Antiviral composition comprising nucleoside analogues derived from nucleic acid and pharmaceutically acceptable salts thereof

Abstract

The present application relates to an antiviral composition, an immunity-enhancing composition, a feed, or a feed additive, comprising nucleoside analogues derived from a nucleotide.

Description

Antiviral composition comprising nucleic acid-derived nucleoside analogs and pharmaceutically acceptable salts thereof

[0001] The present application relates to an antiviral composition, an immunomodulatory composition, and a feed composition comprising a nucleic acid-derived nucleoside analog and a pharmaceutically acceptable salt thereof.

[0002] Viruses are infectious agents that can infect not only animals and plants, but also microorganisms, causing various diseases and disrupting the life cycle of their hosts or even leading to death. Recently, various animal viruses, such as SARS-CoV-2, MERS, and influenza, have infected humans, causing massive human casualties worldwide, posing a significant concern for humanity today. One solution to this situation could be to control viral diseases in animals, thereby freeing us from the fear of cross-species viruses originating from animals.

[0003] Until recently, scientists have devoted endless passion and effort to research and control animal viruses through various methods. However, a definitive method for complete control has yet to be developed. For example, methods such as bait vaccines for wild animals and commercial vaccinations for commercial and companion animals are being used. However, due to the frequent mutations of viruses and the slow pace of vaccine development, it is difficult to expect these methods to be fully effective. Furthermore, as we all know, the expected level of effectiveness will only be achieved through the combination of vaccines and treatments, as well as strict adherence to quarantine guidelines.

[0004] As evidence to support this assertion, we already know from experience that the various vaccinations currently in progress and large-scale national quarantine efforts are unlikely to completely control regionally or globally prevalent animal viral diseases. Many scientists would agree that effective control of viral diseases could be achieved if antiviral drugs were appropriately utilized as the final piece of the puzzle to create an effective virus-related solution.

[0005] Moreover, because the diverse viruses that constantly emerge according to the laws of nature cannot be prevented in advance, the need for therapeutics or inhibitors that can control viruses later on may arise, rather than preventative vaccines that are difficult to respond to quickly. However, humanity currently lacks effective and efficient treatments for animal viruses, and as a result, humanity continues to suffer enormous economic and human losses from various viruses transmitted from animals.

[0006] In this situation where there is an urgent need for anti-virus treatment, viruses of economic animals and companion animals closely related to human life are given priority.

[0007] This patent discusses substances for effective virus proliferation inhibition against African Swine Fever Virus (ASFV), Classical Swine Fever Virus (CSFV), Low pathogenic Avian influenza virus (LPAIV), Canine coronavirus (CCoV), Canine adenovirus (CAV), Canine distemper virus (CDV), Feline parvovirus (FPV), Feline Calicivirus (FCV), Feline infectious peritonitis virus (FIPV, also known as Feline Coronavirus (FCoV), and Foot and Mouth disease virus (FMDV).

[0008] The purpose of the present application is to provide an antiviral composition, an immunomodulatory composition or a feed composition comprising a nucleic acid-derived nucleoside analog and a pharmaceutically acceptable salt thereof.

[0009] One aspect of the present application may be an antiviral composition comprising a nucleoside of the dialdehyde form of inosine, the dialdehyde form of xanthosine, the dialdehyde form of guanosine, or the acyclic diol form of inosine, the acyclic diol form of xanthosine, or the acyclic diol form of guanosine.

[0010] One aspect of the present application may be an immunomodulatory composition comprising a nucleoside of the dialdehyde form of inosine, the dialdehyde form of xanthosine, the dialdehyde form of guanosine, or the acyclic diol form of inosine, the acyclic diol form of xanthosine, or the acyclic diol form of guanosine.

[0011] One aspect of the present application may be a pharmaceutical, feed or feed additive comprising the antiviral composition.

[0012] Specifically, the composition may be a composition exhibiting an antiviral effect against at least one virus selected from the group consisting of African Swine Fever Virus (ASFV), Classical Swine Fever Virus (CSFV), Low pathogenic Avian influenza virus (LPAIV), Canine coronavirus (CCoV), Canine adenovirus (CAV), Canine distemper virus (CDV), Feline parvovirus (FPV), Feline Calicivirus (FCV), Feline infectious peritonitis virus (FIPV, also known as Feline Coronavirus (FCoV), and Foot and Mouth disease virus (FMDV).

[0013] One aspect of the present application may be a method for preventing, improving or treating a virus, comprising administering to a subject a nucleoside of the dialdehyde form of inosine, the dialdehyde form of xanthosine, the dialdehyde form of guanosine or the acyclic diol form of inosine, the acyclic diol form of xanthosine or the acyclic diol form of guanosine.

[0014] One aspect of the present application may be a method of immunomodulation comprising administering to a subject a nucleoside of the dialdehyde form of inosine, the dialdehyde form of xanthosine, the dialdehyde form of guanosine, or the acyclic diol form of inosine, the acyclic diol form of xanthosine, or the acyclic diol form of guanosine.

[0015] One aspect of the present application may be a use of a nucleoside of the dialdehyde form of inosine, the dialdehyde form of xanthosine, the dialdehyde form of guanosine, or the acyclic diol form of inosine, the acyclic diol form of xanthosine, or the acyclic diol form of guanosine for the prevention or treatment of viruses.

