence shown in SEQ ID NO: 1, such as the positions corresponding to amino acid position 372 or amino acid position 383 in the amino acid sequence shown in SEQ ID NO: 1.
[0070] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. These terms apply to polymers of amino acid residues in which one or more amino acid residues is an artificial chemical analog of a corresponding wild-type occurring amino acid, as well as polymers of wild-type occurring amino acids. The polypeptides of the invention can be produced from a nucleic acid disclosed herein or by using standard molecular biology techniques. For example, a truncated protein of the invention can be produced by expressing a recombinant nucleic acid of the invention in an appropriate host cell, or alternatively by a combination of in vitro methods such as protease digestion and purification.
[0071] Thus, the present invention also provides nucleic acid molecules comprising polynucleotide sequences encoding mutant HPPD polypeptides, variants, and fragments thereof, having HPPD enzyme activity and conferring tolerance to certain classes of HPPD inhibitor herbicides in plants. Generally, the present invention encompasses any polynucleotide sequence encoding any of the mutant HPPD polypeptides described herein, as well as any polynucleotide sequence encoding an HPPD polypeptide having one or more conservative amino acid substitutions relative to the mutant HPPD polypeptides described herein. Conservative amino acid substitutions that provide functionally similar amino acids are well known to those skilled in the art, and the following five groups each comprise amino acids that are conservative substitutions for one another: aliphatic: glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I); aromatic: phenylalanine (F), tyrosine (Y), tryptophan (W); sulfur-containing: methionine (M), cysteine (C); basic: arginine (I), lysine (K), histidine (H); acidic: aspartic acid (D), glutamic acid (E), asparagine (N), glutamine (Q).
[0072] In one embodiment, the present invention provides a polynucleotide sequence encoding an amino acid sequence derived from a plant HPPD or an amino acid sequence of a microbial HPPD, wherein the polypeptide has HPPD enzyme activity and comprises at least a combined mutation corresponding to amino acid positions 372 and 383 of SEQ ID NO: 1.
[0073] Therefore, sequences that have HPPD inhibitor herbicide tolerance activity and hybridize under stringent conditions to the gene encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide of the present invention are included in the present invention. For example, these sequences are compared with the sequences of the present invention SEQ ID NO: 11-12, SEQ ID NO: 33-34, SEQ ID NO: 45-46, SEQ ID NO: 57-58, SEQ ID NO: 69-70, SEQ ID NO: 81-82, SEQ ID NO: 93-94, SEQ ID NO: 105-106, SEQ ID NO: 117-118, SEQ ID NO: 129-130, SEQ ID NO: 141-142, SEQ ID NO: 153-154, SEQ ID NO: 159-160, SEQ ID NO: 165-166, SEQ ID NO: 174-175, SEQ ID NO: 183-184, SEQ ID NO: 186-187, SEQ ID NO: 189-190, SEQ ID NO: 192-193, SEQ ID NO: 195-196, SEQ ID NO: 197-201 NO:198-199, SEQ ID NO:201-202, SEQ ID NO:204-205 have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity.
[0074] Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the mutated HPPD gene of the present invention. Nucleic acid molecules or fragments thereof can, under certain circumstances, specifically hybridize to other nucleic acid molecules. In the present invention, two nucleic acid molecules are said to be capable of specific hybridization if they can form an antiparallel double-stranded nucleic acid structure. If two nucleic acid molecules exhibit complete complementarity, one is said to be the "complement" of the other. In the present invention, two nucleic acid molecules are said to exhibit "complete complementarity" when every nucleotide in one molecule is complementary to the corresponding nucleotide in the other. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from complete complementarity are permissible as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to function as a primer or probe, it only needs to be sufficiently complementary in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.
[0075] In the present invention, a substantially homologous sequence is a nucleic acid molecule that can specifically hybridize with the complementary strand of another matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions that promote DNA hybridization, for example, treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from about 2.0×SSC at 50°C for low stringency conditions to about 0.2×SSC at 50°C for high stringency conditions. In addition, the temperature in the washing step can be increased from room temperature of about 22°C for low stringency conditions to about 65°C for high stringency conditions. Both the temperature and the salt concentration can be varied, or one of them can be kept constant while the other is varied. Preferably, the stringent conditions of the present invention may be specific hybridization with the mutated HPPD gene of the present invention in a 6×SSC, 0.5% SDS solution at 65° C., followed by washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.
[0076] As used herein, the term "hybridization" or "specific hybridization" means that a molecule can only bind, double-strand or hybridize to a specific nucleotide sequence under stringent conditions when the sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
[0077] Due to the redundancy of the genetic code, multiple different DNA sequences can encode the same amino acid sequence. Generating alternative DNA sequences encoding identical or substantially identical proteins is within the skill of those skilled in the art. These different DNA sequences are encompassed by the present invention. "Substantially identical" sequences refer to sequences with amino acid substitutions, deletions, additions, or insertions that do not substantially affect herbicide tolerance activity, including fragments that retain herbicide tolerance activity.
[0078] The term "functional activity" or "activity" as used herein refers to the ability of the protein / enzyme (alone or in combination with other proteins) used in the present invention to degrade or attenuate the activity of a herbicide. Plants producing the protein of the present invention preferably produce an "effective amount" of the protein so that when the plant is treated with the herbicide, the level of protein expression is sufficient to give the plant full or partial tolerance to the herbicide (if not otherwise specified, the usual amount). The herbicide can be used in an amount that usually kills the target plant, a normal field use amount and concentration. Preferably, the plant cells and plants of the present invention are protected from growth inhibition or damage caused by herbicide treatment. The transformed plants and plant cells of the present invention preferably have tolerance to HPPD inhibitor herbicides, that is, the transformed plants and plant cells can grow in the presence of an effective amount of HPPD inhibitor herbicides.
[0079] The genes and proteins described in the present invention include not only the specific exemplified sequences, but also parts and / or fragments (including internal and / or terminal deletions compared to the full-length protein), variants, mutants, variant proteins, substitutions (proteins with alternative amino acids), chimeras and fusion proteins that retain the HPPD inhibitor herbicide tolerance activity characteristics of the specific exemplified proteins.
[0080] The term "variant" herein refers to a substantially similar sequence. For polynucleotides, a variant includes deletions and / or additions of one or more nucleotides at one or more internal sites within a reference polynucleotide and / or substitutions of one or more nucleotides at one or more sites in a mutant HPPD polynucleotide. The term "reference polynucleotide or polypeptide" herein includes mutant HPPD nucleotide or amino acid sequences, respectively. The term "wild-type polynucleotide or polypeptide" herein includes wild-type occurring nucleotide or amino acid sequences, respectively. For polynucleotides, conservative variants include amino acid sequences that encode one of the mutant HPPD polypeptides of the invention (due to the degeneracy of the genetic code). Allelic variants of these wild-type occurrences can be identified using well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated using site-directed mutagenesis but still encoding a mutant HPPD protein of the invention. Generally, variants of a particular polynucleotide of the invention will have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotide as determined by sequence comparison programs and parameters.
[0081] As used herein, a "variant protein" refers to a protein derived from a reference protein by deletion or addition of one or more amino acids at one or more internal sites in the mutant HPPD protein and / or substitution of one or more amino acids at one or more sites in the mutant HPPD protein. Variant proteins encompassed by the present invention are biologically active, i.e., they continue to possess the desired activity of the mutant HPPD protein, i.e., the HPPD enzyme activity and / or herbicide tolerance. Such variants can arise, for example, from genetic polymorphisms or from human manipulation. A biologically active variant of a mutant HPPD protein of the present invention will have at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the entire amino acid sequence of the mutant HPPD protein, as determined by sequence alignment programs and parameters. A biologically active variant of a protein of the invention may differ from the protein by as few as 1-15 amino acid residues, as few as 1-10 (e.g., 6-10), as few as 5 (e.g., 4, 3, 2, or even 1) amino acid residues.
[0082] Methods for the comparison of sequences are well known in the art and can be accomplished using mathematical algorithms, such as the algorithm of Myers and Miller (1988) CABIOS 4: 11-17; the local alignment algorithm of Smith et al. (1981) Adv. Appl. Math. 2: 482; the global alignment algorithm of Needeman and Wunsch (1970) J. Mol. Biol. 48: 443-453; and the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 872-264, as modified in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5877. Computer implementations of these mathematical algorithms can be used for sequence comparison to determine sequence homology, including, but not limited to, CLUSTAL in the PC / Gene program (available from Intelligenetics, Mountain View, California); the ALLGN program (version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics Software Package version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, California, USA).
[0083] In certain embodiments, amino acids encoding mutant HPPD polypeptides or variants thereof that retain HPPD enzyme activity can be stacked with any combination of polynucleotide sequences of interest to produce plants having a desired trait. The term "trait" refers to a phenotype resulting from a particular sequence or group of sequences. For example, a polynucleotide encoding an amino acid sequence encoding a mutant HPPD polypeptide or a variant thereof that retains HPPD enzyme activity can be stacked with any other polynucleotide encoding a polypeptide that confers a desired trait, including but not limited to resistance to disease, insects, and herbicides, tolerance to heat and drought, shortened crop maturity, improved industrial processing (e.g., for converting starch or biomass into fermentable sugars), and improved agronomic quality (e.g., high oil content and high protein content).
[0084] As is well known to those skilled in the art, the benefits of combining two or more modes of action in improving the spectrum of weeds controlled and / or wild-type more tolerant or resistant species can also be extended to chemicals that are artificially produced (transgenic or non-transgenic) in crops to impart herbicide tolerance in addition to HPPD-tolerant crops. In fact, the following resistance-encoding traits can be stacked alone or in multiple combinations to provide effective control or prevent the development of weed resistance to herbicides: glyphosate resistance (such as resistant plants or bacteria EPSPS, GOX, GAT), glufosinate resistance (such as PAT, Bar), acetolactate synthase (ALS)-inhibiting herbicide resistance (such as imidazolinone, sulfonylurea, triazolopyrimidine, sulfonanilide, pyrimidinethiobenzoic acid and other chemical resistance genes such as AHAS, Csrl, SurA, etc.), phenoxy auxin herbicides. Resistance (such as aryloxyalkanoate dioxygenase-AAD), dicamba herbicide resistance (such as dicamba monooxygenase-DMO), bromoxynil resistance (such as Bxn), resistance to phytoene desaturase (PDS) inhibitors, resistance to photosystem II inhibitory herbicides (such as psbA), resistance to photosystem I inhibitory herbicides, resistance to protoporphyrinogen oxidase IX (PPO) inhibitory herbicides (such as PPO-1), resistance to phenylurea herbicides (such as CYP76B1), dichloromethane degrading enzyme, etc.
[0085] Glyphosate is widely used because it controls a very broad spectrum of broadleaf and grass weed species. However, repeated use of glyphosate in glyphosate-tolerant crops and non-crop applications has (and continues to) select for weed succession to wild-type, more tolerant species or glyphosate-resistant biotypes. Most herbicide resistance management strategies recommend using an effective amount of a tank-mixed herbicide partner as a method to delay the emergence of resistant weeds, which provides control of the same species but has a different mode of action. Superimposing the gene for the mutant hydroxyphenylpyruvate dioxygenase polypeptide of the present invention with a glyphosate tolerance trait (and / or other herbicide tolerance traits) can achieve control of glyphosate-resistant weed species (broadleaf weed species controlled by one or more HPPD inhibitor herbicides) in glyphosate-tolerant crops by allowing the selective use of glyphosate and an HPPD inhibitor herbicide (such as topazolin, mesotrione, or isoxazolidinone) on the same crop. Application of these herbicides can be simultaneous in a tank mix containing two or more herbicides with different modes of action, single applications of a single herbicide composition in sequential applications (e.g., pre-plant, pre-emergence, or post-emergence) with intervals between applications ranging from 2 hours to 3 months, or alternatively, a combination representing any number of herbicides from each applicable compound class can be used at any time from within 7 months of planting the crop to harvesting the crop (or the pre-harvest interval for a single herbicide, whichever is shortest).
[0086] Flexibility in broadleaf weed control is important in terms of application timing, individual herbicide rates, and the ability to control stubborn or resistant weeds. Glyphosate applications stacked with glyphosate-resistant / mutated HPPD genes in crops can range from 250 to 2500 g ae / ha; HPPD inhibitor herbicides (one or more) can be applied at rates from 25 to 500 g ai / ha. The optimal combination of these application times depends on specific conditions, species, and environment.
[0087] Herbicide formulations (e.g., ester, acid, or salt formulations or soluble concentrates, emulsifiable concentrates, or soluble liquids) and tank mix additives (e.g., adjuvants or compatibilizers) can significantly affect the weed control of a given herbicide or combination of one or more herbicides. Any chemical combination of any of the foregoing herbicides is within the scope of the present invention.
[0088] In addition, the gene encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide of the present invention can be stacked with one or more other input (such as insect resistance, fungal resistance or stress tolerance, etc.) or output (such as increased yield, improved oil content, improved fiber quality, etc.) traits, either alone or in combination with other herbicide-tolerant crop traits. Thus, the present invention can be used to provide a complete agronomic solution with the ability to flexibly and economically control any number of agronomic pests and improve crop quality.
[0089] The combination of these superpositions can be produced by any method, and these methods include but are not limited to: by conventional or top-crossing method hybrid breeding plants or genetic transformation. If these sequences are superimposed by genetic transformation of these plants, the polynucleotide sequence of interest can be combined at any time and in any order. For example, a transgenic plant comprising one or more desired proterties can be used as a target for introducing other proterties by subsequent transformation. These proterties can be introduced simultaneously with the polynucleotide of interest provided by any combination of expression cassettes in a co-transformation scheme. For example, if two sequences are to be introduced, these two sequences can be contained in separate expression cassettes (trans) or in the same expression cassette (cis). The expression of these sequences can be driven by the same promoter or by different promoters. In some cases, it may be desirable to introduce an expression cassette that suppresses the expression of the polynucleotide of interest. This can be combined with any combination of other suppression expression cassettes or overexpression cassettes to produce a desired proterties combination in this plant. It is further recognized that the polynucleotide sequence can be superimposed using a site-specific recombination system at a desired genomic location.
[0090] The gene encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide of the present invention has a higher tolerance to HPPD inhibitor herbicides and is the basis for the possibility of important herbicide-tolerant crops and selection marker characteristics.
[0091] As used herein, the term "expression cassette" refers to a nucleic acid molecule capable of directing the expression of a specific nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to a nucleotide sequence of interest (i.e., a polynucleotide encoding a mutant HPPD polypeptide or a variant retaining HPPD enzyme activity, either alone or in combination with one or more additional nucleic acid molecules encoding polypeptides conferring a desired trait), the nucleotide sequence of interest being operably linked to a termination signal. The coding region typically encodes a protein of interest, but may also encode a functional RNA of interest, such as antisense RNA in the sense or antisense orientation or a non-translated RNA. The expression cassette comprising the nucleotide sequence of interest can be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette can also be a wild-type occurring expression cassette, but must be obtained in a recombinant form useful for heterologous expression. However, typically, the expression cassette is heterologous to the host, i.e., the specific DNA sequence of the expression cassette does not occur wild-type in the host cell and must have been introduced into the new host cell via a transformation event. The expression of the nucleotide sequence in the expression cassette can be under the control of a constitutive promoter or an inducible promoter, which initiates transcription only when the host cell is exposed to some specific external stimulus. In addition, the promoter can be specific for a particular tissue or organ or developmental stage.
[0092] The present invention encompasses transforming plants with an expression cassette capable of expressing a polynucleotide of interest (i.e., a polynucleotide encoding a mutant HPPD polypeptide or a variant thereof that retains HPPD enzyme activity, either alone or in combination with one or more additional nucleic acid molecules encoding polypeptides that confer a desired trait). The expression cassette includes a transcriptional and translational initiation region (i.e., a promoter) and a polynucleotide open reading frame in the 5'-3' transcriptional direction. The expression cassette may optionally include a transcriptional and translational termination region (i.e., a terminator) that functions in plants. In some embodiments, the expression cassette includes a selectable marker gene to allow selection of stable transformants. Expression constructs of the present invention may also include a leader sequence and / or a sequence that allows for inducible expression of the polynucleotide of interest.
[0093] The regulatory sequences of the expression cassette are operably linked to the polynucleotide of interest. The regulatory sequences of the present invention include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operably linked to the herbicide tolerance gene encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide.
[0094] The promoter is a plant-expressible promoter. A "plant-expressible promoter" refers to a promoter that ensures expression of the coding sequence to which it is linked within plant cells. A plant-expressible promoter may be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, the 35S promoter from cauliflower mosaic virus, the maize Ubi promoter, and the promoter from the rice GOS2 gene. Alternatively, a plant-expressible promoter may be a tissue-specific promoter, meaning that the promoter directs expression of a coding sequence at higher levels in certain plant tissues, such as green tissue, than in other plant tissues (as determined by conventional RNA assays), such as the PEP carboxylase promoter. Alternatively, a plant-expressible promoter may be a wound-inducible promoter. A wound-inducible promoter, or one that directs a wound-induced expression pattern, means that when a plant is wounded mechanically or by insect infestation, expression of the coding sequence under its control is significantly increased compared to normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, the promoters of the potato and tomato proteinase inhibitor genes (pin I and pin II) and the maize proteinase inhibitor gene (MPI).
[0095] The transit peptide (also known as secretory signal sequence or targeting sequence) directs the transgenic product to a specific organelle or cellular compartment. For the receptor protein, the transit peptide can be heterologous, for example, targeting the chloroplast using a sequence encoding a chloroplast transit peptide, targeting the endoplasmic reticulum using a 'KDEL' retention sequence, or targeting the vacuole using the CTPP of the barley lectin gene.
[0096] The leader sequence includes, but is not limited to, a small RNA virus leader sequence, such as the EMCV leader sequence (encephalomyocarditis virus 5' non-coding region); a potyvirus leader sequence, such as the MDMV (maize dwarf mosaic virus) leader sequence; a human immunoglobulin heavy chain binding protein (BiP); an untranslated leader sequence of the coat protein mRNA of the alfalfa mosaic virus (AMV RNA4); and a tobacco mosaic virus (TMV) leader sequence.
[0097] Such enhancers include, but are not limited to, cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) enhancer, carnation weathering ring virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, tuberose yellow leaf curl virus (CmYLCV) enhancer, Multan cotton leaf curl virus (CLCuMV), Commelina yellow mottle virus (CoYMV) and peanut chlorotic streak mosaic virus (PCLSV) enhancer.
[0098] For monocot applications, the introns include, but are not limited to, maize hsp70 intron, maize ubiquitin intron, Adh intron 1, sucrose synthase intron, or rice Act1 intron. For dicot applications, the introns include, but are not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron, and "super ubiquitin" intron.
[0099] The terminator can be a suitable polyadenylation signal sequence that functions in plants, including but not limited to the polyadenylation signal sequence derived from the nopaline synthase (NOS) gene of Agrobacterium tumefaciens, the polyadenylation signal sequence derived from the proteinase inhibitor II (pin II) gene, the polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and the polyadenylation signal sequence derived from the α-tubulin gene.
[0100] As used herein, "operably linked" refers to the association of nucleic acid sequences such that one sequence provides a function required of the associated sequence. For purposes of this invention, "operably linked" can mean linking a promoter to a sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. When the sequence of interest encodes a protein and expression of that protein is desired, "operably linked" means that the promoter is linked to the sequence in a manner that allows efficient translation of the resulting transcript. If the promoter is linked to a coding sequence as a transcript fusion and expression of the encoded protein is desired, the linkage is created such that the first translation initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the promoter is linked to a coding sequence as a translational fusion and expression of the encoded protein is desired, the linkage is created such that the first translation initiation codon contained in the 5' untranslated sequence is linked to the promoter, and the linkage is such that the resulting translation product is in-frame with the translational open reading frame encoding the desired protein. Nucleic acid sequences that can be "operably linked" include, but are not limited to, sequences that provide gene expression function (i.e., gene expression elements, such as promoters, 5' untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites and / or transcription terminators), sequences that provide DNA transfer and / or integration function (i.e., T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), sequences that provide selection function (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scorable marker function, sequences that facilitate sequence manipulation in vitro or in vivo (i.e., polylinker sequences, site-specific recombination sequences), and sequences that provide replication function (i.e., bacterial origin of replication, autonomous replication sequences, centromere sequences).
[0101] The genome of a plant, plant tissue or plant cell mentioned in the present invention refers to any genetic material in a plant, plant tissue or plant cell, and includes the genomes of the cell nucleus, plastids and mitochondria.
[0102] In the present invention, the term "plant part" or "plant tissue" includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, plant clusters, and intact plant cells in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, cobs, shells, stems, roots, root tips, anthers, etc.
[0103] The mutant hydroxyphenylpyruvate dioxygenase polypeptides of the present invention can be applied to a variety of plants, including dicotyledonous plants including but not limited to alfalfa, beans, cauliflower, cabbage, carrots, celery, cotton, cucumber, eggplant, lettuce, melon, peas, peppers, zucchini, radish, rapeseed, spinach, soybean, pumpkin, tomato, Arabidopsis, peanuts, or watermelon; preferably, the dicotyledonous plants are cucumber, soybean, Arabidopsis, tobacco, cotton, peanuts, or rapeseed. The monocotyledonous plants include but are not limited to rice, sorghum, wheat, barley, rye, millet, sugarcane, oats, or lawn grass; preferably, the monocotyledonous plants are rice, sorghum, wheat, barley, millet, sugarcane, or oats.
[0104] For purposes of the present invention, the term "plant transformation" refers to the transformation of a herbicide-resistant or -tolerant mutant HPPD polynucleotide, either alone or in combination with one or more additional nucleic acid molecules encoding polypeptides conferring the desired trait, into a plant cell after cloning into an expression system. The receptor and target expression cassettes of the present invention can be introduced into plant cells using a variety of well-known methods. In the context of polynucleotides, the term "introducing" (e.g., a nucleotide construct of interest) is intended to mean providing the polynucleotide to the plant in such a manner that the polynucleotide gains access to or presence within a plant cell. Where more than one polynucleotide is to be introduced, these polynucleotides can be assembled as part of a single nucleotide construct or as separate nucleotide constructs and can be located on the same or different transformation vectors. Thus, the polynucleotides can be introduced into the host cell of interest in a single transformation event, in separate transformation events, or as part of a breeding program. The methods of the present invention do not depend on a specific method for introducing one or more polynucleotides into a plant, only on gaining access to or presence within at least one cell of the plant. Methods known in the art for introducing one or more polynucleotides into a plant include, but are not limited to, transient transformation methods, stable transformation methods, virus-mediated methods, or genome editing techniques.
[0105] The term "stable transformation" refers to the introduction of a foreign gene into the plant genome, which is stably integrated into the genome of the plant and any successive generations thereof, resulting in stable inheritance of the foreign gene.
[0106] The term "transient transformation" refers to the introduction of nucleic acid molecules or proteins into plant cells, which perform their functions but do not integrate into the plant genome, resulting in the inability of the exogenous genes to be stably inherited.
[0107] The term "genome editing technology" refers to genome modification technologies that can precisely manipulate genomic sequences to achieve site-directed gene mutations, insertions, deletions, and other operations. Currently, the main genome editing technologies include HE (homing endonuclease), ZFN technology (Zinc-finger nuclease), TALEN technology (transcription activator-like effector nuclease), and CRISPR technology (Clustered regulatory interspaced short palindromic repeat).
[0108] For those skilled in the art, the numerous available transformation vectors for plant transformation are known, and the gene relevant to the present invention can be used in combination with any of the above-mentioned vectors. The selection of the vector will depend on the preferred transformation technology and the target species for transformation. For some target species, different antibiotic or herbicide selection markers can be preferred. Selectable markers routinely used in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics or related herbicides (described by Bevan et al. in 1983 in Nat. Sci., Vol. 304, pp. 184-187), the pat and bar genes, which confer resistance to the herbicide glufosinate (also known as glufosinate-ammonium; see White et al. in 1990 in Nucl. Acids Res, Vol. 18, p. 1062, Spencer et al. in 1990 in Theor. Appl. Genet, Vol. 79, pp. 625-631, and U.S. Pat. Nos. 5,561,236 and 5,276,268), the hpn gene, which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann, Mol. Cell Biol. 4: 2929-2931), and the dnfr gene, which confers resistance to methotrexate (Bourouis et al. in 1983 in EMBO). J., Vol. 2, pp. 1099-1104), an EPSPS gene that confers resistance to glyphosate (U.S. Pat. Nos. 4,940,935 and 5,188,642), a glyphosate N-acetyltransferase (GAT) gene that also confers resistance to glyphosate (Castle et al., 2004, Science, Vol. 304, pp. 1151-1154; U.S. Patent Application Publication Nos. 20070004912, 20050246798, and 20050060767), and a mannose-6-phosphate isomerase gene that provides for the metabolism of mannose (U.S. Pat. Nos. 5,767,378 and 5,994,629).
[0109] Methods for regenerating plants are also well known in the art. For example, Ti plasmid vectors have been used to deliver foreign DNA, as well as direct DNA uptake, liposomes, electroporation, microinjection, and microprojectiles.
[0110] The cropping systems of the present invention include transgenic plants that are tolerant to one or more herbicides, and / or combinations of herbicide treatments that can be used at different stages of the plant's development, which, when applied, effectively control weed growth and produce plants with high yields and / or reduced injury.
[0111] In the present invention, the weeds refer to plants that compete with the cultivated target plants in the plant growth environment.
[0112] The terms "control" and / or "prevention" of the present invention refer to at least applying an effective dose of an HPPD inhibitor herbicide directly (e.g., by spraying) to the plant growth environment to minimize the development of weeds and / or stop their growth. At the same time, the target plants to be cultivated should be morphologically normal and can be cultivated under conventional methods for consumption and / or production of products; preferably, they have reduced plant damage and / or increased plant yield compared to non-transgenic wild-type plants. The reduced plant damage specifically includes, but is not limited to, improved stem resistance, and / or increased grain weight, etc. The "control" and / or "prevention" effect of the mutant hydroxyphenylpyruvate dioxygenase polypeptide on weeds can exist independently and will not be weakened and / or disappear due to the presence of other substances that can "control" and / or "prevent" weeds. Specifically, any tissue of the transgenic plant (containing a gene encoding a mutant hydroxyphenylpyruvate dioxygenase polypeptide) simultaneously and / or asynchronously presents and / or produces the mutant hydroxyphenylpyruvate dioxygenase polypeptide and / or another substance that can control weeds. The presence of the other substance neither affects the "control" and / or "prevention" effect of the mutant hydroxyphenylpyruvate dioxygenase polypeptide on weeds, nor can it cause the "control" and / or "prevention" effect to be completely and / or partially achieved by the other substance, and has nothing to do with the mutant hydroxyphenylpyruvate dioxygenase polypeptide.
[0113] The "plant propagules" mentioned in the present invention include, but are not limited to, plant sexual propagules and plant asexual propagules. Plant sexual propagules include, but are not limited to, plant seeds; plant asexual propagules refer to vegetative organs or specialized tissues of a plant that can produce new plants in vitro; such vegetative organs or specialized tissues include, but are not limited to, roots, stems, and leaves. For example, plants with roots as asexual propagules include strawberries and sweet potatoes; plants with stems as asexual propagules include sugarcane and potatoes (tubers); and plants with leaves as asexual propagules include aloe vera and begonia.
[0114] The present invention can confer novel herbicide resistance traits on plants without observed adverse effects on phenotype, including yield. Plants of the present invention can tolerate, for example, 0.5x, 1x, 2x, 3x, 4x, or 8x the typical application level of at least one of the tested herbicides. These increased tolerance levels are within the scope of the present invention. For example, various techniques known in the art can be foreseen for optimization and further development to increase expression of a given gene.
[0115] The present invention provides a mutant hydroxyphenylpyruvate dioxygenase polypeptide, its encoding gene and use, which have the following advantages:
[0116] 1. The present invention discloses for the first time that combined mutations at positions 372 and 383 of hydroxyphenylpyruvate dioxygenase polypeptides from different species can confer synergistic tolerance to pyrazolone, isoxazole and triketone HPPD inhibitor herbicides on plants, and in particular, can confer tolerance to 4 times the field concentration of pyrazoline, isoxazole and mesotrione on transgenic soybean plants. Therefore, the present invention has broad application prospects in plants.
[0117] 2. The combination of the 372+383 mutation in the hydroxyphenylpyruvate dioxygenase polypeptide of the present invention and further combination with other mutation sites does not affect the synergistic tolerance of the 372+383 combination mutation alone to HPPD inhibitor herbicides, demonstrating the importance and stability of the 372+383 combination mutation of the HPPD polypeptide in conferring tolerance to HPPD inhibitor herbicides on plants.
[0118] 3. Based on the combined mutations at positions 372 and 383 of the hydroxyphenylpyruvate dioxygenase polypeptide of the present invention, optimizing the C-terminus of the HPPD amino acid sequence will be beneficial for improving the tolerance of plants to isoxathiapiprolin.
[0119] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0120] FIG1 is a schematic diagram of the structure of the Arabidopsis thaliana recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence of the present invention;
[0121] FIG2 is a schematic diagram of the structure of the control recombinant expression vector DBN11726N of the present invention;
[0122] FIG3 is a phylogenetic tree of HPPD from different species of the present invention. DETAILED DESCRIPTION
[0123] The following specific examples further illustrate the technical solutions of the mutant hydroxyphenylpyruvate dioxygenase polypeptide, its encoding gene and use of the present invention.
[0124] Example 1: Select sites 372 and 383 of AsHPPD for combined mutation (F372A+F383W) and verify the mutation effect
[0125] 1. Obtaining AsHPPD and AsHPPDm-F372A-F383W genes
[0126] The amino acid sequence of the oat wild-type HPPD (AsHPPD) is shown in SEQ ID NO: 1 in the sequence listing; the AsHPPD-01 nucleotide sequence encoding the AsHPPD is shown in SEQ ID NO: 2 in the sequence listing; and the AsHPPD-02 nucleotide sequence encoding the AsHPPD obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 3 in the sequence listing.
[0127] The 372 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 4 in the sequence listing, the AsHPPDm-F372A-01 nucleotide sequence encoding the AsHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 5 in the sequence listing, and the AsHPPDm-F372A-02 nucleotide sequence encoding the AsHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO: 6 in the sequence listing.
[0128] The 383 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 7 in the sequence listing, the AsHPPDm-F383W-01 nucleotide sequence encoding the AsHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 8 in the sequence listing, and the AsHPPDm-F383W-02 nucleotide sequence encoding the AsHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO: 9 in the sequence listing.
[0129] The 372 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383 position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 10 in the sequence listing. The AsHPPDm-F372A-F383W-01 nucleotide sequence encoding the AsHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 11 in the sequence listing. The AsHPPDm-F372A-F383W-02 nucleotide sequence encoding the AsHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 12 in the sequence listing.
[0130] 2. Synthesis of the above nucleotide sequence
[0131] The 5' and 3' ends of the synthesized AsHPPD-02 nucleotide sequence (SEQ ID NO: 3), AsHPPDm-F372A-02 nucleotide sequence (SEQ ID NO: 6), AsHPPDm-F383W-02 nucleotide sequence (SEQ ID NO: 9), and AsHPPDm-F372A-F383W-02 nucleotide sequence (SEQ ID NO: 12) were respectively connected to universal linker primer 1:
[0132] 5'-end universal linker primer 1: 5'-agtttttctgattaacagactagt-3', as shown in SEQ ID NO: 230 in the sequence listing;
[0133] 3' end universal linker primer 1: 5'-caaatgtttgaacgatcggcgcgcc-3', as shown in SEQ ID NO: 231 in the sequence listing.
[0134] 3. Construction of an Arabidopsis thaliana recombinant expression vector containing the oat HPPD gene (F372A-F383W)
[0135] The plant expression vector DBNBC-01 was subjected to a double enzyme digestion reaction using restriction endonucleases Spe I and Asc I to linearize the plant expression vector. The digestion product was purified to obtain a linearized DBNBC-01 expression vector backbone (vector backbone: pCAMBIA2301 (available from CAMBIA)). The AsHPPDm-F372A-F383W-02 nucleotide sequence connected to the universal linker primer 1 was recombined with the linearized DBNBC-01 expression vector backbone. The operation steps were carried out according to the instructions of the Takara In-Fusion seamless connection product kit (Clontech, CA, USA, CAT: 121416) to construct a recombinant expression vector DBN11726, the structure of which is shown in Figure 1 (Spec: spectinomycin gene; RB: right border; eFMV: 34S enhancer of Scrophulariaceae mosaic virus (SEQ ID NO: 13); prBrCBP: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 14); spAtCTP2: Arabidopsis chloroplast transit peptide (SEQ ID NO: 15); EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 16); tPsE9: terminator of the pea RbcS gene (SEQ ID NO: 17); prAtUbi10: promoter of the Arabidopsis ubiquitin 10 gene (SEQ ID NO: 18); AsHPPDm-F372A-F383W-02: nucleotide sequence of AsHPPDm-F372A-F383W-02 (SEQ ID NO: 12); tNos: terminator of the nopaline synthase gene (SEQ ID NO: 19); pr35S-01: cauliflower mosaic virus 35S promoter (SEQ ID NO: 20); PAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 21). NO: 21); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 22); LB: left border).
[0136] The recombinant expression vector DBN11726 was transformed into Escherichia coli T1 competent cells using a heat shock method. The heat shock conditions were as follows: 50 μL of Escherichia coli T1 competent cells and 10 μL of plasmid DNA (recombinant expression vector DBN11726), incubated in a 42°C water bath for 30 s; shaken at 37°C for 1 h (shaking on a shaker at 100 rpm); then cultured on the LB solid plate containing 50 mg / L spectinomycin at 37°C for 12 h, white colonies were picked, and cultured overnight in LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 50 mg / L spectinomycin, pH adjusted to 7.5 with NaOH) at 37°C. The plasmid was extracted by alkaline method: the bacterial solution was centrifuged at 12000 rpm for 1 min, the supernatant was removed, and the precipitated bacteria were suspended in 100 μl of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH 8.0); 200 μl of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times to mix, and place on ice for 3-5 minutes; add 150 μL of ice-cold solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 minutes; centrifuge at 4°C and 12000 rpm for 5 minutes, add 2 volumes of anhydrous ethanol to the supernatant, mix well, and place at room temperature for 5 minutes; centrifuge at 4°C and 12000 rpm for 5 minutes, discard the supernatant, wash the precipitate with 70% (v / v) ethanol, and air-dry; add 30 μL of TE (10mM Tris-HCl, 1mM EDTA, pH 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest the RNA in a water bath at 37°C for 30 minutes; store at -20°C until use. The extracted plasmid was sequenced and identified, and the results showed that the nucleotide sequence of the recombinant expression vector DBN11726 between the Spe I and Asc I sites was the nucleotide sequence shown in SEQ ID NO: 12 in the sequence listing, namely the AsHPPDm-F372A-F383W-02 nucleotide sequence.