[0016] One aspect of the present application may be the use of a nucleoside of the dialdehyde form of inosine, the dialdehyde form of xanthosine, the dialdehyde form of guanosine, or the acyclic diol form of inosine, the acyclic diol form of xanthosine, or the acyclic diol form of guanosine for immunomodulation.

[0017] Nucleoside analogs derived from nucleic acids according to the present invention can be usefully used as antiviral agents.

[0018] Hereinafter, the present application is described in detail.

[0019] The antiviral or immunomodulatory composition of the present application is characterized by containing, as an active ingredient, a nucleoside analogue in the form of a dialdehyde or an acyclic diol, and, in a specific embodiment, inosine, xanthosine, guanosine, and pharmaceutically acceptable salts thereof in the form of a dialdehyde or an acyclic diol derived from a nucleic acid represented by the following chemical formulae 1 to 6.

[0020]

[0021] [Chemical Formula 1]

[0022]

[0023] [Chemical Formula 2]

[0024]

[0025] [Chemical Formula 3]

[0026]

[0027] [Chemical Formula 4]

[0028]

[0029] [Chemical Formula 5]

[0030]

[0031] [Chemical Formula 6]

[0032]

[0033]

[0034] These active ingredients, inosine, xanthosine, or guanosine in the form of dialdehyde or acyclic diol, can be produced through an optimized process. As a specific example, they can be produced by the method described in the examples according to the present invention, but are not limited thereto.

[0035] At this time, the compound represented by Chemical Formula 1 to 6 or a pharmaceutically acceptable salt thereof is added in an amount of 0.0001 to 20 parts by weight, 0.0001 to 15 parts by weight, 0.0001 to 10 parts by weight, 0.0001 to 5 parts by weight, 0.0001 to 1 part by weight, 0.0001 to 0.5 parts by weight, 0.0001 to 0.1 parts by weight, 0.0001 to 0.05 parts by weight, 0.0001 to 0.01 parts by weight, 0.0001 to 0.005 parts by weight, 0.0001 to 0.001 parts by weight, 0.0001 to 0.005 parts by weight, 0.001 to 20 parts by weight, 0.001 0.001 to 15 parts by weight, 0.001 to 10 parts by weight, 0.001 to 5 parts by weight, 0.001 to 1 part by weight, 0.001 to 0.5 parts by weight, 0.001 to 0.1 part by weight, 0.001 to 0.05 parts by weight, 0.001 to 0.01 part by weight, 0.001 to 0.005 parts by weight, 0.01 to 20 parts by weight, 0.01 to 15 parts by weight, 0.01 to 10 parts by weight, 0.01 to 5 parts by weight, 0.01 to 1 part by weight, 0.01 to 0.5 parts by weight, 0.01 to 0.1 part by weight, 0.01 to 0.05 parts by weight, 0.1 to 20 parts by weight, 0.1 to 15 parts by weight, 0.1 to 10 parts by weight, 0.1 to 5 parts by weight, 0.1 to 1 part by weight, 0.1 to 0.5 parts by weight, 1 to 20 parts by weight, 1 to 15 parts by weight, 1 to 10 parts by weight, 1 to 5 parts by weight, 5 to 20 parts by weight, 5 to 15 parts by weight, 5 to 10 parts by weight, 10 to 20 parts by weight, 10 to 15 parts by weight, or 15 to 20 parts by weight, wherein the compound or a pharmaceutically acceptable salt thereof is 0.If it is included in an amount less than 0001 parts by weight, the antiviral effect of the compound is not properly manifested, and if it is included in an amount exceeding 20 parts by weight, the increase in the antiviral effect is insignificant compared to the increase in the compound content, which is not desirable.

[0036] The above virus is not limited to any type of virus, but may specifically originate from companion animals or industrial animals. Examples of such companion animals or industrial animals include cloven-hoofed animals such as cattle, pigs, goats, sheep, and deer; fish; arthropods; dogs, cats; or birds.

[0037] Examples of viruses originating from cloven-hoofed animals such as cattle, pigs, goats, sheep, deer, fish, arthropods, dogs, cats or birds include, but are not limited to, African Swine Fever Virus (ASFV), Classical Swine Fever Virus (CSFV), Low pathogenic Avian influenza virus (LPAIV), Canine coronavirus (CCoV), Canine adenovirus (CAV), Canine distemper virus (CDV), Feline parvovirus (FPV), Feline Calicivirus (FCV), Feline infectious peritonitis virus (FIPV, also known as Feline Coronavirus (FCoV)) and Foot and Mouth disease virus (FMDV).

[0038]

[0039] The following is a description of representative viruses among those for which antiviral efficacy has been verified in this application.

[0040] African swine fever, caused by the African swine fever virus (ASFV), is a fatal viral hemorrhagic disease with a mortality rate of up to 100%, causing significant economic damage to the pig industry. ASFV has been present in Africa since the 1920s and is endemic throughout most of sub-Saharan Africa. It has also occurred in Europe and South America in the past and has been largely eradicated, although it took more than 30 years to completely eradicate the disease in Spain and Portugal. Since 2007, when African swine fever entered Europe through the Republic of Georgia, the virus has spread widely among domestic pigs and wild boar in the region, and is now endemic in many Eastern European countries and parts of the Russian Federation.