[0137] According to the above-mentioned method for constructing the recombinant expression vector DBN11726, the AsHPPD-02 nucleotide sequence, the AsHPPDm-F372A-02 nucleotide sequence, and the AsHPPDm-F383W-02 nucleotide sequence connected to the universal linker primer 1 were respectively subjected to recombination reactions with the linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11727, DBN11728, and DBN11729, respectively. Sequencing verified that the nucleotide sequences in the recombinant expression vectors DBN11727, DBN11728, and DBN11729 contained the nucleotide sequence set forth in SEQ ID NO:3, the nucleotide sequence set forth in SEQ ID NO:6, and the nucleotide sequence set forth in SEQ ID NO:9, respectively, in the sequence listing, indicating that the AsHPPD-02 nucleotide sequence, the AsHPPDm-F372A-02 nucleotide sequence, and the AsHPPDm-F383W-02 nucleotide sequence were correctly inserted.
[0138] The control recombinant expression vector DBN11726N was constructed, and its vector structure is shown in FIG2 (Spec: spectinomycin gene; RB: right border; eFMV: 34S enhancer of figwort mosaic virus (SEQ ID NO: 13); prBrCBP: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 14); spAtCTP2: chloroplast transit peptide of Arabidopsis thaliana (SEQ ID NO: 15); EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 16); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 17); pr35S-01: cauliflower mosaic virus 35S promoter (SEQ ID NO: 20); PAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 21); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 22). NO:22); LB: left boundary).
[0139] 4. Transformation of Arabidopsis thaliana recombinant expression vector into Agrobacterium
[0140] The correctly constructed recombinant expression vectors DBN11726, DBN11727, DBN11728, DBN11729 and DBN11726N were respectively transformed into Agrobacterium GV3101 using the liquid nitrogen method. The transformation conditions were as follows: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and warmed in a 37°C water bath for 10 minutes; the transformed Agrobacterium GV3101 was inoculated into an LB test tube and cultured at a temperature of 28°C and a rotation speed of 200 rpm for 2 hours, and then spread on the LB solid plate containing 50 mg / L rifampicin and 50 mg / L spectinomycin until a positive single colony grew. The single colony was picked, cultured, and its plasmid was extracted. The extracted plasmid was sequenced and identified. The results showed that the structures of the recombinant expression vectors DBN11726 to DBN11729 and DBN11726N were completely correct.
[0141] 5. Obtaining transgenic Arabidopsis plants
[0142] Wild-type Arabidopsis seeds were suspended in 0.1% (w / v) agarose solution. The suspended seeds were kept at 4°C for 2 days to complete the dormancy requirement to ensure synchronous germination of the seeds. The soil was mixed with vermiculite and irrigated with water until moist, and the soil mixture was allowed to drain for 24 hours. The pretreated seeds were planted on the soil mixture and covered with a moisture-retaining dome for 7 days. The seeds were allowed to germinate and kept at a constant temperature (22°C) and constant humidity (40-50%) with a light intensity of 120-150 μmol / m 2 s -1 Plants were grown in a greenhouse under long-day conditions (16 h light / 8 h dark). Plants were initially irrigated with Hoagland's nutrient solution and subsequently with deionized water, keeping the soil moist but not soaking wet.
[0143] Arabidopsis thaliana was transformed using the floral soak method. One or more 15-30 mL pre-cultures of LB broth (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH adjusted to 7.5 with NaOH) containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated with selected Agrobacterium colonies. The pre-cultures were incubated overnight at 28°C with constant shaking at 220 rpm. Each pre-culture was inoculated with two 500 ml cultures of the LB broth containing spectinomycin (50 mg / L) and rifampicin (10 mg / L), and the cultures were incubated overnight with continuous shaking at 28°C. The cells were precipitated by centrifugation at room temperature at approximately 4000 rpm for 20 min, and the resulting supernatant was discarded. The cell pellet was gently resuspended in 500 mL of infiltration medium containing 1 / 2× MS salts / B5 vitamins, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (stock solution in 1 mg / mL DMSO)), and 300 μL / L Silvet L-77. Approximately one-month-old Arabidopsis plants were soaked in the infiltration medium containing the resuspended cells for 5 minutes, ensuring that the youngest inflorescences were immersed. The Arabidopsis plants were then turned on their sides and covered, and kept moist in the dark for 24 hours. The Arabidopsis plants were cultured normally at a temperature of 22°C with a photoperiod of 16 hours light / 8 hours dark. Seeds were harvested after approximately 4 weeks.
[0144] Freshly harvested T1 seeds (AsHPPD-02 nucleotide sequence, AsHPPDm-F372A-02 nucleotide sequence, AsHPPDm-F383W-02 nucleotide sequence, AsHPPDm-F372A-F383W-02 nucleotide sequence, and control recombinant expression vector DBN11726N) were dried at room temperature for 7 days. The seeds were then planted in 26.5 cm × 51 cm germination trays, with each tray receiving 200 mg of T1 seeds (approximately 10,000 seeds). The seeds had been previously suspended in distilled water and stored at 4°C for 2 days to complete dormancy and ensure synchronous germination.
[0145] Mix horse manure soil with vermiculite and use water bottom irrigation to moistening, utilize gravity drainage.Use pipette, pretreated seeds are planted on soil mixture evenly, and cover 4-5 days with moisturizing cover.After using emerging, spray glufosinate (select the PAT gene of cotransformation) and carry out the first day of initial transformant selection and remove cover.
[0146] T1 plants (at the cotyledonary and 2-4 leaf stages, respectively) were sprayed with a 0.2% solution of Liberty herbicide (200 g ai / L of glufosinate) at 7 days post-planting (DAP) and again at 11 DAP using a DeVilbiss compressed air nozzle at a spray volume of 10 mL / tray (703 L / ha) to provide an effective amount of glufosinate of 280 g ai / ha per application. Survivors (actively growing plants) were identified 4-7 days after the last spray and transplanted into 7 cm x 7 cm square pots prepared with horse manure soil and vermiculite (3-5 plants per tray). Transplanted plants were covered with a moisture-retaining dome for 3-4 days and placed in a 22°C incubator as before or directly moved into a greenhouse. The covers were then removed and the plants were transplanted into a greenhouse (temperature 22 ± 5°C, 50 ± 30% RH, 14 h light: 10 h dark, minimum 500 μE / m2) at least 1 day before testing the mutant HPPD gene for its ability to confer tolerance to HPPD inhibitor herbicides. 2 s -1 wild type + supplemental light).
[0147] 6. Detection of herbicide tolerance in transgenic Arabidopsis plants containing the AsHPPDm-F372A-F383W-02 nucleotide sequence
[0148] T1 transformants were first selected from an untransformed seed background using a glufosinate selection scheme. Arabidopsis thaliana T1 plants transformed with the AsHPPD-02 nucleotide sequence (AsHPPD-02), Arabidopsis thaliana T1 plants transformed with the AsHPPDm-F372A-02 nucleotide sequence (AsHPPDm-F372A-02), Arabidopsis thaliana T1 plants transformed with the AsHPPDm-F383W-02 nucleotide sequence (AsHPPDm-F383W-02), Arabidopsis thaliana T1 plants transformed with the AsHPPDm-F372A-F383W-02 nucleotide sequence (AsHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants transformed with the control recombinant expression vector DBN11726N (DBN11726N), and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were treated with three concentrations of pyraclostrobin (100 g ai / ha (4 times the field concentration, 4×), 200 g ai / ha (4 times the field concentration, 2×), and 100 g ai / ha (2 times the field concentration, 2×). ai / ha (8 times the field concentration, 8×) and 0 g ai / ha (water, 0×)), three concentrations of isoxaflutole (140 g ai / ha (2 times the field concentration, 2×), 280 g ai / ha (4 times the field concentration, 4×) and 0 g ai / ha (water, 0×)) and three concentrations of mesotrione (210 g ai / ha (2 times the field concentration, 2×), 420 g ai / ha (4 times the field concentration, 4×) and 0 g ai / ha (water, 0×)) were sprayed to detect the herbicide tolerance of Arabidopsis thaliana. Seven days after spraying (7 DAT), the degree of damage to each plant caused by the herbicide was calculated based on the proportion of leaf albinism area (leaf albinism area proportion = leaf albinism area / total leaf area × 100%): basically no albinism phenotype was assigned as level 0, the leaf albinism area proportion of less than 50% was assigned as level 1, the leaf albinism area proportion of more than 50% was assigned as level 2, and the leaf albinism area proportion of 100% was assigned as level 3.
[0149] The resistance performance of each recombinant expression vector transformation event was scored according to the formula X = [Σ(N×S) / (T×M)]×100 (X = phytotoxicity score, N = number of plants affected by the same level, S = number of phytotoxicity levels, T = total number of plants, and M = highest phytotoxicity level). Resistance was evaluated based on the scores: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), lowly resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 1.
[0150] Table 1. Results of the tolerance experiment of transgenic Arabidopsis thaliana T1 plants to pyraclostrobin
[0151]
[0152] The results in Table 1 showed that compared with CK, AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 all showed high tolerance to 4-fold or 8-fold the field concentration of benzopyrene, while AsHPPD-02 and DBN11726N had no tolerance to benzopyrene.
[0153] Table 2. Results of the tolerance experiment of transgenic Arabidopsis thaliana T1 plants to isoxathiapiprolin
[0154]
[0155]
[0156] The results in Table 2 showed that: (1) Compared with CK, AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed different degrees of tolerance to different concentrations of isoxathiapiprolin, while AsHPPD-02 and DBN11726N had no tolerance to isoxathiapiprolin; (2) For isoxathiapiprolin at a concentration twice that of field standards, AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed moderate resistance, moderate resistance and high resistance, respectively, indicating that the wild-type HPPD amino acid sequence 37 The effect of combined mutation at sites 372 and 383 (F372A+F383W) was better than that of single-site mutation of F372A or F383W; (3) To 4 times the field concentration of isoxathiapiprolin, AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed low resistance, low resistance and high resistance, respectively. This shows that the effect of combined mutation at sites 372 and 383 (F372A+F383W) of the wild-type HPPD amino acid sequence is not only better than that of single-site mutation of F372A or F383W, but also further shows synergistic herbicide tolerance effect.
[0157] Table 3. Results of the tolerance experiment of transgenic Arabidopsis thaliana T1 plants to mesotrione
[0158]
[0159]
[0160] The results in Table 3 showed that: (1) Compared with CK, AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed different degrees of tolerance to different concentrations of mesotrione, while AsHPPD-02 and DBN11726N had no tolerance to mesotrione; (2) For mesotrione at a concentration twice that of the field, AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed moderate resistance, moderate resistance and high resistance, respectively, indicating that the wild-type HPPD amino acid sequence 372A-02 had a strong tolerance to mesotrione. The effect of combined mutation at sites 372 and 383 (F372A+F383W) was better than that of single-site mutation of F372A or F383W; (3) To 4 times the field concentration of mesotrione, AsHPPDm-F372A-02, AsHPPDm-F383W-02 and AsHPPDm-F372A-F383W-02 showed low resistance, low resistance and high resistance, respectively. This shows that the effect of combined mutation at sites 372 and 383 (F372A+F383W) of the wild-type HPPD amino acid sequence is not only better than that of single-site mutation of F372A or F383W, but also further shows synergistic herbicide tolerance effect.
[0161] Tables 2 and 3 above fully demonstrate that the combined mutations (F372A+F383W) at positions 372 and 383 of the wild-type HPPD amino acid sequence have a synergistic effect on HPPD inhibitor herbicide tolerance.
[0162] Second Example: Combined mutations (F372A+F383W) were performed on the 372 and 383 sites of the HPPD amino acid sequences from different species and their mutation effects were verified.
[0163] In order to further verify the synergistic effect of the combined mutations at sites 372 and 383 of the HPPD amino acid sequence, the evolutionary tree of HPPDs from different species (as shown in Figure 3) was analyzed, and HPPDs from representative species on different branches were selected, and combined mutations (F372A+F383W) were performed at sites 372 and 383 of their amino acid sequences to verify their mutation effects.
[0164] 1. Obtaining HPPD from different species and mutated HPPD (F372A+F383W)
[0165] (1) Obtaining the HPPD mutant (F372A+F383W) in Arabidopsis
[0166] The amino acid sequence of Arabidopsis wild-type HPPD (AtHPPD) is shown in SEQ ID NO: 23 in the sequence listing; the AtHPPD-01 nucleotide sequence encoding the AtHPPD is shown in SEQ ID NO: 24 in the sequence listing; and the AtHPPD-02 nucleotide sequence encoding the AtHPPD obtained based on the Arabidopsis / soybean common preferred codon is shown in SEQ ID NO: 25 in the sequence listing.
[0167] The 372 position of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the AtHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 26 in the sequence listing. The AtHPPDm-F372A-01 nucleotide sequence encoding the AtHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 27 in the sequence listing. The AtHPPDm-F372A-02 nucleotide sequence encoding the AtHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 28 in the sequence listing.
[0168] The 383 position of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F383W amino acid sequence, as shown in SEQ ID NO:29 in the sequence listing, the AtHPPDm-F383W-01 nucleotide sequence encoding the AtHPPDm-F383W amino acid sequence is shown in SEQ ID NO:30 in the sequence listing, and the AtHPPDm-F383W-02 nucleotide sequence encoding the AtHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO:31 in the sequence listing.
[0169] The 372th position of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 32 in the sequence listing. The AtHPPDm-F372A-F383W-01 nucleotide sequence encoding the AtHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 33 in the sequence listing. The AtHPPDm-F372A-F383W-02 nucleotide sequence encoding the AtHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 34 in the sequence listing.
[0170] (2) Obtaining the HPPD mutant of alfalfa (F372A+F383W)
[0171] The amino acid sequence of the wild-type alfalfa HPPD (MsHPPD) is shown in SEQ ID NO: 35 in the sequence listing; the nucleotide sequence of MsHPPD-01 encoding the MsHPPD is shown in SEQ ID NO: 36 in the sequence listing; and the nucleotide sequence of MsHPPD-02 encoding the MsHPPD obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 37 in the sequence listing.
[0172] The 372 position of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the MsHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 38 in the sequence listing. The MsHPPDm-F372A-01 nucleotide sequence encoding the MsHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 39 in the sequence listing. The MsHPPDm-F372A-02 nucleotide sequence encoding the MsHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 40 in the sequence listing.
[0173] The 383 position of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the MsHPPDm-F383W amino acid sequence, as shown in SEQ ID NO:41 in the sequence listing, the MsHPPDm-F383W-01 nucleotide sequence encoding the MsHPPDm-F383W amino acid sequence, as shown in SEQ ID NO:42 in the sequence listing, and the MsHPPDm-F383W-02 nucleotide sequence encoding the MsHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO:43 in the sequence listing.
[0174] The 372th position of the MsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the MsHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO:44 in the sequence listing. The MsHPPDm-F372A-F383W-01 nucleotide sequence encoding the MsHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO:45 in the sequence listing. The MsHPPDm-F372A-F383W-02 nucleotide sequence encoding the MsHPPDm-F372A-F383W amino acid sequence obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO:46 in the sequence listing.
[0175] (3) Obtaining cotton mutant HPPD (F372A+F383W)
[0176] The amino acid sequence of cotton wild-type HPPD (GsHPPD) is shown in SEQ ID NO: 47 in the sequence listing; the GsHPPD-01 nucleotide sequence encoding the GsHPPD is shown in SEQ ID NO: 48 in the sequence listing; and the GsHPPD-02 nucleotide sequence encoding the GsHPPD obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 49 in the sequence listing.
[0177] The 372 position of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the GsHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 50 in the sequence listing. The GsHPPDm-F372A-01 nucleotide sequence encoding the GsHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 51 in the sequence listing. The GsHPPDm-F372A-02 nucleotide sequence encoding the GsHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 52 in the sequence listing.
[0178] The 383 position of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GsHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 53 in the sequence listing, the GsHPPDm-F383W-01 nucleotide sequence encoding the GsHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 54 in the sequence listing, and the GsHPPDm-F383W-02 nucleotide sequence encoding the GsHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO: 55 in the sequence listing.
[0179] The 372th position of the GsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GsHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 56 in the sequence listing. The GsHPPDm-F372A-F383W-01 nucleotide sequence encoding the GsHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 57 in the sequence listing. The GsHPPDm-F372A-F383W-02 nucleotide sequence encoding the GsHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 58 in the sequence listing.
[0180] (4) Obtaining rapeseed mutant HPPD (F372A+F383W)
[0181] The amino acid sequence of the rapeseed wild-type HPPD (BnHPPD) is shown in SEQ ID NO: 59 in the sequence listing; the BnHPPD-01 nucleotide sequence encoding the BnHPPD is shown in SEQ ID NO: 60 in the sequence listing; and the BnHPPD-02 nucleotide sequence encoding the BnHPPD obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 61 in the sequence listing.
[0182] The 372 position of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the BnHPPDm-F372A amino acid sequence, as shown in SEQ ID NO:62 in the sequence listing. The BnHPPDm-F372A-01 nucleotide sequence encoding the BnHPPDm-F372A amino acid sequence is shown in SEQ ID NO:63 in the sequence listing. The BnHPPDm-F372A-02 nucleotide sequence encoding the BnHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO:64 in the sequence listing.
[0183] The 383 position of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the BnHPPDm-F383W amino acid sequence, as shown in SEQ ID NO:65 in the sequence listing, the BnHPPDm-F383W-01 nucleotide sequence encoding the BnHPPDm-F383W amino acid sequence, as shown in SEQ ID NO:66 in the sequence listing, and the BnHPPDm-F383W-02 nucleotide sequence encoding the BnHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO:67 in the sequence listing.
[0184] The 372 position of the BnHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383 position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the BnHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO:68 in the sequence listing. The BnHPPDm-F372A-F383W-01 nucleotide sequence encoding the BnHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO:69 in the sequence listing. The BnHPPDm-F372A-F383W-02 nucleotide sequence encoding the BnHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO:70 in the sequence listing.
[0185] (5) Obtaining soybean mutant HPPD (F372A+F383W)
[0186] The amino acid sequence of soybean wild-type HPPD (GmHPPD) is shown in SEQ ID NO: 71 in the sequence listing; the GmHPPD-01 nucleotide sequence encoding the GmHPPD is shown in SEQ ID NO: 72 in the sequence listing; and the GmHPPD-02 nucleotide sequence encoding the GmHPPD obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 73 in the sequence listing.
[0187] The 372 position of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the GmHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 74 in the sequence listing. The GmHPPDm-F372A-01 nucleotide sequence encoding the GmHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 75 in the sequence listing. The GmHPPDm-F372A-02 nucleotide sequence encoding the GmHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 76 in the sequence listing.
[0188] The 383 position of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GmHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 77 in the sequence listing, the GmHPPDm-F383W-01 nucleotide sequence encoding the GmHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 78 in the sequence listing, and the GmHPPDm-F383W-02 nucleotide sequence encoding the GmHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean, as shown in SEQ ID NO: 79 in the sequence listing.
[0189] The 372th position of the GmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the GmHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 80 in the sequence listing. The GmHPPDm-F372A-F383W-01 nucleotide sequence encoding the GmHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 81 in the sequence listing. The GmHPPDm-F372A-F383W-02 nucleotide sequence encoding the GmHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 82 in the sequence listing.
[0190] (6) Obtaining tobacco mutant HPPD (F372A+F383W)
[0191] The amino acid sequence of tobacco wild-type HPPD (NtHPPD) is shown in SEQ ID NO:83 in the sequence listing; the NtHPPD-01 nucleotide sequence encoding the NtHPPD is shown in SEQ ID NO:84 in the sequence listing; and the NtHPPD-02 nucleotide sequence encoding the NtHPPD obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO:85 in the sequence listing.
[0192] The 372 position of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the NtHPPDm-F372A amino acid sequence, as shown in SEQ ID NO:86 in the sequence listing, the NtHPPDm-F372A-01 nucleotide sequence encoding the NtHPPDm-F372A amino acid sequence, as shown in SEQ ID NO:87 in the sequence listing, and the NtHPPDm-F372A-02 nucleotide sequence encoding the NtHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO:88 in the sequence listing.
[0193] The 383 position of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the NtHPPDm-F383W amino acid sequence, as shown in SEQ ID NO:89 in the sequence listing, the NtHPPDm-F383W-01 nucleotide sequence encoding the NtHPPDm-F383W amino acid sequence, as shown in SEQ ID NO:90 in the sequence listing, and the NtHPPDm-F383W-02 nucleotide sequence encoding the NtHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO:91 in the sequence listing.
[0194] The 372 position of the NtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383 position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the NtHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 92 in the sequence listing. The NtHPPDm-F372A-F383W-01 nucleotide sequence encoding the NtHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 93 in the sequence listing. The NtHPPDm-F372A-F383W-02 nucleotide sequence encoding the NtHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 94 in the sequence listing.
[0195] (7) Obtaining the rice mutant HPPD (F372A+F383W)
[0196] The amino acid sequence of the wild-type rice HPPD (OsHPPD) is shown in SEQ ID NO: 95 in the sequence listing; the nucleotide sequence of OsHPPD-01 encoding the OsHPPD is shown in SEQ ID NO: 96 in the sequence listing; and the nucleotide sequence of OsHPPD-02 encoding the OsHPPD obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 97 in the sequence listing.
[0197] The 372 position of the OsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the OsHPPDm-F372A amino acid sequence, as shown in SEQ ID NO:98 in the sequence listing. The OsHPPDm-F372A-01 nucleotide sequence encoding the OsHPPDm-F372A amino acid sequence is shown in SEQ ID NO:99 in the sequence listing. The OsHPPDm-F372A-02 nucleotide sequence encoding the OsHPPDm-F372A amino acid sequence obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO:100 in the sequence listing.
[0198] The 383rd position of the OsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the OsHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 101 in the sequence listing. The OsHPPDm-F383W-01 nucleotide sequence encoding the OsHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 102 in the sequence listing. The OsHPPDm-F383W-02 nucleotide sequence encoding the OsHPPDm-F383W amino acid sequence obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 103 in the sequence listing.
[0199] The amino acid sequence of OsHPPD was mutated from phenylalanine (F) at position 372 to alanine (A), and from phenylalanine (F) at position 383 to tryptophan (W) to obtain the amino acid sequence OsHPPDm-F372A-F383W, as shown in SEQ ID NO: 104 in the sequence listing. The nucleotide sequence OsHPPDm-F372A-F383W-01 encoding the amino acid sequence OsHPPDm-F372A-F383W is shown in SEQ ID NO: 105 in the sequence listing. The nucleotide sequence OsHPPDm-F372A-F383W-02 encoding the amino acid sequence OsHPPDm-F372A-F383W obtained based on the Arabidopsis / soybean common preferred codons is shown in SEQ ID NO: 106 in the sequence listing.
[0200] (8) Obtaining the HPPD mutant (F372A+F383W) in sorghum
[0201] The amino acid sequence of sorghum wild-type HPPD (SbHPPD) is shown in SEQ ID NO: 107 in the sequence listing; the SbHPPD-01 nucleotide sequence encoding the SbHPPD is shown in SEQ ID NO: 108 in the sequence listing; and the SbHPPD-02 nucleotide sequence encoding the SbHPPD obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 109 in the sequence listing.
[0202] The 372 position of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the SbHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 110 in the sequence listing. The SbHPPDm-F372A-01 nucleotide sequence encoding the SbHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 111 in the sequence listing. The SbHPPDm-F372A-02 nucleotide sequence encoding the SbHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 112 in the sequence listing.
[0203] The 383 position of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the SbHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 113 in the sequence listing. The SbHPPDm-F383W-01 nucleotide sequence encoding the SbHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 114 in the sequence listing. The SbHPPDm-F383W-02 nucleotide sequence encoding the SbHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 115 in the sequence listing.
[0204] The 372th position of the SbHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the SbHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 116 in the sequence listing. The SbHPPDm-F372A-F383W-01 nucleotide sequence encoding the SbHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 117 in the sequence listing. The SbHPPDm-F372A-F383W-02 nucleotide sequence encoding the SbHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 118 in the sequence listing.
[0205] (9) Obtaining barley mutant HPPD (F372A+F383W)
[0206] The amino acid sequence of the wild-type barley HPPD (HvHPPD) is shown in SEQ ID NO: 119 in the sequence listing; the HvHPPD-01 nucleotide sequence encoding the HvHPPD is shown in SEQ ID NO: 120 in the sequence listing; and the HvHPPD-02 nucleotide sequence encoding the HvHPPD obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 121 in the sequence listing.
[0207] The 372 position of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the HvHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 122 in the sequence listing. The HvHPPDm-F372A-01 nucleotide sequence encoding the HvHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 123 in the sequence listing. The HvHPPDm-F372A-02 nucleotide sequence encoding the HvHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 124 in the sequence listing.
[0208] The 383 position of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HvHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 125 in the sequence listing. The HvHPPDm-F383W-01 nucleotide sequence encoding the HvHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 126 in the sequence listing. The HvHPPDm-F383W-02 nucleotide sequence encoding the HvHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 127 in the sequence listing.
[0209] The 372th position of the HvHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HvHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 128 in the sequence listing. The HvHPPDm-F372A-F383W-01 nucleotide sequence encoding the HvHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 129 in the sequence listing. The HvHPPDm-F372A-F383W-02 nucleotide sequence encoding the HvHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 130 in the sequence listing.
[0210] (10) Obtaining the HPPD mutant (F372A+F383W) in maize
[0211] The amino acid sequence of the wild-type maize HPPD (ZmHPPD) is shown in SEQ ID NO: 131 in the sequence listing; the ZmHPPD-01 nucleotide sequence encoding the ZmHPPD is shown in SEQ ID NO: 132 in the sequence listing; and the ZmHPPD-02 nucleotide sequence encoding the ZmHPPD obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 133 in the sequence listing.
[0212] The 372 position of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the ZmHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 134 in the sequence listing. The ZmHPPDm-F372A-01 nucleotide sequence encoding the ZmHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 135 in the sequence listing. The ZmHPPDm-F372A-02 nucleotide sequence encoding the ZmHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 136 in the sequence listing.
[0213] The 383 position of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the ZmHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 137 in the sequence listing, the ZmHPPDm-F383W-01 nucleotide sequence encoding the ZmHPPDm-F383W amino acid sequence is shown in SEQ ID NO: 138 in the sequence listing, and the ZmHPPDm-F383W-02 nucleotide sequence encoding the ZmHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 139 in the sequence listing.
[0214] The 372 position of the ZmHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383 position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the ZmHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 140 in the sequence listing. The ZmHPPDm-F372A-F383W-01 nucleotide sequence encoding the ZmHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 141 in the sequence listing. The ZmHPPDm-F372A-F383W-02 nucleotide sequence encoding the ZmHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 142 in the sequence listing.
[0215] (11) Obtaining the HPPD mutant of Pseudomonas fluorescens (F372A+F383W)
[0216] The amino acid sequence of the wild-type HPPD (PfHPPD) of Pseudomonas fluorescens is shown in SEQ ID NO: 143 in the sequence listing; the PfHPPD-01 nucleotide sequence encoding the PfHPPD is shown in SEQ ID NO: 144 in the sequence listing; and the PfHPPD-02 nucleotide sequence encoding the PfHPPD obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 145 in the sequence listing.
[0217] The 372 position of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A) to obtain the PfHPPDm-F372A amino acid sequence, as shown in SEQ ID NO: 146 in the sequence listing. The PfHPPDm-F372A-01 nucleotide sequence encoding the PfHPPDm-F372A amino acid sequence is shown in SEQ ID NO: 147 in the sequence listing. The PfHPPDm-F372A-02 nucleotide sequence encoding the PfHPPDm-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 148 in the sequence listing.
[0218] The 383 position of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the PfHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 149 in the sequence listing, the PfHPPDm-F383W-01 nucleotide sequence encoding the PfHPPDm-F383W amino acid sequence, as shown in SEQ ID NO: 150 in the sequence listing, and the PfHPPDm-F383W-02 nucleotide sequence encoding the PfHPPDm-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean, as shown in SEQ ID NO: 151 in the sequence listing.
[0219] The 372th position of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the PfHPPDm-F372A-F383W amino acid sequence, as shown in SEQ ID NO: 152 in the sequence listing. The PfHPPDm-F372A-F383W-01 nucleotide sequence encoding the PfHPPDm-F372A-F383W amino acid sequence is shown in SEQ ID NO: 153 in the sequence listing. The PfHPPDm-F372A-F383W-02 nucleotide sequence encoding the PfHPPDm-F372A-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 154 in the sequence listing.
[0220] 2. Construction of Arabidopsis recombinant expression vectors containing HPPD mutations from different species (F372A+F383W combined site mutations, F372A single site mutations, or F383W single site mutations)
[0221] According to the method of constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence in the first embodiment 3, the AtHPPD-02 nucleotide sequence, AtHPPDm-F372A-02 nucleotide sequence, AtHPPDm-F383W-02 nucleotide sequence, AtHPPDm-F372A-F383W-02 nucleotide sequence, MsHPPD-02 nucleotide sequence, MsHPPDm-F372A-0 2 nucleotide sequence, MsHPPDm-F383W-02 nucleotide sequence, MsHPPDm-F372A-F383W-02 nucleotide sequence, GsHPPD-02 nucleotide sequence, GsHPPDm-F372A-02 nucleotide sequence, GsHPPDm-F383W-02 nucleotide sequence, GsHPPDm-F372A-F383W-02 nucleotide sequence, BnHPPD-02 nucleotide sequence, BnHPPDm-F372A-02 nucleotide sequence, BnHPPDm-F383 W-02 nucleotide sequence, BnHPPDm-F372A-F383W-02 nucleotide sequence, GmHPPD-02 nucleotide sequence, GmHPPDm-F372A-02 nucleotide sequence, GmHPPDm-F383W-02 nucleotide sequence, GmHPPDm-F372A-F383W-02 nucleotide sequence, NtHPPD-02 nucleotide sequence, NtHPPDm-F372A-02 nucleotide sequence, NtHPPDm-F383W-02 nucleotide sequence, NtHPPDm-F 372A-F383W-02 nucleotide sequence, OsHPPD-02 nucleotide sequence, OsHPPDm-F372A-02 nucleotide sequence, OsHPPDm-F383W-02 nucleotide sequence, OsHPPDm-F372A-F383W-02 nucleotide sequence, SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence, SbHPPDm-F372A-F383W-02 nucleotide sequence,The HvHPPD-02 nucleotide sequence, HvHPPDm-F372A-02 nucleotide sequence, HvHPPDm-F383W-02 nucleotide sequence, HvHPPDm-F372A-F383W-02 nucleotide sequence, ZmHPPD-02 nucleotide sequence, ZmHPPDm-F372A-02 nucleotide sequence, ZmHPPDm-F383W-02 nucleotide sequence, ZmHPPDm-F372A-F383W-02 nucleotide sequence, PfHPPD-02 nucleotide sequence, PfHPPDm-F372A-02 nucleotide sequence, PfHPPDm-F383W-02 nucleotide sequence and PfHPPDm-F372A-F383W-02 nucleotide sequence were respectively subjected to recombination reaction with the linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11730 to DBN11773 in sequence. Sequencing verified that the above nucleotide sequences were correctly inserted into the recombinant expression vectors DBN11730 to DBN11773.
[0222] 3. Transformation of Arabidopsis thaliana recombinant expression vector into Agrobacterium
[0223] According to the method for transforming the Arabidopsis thaliana recombinant expression vector into Agrobacterium in the above-mentioned First Example 4, the correctly constructed recombinant expression vectors DBN11730 to DBN11773 and the control recombinant expression vector DBN11726N constructed in the First Example 3 were respectively transformed into Agrobacterium GV3101 using the liquid nitrogen method. The sequencing verification results showed that the structures of the recombinant expression vectors DBN11730 to DBN11773 and DBN11726N were completely correct.