[0041] ASFV does not infect humans or other animals, but is only susceptible to animals belonging to the pig family (Suidae). Domestic pigs and wild boars are its natural hosts. Uniquely, wild pigs in Africa, such as warthogs and giant forest hogs, do not show clinical symptoms even when infected, so they act as reservoirs for African swine fever virus. Excluding pigs, soft ticks, which are the only species of tick belonging to the Ornithodoros spp., carry the virus and transmit it to pigs or wild boars as a vector. Currently, there is no vaccine or treatment available globally, so the best way to prevent the virus from entering the country is to prevent it from entering the country.

[0042] Hog cholera is an acute, systemic infectious disease caused by the Classical Swine Fever Virus (CSFV), a Class 1 livestock contagious disease. Upon infection, it presents with a severe febrile reaction, as well as external symptoms such as skin spots, and upon autopsy, hemorrhagic spots in the bladder and kidneys, button-shaped ulcers in the ileocecal colon, and hemorrhagic infarction of the spleen. However, in pigs that have partially developed immunity or on farms where the disease is continuously occurring, these specific symptoms often do not appear.

[0043] Preventive measures include vaccination with a live, attenuated vaccine. When administered according to an appropriate vaccination program using a properly refrigerated vaccine, the disease can be effectively prevented. The disease has been eradicated in many countries, including the United States, and neighboring Japan has also established and is pursuing an eradication plan. In Korea, an effective vaccine has been developed and is commercially available, allowing for appropriate vaccination to control outbreaks. However, pig farms often avoid vaccination for economic reasons, resulting in persistent outbreaks.

[0044] Avian influenza (AI) is a viral infectious disease caused by infection with pathogenic influenza viruses in wild birds and domesticated poultry. Clinical symptoms and pathogenicity vary depending on the pathogenicity of the virus, and it is divided into apathogenic, low pathogenic, and highly pathogenic avian influenza. Highly pathogenic avian influenza (HPAI) is classified as a "Type 1 livestock disease" in Korea and a "List A disease" by the World Organization for Epizootics (OIE). Most countries conduct thorough surveillance and testing in relation to outbreaks, and implement eradication measures such as establishing emergency quarantine lines, blocking movement, and culling in the event of an outbreak. On the other hand, low pathogenic avian influenza is classified as a "Type 2 livestock disease" in Korea and is managed as a quarantine measure to suppress outbreaks, reduce damage, and mitigate the spread through vaccination.

[0045] All low-pathogenic avian influenza viruses occurring in Korea are H9N2, first reported in 1996. While they have low mortality rates, they cause significant economic damage in laying hens by causing problems such as reduced egg production, eggshell discoloration, reduced egg quality, and reduced feed intake (in broilers). Avian influenza viruses can be transmitted via droplets, air, and water, but the primary method of transmission is direct contact with feces. This means that feces can contaminate the boots or clothing of poultry managers, feed trucks, equipment, tools, and the surface of eggs, directly infecting other chickens. A single gram of feces from an infected chicken can infect approximately one million chickens. Therefore, thorough disinfection is crucial to prevent transmission. For prevention, an inactivated H9N2 vaccine is commercially available, which reduces symptoms and helps minimize economic losses in poultry farms. However, there are no commercially available treatments or preventatives, so simple quarantine measures are crucial.

[0046] Canine coronavirus (CCoV) belongs to the Coronaviridae family and is a single-stranded RNA virus that causes canine coronavirus infection in dogs. Canine coronavirus infection first emerged in the United States in 1971, at which time the causative virus was isolated. Multiple outbreaks of this disease have also been reported in Austria, Japan, and Korea. It is currently recognized as a cause of canine viral diarrhea, as it can be mixed with canine parvovirus infection and exacerbate symptoms. It causes an acute viral gastrointestinal infection characterized by vomiting, diarrhea, and dehydration. While both puppies and adult dogs are susceptible, puppies are particularly prevalent and have more pronounced symptoms. Dogs are susceptible regardless of breed or age, and transmission and morbidity are rapid, with outbreaks occurring particularly quickly in group-bred dogs.

[0047] Commercially available vaccines are being administered as a preventative measure against canine coronavirus infection, but safety concerns require careful consideration. For example, there was a case where encephalitis was induced as a side effect when the live attenuated canine distemper vaccine and the canine parvovirus vaccine were administered together. There is currently no effective treatment, and symptomatic treatment through early diagnosis remains the most effective approach. Fluid therapy and antibiotics to prevent secondary bacterial infections are used as part of symptomatic treatment to ensure dogs are stable, warm, and stress-free.

[0048] Canine adenovirus (CAV) is divided into CAV-1, which causes infectious hepatitis in dogs, and CAV-2, which causes kennel cough (a common cold or bronchitis in dogs). Naturally, canines, such as dogs, foxes, and coyotes, are susceptible to the virus, affecting all breeds, sexes, and ages. It is widespread worldwide. It is usually transmitted orally, and even after recovery, the virus remains partially in the kidneys, excreting through urine for 6 to 9 months. Therefore, infected canines can act as long-term carriers. After an incubation period of 3 to 8 days following initial infection, the animal becomes weak, develops a runny nose and eye discharge, and exhibits abnormal febrile reactions. Additionally, digestive symptoms such as diarrhea and vomiting may also occur. Liver edema can lead to severe abdominal pain. Jaundice can also occur in the late stages of hepatitis. Dogs with hepatitis may develop blue eyes during the recovery period, a condition called "hepatitis blue eye."