[0224] 4. Testing the herbicide tolerance effect of Arabidopsis plants transformed with HPPD mutations from different species (F372A+F383W combined site mutation, F372A single site mutation, or F383W single site mutation)
[0225] According to the method in the first embodiment 5 above, the Arabidopsis inflorescence was immersed in the Agrobacterium solution of this embodiment 3, so that the T-DNA in the recombinant expression vectors DBN11730 to DBN11773 constructed in this embodiment 2 and the control recombinant expression vector DBN11726N constructed in the first embodiment 3 were transferred into the Arabidopsis chromosome to obtain the corresponding transgenic Arabidopsis plants, namely, the Arabidopsis T1 plant (AtHPPD-02) into which the AtHPPD-02 nucleotide sequence was transferred, the Arabidopsis T1 plant (AtHPPDm-F372A-02) into which the AtHPPDm-F383W-02 nucleotide sequence was transferred, and the Arabidopsis T1 plant (AtHPPDm-F383W-02) into which the AtHPPDm-F383W-02 nucleotide sequence was transferred. The Arabidopsis thaliana T1 plants with the nucleic acid sequence (AtHPPDm-F383W-02), the Arabidopsis thaliana T1 plants with the AtHPPDm-F372A-F383W-02 nucleotide sequence (AtHPPDm-F372A-F383W-02), the Arabidopsis thaliana T1 plants with the MsHPPD-02 nucleotide sequence (MsHPPD-02), the Arabidopsis thaliana T1 plants with the MsHPPDm-F372A-02 nucleotide sequence (MsHPPDm-F372A-02), the Arabidopsis thaliana T1 plants with the MsHPPDm-F383W-02 nucleotide sequence (MsHPPDm-F383W-02), and the Arabidopsis thaliana T1 plants with the MsHPPDm-F372A-02 nucleotide sequence (MsHPPDm-F383W-02). 2A-F383W-02 nucleotide sequence (MsHPPDm-F372A-F383W-02), Arabidopsis T1 plants transformed with the GsHPPD-02 nucleotide sequence (GsHPPD-02), Arabidopsis T1 plants transformed with the GsHPPDm-F372A-02 nucleotide sequence (GsHPPDm-F372A-02), Arabidopsis T1 plants transformed with the GsHPPDm-F383W-02 nucleotide sequence (GsHPPDm-F383W-02), and Arabidopsis T1 plants transformed with the GsHPPDm-F372A-F383W-02 nucleotide sequence (GsHPPDm-F383W-02). 3W-02), Arabidopsis thaliana T1 plants transformed with the BnHPPD-02 nucleotide sequence (BnHPPD-02), Arabidopsis thaliana T1 plants transformed with the BnHPPDm-F372A-02 nucleotide sequence (BnHPPDm-F372A-02), Arabidopsis thaliana T1 plants transformed with the BnHPPDm-F383W-02 nucleotide sequence (BnHPPDm-F383W-02), Arabidopsis thaliana T1 plants transformed with the BnHPPDm-F372A-F383W-02 nucleotide sequence (BnHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants transformed with the GmHPPD-02 nucleotide sequence (GmHPPD-02),Arabidopsis thaliana T1 plants transformed with the GmHPPDm-F372A-02 nucleotide sequence (GmHPPDm-F372A-02), Arabidopsis thaliana T1 plants transformed with the GmHPPDm-F383W-02 nucleotide sequence (GmHPPDm-F383W-02), Arabidopsis thaliana T1 plants transformed with the GmHPPDm-F372A-F383W-02 nucleotide sequence (GmHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants transformed with the NtHPPD-02 nucleotide sequence (NtHPPD-02), and Arabidopsis thaliana T1 plants transformed with the NtHPPDm-F372A-02 nucleotide sequence (NtHPPDm-F372A-02). , Arabidopsis thaliana T1 plants transformed with the NtHPPDm-F383W-02 nucleotide sequence (NtHPPDm-F383W-02), Arabidopsis thaliana T1 plants transformed with the NtHPPDm-F372A-F383W-02 nucleotide sequence (NtHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants transformed with the OsHPPD-02 nucleotide sequence (OsHPPD-02), Arabidopsis thaliana T1 plants transformed with the OsHPPDm-F372A-02 nucleotide sequence (OsHPPDm-F372A-02), Arabidopsis thaliana T1 plants transformed with the OsHPPDm-F383W-02 nucleotide sequence (OsHPPDm-F383W-02) , Arabidopsis thaliana T1 plants transformed with the OsHPPDm-F372A-F383W-02 nucleotide sequence (OsHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants transformed with the SbHPPD-02 nucleotide sequence (SbHPPD-02), Arabidopsis thaliana T1 plants transformed with the SbHPPDm-F372A-02 nucleotide sequence (SbHPPDm-F372A-02), Arabidopsis thaliana T1 plants transformed with the SbHPPDm-F383W-02 nucleotide sequence (SbHPPDm-F383W-02), Arabidopsis thaliana T1 plants transformed with the SbHPPDm-F372A-F383W-02 nucleotide sequence (SbHPPDm-F3 72A-F383W-02), Arabidopsis thaliana T1 plants transformed with the HvHPPD-02 nucleotide sequence (HvHPPD-02), Arabidopsis thaliana T1 plants transformed with the HvHPPDm-F372A-02 nucleotide sequence (HvHPPDm-F372A-02), Arabidopsis thaliana T1 plants transformed with the HvHPPDm-F383W-02 nucleotide sequence (HvHPPDm-F383W-02), Arabidopsis thaliana T1 plants transformed with the HvHPPDm-F372A-F383W-02 nucleotide sequence (HvHPPDm-F372A-F383W-02), Arabidopsis thaliana T1 plants transformed with the ZmHPPD-02 nucleotide sequence (ZmHPPD-02),The T1 plants of Arabidopsis thaliana transformed with the nucleotide sequence of ZmHPPDm-F372A-02 (ZmHPPDm-F372A-02), the T1 plants of Arabidopsis thaliana transformed with the nucleotide sequence of ZmHPPDm-F383W-02 (ZmHPPDm-F383W-02), the T1 plants of Arabidopsis thaliana transformed with the nucleotide sequence of ZmHPPDm-F372A-F383W-02 (ZmHPPDm-F372A-F383W-02), the T1 plants of Arabidopsis thaliana transformed with the nucleotide sequence of PfHPPD-02 (PfHPPD-02), the T1 plants of Arabidopsis thaliana transformed with the nucleotide sequence of ZmHPPDm-F372A-02 (ZmHPPDm ... ZmHPPDm-F372A-02 (ZmHPPDm- T1 plants of Arabidopsis thaliana transformed with the nucleotide sequence of PfHPPDm-F372A-02 (PfHPPDm-F372A-02), T1 plants of Arabidopsis thaliana transformed with the nucleotide sequence of PfHPPDm-F383W-02 (PfHPPDm-F383W-02), T1 plants of Arabidopsis thaliana transformed with the nucleotide sequence of PfHPPDm-F372A-F383W-02 (PfHPPDm-F372A-F383W-02), and T1 plants of Arabidopsis thaliana transformed with the control recombinant expression vector DBN11726N (DBN11726N).
[0226] According to the method in the first example 6 above, the above-mentioned Arabidopsis T1 plants and wild-type Arabidopsis plants (CK) (18 days after sowing) were sprayed with three concentrations of pyraclostrobin (25 g ai / ha (1 times the field concentration, 1×), 100 g ai / ha (4 times the field concentration, 4×) and 0 g ai / ha (water, 0×)), three concentrations of isoxaflutole (35 g ai / ha (0.5 times the field concentration, 0.5×), 70 g ai / ha (1 times the field concentration, 1×) and 0 g ai / ha (water, 0×)) and three concentrations of mesotrione (52.5 g ai / ha (0.5 times the field concentration, 0.5×), 105 g ai / ha (1 times the field concentration, 1×) and 0 g ai / ha (water, 0×)) to detect the herbicide tolerance of Arabidopsis. The experimental results are shown in Tables 4 to 6.
[0227] Table 4. Results of the tolerance test of Arabidopsis thaliana T1 plants transformed with HPPD mutants from different species to benzylpyraclostrobin
[0228]
[0229]
[0230]
[0231]
[0232] The results in Table 4 showed that: (1) compared with Arabidopsis plants with unmutated HPPD genes, Arabidopsis plants with HPPD genes with combined mutations at sites 372 and 383 (F372A+F383W) from different species and with HPPD genes with single point mutations at site 372 (F372A) from different species showed varying degrees of tolerance to benzopyrene. Only HPPD genes with single point mutations at site 383 (F383W) from some species (sorghum, barley and corn) could confer tolerance to benzopyrene in Arabidopsis plants, while CK plants and control vector DBN11726N plants had no tolerance to benzopyrene.
[0233] (2) From the perspective of resistance evaluation, for benzylpyraclostrobin, the herbicide tolerance of Arabidopsis plants that have been transformed with the HPPD gene with a combined mutation at sites 372 and 383 (F372A+F383W) from different species (except alfalfa) is not only better than that of Arabidopsis plants that have been transformed with the HPPD gene with single-site mutations F372A or F383W, but also further shows a synergistic herbicide tolerance effect.
[0234] (3) From the perspective of the scores, the tolerance scores of Arabidopsis plants that had been transferred with the HPPD gene with the combined mutations at sites 372 and 383 (F372A+F383W) derived from alfalfa were lower than those with the single-point mutations F372A or F383W. Furthermore, for 4 times the field concentration of fenpyraclostrobin, about 50% of the Arabidopsis plants that had been transferred with the HPPD gene with the combined mutations at sites 372 and 383 derived from alfalfa had damage levels of 0 and 1, 25% of the Arabidopsis plants that had been transferred with the HPPD gene with the single-point mutation at site 372 derived from alfalfa had damage levels of 0 and 1, and all the Arabidopsis plants that had been transferred with the HPPD gene with the single-point mutation at site 383 derived from alfalfa had damage levels of 0 and 1. This suggests that the HPPD gene derived from the combined mutation of sites 372 and 383 (F372A+F383W) of alfalfa can confer synergistic herbicide tolerance to Arabidopsis plants.
[0235] Table 5. Results of the tolerance experiment to isoxathiapiprolin in Arabidopsis thaliana T1 plants transformed with HPPD mutants from different species
[0236]
[0237]
[0238]
[0239] The results in Table 5 showed that: (1) compared with Arabidopsis plants with unmutated HPPD genes, Arabidopsis plants with HPPD genes with combined mutations at sites 372 and 383 (F372A+F383W) from different species and with HPPD genes with single point mutations at site 372 (F372A) from different species showed varying degrees of tolerance to isoxathiapiprolin. Only HPPD genes with single point mutations at site 383 (F383W) from some species (sorghum, barley and corn) could confer tolerance to isoxathiapiprolin in Arabidopsis plants, while CK plants and control vector DBN11726N plants had no tolerance to isoxathiapiprolin.
[0240] (2) From the perspective of resistance evaluation, for isoxazolidinone, the herbicide tolerance of Arabidopsis plants that have been introduced with the HPPD gene with combined mutations at sites 372 and 383 (F372A+F383W) from different species (except corn) is not only better than that of Arabidopsis plants that have been introduced with the HPPD gene with single-site mutations F372A or F383W, but also further shows a synergistic herbicide tolerance effect.
[0241] (3) From the perspective of the score, the tolerance score of the Arabidopsis plants that were transferred with the HPPD gene with the combined mutations at sites 372 and 383 of maize was lower than that of the single-site mutations F372A or F383W. Furthermore, for 1 times the field concentration of isoxazolidinone, about 69% of the Arabidopsis plants that were transferred with the HPPD gene with the combined mutations at sites 372 and 383 of maize had damage levels of 0 and 1, 6% of the Arabidopsis plants that were transferred with the HPPD gene with the single-site mutation at site 372 of maize had damage levels of 0 and 1, and 0% of the Arabidopsis plants that were transferred with the HPPD gene with the single-site mutation at site 383 of maize had damage levels of 0 and 1. This indicates that the HPPD gene with the combined mutations at sites 372 and 383 of maize (F372A+F383W) can confer synergistic herbicide tolerance on Arabidopsis plants.
[0242] Table 6. Results of the tolerance experiment to mesotrione in Arabidopsis T1 plants transformed with HPPD mutants from different species
[0243]
[0244]
[0245]
[0246]
[0247] The results in Table 6 showed that: (1) compared with Arabidopsis plants with unmutated HPPD genes, Arabidopsis plants with HPPD genes with combined mutations at sites 372 and 383 (F372A+F383W) from different species or with HPPD genes with single point mutations at site 372 (F372A) from different species all showed varying degrees of tolerance to mesotrione. Only HPPD genes with single point mutations at site 383 (F383W) from some species (barley and corn) could confer tolerance to mesotrione in Arabidopsis plants, while CK plants and control vector DBN11726N plants had no tolerance to mesotrione.
[0248] (2) From the perspective of resistance evaluation, for mesotrione, the herbicide tolerance of Arabidopsis plants that have been introduced with the HPPD gene with a combined mutation at sites 372 and 383 (F372A+F383W) from different species (except tobacco) is not only better than that of Arabidopsis plants that have been introduced with the HPPD gene with single-site mutations F372A or F383W, but also further shows a synergistic herbicide tolerance effect.
[0249] (3) From the perspective of scores, the tolerance scores of Arabidopsis plants with the HPPD gene transformed with the combined mutations at sites 372 and 383 (F372A+F383W) derived from tobacco were lower than those with the single-site mutations F372A or F383W for 0.5 times and 1 times the field concentration of mesotrione, and further showed a synergistic herbicide tolerance effect.
[0250] In summary, the results in Tables 4 to 6 indicate that HPPD genes with combined mutations at sites 372 and 383 (F372A+F383W) from different species can confer synergistic herbicide tolerance to plants.
[0251] Example 3: Different mutations (F372G+F383W combination mutation or F372V+F383W combination mutation) were performed on the 372 and 383 sites of the HPPD amino acid sequence and their mutation effects were verified.
[0252] 1. Obtain AsHPPDm-F372G-F383W and AsHPPDm-F372V-F383W genes
[0253] (1) The 372 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to glycine (G) to obtain the AsHPPDm-F372G amino acid sequence, as shown in SEQ ID NO: 155 in the sequence listing, the AsHPPDm-F372G-01 nucleotide sequence encoding the AsHPPDm-F372G amino acid sequence, as shown in SEQ ID NO: 156 in the sequence listing, and the AsHPPDm-F372G-02 nucleotide sequence encoding the AsHPPDm-F372G amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean, as shown in SEQ ID NO: 157 in the sequence listing.
[0254] The 372th position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to glycine (G), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372G-F383W amino acid sequence, as shown in SEQ ID NO: 158 in the sequence listing. The AsHPPDm-F372G-F383W-01 nucleotide sequence encoding the AsHPPDm-F372G-F383W amino acid sequence is shown in SEQ ID NO: 159 in the sequence listing. The AsHPPDm-F372G-F383W-02 nucleotide sequence encoding the AsHPPDm-F372G-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 160 in the sequence listing.
[0255] (2) The 372 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to valine (V) to obtain the AsHPPDm-F372V amino acid sequence, as shown in SEQ ID NO: 161 in the sequence listing, the AsHPPDm-F372V-01 nucleotide sequence encoding the AsHPPDm-F372V amino acid sequence, as shown in SEQ ID NO: 162 in the sequence listing, and the AsHPPDm-F372V-02 nucleotide sequence encoding the AsHPPDm-F372V amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO: 163 in the sequence listing.
[0256] The 372 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to valine (V), and the 383 position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372V-F383W amino acid sequence, as shown in SEQ ID NO: 164 in the sequence listing. The AsHPPDm-F372V-F383W-01 nucleotide sequence encoding the AsHPPDm-F372V-F383W amino acid sequence is shown in SEQ ID NO: 165 in the sequence listing. The AsHPPDm-F372V-F383W-02 nucleotide sequence encoding the AsHPPDm-F372V-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 166 in the sequence listing.
[0257] 2. Construction of Arabidopsis thaliana recombinant expression vector containing oat HPPD gene (F372G+F383W or F372V+F383W)
[0258] Following the method for constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence described in Example 3, the AsHPPDm-F372G-02 nucleotide sequence, the AsHPPDm-F372G-F383W-02 nucleotide sequence, the AsHPPDm-F372V-02 nucleotide sequence, and the AsHPPDm-F372V-F383W-02 nucleotide sequence linked to the universal adapter primer 1 were respectively subjected to recombination reactions with the linearized DBNBC-01 expression vector backbone, thereby obtaining recombinant expression vectors DBN11774 to DBN11777. Sequencing verified the correct insertion of the nucleotide sequences in the recombinant expression vectors DBN11774 to DBN11777.
[0259] 3. Transformation of Arabidopsis thaliana recombinant expression vector into Agrobacterium
[0260] According to the method for transforming the Arabidopsis recombinant expression vector into Agrobacterium in the above-mentioned First Example 4, the correctly constructed recombinant expression vectors DBN11774 to DBN11777, the recombinant expression vector DBN11727 containing the AsHPPD-02 nucleotide sequence in the First Example 3, the recombinant expression vector DBN11729 containing the AsHPPDm-F383W-02 nucleotide sequence in the First Example 3, and the control recombinant expression vector DBN11726N constructed in the First Example 3 were respectively transformed into Agrobacterium GV3101 using the liquid nitrogen method. The sequencing verification results showed that the structures of the recombinant expression vectors DBN11774 to DBN11777 and DBN11727, DBN11729 and DBN11726N were completely correct.
[0261] 4. Testing the herbicide tolerance effect of transgenic Arabidopsis plants incorporating the AsHPPDm-F372G-F383W-02 or AsHPPDm-F372V-F383W-02 nucleotide sequences
[0262] According to the method in the first embodiment 5 above, the Arabidopsis inflorescence was immersed in the Agrobacterium solution of this embodiment 3, so that the T-DNAs of the recombinant expression vectors DBN11774 to DBN11777 constructed in this embodiment 2, the recombinant expression vector DBN11727 containing the AsHPPD-02 nucleotide sequence in the first embodiment 3, the recombinant expression vector DBN11729 containing the AsHPPDm-F383W-02 nucleotide sequence in the first embodiment 3, and the control recombinant expression vector DBN11726N constructed in the first embodiment 3 were transferred into the Arabidopsis chromosome to obtain the corresponding transgenic Arabidopsis plants, i.e., Arabidopsis T1 plants (AsHPPDm-F372G-02 plants) transferred with the AsHPPDm-F372G-02 nucleotide sequence. 72G-02), Arabidopsis thaliana T1 plants transformed with the AsHPPDm-F372G-F383W-02 nucleotide sequence (AsHPPDm-F372G-F383W-02), Arabidopsis thaliana T1 plants transformed with the AsHPPDm-F372V-02 nucleotide sequence (AsHPPDm-F372V-02), Arabidopsis thaliana T1 plants transformed with the AsHPPDm-F372V-F383W-02 nucleotide sequence (AsHPPDm-F372V-F383W-02), Arabidopsis thaliana T1 plants transformed with the AsHPPD-02 nucleotide sequence, Arabidopsis thaliana T1 plants transformed with the AsHPPDm-F383W-02 nucleotide sequence, and Arabidopsis thaliana T1 plants transformed with the control recombinant expression vector DBN11726N.
[0263] 5. Verify the synergistic effect of F372G+F383W or F372V+F383W
[0264] According to the method of the first embodiment 6, the Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were sprayed with three concentrations of pyraclostrobin (100 g ai / ha (4 times the field concentration, 4×), 200 g ai / ha (8 times the field concentration, 8×), and 0 g ai / ha (water, 0×)), three concentrations of isoxaflutole (140 g ai / ha (2 times the field concentration, 2×), 280 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)), and three concentrations of mesotrione (210 g ai / ha (2 times the field concentration, 2×), 420 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)) to test the herbicide tolerance of Arabidopsis thaliana. The experimental results are shown in Tables 7 to 9.
[0265] Table 7. Results of the tolerance test of transgenic Arabidopsis thaliana T1 plants to benzylpyraclostrobin
[0266]
[0267]
[0268] The results in Table 7 show that compared with CK, AsHPPDm-F372G-02, AsHPPDm-F383W-02, AsHPPDm-F372G-F383W-02, AsHPPDm-F372V-02 and AsHPPDm-F372V-F383W-02 all showed high tolerance to 4 times or 8 times the field concentration of benzopyrene, while AsHPPD-02 and the control vector DBN11726N plants had no tolerance to benzopyrene.