[0049] There is currently no clear treatment, and symptomatic treatment (antibiotics to eliminate secondary infections and intravenous fluids to balance electrolytes and treat dehydration) is the primary treatment, allowing infected individuals to develop immunity and recover. For prevention, a commercially available vaccine, the CAV-2 virus vaccine, is used, which has shown protective efficacy against both CAV-1 and CAV-2.

[0050] Canine distemper is caused by the canine distemper virus (CDV) and is a representative acute, febrile viral disease of dogs. After an incubation period of 3 to 6 days, it shows symptoms such as rhinitis, fever, severe respiratory symptoms, digestive problems, hardening of the paw pads, and neurological symptoms. In addition, it is highly contagious and has a high mortality rate, so when neurological symptoms appear, death occurs in almost 100% of dogs. This disease mainly occurs in young dogs under 1 year of age and occasionally occurs in older dogs. Known transmission routes are feces, urine, and nasal fluids discharged by infected dogs, and the virus is shed for 60 to 90 days after infection.

[0051] The only preventative measure is vaccination. The first vaccination is administered at two months of age, with booster shots every three to four weeks. Annual boosters are required. Current treatment options are symptomatic, including sulfa drugs or antibiotics to suppress secondary bacterial infections, glucose or electrolyte replacement for dehydration, and immunostimulants to speed recovery.

[0052] Feline panleukopenia (also known as feline infectious enteritis or panleukopenia) is a highly contagious and fatal disease affecting all cat species, caused by feline parvovirus (FPV). Its name, panleukopenia, comes from the marked decrease in white blood cells seen in infected animals. While it is primarily transmitted through contact with bodily fluids and feces of infected animals, it can also be transmitted through fleas, bedbugs, and other vectors that have come into contact with these vectors. It can also be transmitted through bedding, food, clothing, or shoes that have come into contact with infected animals. Clinical symptoms typically appear within 4 to 6 days of exposure, but can appear within 2 to 14 days. It is not contagious to humans. The causative agent, FPV, is structurally very stable and is known to survive for up to a year in the right environment. Furthermore, animals that have recovered from the disease can still have the virus in their excrement for up to six weeks after recovery.

[0053] Vaccines are available for prevention, primarily in combination with other diseases. Because panleukopenia is a serious condition in cats, preventive vaccination is recommended for all cats. While there are currently no commercially available treatments, recombinant interferon omega has been shown to inhibit the proliferation of FPV in vitro. For symptomatic treatment, whole blood transfusions are sometimes performed to increase white blood cell counts, and intravenous fluids containing antibiotics and vitamins A, B, and C are administered to prevent sepsis caused by dehydration.

[0054] Feline calicivirus (FCV) causes severe acute and chronic respiratory disease in cats. Infected cats may present with acute or gradual clinical signs. Rarely, no clinical signs are present, but symptoms may develop under stress or a weakened immune system. Common clinical signs include rhinitis, conjunctivitis, stomatitis, gingivitis, and glossitis, with occasional pneumonia, fever, abortion, and cystitis. Even after treatment, cats can shed the virus for months or even years.

[0055] There is currently no specific treatment for FCV infection. Antibiotics and immunomodulators are sometimes prescribed to treat and prevent secondary infections. Treating stomatitis is difficult, and steroids can worsen upper respiratory tract infection symptoms, requiring close observation. While the feline calicivirus vaccine has been widely used for the past 20 years to prevent the disease, it does not provide 100% protection, necessitating the development of a treatment. Nevertheless, it is recommended because it can alleviate symptoms of FCV infection.

[0056] Feline infectious peritonitis (FEPI) is caused by mutations in the feline coronavirus (FCoV). In approximately 10% of cats infected with FCoV, mutations in the virus, due to various causes, occur, proliferating within macrophages and causing a systemic disease with immune-mediated vasculitis and pyogenic granulomatous lesions.

[0057] Clinical signs caused by feline infectious peritonitis include weight loss, anorexia, and high fever, and various clinical signs are shown depending on the affected organ. Based on the lesion pattern, it can be divided into two types: effusive form (wet form) and non-effusive form (dry form). Effusive form of feline infectious peritonitis is characterized by fibrinous peritonitis and pleurisy caused by a humoral immune response, causing effusion in the abdominal cavity, thoracic cavity, or pericardium, and may progress to systemic disease. The non-effusive form is mainly involved in humoral immunity, but cell-mediated immunity is also known to be partially involved. Granulomatous lesions that occur in the affected organ cause clinical signs. In particular, the development of neurological symptoms is more common in the non-effusive form than in the effusive form.

[0058] Vaccines exist as a preventative measure, but veterinarians have differing opinions on their effectiveness. Peritonitis can occur even after vaccination, and there are safety concerns (vaccines can cause disease), so vaccination is generally not recommended. Unfortunately, it is currently an incurable disease with no cure or treatment, so symptomatic treatment is the only option. Even symptomatic treatment focuses on alleviating symptoms through immune modulation. In Japan, veterinarians suggest that omega interferon can be used for treatment, but it is not an official treatment, and even with its use, deaths are high. Its high cost makes it uncommon.

[0059] Foot-and-mouth disease virus (FMDV) is a small RNA virus that is classified into seven serotypes: A, O, C, Asia1, SAT1, SAT2, and SAT3. These major serotypes are further divided into about 80 subtypes. This virus infects cloven-hoofed animals (cloven-hoofed animals), such as cattle, pigs, goats, sheep, and deer. Although the mortality rate is not very high, it causes blisters to form on the lips, tongue, nose, and between the hooves, and causes loss of appetite, elevated body temperature, growth retardation, decreased exercise ability, and decreased milk production in dairy cows, which significantly reduces the commercial value of livestock. In addition, it is highly contagious and is classified as a List A disease (a disease that spreads quickly and causes significant economic damage in international trade) by the World Organization for Animal Health (OIE), and is also designated as a Class 1 livestock infectious disease in Korea.

[0060] Currently, the only preventative measure is vaccination. However, the level of cross-protection between viruses by vaccines is very weak, requiring different vaccines for different serotypes and subtypes. Furthermore, the vaccine's protective effect is short-lived, lasting only about six months, requiring frequent vaccinations. Furthermore, because vaccines produce antibodies identical to those produced by the actual disease, blood tests make it difficult to distinguish infected from vaccinated livestock. Therefore, if vaccination is implemented, countries cannot be certified as free of foot-and-mouth disease, hindering the export of related livestock products, potentially posing significant economic challenges.

[0061] As the pharmaceutically acceptable salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful. As the free acid, an inorganic acid and an organic acid can be used. As the inorganic acid, hydrochloric acid, hydrobromic acid, sulfuric acid, sulfurous acid, phosphoric acid, etc. can be used, and as the organic acid, citric acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, acetic acid, glycolic acid, succinic acid, tartaric acid, 4-toluenesulfonic acid, galacturonic acid, embonic acid, glutamic acid, aspartic acid, etc. can be used. In addition, the pharmaceutical composition containing the nucleoside analog represented by Chemical Formulas 1 to 6 of the present application can include not only a pharmaceutically acceptable salt, but also all salts, hydrates, and solvates that can be prepared by a conventional method.

[0062] The addition salt according to the present application can be prepared by a conventional method, for example, by dissolving a compound selected from the group consisting of compounds represented by chemical formulas 1 to 6 in a water-miscible organic solvent such as acetone, methanol, ethanol, or acetonitrile, adding an excess amount of organic acid or an aqueous solution of an inorganic acid, and then precipitating or crystallizing. Subsequently, the solvent or the excess amount of acid is evaporated from the mixture, followed by drying to obtain an addition salt, or the precipitated salt can be produced by suction filtration.

[0063] In addition, the composition may be selected from a pharmaceutical composition or a health food composition. In one specific embodiment, if the antiviral composition is a pharmaceutical composition, it may additionally include one or more additives selected from the group consisting of suitable carriers, excipients, disintegrants, sweeteners, coating agents, bulking agents, lubricants, flavoring agents, antioxidants, buffers, bacteriostatic agents, diluents, dispersants, surfactants, binders, and lubricants commonly used in the manufacture of pharmaceutical compositions. Specifically, carriers, excipients, and diluents may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like. These solid preparations may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like, into the composition. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

[0064] In another embodiment of the present application, the pharmaceutical composition may be formulated into granules, powders, coated tablets, tablets, pills, capsules, suppositories, gels, syrups, suspensions, emulsions, drops, or liquids according to a conventional method and used. According to one embodiment of the present application, the pharmaceutical composition may be administered to a subject in a conventional manner through a method well known in the art, for example, oral, intravenous, intraarterial, intramuscular, subcutaneous, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, inhalational, topical, rectal, intraocular, or intradermal route, but is not limited thereto.

[0065] The specific dosage of the compound represented by the above chemical formulas 1 to 6 or a pharmaceutically acceptable salt thereof may vary depending on the condition and weight of the subject, the type and degree of the disease, the form of the drug, the route and period of administration, and may be appropriately selected by a person skilled in the art.

[0066] In another specific example of the present application, the pharmaceutical composition comprises 0.01 to 90 parts by weight, 0.01 to 50 parts by weight, 0.01 to 10 parts by weight, 0.01 to 5 parts by weight, 0.01 to 1 part by weight, 0.01 to 0.1 part by weight, 0.1 to 90 parts by weight, 0.1 to 50 parts by weight, 0.1 to 10 parts by weight, 0.1 to 5 parts by weight, 0.1 to 1 part by weight, 1 to 90 parts by weight, 1 to 50 parts by weight, 1 to 10 parts by weight, 1 to 5 parts by weight, 10 to 90 parts by weight, 10 to 70 parts by weight, 10 to 50 parts by weight, It may contain, but is not limited to, 10 to 30 parts by weight, or 10 to 20 parts by weight.

[0067] According to one embodiment of the present application, but not limited thereto, when an appropriate amount for each livestock species is orally administered to an animal as specified below, the animal is absorbed through intestinal epithelial cells, enters the bloodstream, and spreads to each organ tissue, and is particularly delivered / absorbed to cells existing in tissues where viruses proliferate, thereby inhibiting viral proliferation in cells infected by viral challenge, and consequently can be used as a therapeutic agent for animals infected with viruses.

[0068] In the present application, the subject may be, but is not limited to, a mammal, a bird, a fish, or an arthropod. The mammalian subject may be a pig, a cow, a dog, a cat, or a chicken. The fish subject may be halibut, salmon, sea bream, eel, black rockfish, or trout. The arthropod subject may be shrimp or lobster.