[0269] Table 8. Results of the tolerance experiment of transgenic Arabidopsis thaliana T1 plants to isoxathiapiprolin
[0270]
[0271] Table 9. Results of the tolerance experiment of transgenic Arabidopsis thaliana T1 plants to mesotrione
[0272]
[0273] The results in Tables 8 and 9 show that: (1) compared with CK, the Arabidopsis plants transformed with the HPPD gene with a combined mutation of sites 372 and 383 (F372G+F383W or F372V+F383W) derived from oats, the HPPD gene with a single point mutation (F372G or F372V) derived from oats at 372, and the HPPD gene with a single point mutation (F383W) derived from oats at 383 all had varying degrees of tolerance to isoxathiapiprolin and mesotrione, while the Arabidopsis plants transformed with the unmutated HPPD gene and the plants transformed with the control vector DBN11726N had no tolerance to isoxathiapiprolin and mesotrione.
[0274] (2) From the perspective of resistance evaluation, for isoxaflutole or mesotrione at 2 times the field concentration, the herbicide tolerance (high resistance) of Arabidopsis plants with HPPD genes with combined mutations at sites 372 and 383 (F372G+F383W or F372V+F383W) from oats was better than that of Arabidopsis plants with HPPD genes with single site mutations at sites 372 (moderate resistance) or sites 383 (moderate resistance); for 4 times the field concentration, the herbicide tolerance was better than that of Arabidopsis plants with HPPD genes with single site mutations at sites 372 (moderate resistance). The herbicide tolerance (high resistance) of Arabidopsis thaliana plants with the HPPD gene transferred with the combined mutations of sites 372 and 383 (F372G+F383W or F372V+F383W) from oats was not only better than that of Arabidopsis thaliana plants with the HPPD gene transferred with the single point mutation of 372 (low resistance) or the single point mutation of 383 (low resistance), but also further showed a synergistic herbicide tolerance effect.
[0275] Tables 8 and 9 above fully demonstrate that different forms of mutations (F372G+F383W combined mutation or F372V+F383W combined mutation) at positions 372 and 383 of the wild-type HPPD amino acid sequence also have synergistic effects on HPPD inhibitor herbicide tolerance.
[0276] Example 4: Combined mutations at positions 372 and 383 of the HPPD amino acid sequence and further combinations with other mutation sites and their effects
[0277] 1. Obtain multi-site combination mutation sequences
[0278] (1) Obtaining the amino acid sequence of HPPDm-1 (AsHPPDm-A107-F372A-F383W amino acid sequence)
[0279] The 107th position of the AsHPPD amino acid sequence was deleted and mutated from the original alanine (A), and the 372th position was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-A107-F372A amino acid sequence, as shown in SEQ ID NO: 167 in the sequence listing. The AsHPPDm-A107-F372A-01 nucleotide sequence encoding the AsHPPDm-A107-F372A amino acid sequence is shown in SEQ ID NO: 168 in the sequence listing. The AsHPPDm-A107-F372A-02 nucleotide sequence encoding the AsHPPDm-A107-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 169 in the sequence listing.
[0280] The 107th position of the AsHPPD amino acid sequence was deleted and mutated from the original alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-A107-F383W amino acid sequence, as shown in SEQ ID NO: 170 in the sequence listing. The AsHPPDm-A107-F383W-01 nucleotide sequence encoding the AsHPPDm-A107-F383W amino acid sequence is shown in SEQ ID NO: 171 in the sequence listing. The AsHPPDm-A107-F383W-02 nucleotide sequence encoding the AsHPPDm-A107-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 172 in the sequence listing.
[0281] The 107th position of the AsHPPD amino acid sequence was deleted and mutated from the original alanine (A), the 372th position was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-1 amino acid sequence (AsHPPDm-A107-F372A-F383W amino acid sequence), as shown in SEQ ID NO: 173 in the sequence listing. The HPPDm-1-01 nucleotide sequence encoding the HPPDm-1 amino acid sequence is shown in SEQ ID NO: 174 in the sequence listing. The HPPDm-1-02 nucleotide sequence encoding the HPPDm-1 amino acid sequence obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 175 in the sequence listing.
[0282] (2) Obtaining the amino acid sequence of HPPDm-2 (AsHPPDm-A111T-F372A-F383W amino acid sequence)
[0283] The 111th position of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), and the 372th position was mutated from the original phenylalanine (F) to alanine (A) to obtain the AsHPPDm-A111T-F372A amino acid sequence, as shown in SEQ ID NO: 176 in the sequence listing. The AsHPPDm-A111T-F372A-01 nucleotide sequence encoding the AsHPPDm-A111T-F372A amino acid sequence is shown in SEQ ID NO: 177 in the sequence listing. The AsHPPDm-A111T-F372A-02 nucleotide sequence encoding the AsHPPDm-A111T-F372A amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 178 in the sequence listing.
[0284] The 111th position of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-A111T-F383W amino acid sequence, as shown in SEQ ID NO: 179 in the sequence listing. The AsHPPDm-A111T-F383W-01 nucleotide sequence encoding the AsHPPDm-A111T-F383W amino acid sequence is shown in SEQ ID NO: 180 in the sequence listing. The AsHPPDm-A111T-F383W-02 nucleotide sequence encoding the AsHPPDm-A111T-F383W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 181 in the sequence listing.
[0285] The 111th position of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), the 372th position was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-2 amino acid sequence (AsHPPDm-A111T-F372A-F383W amino acid sequence), as shown in SEQ ID NO: 182 in the sequence listing. The HPPDm-2-01 nucleotide sequence encoding the HPPDm-2 amino acid sequence is shown in SEQ ID NO: 183 in the sequence listing. The HPPDm-2-02 nucleotide sequence encoding the HPPDm-2 amino acid sequence obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 184 in the sequence listing.
[0286] (3) Obtaining the amino acid sequence of HPPDm-3 (AsHPPDm-A106G-F372A-F383W amino acid sequence)
[0287] The 106th position of the AsHPPD amino acid sequence was mutated from the original alanine (A) to glycine (G), the 372th position was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-3 amino acid sequence (AsHPPDm-A106G-F372A-F383W amino acid sequence), as shown in SEQ ID NO: 185 in the sequence listing. The HPPDm-3-01 nucleotide sequence encoding the HPPDm-3 amino acid sequence is shown in SEQ ID NO: 186 in the sequence listing. The HPPDm-3-02 nucleotide sequence encoding the HPPDm-3 amino acid sequence obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 187 in the sequence listing.
[0288] (4) Obtaining the amino acid sequence of HPPDm-4 (AsHPPDm-A107-K351N-F372A-F383W amino acid sequence)
[0289] The 107th position of the AsHPPD amino acid sequence was deleted and mutated from the original alanine (A), the 351th position was mutated from the original lysine (K) to asparagine (N), the 372th position was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-4 amino acid sequence (AsHPPDm-A107-K351N-F372A-F383W amino acid sequence), as shown in SEQ ID NO: 188 in the sequence listing. The HPPDm-4-01 nucleotide sequence encoding the HPPDm-4 amino acid sequence is shown in SEQ ID NO: 189 in the sequence listing. The HPPDm-4-02 nucleotide sequence encoding the HPPDm-4 amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 190 in the sequence listing.
[0290] (5) Obtaining the amino acid sequence of HPPDm-5 (AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence)
[0291] The 111th position of the AsHPPD amino acid sequence was mutated from the original alanine (A) to threonine (T), the 351th position was mutated from the original lysine (K) to asparagine (N), the 372th position was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-5 amino acid sequence (AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence), as shown in SEQ ID NO: 191 in the sequence listing. The HPPDm-5-01 nucleotide sequence encoding the HPPDm-5 amino acid sequence is shown in SEQ ID NO: 192 in the sequence listing. The HPPDm-5-02 nucleotide sequence encoding the HPPDm-5 amino acid sequence obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 193 in the sequence listing.
[0292] (6) Obtaining the amino acid sequence of HPPDm-6 (AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence)
[0293] The 106th position of the AsHPPD amino acid sequence was mutated from the original alanine (A) to glycine (G), the 351th position was mutated from the original lysine (K) to asparagine (N), the 372th position was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the HPPDm-6 amino acid sequence (AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence), as shown in SEQ ID NO: 194 in the sequence listing. The HPPDm-6-01 nucleotide sequence encoding the HPPDm-6 amino acid sequence is shown in SEQ ID NO: 195 in the sequence listing. The HPPDm-6-02 nucleotide sequence encoding the HPPDm-6 amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 196 in the sequence listing.
[0294] (7) Obtaining the amino acid sequence of HPPDm-7
[0295] The amino acid sequence of HPPDm-7 is obtained by mutating the C-terminal amino acid of the oat-derived HPPD amino acid sequence based on the AsHPPDm-A107-K351N-F372A-F383W amino acid sequence. The amino acid sequence of HPPDm-7 is shown in SEQ ID NO: 197 in the sequence listing. The HPPDm-7-01 nucleotide sequence encoding the HPPDm-7 amino acid sequence is shown in SEQ ID NO: 198 in the sequence listing. The HPPDm-7-02 nucleotide sequence encoding the HPPDm-7 amino acid sequence is obtained based on the common Arabidopsis / soybean preferred codons, as shown in SEQ ID NO: 199 in the sequence listing.
[0296] (8) Obtaining the amino acid sequence of HPPDm-8
[0297] The amino acid sequence of HPPDm-8 is obtained by mutating the C-terminal amino acid of the oat-derived HPPD amino acid sequence based on the AsHPPDm-A111T-K351N-F372A-F383W amino acid sequence. The amino acid sequence of HPPDm-8 is shown in SEQ ID NO: 200 in the sequence listing. The HPPDm-8-01 nucleotide sequence encoding the HPPDm-8 amino acid sequence is shown in SEQ ID NO: 201 in the sequence listing. The HPPDm-8-02 nucleotide sequence encoding the HPPDm-8 amino acid sequence is obtained based on the common Arabidopsis / soybean preferred codons, as shown in SEQ ID NO: 202 in the sequence listing.
[0298] (9) Obtaining the amino acid sequence of HPPDm-9
[0299] The amino acid sequence of HPPDm-9 is obtained by mutating the C-terminal amino acid of the oat-derived HPPD amino acid sequence based on the AsHPPDm-A106G-K351N-F372A-F383W amino acid sequence. The amino acid sequence of HPPDm-9 is shown in SEQ ID NO: 203 in the sequence listing. The HPPDm-9-01 nucleotide sequence encoding the HPPDm-9 amino acid sequence is shown in SEQ ID NO: 204 in the sequence listing. The HPPDm-9-02 nucleotide sequence encoding the HPPDm-9 amino acid sequence is obtained based on the common Arabidopsis / soybean preferred codons, as shown in SEQ ID NO: 205 in the sequence listing.
[0300] 2. Construction of an Arabidopsis recombinant expression vector containing multi-site combined mutations of HPPD
[0301] According to the method of constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence in the first embodiment 3, the AsHPPDm-A107-F372A-02 nucleotide sequence, AsHPPDm-A107-F383W-02 nucleotide sequence, HPPDm-1-02 nucleotide sequence, AsHPPDm-A111T-F372A-02 nucleotide sequence, AsHPPDm-A111T-F383W-02 nucleotide sequence, and HPPDm-1-02 nucleotide sequence connected to the universal linker primer 1 were added. The HPPDm-02 nucleotide sequence, HPPDm-2-02 nucleotide sequence, HPPDm-3-02 nucleotide sequence, HPPDm-4-02 nucleotide sequence, HPPDm-5-02 nucleotide sequence, HPPDm-6-02 nucleotide sequence, HPPDm-7-02 nucleotide sequence, HPPDm-8-02 nucleotide sequence, and HPPDm-9-02 nucleotide sequence were respectively subjected to recombination reactions with the linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11778 to DBN11790, respectively. Sequencing verified that the above nucleotide sequences were correctly inserted into the recombinant expression vectors DBN11778 to DBN11790.
[0302] 3. Transformation of Arabidopsis thaliana recombinant expression vector into Agrobacterium
[0303] According to the method for transforming the recombinant expression vector of Arabidopsis thaliana into Agrobacterium in the first embodiment 4, the correctly constructed recombinant expression vectors DBN11778 to DBN11790, the recombinant expression vector DBN11727 containing the AsHPPD-02 nucleotide sequence in the first embodiment 3, and the control expression vector DBN11726N in the first embodiment 3 were transformed into Agrobacterium GV3101 using the liquid nitrogen method, respectively. Sequencing verification results showed that the structures of the recombinant expression vectors DBN11778 to DBN11790, DBN11727, and DBN11726N were completely correct.
[0304] 4. Detection of herbicide tolerance in Arabidopsis plants with multi-site HPPD mutations
[0305] According to the method in the first embodiment 5 above, the Arabidopsis inflorescence was immersed in the Agrobacterium solution of this embodiment 3, so that the recombinant expression vectors DBN11778 to DBN11790 constructed in this embodiment 2, the recombinant expression vector DBN11727 containing the AsHPPD-02 nucleotide sequence in the first embodiment 3, and the T-DNA in the control expression vector DBN11726N in the first embodiment 3 were transferred into the Arabidopsis chromosome to obtain the corresponding transgenic Arabidopsis plants, i.e., Arabidopsis T1 plants transferred with the AsHPPDm-A107-F372A-02 nucleotide sequence. (AsHPPDm-A107-F372A-02), Arabidopsis thaliana T1 plants transformed with the AsHPPDm-A107-F383W-02 nucleotide sequence (AsHPPDm-A107-F383W-02), Arabidopsis thaliana T1 plants transformed with the HPPDm-1-02 nucleotide sequence (HPPDm-1-02), Arabidopsis thaliana T1 plants transformed with the AsHPPDm-A111T-F372A-02 nucleotide sequence (AsHPPDm-A111T-F372A-02), and Arabidopsis thaliana T1 plants transformed with the AsHPPDm-A111T-F383W-02 nucleotide sequence (AsHPPDm-A107-F383W-02). -02 nucleotide sequence (AsHPPDm-A111T-F383W-02), Arabidopsis thaliana T1 plant into which the HPPDm-2-02 nucleotide sequence was introduced (HPPDm-2-02), Arabidopsis thaliana T1 plant into which the HPPDm-3-02 nucleotide sequence was introduced (HPPDm-3-02), Arabidopsis thaliana T1 plant into which the HPPDm-4-02 nucleotide sequence was introduced (HPPDm-4-02), Arabidopsis thaliana T1 plant into which the HPPDm-5-02 nucleotide sequence was introduced (HPPDm-5-02), and Arabidopsis thaliana T1 plant into which the HPPDm-6-0 2 nucleotide sequence (HPPDm-6-02), Arabidopsis thaliana T1 plants introduced with the HPPDm-7-02 nucleotide sequence (HPPDm-7-02), Arabidopsis thaliana T1 plants introduced with the HPPDm-8-02 nucleotide sequence (HPPDm-8-02), Arabidopsis thaliana T1 plants introduced with the HPPDm-9-02 nucleotide sequence (HPPDm-9-02), Arabidopsis thaliana T1 plants introduced with the AsHPPD-02 nucleotide sequence (AsHPPD-02), and Arabidopsis thaliana T1 plants introduced with the control expression vector (DBN11726N).
[0306] According to the method of the first example 6, the Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (CK) (18 days after sowing) were sprayed with three concentrations of pyraclostrobin (100 g ai / ha (4 times the field concentration, 4×), 200 g ai / ha (8 times the field concentration, 8×), and 0 g ai / ha (water, 0×)), three concentrations of isoxaflutole (140 g ai / ha (2 times the field concentration, 2×), 280 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)), and three concentrations of mesotrione (210 g ai / ha (2 times the field concentration, 2×), 420 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)) to test the herbicide tolerance of Arabidopsis thaliana. The experimental results are shown in Tables 10 to 12.
[0307] Table 10. Results of the tolerance test of Arabidopsis thaliana T1 plants transformed with multi-site combined mutation HPPD genes to benzylpyraclostrobin
[0308]
[0309] The results in Table 10 show that compared with CK and Arabidopsis plants transformed with the unmutated HPPD gene, for 4 times or 8 times the field concentration of pyraclostrobin, the combined mutations at sites 372 and 383 combined with other mutation sites (including A107 deletion, A111T, A106G, A107+K351N, A111T+K351N, A106G+K351N, A107+K351N+C-terminal mutation site, A111T+K351N+C-terminal mutation site) showed a significant difference in the HPPD gene expression between the CK and the transformed Arabidopsis plants. The results of a study in which the HPPD gene (mutated at positions 372 and 383 or A106G+K351N+C-terminal mutations) conferred high tolerance to fenpyrazone in plants. This indicates that the combined mutations at positions 372 and 383 of the HPPD amino acid sequence, combined with other mutations, do not affect the tolerance to fenpyrazone induced by the combined mutations at positions 372 and 383 alone. This also demonstrates the importance and stability of combined mutations at positions 372 and 383 in conferring tolerance to HPPD inhibitor herbicides. However, Arabidopsis T1 plants transformed with the control recombinant expression vector DBN11726N showed no tolerance to fenpyrazone.