[0069] In another specific example of the present application, the health food comprises a compound selected from the group consisting of compounds of chemical formulas 1 to 6 and pharmaceutically acceptable salts thereof in an amount of 0.01 to 90 parts by weight, 0.01 to 50 parts by weight, 0.01 to 10 parts by weight, 0.01 to 5 parts by weight, 0.01 to 1 part by weight, 0.01 to 0.1 part by weight, 0.1 to 90 parts by weight, 0.1 to 50 parts by weight, 0.1 to 10 parts by weight, 0.1 to 5 parts by weight, 0.1 to 1 part by weight, 1 to 90 parts by weight, 1 to 50 parts by weight, 1 to 10 parts by weight, 1 to 5 parts by weight, 10 to 90 parts by weight, 10 to 70 parts by weight, 10 to 50 parts by weight, 10 to 30 parts by weight, or 10 to 20 parts by weight, but is not limited thereto. In another specific example of the present application, the health food may further include one or more additives selected from the group consisting of organic acids, phosphates, antioxidants, lactose casein, dextrin, glucose, sugar and sorbitol. The organic acid may be, but is not limited to, citric acid, malic acid, adipic acid or lactic acid, the phosphate may be, but is not limited to, sodium phosphate, potassium phosphate, acid pyrophosphate or polyphosphate (polyphosphate), and the antioxidant may be, but is not limited to, a natural antioxidant such as polyphenol, catechin, alpha-tocopherol, rosemary extract, licorice extract, chitosan, tannic acid or phytic acid. In another specific example of the present application, the health food may contain, in addition to the effective ingredient, various nutrients, probiotics, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.According to one embodiment of the present application, the health food may be in the form of, but is not limited to, a solid, powder, granule, tablet, capsule, liquid, or beverage. In addition, the health food may be used in the manufacture of foods such as, but not limited to, confectionery, sugar, ice cream products, dairy products, meat products, fish products, tofu or jelly, edible oils and fats, noodles, teas, beverages, special nutritional foods, health supplements, seasoned foods, ice, ginseng products, kimchi pickled foods, dried foods, fruits, vegetables, dried fruits or vegetables, cut products, fruit juices, vegetable juices, mixed juices thereof, chips, noodles, processed livestock products, processed fishery products, processed dairy products, fermented dairy products, legume products, grain products, microbial fermented foods, confectionery and bakery products, seasonings, processed meat products, acidic beverages, licorice, herbs, etc.

[0070] In addition, the present application provides a feed additive containing as an active ingredient a compound selected from the group consisting of compounds of chemical formulae 1 to 6 and pharmaceutically acceptable salts thereof.

[0071] In one embodiment, the feed additive of the present application, like the antiviral composition, can be applied in various forms. Examples of formulation forms include, but are not limited to, liquids, suspensions, powders, granules, tablets, capsules, pills, etc. In addition, in order to formulate in the above form, in addition to the above active ingredient, one or more additives or excipients that can be typically included in feed additives, such as diluents, lubricants, binders, disintegrants, sweeteners, stabilizers, and preservatives, can be selected and used, and flavorings, immune-enhancing agents, etc. for providing additional functions can be mixed and used. Specifically, the diluent can be lactose, corn starch, soybean oil, microcrystalline cellulose, or mannitol, the lubricant can be magnesium stearate or talc, and the binder can be polyvinylpyrrolidone or hydroxypropyl cellulose. In addition, the disintegrant may be calcium carboxymethylcellulose, sodium starch glycolate, potassium polacrilin, or crospovidone; the sweetener may be white sugar, fructose, sorbitol, aspartame, or nucleic acid (IMP, GMP); the stabilizer may be sodium carboxymethylcellulose, beta-cyclodextrin, pectin, or xanthan gum; and the preservative may be methyl parahydroxybenzoate, propyl parahydroxybenzoate, or potassium sorbate.

[0072] The above feed additive may be selected from the group consisting of mammals, fish, birds or arthropods, specifically pigs, cattle, chickens, goats, sheep, horses, fish, shrimp, insects, dogs and cats. Specifically, pigs, cattle, chickens, dogs and cats may be used, but are not limited thereto. The feed additive can inhibit the activity of a virus selected from the group consisting of African Swine Fever Virus (ASFV), Classical Swine Fever Virus (CSFV), Low pathogenic Avian influenza virus (LPAIV), Canine coronavirus (CCoV), Canine adenovirus (CAV), Canine distemper virus (CDV), Feline parvovirus (FPV), Feline Calicivirus (FCV), Feline infectious peritonitis virus (FIPV, also known as Feline Coronavirus (FCoV), and Foot and Mouth disease virus (FMDV).

[0073] The above feed additive can be fed to mammals, fish, birds, or arthropods, specifically pigs, cattle, chickens, goats, sheep, horses, fish, shrimp, insects, dogs, or cats, at the same dosage and administration as the antiviral composition according to the present application. In addition, the feeding method may be a feeding method well known in the art, such as oral feeding by mixing with feed, etc., but is not limited thereto.

[0074] In one embodiment, the feed additive of the present application may be added in various proportions, such as, but not limited to, 0.01 to 300 g, 1 g to 200 g, or 10 g to 100 g per 1 kg of feed on a dry weight basis (i.e., 0.001 wt% to 30 wt%, 0.1 wt% to 20 wt%, or 1 wt% to 10 wt% relative to the total dry weight of the feed), in accordance with the dosage and administration described above.

[0075] The antiviral material selected from the compounds of formulae 1 to 6 and their pharmaceutically acceptable salts included in the antiviral composition, pharmaceutical composition or feed additive according to the present application exhibits a mechanism for effectively inhibiting the infection and proliferation of a virus by inhibiting the function of inosine monophosphate dehydrogenase (IMP Dehydrogenase, IMPDH) that produces GMP required when a virus invades a cell and carries out gene replication, thereby making the source of viral gene replication insufficient and inhibiting smooth viral gene replication, or by causing abnormalities in the functional proteins of the virus that are inserted into the replication process as guanosine analogs and produced as final products during the viral gene replication process, thereby reducing infectivity.

[0076] The well-known mechanisms of action of some nucleoside analogues, such as immune modulation, increased expression of interferon stimulating factors, inhibition of viral RNA polymerase, etc., may also be mechanisms selected from the compounds of formulae 1 to 6 and their pharmaceutically acceptable salts included in the antiviral composition, pharmaceutical composition or feed additive according to the present application.

[0077]

[0078] Hereinafter, to facilitate understanding of this application, examples will be provided in detail. However, the following examples are intended only to illustrate the contents of this application and are not intended to limit the scope of this application. The examples in this application are provided to provide a more complete explanation of this application to those of average skill in the art.

[0079] [Example]

[0080] Manufacturing Example 1: Manufacturing method of nucleoside analog using inosine monophosphate (IMP), xanthosine monophosphate (XMP), and guanosine monophosphate (GMP)

[0081] 1-1. Method for producing dialdehyde-type nucleosides

[0082] For oxidative cleavage, IMP, XMP, or GMP (manufactured and supplied by CJ CheilJedang) dissolved in water is prepared using periodate (NaIO4) as a catalyst and an organic solvent, and then filtered using filter paper, and the permeate is purified using an anion exchange resin (WA30) and then freeze-dried to obtain the final product (Maria Meurillon et al., 2014 Eur. J. Med. Chem. 77:18-37).

[0083]

[0084] 1-2. Manufacturing method of acyclic diol type nucleoside

[0085] For oxidative cleavage, IMP, XMP, or GMP (manufactured and supplied by CJ CheilJedang) dissolved in water is prepared using periodate (NaIO4) as a catalyst and an organic solvent, then filtered using filter paper, and sodium borohydride (NaBH4) is added to the permeate for reduction, followed by freeze-drying to obtain the final product (Maria Meurillon et al., 2014 Eur. J. Med. Chem. 77:18-37).

[0086]

[0087] Example 1: African Swine Fever Virus (ASFV)

[0088] To evaluate the virus infection and inhibitory efficacy of inosine, xanthosine, and guanosine in dialdehyde form and acyclic diol form against African swine fever virus (ASFV, China / 2018 / AnhuiXCGQ), porcine alveolar macrophages (PAM cell line) were seeded in a 48-well plate at a density of 0.5x10 5 After seeding cells / well, they were cultured for one day. The next day, 1 MOI of ASFV and dialdehyde and acyclic diol forms of inosine, xanthosine, and guanosine were simultaneously treated to the cells, and after 2 days, DNA was extracted from the infected cells using a Viral gene (DNA / RNA) extraction kit (iNtRON, 101410754). The antiviral efficacy of the materials was verified using the extracted DNA with ASFV-specific primers (F-AGTTCGGATGTCACAACGCT, R-ACTGGTTCCCTCCACCGATA) and real-time RT-qPCR experiment (95℃, 5 min, 1 cycle, 95℃, 10 sec, 65℃, 30 sec, 56℃, 60 sec, 40 cycles).

[0089] As shown in [Table 1], when inosine, xanthosine, and guanosine in dialdehyde form and acyclic diol form were treated to cells, it was confirmed that ASFV infection and proliferation were inhibited. The best effect (IC) was observed in the dialdehyde form of guanosine. 50: 79.0 μM), and inosine and xanthosine showed antiviral effects in that order. In addition, materials in the form of acyclic diol also showed antiviral effects against ASFV in the order of guanosine, inosine, and xanthosine.

[0090] ASFV infection inhibition concentration, cytotoxicity, and selectivity index (IC) of inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms 50 CC 50 SIDialdehyde-Inosine< 96.6 uM (±1.26)> 10000 uM> 103.5Dialdehyde-Xanthosine< 110.0 uM (±1.1)> 10000 uM> 90.9Dialdehyde-Guanosine< 79.0 uM (±1.0)> 6000 uM> 75.9Acyclic diol-Inosine< 353.0 uM (±1.1)> 10000 uM> 28.3Acyclic diol-Xanthosine< 1165 uM (±1.1)> 10000 uM> 8.6Acyclic diol-Guanosine< 270.0 uM (±1.6)> 10000 uM> 37.0

[0091] Example 2: Classical Swine Fever Virus (CSFV)

[0092] To evaluate the virus infection and inhibitory efficacy of inosine, xanthosine, and guanosine in the dialdehyde form and acyclic diol form against swine cholera virus (CSFV), porcine kidney cells (PK15 cell line) were seeded in a 96-well plate at a density of 1x10 4 After seeding cells / well, 100 TCID 50 / well of CSFV and dialdehyde and acyclic diol forms of inosine, xanthosine, and guanosine were simultaneously treated to cells, and RNA was isolated from the infected cells after 2 days using a commercially available Viral RNA extraction kit (Ribospin™ vRD Ⅱ). The antiviral efficacy of the materials was verified using the isolated RNA and real-time RT-qPCR experiment (95°C, 15 min, 1 cycle, 95°C, 20 sec, 58°C, 40 sec, 40 cycles) using CSFV-specific primers (F-CTCTGGTCAGGGTGCTCAAG, R-GAGGGACTGTGCAACCATCA).