[0310] Table 11. Results of the tolerance experiment on isoxathiapiprolin in Arabidopsis thaliana T1 plants transformed with multi-site combined mutation HPPD genes
[0311]
[0312]
[0313] Table 12. Results of the tolerance test of Arabidopsis thaliana T1 plants transformed with multi-site combined HPPD mutations to mesotrione
[0314]
[0315]
[0316] The results in Tables 11 and 12 show that: (1) compared with CK and Arabidopsis plants transformed with the unmutated HPPD gene, HPPD genes with combined mutations at sites 372 and 383 combined with other mutation sites (including A107 deletion, A111T, A106G, A107+K351N, A111T+K351N, A106G+K351N, A107+K351N+C-terminal mutation site, A111T+K351N+C-terminal mutation site or A106G+K351N+C-terminal mutation site) can confer high tolerance to isoxathiapiprolin and mesotrione at 2 times or 4 times the field concentration of isoxathiapiprolin and mesotrione; while Arabidopsis T1 plants transformed with the control recombinant expression vector DBN11726N have no tolerance to isoxathiapiprolin and mesotrione.
[0317] (2) From the perspective of resistance evaluation, the herbicide tolerance (high resistance) of Arabidopsis plants transformed with the HPPDm-1-02 (AsHPPDm-A107-F372A-F383W-02) gene was not only better than that of Arabidopsis plants transformed with the AsHPPDm-A107-F372A-02 gene (low resistance) or the AsHPPDm-A107-F383W-02 gene (low resistance), but also showed a synergistic herbicide tolerance effect. Similarly, the herbicide tolerance of Arabidopsis plants transformed with the HPPDm-2-02 (AsHPPDm-A111T-F372A-F383W) gene was better than that of Arabidopsis plants transformed with the AsHPPDm-A107-F372A-F383W-02 gene (low resistance). The results not only showed superior herbicide tolerance to Arabidopsis plants harboring the AsHPPDm-A111T-F372A-02 gene (low resistance) or the AsHPPDm-A111T-F383W-02 gene (low resistance), but also demonstrated synergistic herbicide tolerance. Therefore, the HPPD amino acid sequence 372+383 combined mutation combined with other mutations did not affect the synergistic herbicide tolerance of the 372+383 combined mutation alone against HPPD inhibitor herbicides, further demonstrating the importance and stability of the HPPD amino acid sequence 372+383 combined mutation in conferring plant tolerance to HPPD inhibitor herbicides.
[0318] (3) From the perspective of resistance scores, the resistance scores (0 points) of Arabidopsis T1 plants transformed with the nucleotide sequences HPPDm-7-02 to HPPDm-9-02 were better than those of Arabidopsis T1 plants transformed with the nucleotide sequences HPPDm-1-02 to HPPDm-6-02 to 4 times the field concentration of isoxazolidinone, indicating that optimizing the C-terminus of the HPPD amino acid sequence will be beneficial to improving the plant's tolerance to isoxazolidinone.
[0319] Example 5: Mutation of the HPPD amino acid sequence in a non-F372A (F372G / F372V) + F383W combination and verification of the mutation effect
[0320] 1. Obtain mutant genes with a non-F372A (F372G / F372V) + F383W combination derived from the HPPD amino acid sequences of oats and Arabidopsis
[0321] (1) F372A+F415W combined mutant gene of HPPD from oats
[0322] The 415 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F415W amino acid sequence, as shown in SEQ ID NO: 206 in the sequence listing, the AsHPPDm-F415W-01 nucleotide sequence encoding the AsHPPDm-F415W amino acid sequence, as shown in SEQ ID NO: 207 in the sequence listing, and the AsHPPDm-F415W-02 nucleotide sequence encoding the AsHPPDm-F415W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO: 208 in the sequence listing.
[0323] The 372 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 415 position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AsHPPDm-F372A-F415W amino acid sequence, as shown in SEQ ID NO: 209 in the sequence listing. The AsHPPDm-F372A-F415W-01 nucleotide sequence encoding the AsHPPDm-F372A-F415W amino acid sequence is shown in SEQ ID NO: 210 in the sequence listing. The AsHPPDm-F372A-F415W-02 nucleotide sequence encoding the AsHPPDm-F372A-F415W amino acid sequence obtained based on the common Arabidopsis / soybean preferred codons is shown in SEQ ID NO: 211 in the sequence listing.
[0324] (2) F372A+F415W combined mutant gene of HPPD from Arabidopsis
[0325] The amino acid at position 424 of the AtHPPD amino acid sequence (corresponding to position 415 of the amino acid sequence shown in SEQ ID NO: 1, i.e., position 415) was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F415W amino acid sequence, as shown in SEQ ID NO: 212 in the sequence listing. The AtHPPDm-F415W-01 nucleotide sequence encoding the AtHPPDm-F415W amino acid sequence is shown in SEQ ID NO: 213 in the sequence listing. The AtHPPDm-F415W-02 nucleotide sequence encoding the AtHPPDm-F415W amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 214 in the sequence listing.
[0326] The 372 position of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 415 position was mutated from the original phenylalanine (F) to tryptophan (W) to obtain the AtHPPDm-F372A-F415W amino acid sequence, as shown in SEQ ID NO: 215 in the sequence listing. The AtHPPDm-F372A-F415W-01 nucleotide sequence encoding the AtHPPDm-F372A-F415W amino acid sequence is shown in SEQ ID NO: 216 in the sequence listing. The AtHPPDm-F372A-F415W-02 nucleotide sequence encoding the AtHPPDm-F372A-F415W amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 217 in the sequence listing.
[0327] (3) F372A+F383Y combined mutant gene of HPPD from oats
[0328] The 383 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AsHPPDm-F383Y amino acid sequence, as shown in SEQ ID NO: 218 in the sequence listing, the AsHPPDm-F383Y-01 nucleotide sequence encoding the AsHPPDm-F383Y amino acid sequence, as shown in SEQ ID NO: 219 in the sequence listing, and the AsHPPDm-F383Y-02 nucleotide sequence encoding the AsHPPDm-F383Y amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean, as shown in SEQ ID NO: 220 in the sequence listing.
[0329] The 372 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383 position was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AsHPPDm-F372A-F383Y amino acid sequence, as shown in SEQ ID NO: 221 in the sequence listing. The AsHPPDm-F372A-F383Y-01 nucleotide sequence encoding the AsHPPDm-F372A-F383Y amino acid sequence is shown in SEQ ID NO: 222 in the sequence listing. The AsHPPDm-F372A-F383Y-02 nucleotide sequence encoding the AsHPPDm-F372A-F383Y amino acid sequence obtained based on the common preferred codons of Arabidopsis / soybean is shown in SEQ ID NO: 223 in the sequence listing.
[0330] (4) F372A+F383Y combined mutant gene of HPPD from Arabidopsis
[0331] The amino acid at position 392 of the AtHPPD amino acid sequence (corresponding to position 383 of the amino acid sequence shown in SEQ ID NO: 1, i.e., position 383) was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AtHPPDm-F383Y amino acid sequence, as shown in SEQ ID NO: 224 in the sequence listing. The AtHPPDm-F383Y-01 nucleotide sequence encoding the AtHPPDm-F383Y amino acid sequence is shown in SEQ ID NO: 225 in the sequence listing. The AtHPPDm-F383Y-02 nucleotide sequence encoding the AtHPPDm-F383Y amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 226 in the sequence listing.
[0332] The 372th position of the AtHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 383th position was mutated from the original phenylalanine (F) to tyrosine (Y) to obtain the AtHPPDm-F372A-F383Y amino acid sequence, as shown in SEQ ID NO: 227 in the sequence listing. The AtHPPDm-F372A-F383Y-01 nucleotide sequence encoding the AtHPPDm-F372A-F383Y amino acid sequence is shown in SEQ ID NO: 228 in the sequence listing. The AtHPPDm-F372A-F383Y-02 nucleotide sequence encoding the AtHPPDm-F372A-F383Y amino acid sequence obtained based on the common preferred codons of Arabidopsis thaliana / soybean is shown in SEQ ID NO: 229 in the sequence listing.
[0333] 2. Construction of an Arabidopsis recombinant expression vector containing a mutant HPPD gene in the form of a non-F372A (F372G / F372V) + F383W combination
[0334] According to the method for constructing the recombinant expression vector DBN11726 containing the AsHPPDm-F372A-F383W-02 nucleotide sequence in the above-mentioned first example 3, the AsHPPDm-F415W-02 nucleotide sequence, AsHPPDm-F372A-F415W-02 nucleotide sequence, AtHPPDm-F415W-02 nucleotide sequence, AtHPPDm-F372A-F415W-02 nucleotide sequence, AsHPPDm-F383Y-02 nucleotide sequence, AsHPPDm-F372A-F383Y-02 nucleotide sequence, AtHPPDm-F383Y-02 nucleotide sequence and AtHPPDm-F372A-F383Y-02 nucleotide sequence connected to the universal linker primer 1 were respectively subjected to recombination reactions with the linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN11791 to DBN11798, respectively. Sequencing verified that the above nucleotide sequences were correctly inserted into the recombinant expression vectors DBN11791 to DBN11798.
[0335] 3. Transformation of Arabidopsis thaliana recombinant expression vector into Agrobacterium
[0336] According to the method for transforming the Arabidopsis thaliana recombinant expression vector into Agrobacterium in the above-mentioned first embodiment 4, the correctly constructed recombinant expression vectors DBN11791 to DBN11798, the recombinant expression vector DBN11727 containing the AsHPPD-02 nucleotide sequence in the first embodiment 3, the recombinant expression vector DBN11728 containing the AsHPPDm-F372A-02 nucleotide sequence in the first embodiment 3, the recombinant expression vector DBN11730 containing the AtHPPDm-02 nucleotide sequence in the second embodiment 2, and the recombinant expression vector DBN11731 containing the AtHPPDm-F372A-02 nucleotide sequence in the second embodiment 2 were respectively transformed into Agrobacterium GV3101 using the liquid nitrogen method. Sequencing verification results showed that the structures of the recombinant expression vectors DBN11791 to DBN11798, DBN11727, DBN11728, DBN11730 and DBN11731 were completely correct.
[0337] 4. Testing the herbicide tolerance effect of Arabidopsis plants with mutant HPPD genes in the non-F372A (F372G / F372V) + F383W combination
[0338] According to the method of the first embodiment 5 above, the Arabidopsis inflorescence was immersed in the Agrobacterium solution of this embodiment 3 to transfer the T-DNA in the recombinant expression vectors DBN11791 to DBN11798 and DBN11727, DBN11728, DBN11730, and DBN11731 constructed in this embodiment 2 into the Arabidopsis chromosomes, thereby obtaining the corresponding transgenic Arabidopsis plants, i.e., Arabidopsis T1 plants (AsHPPDm-F415W-02) carrying the AsHPPDm-F415W-02 nucleotide sequence. , Arabidopsis thaliana T1 plants introduced with the AsHPPDm-F372A-F415W-02 nucleotide sequence (AsHPPDm-F372A-F415W-02), Arabidopsis thaliana T1 plants introduced with the AtHPPDm-F415W-02 nucleotide sequence (AtHPPDm-F415W-02), Arabidopsis thaliana T1 plants introduced with the AtHPPDm-F372A-F415W-02 nucleotide sequence (AtHPPDm-F372A-F415W-02), and Arabidopsis thaliana T1 plants introduced with the AsHPPDm-F383Y- 02 nucleotide sequence (AsHPPDm-F383Y-02), Arabidopsis thaliana T1 plant into which the AsHPPDm-F372A-F383Y-02 nucleotide sequence was transferred (AsHPPDm-F372A-F383Y-02), Arabidopsis thaliana T1 plant into which the AtHPPDm-F383Y-02 nucleotide sequence was transferred (AtHPPDm-F383Y-02), Arabidopsis thaliana T1 plant into which the AtHPPDm-F372A-F383Y-02 nucleotide sequence was transferred (AtHPPDm -F372A-F383Y-02), Arabidopsis thaliana T1 plants introduced with the AsHPPD-02 nucleotide sequence (AsHPPD-02), Arabidopsis thaliana T1 plants introduced with the AsHPPDm-F372A-02 nucleotide sequence (AsHPPDm-F372A-02), Arabidopsis thaliana T1 plants introduced with the AtHPPDm-02 nucleotide sequence (AtHPPDm-02), and Arabidopsis thaliana T1 plants introduced with the AtHPPDm-F372A-02 nucleotide sequence (AtHPPDm-F372A-02).
[0339] According to the method of the first embodiment 6, the Arabidopsis thaliana T1 plants and wild-type Arabidopsis thaliana plants (18 days after sowing) were treated with three concentrations of pyraclostrobin (25 g ai / ha (1 times the field concentration, 1×), 100 g ai / ha (4 times the field concentration, 4×) and 0 g ai / ha (water, 0×)), five concentrations of isoxaflutole (35 g ai / ha (0.5 times the field concentration, 0.5×), 70 g ai / ha (1 times the field concentration, 1×), 140 g ai / ha (2 times the field concentration, 2×), 280 g ai / ha (4 times the field concentration, 4×) and 0 g ai / ha (water, 0×)). ai / ha (water, 0×)) (wherein, 0×, 0.5× and 1× concentrations of isoxaflutole were used for spraying Arabidopsis T1 plants transformed with HPPD mutants derived from Arabidopsis thaliana; 0×, 2× and 4× concentrations of isoxaflutole were used for spraying Arabidopsis T1 plants transformed with HPPD mutants derived from oats) and 5 concentrations of mesotrione (52.5 g ai / ha (0.5 times the field concentration, 0.5×), 105 g ai / ha (1 times the field concentration, 1×), 210 g ai / ha (2 times the field concentration, 2×), 420 g ai / ha (4 times the field concentration, 4×) and 0 g Arabidopsis plants were sprayed with mesotrione at concentrations of 0×, 0.5×, and 1× (water, 0×) to test herbicide tolerance. The results are shown in Tables 13 to 15.
[0340] Table 13 Results of the tolerance test of Arabidopsis thaliana T1 plants with HPPD mutations other than F372A (F372G / F372V) + F383W to benzylpyraclostrobin
[0341]
[0342] Table 14 Results of the tolerance test of Arabidopsis thaliana T1 plants with HPPD mutations other than F372A (F372G / F372V) + F383W to isoxathiapiprolin
[0343]
[0344]
[0345] Table 15 Results of the tolerance test of Arabidopsis thaliana T1 plants with HPPD mutations other than F372A (F372G / F372V) + F383W to mesotrione
[0346]
[0347]
[0348] The results in Tables 13 to 15 indicate that Arabidopsis T1 plants harboring the F372A+F415W or F372A+F383Y combined HPPD gene mutations exhibited essentially the same tolerance to HPPD inhibitor herbicides as Arabidopsis T1 plants harboring the F372A single-site HPPD gene mutation. This demonstrates that combining any two sites within the HPPD amino acid sequence does not always confer synergistic tolerance to HPPD inhibitor herbicides. This also demonstrates that the synergistic technical effects of the HPPD amino acid sequence mutations at sites 372 and 383 of the present invention are unpredictable.
[0349] Example 6: Acquisition and Verification of Transgenic Soybean Plants
[0350] 1. Transformation of Agrobacterium with recombinant expression vector
[0351] The recombinant expression vector DBN11758 containing the SbHPPD-02 nucleotide sequence, the recombinant expression vector DBN11759 containing the SbHPPDm-F372A-02 nucleotide sequence, the recombinant expression vector DBN11760 containing the SbHPPDm-F383W-02 nucleotide sequence, and the recombinant expression vector DBN11761 containing the SbHPPDm-F372A-F383W-02 nucleotide sequence in Example 2, and the control recombinant expression vector DBN11726N in Example 1 3 were transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) using the liquid nitrogen method. The transformation conditions are as follows: 100 μL of Agrobacterium LBA4404, 3 μL of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and warmed in a 37°C water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated into an LB test tube and cultured at 28°C and 200 rpm for 2 hours, and then spread on the LB solid plate containing 50 mg / L rifampicin and 50 mg / L spectinomycin until a positive single colony grew. The single colony was picked and cultured, and its plasmid was extracted. The extracted plasmid was sequenced and identified. The results showed that the structures of the recombinant expression vectors DBN11758, DBN11759, DBN11760, DBN11761, and DBN11726N were completely correct.
[0352] 2. Obtaining genetically modified soybean plants
[0353] According to the conventional Agrobacterium infection method, the cotyledonary node tissue of the aseptically cultured soybean variety Zhonghuang 13 was co-cultured with the Agrobacterium described in Example 1 to transform the T-DNA (including the 34S enhancer sequence of Scrophulariaceae mosaic virus, the promoter sequence of the rapeseed eukaryotic elongation factor gene 1α (Tsf1), the Arabidopsis thaliana chloroplast transit peptide sequence, the 5-enolpyruvylshikimate-3-phosphate synthase gene, the terminator sequence of the pea RbcS gene, the Arabidopsis thaliana ubiquitin 10 gene promoter sequence, the SbHPPD-02 nucleotide sequence, the SbHPPDm-F372A-02 nucleotide sequence) in the above-mentioned recombinant expression vectors DBN11758, DBN11759, DBN11760, DBN11761 and DBN11726N into the recombinant expression vectors DBN11758, DBN11759, DBN11760, DBN11761 and DBN11726N) into the recombinant expression vectors DBN11726 The nucleotide sequence of SbHPPDm-F383W-02, the nucleotide sequence of SbHPPDm-F372A-F383W-02, the terminator sequence of the nopaline synthase gene, the cauliflower mosaic virus 35S promoter sequence, the phosphinothricin N-acetyltransferase gene, and the terminator sequence of the cauliflower mosaic virus 35S were transferred into the soybean chromosome, and soybean plants with the SbHPPD-02 nucleotide sequence, the SbHPPDm-F372A-02 nucleotide sequence, the SbHPPDm-F383W-02 nucleotide sequence, the SbHPPDm-F372A-F383W-02 nucleotide sequence, and the control vector DBN11726N were obtained.
[0354] For Agrobacterium-mediated soybean transformation, mature soybean seeds were germinated in soybean germination medium (3.1 g / L B5 salts, B5 vitamins, 20 g / L sucrose, 8 g / L agar, pH 5.6). Seeds were plated on the germination medium and incubated under the following conditions: temperature 25 ± 1°C, photoperiod (16 / 8 h light / dark). After 4-6 days of germination, sterile soybean seedlings with swollen cotyledonary nodes were harvested. The hypocotyls were cut 3-4 mm below the cotyledonary nodes, the cotyledons were cut longitudinally, and the terminal bud, lateral buds, and seminal roots were removed. The back of a scalpel is used to wound the cotyledonary node, and the wounded cotyledonary node tissue is contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transmitting the SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence or SbHPPDm-F372A-F383W-02 nucleotide sequence to the wounded cotyledonary node tissue (step 1: infection step). In this step, the cotyledonary node tissue is preferably immersed in the Agrobacterium suspension (OD 660= 0.5-0.8, and inoculated with infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholineethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3) for initial inoculation. The cotyledonary node tissue is co-cultivated with Agrobacterium for a period of time (3 days) (Step 2: Co-cultivation Step). Preferably, after the infection step, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6). This co-cultivation period can be followed by an optional "recovery" step. In the "recovery" step, the recovery medium (3.1 g / L B5 salts, B5 vitamins, 1 g / L MES, 30 g / L sucrose, 2 mg / L ZT, 8 g / L agar, 150 mg / L cephalosporin, 100 mg / L glutamic acid, 100 mg / L aspartic acid, pH 5.6) contains at least one antibiotic known to inhibit the growth of Agrobacterium (150-250 mg / L cephalosporin), and no selective agent for plant transformants is added (Step 3: Recovery Step). Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on solid medium containing the antibiotic but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Subsequently, the tissue pieces regenerated from the cotyledonary nodes are cultured on medium containing the selective agent (glyphosate) to select for growing transformed callus (Step 4: Selection Step). Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on a screening solid medium with a selective agent (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6), resulting in selective growth of the transformed cells. Then, the transformed cells are regenerated into plants (step 5: regeneration step). Preferably, the tissue pieces regenerated from the cotyledonary nodes grown on a medium containing a selective agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.
[0355] The resistant tissue blocks obtained by screening were transferred to the B5 differentiation medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6) and cultured for differentiation at 25° C. The differentiated seedlings were transferred to the B5 rooting medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L), cultured on the rooting medium at 25° C. to a height of about 10 cm, and then moved to a greenhouse for culture until fruiting. In the greenhouse, the cells were cultured at 26°C for 16 h and then at 20°C for 8 h each day.
[0356] The above-mentioned soybean T0 plants transformed with the SbHPPD-02 nucleotide sequence, the soybean T0 plants transformed with the SbHPPDm-F372A-02 nucleotide sequence, the soybean T0 plants transformed with the SbHPPDm-F383W-02 nucleotide sequence, the soybean T0 plants transformed with the SbHPPDm-F372A-F383W-02 nucleotide sequence, and the soybean T0 plants transformed with the control vector DBN11726N were sent to the greenhouse for transplanting, culture, and reproduction to obtain the corresponding transgenic T1 plants.
[0357] 3. Verification of transgenic soybean plants using TaqMan
[0358] Approximately 100 mg of leaves were collected from soybean T1 plants transfected with the SbHPPD-02 nucleotide sequence, the SbHPPDm-F372A-02 nucleotide sequence, the SbHPPDm-F383W-02 nucleotide sequence, the SbHPPDm-F372A-F383W-02 nucleotide sequence, and the control vector DBN11726N. Genomic DNA was extracted using the Qiagen DNeasy Plant Maxi Kit. The EPSPS gene copy number was determined by quantitative PCR using TaqMan probes to determine the copy number of the mutant HPPD gene. Wild-type soybean plants were used as controls and analyzed using the same method. The experiment was replicated three times, and the average value was calculated.
[0359] The specific method for detecting EPSPS gene copy number is as follows:
[0360] Step 11, taking 100 mg of leaves each from a soybean T1 plant transformed with the SbHPPD-02 nucleotide sequence, a soybean T1 plant transformed with the SbHPPDm-F372A-02 nucleotide sequence, a soybean T1 plant transformed with the SbHPPDm-F383W-02 nucleotide sequence, a soybean T1 plant transformed with the SbHPPDm-F372A-F383W-02 nucleotide sequence, a soybean T1 plant transformed with the control vector DBN11726N, and a wild-type soybean plant, and grinding them into a homogenate using liquid nitrogen in a mortar, with three replicates for each sample;
[0361] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to the product manual.
[0362] Step 13: Determine the genomic DNA concentration of the sample using NanoDrop 2000 (Thermo Scientific);
[0363] Step 14: adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μL;
[0364] Step 15: Taqman probe fluorescence quantitative PCR method was used to identify the copy number of the sample. A sample with a known copy number was used as a standard, and a sample of a wild-type soybean plant was used as a control. Each sample was repeated three times, and the average value was taken. The sequences of the fluorescence quantitative PCR primers and probes were:
[0365] The following primers and probes were used to detect the EPSPS gene sequence:
[0366] Primer 1: ctggaaggcgaggacgtcatcaata as shown in SEQ ID NO: 232 in the sequence listing;
[0367] Primer 2: tggcggcattgccgaaatcgag as shown in SEQ ID NO: 233 in the sequence listing;
[0368] Probe 1: atgcaggcgatgggcgcccgcatccgta as shown in SEQ ID NO: 234 in the sequence listing;
[0369] The PCR reaction system is:
[0370]
[0371] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in amber tubes at 4°C.
[0372] PCR reaction conditions are:
[0373]
[0374] Data were analyzed using SDS2.3 software (Applied Biosystems).
[0375] By analyzing the experimental results of EPSPS gene copy number, it was confirmed that the SbHPPD-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F383W-02 nucleotide sequence, SbHPPDm-F372A-F383W-02 nucleotide sequence and the control vector DBN11726N had all been integrated into the chromosome genome of the tested soybean plants, and soybean T1 plants transformed with the SbHPPD-02 nucleotide sequence, soybean T1 plants transformed with the SbHPPDm-F372A-02 nucleotide sequence, soybean T1 plants transformed with the SbHPPDm-F383W-02 nucleotide sequence, soybean T1 plants transformed with the SbHPPDm-F372A-F383W-02 nucleotide sequence and soybean T1 plants transformed with the control vector DBN11726N all obtained single-copy transgenic soybean plants.
[0376] 4. Testing the tolerance of transgenic soybean plants to HPPD inhibitor herbicides
[0377] Soybean T1 plants transformed with the SbHPPD-02 nucleotide sequence, soybean T1 plants transformed with the SbHPPDm-F372A-02 nucleotide sequence, soybean T1 plants transformed with the SbHPPDm-F383W-02 nucleotide sequence, soybean T1 plants transformed with the SbHPPDm-F372A-F383W-02 nucleotide sequence, soybean T1 plants transformed with the control vector DBN11726N, and wild-type soybean plants (seedling stage V3-V4) were treated with three concentrations of fenpyrad (25 g ai / ha (1 times the field concentration, 1×), 100 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)), three concentrations of isoxathiapiprolin (70 g ai / ha (1 times the field concentration, 1×), 280 g ai / ha (4 times the field concentration, 4×), and 0 g Soybean plants were sprayed with 105 g ai / ha (water, 0×) and three concentrations of mesotrione (105 g ai / ha (1× field strength, 1×), 420 g ai / ha (4× field strength, 4×), and 0 g ai / ha (water, 0×)) to test their herbicide tolerance. Seven days after spraying (7 DAT), the degree of herbicide damage to each plant was counted and scored and evaluated for resistance based on the method described in Example 6 above. Two soybean T1 plant lines (S1 and S2) were transformed with the SbHPPD-02 nucleotide sequence, two soybean T1 plant lines (S3 and S4) were transformed with the SbHPPDm-F372A-02 nucleotide sequence, two soybean T1 plant lines (S5 and S6) were transformed with the SbHPPDm-F383W-02 nucleotide sequence, two soybean T1 plant lines (S7 and S8) were transformed with the SbHPPDm-F372A-F383W-02 nucleotide sequence, one soybean T1 plant line (S9) was transformed with the control vector DBN11726N, and one wild-type soybean plant line (CK1) was selected. Eight plants from each line were tested. The experimental results are shown in Tables 16 to 18.
[0378] Table 16 Transgenic soybean T1 plant tolerance test results to benzylpyraclostrobin
[0379]
[0380]
[0381] Table 17 Transgenic soybean T1 plant tolerance test results to isoxathiapiprolin
[0382]
[0383]
[0384] Table 18 Transgenic soybean T1 plant tolerance test results to mesotrione
[0385]
[0386] Tables 16 to 18 show that: (1) compared with soybean plants with unmutated HPPD genes and wild-type soybean plants, SbHPPDm-F372A-02, SbHPPDm-F383W-02 and SbHPPDm-F372A-F383W-02 developed different degrees of tolerance to different concentrations of HPPD inhibitor herbicides, while DBN11726N had no tolerance to HPPD inhibitor herbicides; (2) HPPD plants with combined mutations at positions 372 and 383 (F372A+F383W) had no tolerance to HPPD inhibitor herbicides. The herbicide tolerance of soybean plants with the PD gene is not only better than that of soybean plants with the F372A or F383W single-site mutation HPPD gene, but also further shows a synergistic herbicide tolerance effect, indicating that the mutated HPPD (F372A+F383W) can confer synergistic tolerance to HPPD inhibitor herbicides on transgenic soybean plants, and further proves the importance and stability of the combined mutation of sites 372 and 383 of the HPPD amino acid sequence in conferring tolerance to HPPD inhibitor herbicides on plants.
[0387] In summary, the present invention discloses for the first time that combined mutations at positions 372 and 383 of hydroxyphenylpyruvate dioxygenase polypeptides from different species can confer synergistic tolerance to pyrazolone, isoxazole and triketone HPPD inhibitor herbicides on plants, and in particular, can confer tolerance to 4 times the field concentration of pyrazoline, isoxazole and mesotrione on transgenic soybean plants. Therefore, it has broad application prospects in plants.
[0388] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A mutant hydroxyphenylpyruvate dioxygenase polypeptide that retains the activity of catalyzing the conversion of hydroxyphenylpyruvate to homogentisic acid or homogentisate and is less sensitive to HPPD inhibitor herbicides than wild-type HPPD, wherein, it contains amino acid mutations at the following sites corresponding to the amino acid sequence shown in SEQ ID NO: 1: substituted with A, G or V at position F372 and substituted with W at position F383; Preferably, the mutant hydroxyphenylpyruvate dioxygenase polypeptide contains amino acid mutations at the following sites corresponding to the amino acid sequence shown in SEQ ID NO: 1: substituted with A at position F372 and substituted with W at position F383.
2. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to claim 1, wherein, the mutant hydroxyphenylpyruvate dioxygenase polypeptide further contains a second mutation; Preferably, the second mutation contains amino acid mutations at at least one of the following sites corresponding to the amino acid sequence shown in SEQ ID NO: 1: A106G, deletion of A107, A111T or K351N.
3. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to claim 1 or 2, wherein, the mutant hydroxyphenylpyruvate dioxygenase polypeptide includes: a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 173, SEQ ID NO: 182, SEQ ID NO: 185, SEQ ID NO: 188, SEQ ID NO: 191, SEQ ID NO: 194, SEQ ID NO: 197, SEQ ID NO: 200 or SEQ ID NO:
203.
4. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1-3, wherein, the mutant hydroxyphenylpyruvate dioxygenase polypeptide is derived from plant wild-type HPPD or microbial wild-type HPPD.
5. A polynucleotide encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1-4.
6. An expression cassette or recombinant vector, wherein, it contains the polynucleotide according to claim 5 under the regulation of a regulatory sequence in effective connection.
7. A method for expanding the range of herbicides tolerated by plants, wherein, it includes: co-expressing the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1-4 with at least one herbicide tolerance protein different from the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1-4.
8. The method for expanding the range of herbicides tolerated by plants according to claim 7, wherein, the herbicide tolerance protein is 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, α-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, acetolactate synthase, cytochrome-like protein and / or protoporphyrinogen oxidase.
9. A method for selecting transformed plant cells, wherein, it includes: Transform multiple plant cells with the polynucleotide of claim 5, and culture the cells at an HPPD inhibitor herbicide concentration that allows the growth of the transformed cells expressing the polynucleotide while killing or inhibiting the growth of untransformed cells; Preferably, the HPPD inhibitor herbicide includes pyrazolone HPPD inhibitor herbicides, triketone HPPD inhibitor herbicides, and / or isoxazole HPPD inhibitor herbicides; more preferably, the pyrazolone HPPD inhibitor herbicide is benzofenap, the isoxazole HPPD inhibitor herbicide is clomazone, and the triketone HPPD inhibitor herbicide is mesotrione.
10. A method for controlling weeds, characterized in that, comprising: applying an effective dose of an HPPD inhibitor herbicide to a field planted with a target plant, wherein the target plant comprises the polynucleotide of claim 5; Preferably, the target plant is a glyphosate-tolerant plant and the weed is a glyphosate-resistant weed; Preferably, the HPPD inhibitor herbicide includes pyrazolone HPPD inhibitor herbicides, triketone HPPD inhibitor herbicides, and / or isoxazole HPPD inhibitor herbicides; more preferably, the pyrazolone HPPD inhibitor herbicide is benzofenap, the isoxazole HPPD inhibitor herbicide is clomazone, and the triketone HPPD inhibitor herbicide is mesotrione.
11. A method for protecting a plant from damage caused by an HPPD inhibitor herbicide or conferring HPPD inhibitor herbicide tolerance to a plant, characterized in that, comprising: introducing the polynucleotide of claim 5, or the expression cassette of claim 6, or the recombinant vector into a plant, so that the plant after introduction produces an amount of the mutant hydroxyphenylpyruvate dioxygenase polypeptide sufficient to protect it from damage by the HPPD inhibitor herbicide; Preferably, the HPPD inhibitor herbicide includes pyrazolone HPPD inhibitor herbicides, triketone HPPD inhibitor herbicides, and / or isoxazole HPPD inhibitor herbicides; more preferably, the pyrazolone HPPD inhibitor herbicide is benzofenap, the isoxazole HPPD inhibitor herbicide is clomazone, and the triketone HPPD inhibitor herbicide is mesotrione.
12. A method for producing a plant tolerant to an HPPD inhibitor herbicide, characterized in that, comprising introducing the polynucleotide of claim 5 into the genome of the plant; Preferably, the introducing method includes a genetic transformation method, a genome editing method, or a gene mutation method; Preferably, the HPPD inhibitor herbicide includes pyrazolone HPPD inhibitor herbicides, triketone HPPD inhibitor herbicides, and / or isoxazole HPPD inhibitor herbicides; more preferably, the pyrazolone HPPD inhibitor herbicide is benzofenap, the isoxazole HPPD inhibitor herbicide is clomazone, and the triketone HPPD inhibitor herbicide is mesotrione.
13. A method for culturing a plant tolerant to an HPPD inhibitor herbicide, It is characterized in that comprising: planting at least one plant propagule, the genome of which comprises the polynucleotide according to claim 5; growing the plant propagule into a plant; applying an effective dose of an HPPD inhibitor herbicide to a plant growth environment comprising at least the plant, and harvesting a plant having reduced plant damage and / or increased plant yield as compared to plants not having the polynucleotide according to claim 5; Preferably, the HPPD inhibitor herbicide comprises a pyrazolone HPPD inhibitor herbicide, a triketone HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; More preferably, the pyrazolone HPPD inhibitor herbicide is benzofenap, the isoxazole HPPD inhibitor herbicide is clomazone, and the triketone HPPD inhibitor herbicide is mesotrione.
14. A method for obtaining a processed agricultural product, characterized in that comprises processing the harvest of the HPPD inhibitor herbicide-tolerant plant obtained by the method according to claim 13 to obtain a processed agricultural product.
15. A planting system for controlling weed growth, characterized in that comprises an HPPD inhibitor herbicide and a plant growth environment in which there is at least one target plant, the target plant comprising the polynucleotide according to claim 5; Preferably, the target plant is a glyphosate-tolerant plant and the weed is a glyphosate-resistant weed; Preferably, the HPPD inhibitor herbicide comprises a pyrazolone HPPD inhibitor herbicide, a triketone HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; More preferably, the pyrazolone HPPD inhibitor herbicide is benzofenap, the isoxazole HPPD inhibitor herbicide is clomazone, and the triketone HPPD inhibitor herbicide is mesotrione.
16. Use of the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any one of claims 1-4 for conferring HPPD inhibitor herbicide tolerance to a plant; Preferably, the HPPD inhibitor herbicide comprises a pyrazolone HPPD inhibitor herbicide, a triketone HPPD inhibitor herbicide and / or an isoxazole HPPD inhibitor herbicide; More preferably, the pyrazolone HPPD inhibitor herbicide is benzofenap, the isoxazole HPPD inhibitor herbicide is clomazone, and the triketone HPPD inhibitor herbicide is mesotrione.