[0093] As shown in [Table 2], the inhibitory effects of inosine, xanthosine, and guanosine in the dialdehyde form and acyclic diol form on CSFV infection and proliferation were confirmed. The dialdehyde form of xanthosine showed the best effect (IC 50 : 156.7 μM) and showed antiviral effects in the order of guanosine and inosine. Additionally, in the acyclic diol form, the IC was in the order of inosine, xanthosine, and guanosine. 50 showed a value, and relatively higher IC than dialdehyde type materials. 50 The value was indicated.

[0094] Inhibitory concentrations, cytotoxicity, and selectivity index (IC) of CSFV infection by inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms 50 CC 50SIDialdehyde-Inosine< 238.3 uM (±85.3)> 10000 uM> 42.0Dialdehyde-Xanthosine< 156.7 uM (±65.2)> 10000 uM> 63.8Dialdehyde-Guanosine< 165.2 uM (±15.6)> 6000 uM> 36.1Acyclic diol-Inosine< 1754 uM (±302.5)> 10000 uM> 5.7Acyclic diol-Xanthosine< 2960 uM (±371.5)> 10000 uM> 3.4Acyclic diol-Guanosine< 3608 uM (±868.5)> 10000 uM>2.8

[0095] Example 3: Low pathogenic avian influenza virus (LPAIV)

[0096] To evaluate the inhibitory effects of inosine, xanthosine, and guanosine in dialdehyde form and acyclic diol form on virus infection and proliferation against low pathogenic avian influenza (LPAIV, H9N2), canine kidney cells (MDCK cell line) were seeded in 96-well plates at a density of 1.4 × 10 4 After seeding cells / well, culture for one day. The next day, 20 TCID 50 / well LPAIV and dialdehyde and acyclic diol forms of inosine, xanthosine, and guanosine were simultaneously treated to cells, and RNA was isolated from infected cells after 2 days using a commercially available Viral RNA extraction kit (Ribospin™ vRD Ⅱ). The antiviral efficacy of the materials was verified using the extracted RNA with LPAIV-specific primers (F-GCTAGGCAGATGGTACAGGC, R-TGCACTCCCATCCGTTTCTG) and real-time RT-qPCR experiment (95℃, 15 min, 1 cycle, 95℃, 20 sec, 58℃, 40 sec, 40 cycles).

[0097] As can be seen in [Table 3], the dialdehyde form of guanosine showed the best efficacy (IC 50 : 102.2 μM), and the antiviral efficacy against LPAIV was confirmed in the order of xanthosine and inosine. In addition, materials in the form of acyclic diol showed antiviral efficacy against LPAIV in the order of guanosine, inosine, and xanthosine.

[0098] Inhibitory concentration, cytotoxicity, and selectivity index (IC) of LPAIV by inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms 50 CC 50SIDialdehyde-Inosine< 267.7 uM (±131.0)> 10000 uM> 37.4Dialdehyde-Xanthosine< 221.8 uM (±20.6)> 10000 uM> 45.1Dialdehyde-Guanosine< 102.2 uM (±2.0)> 6000 uM> 58.7Acyclic diol-Inosine< 1811 uM (±101.8)> 10000 uM> 5.5Acyclic diol-Xanthosine< 2005 uM (±697.9)> 10000 uM> 5.0Acyclic diol-Guanosine< 1336 uM (±246.8)> 10000 uM>7.5

[0099]

[0100] Example 4: Canine coronavirus (CCoV)

[0101] To evaluate the viral infection and inhibitory efficacy of inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms against canine coronavirus (CCoV), canine fibroblasts (A-72 cell line) were seeded in 96-well plates at a density of 1.4 x 10 4 After seeding cells / well, culture for one day. The next day, 50 TCID 50 / well CCoV and dialdehyde and acyclic diol forms of inosine, xanthosine, and guanosine were simultaneously treated to cells, and RNA was extracted from the infected cells after 2 days using a commercially available Viral RNA extraction kit (Ribospin™ vRD Ⅱ). The antiviral efficacy of the materials was verified using the extracted RNA with CCoV-specific primers (F-TGAAGGTGTGCCAACTGGTGT, R-GCCCATCCTGTCGCACTACT) and real-time RT-qPCR experiment (95℃, 15 min for 1 cycle, 95℃, 20 sec, 58℃, 40 sec for 40 cycles).

[0102] As can be seen in [Table 4], excellent efficacy (IC) was observed in the dialdehyde form of inosine and xanthosine. 50 : 45.1 μM and 43.0 μM), and guanosine showed an IC of 109.7 μM. 50 The values ​​were shown. Additionally, materials in the form of acyclic diols were observed to have antiviral efficacy against CCoV in the order of inosine, guanosine, and xanthosine.

[0103] Inhibitory concentrations, cytotoxicity, and selectivity indices (IC) of CCoV infection by inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms 50 CC 50SIDialdehyde-Inosine< 45.1 uM (±0.8)> 10000 uM> 221.7Dialdehyde-Xanthosine< 43.0 uM (±0.3)> 10000 uM> 232.6Dialdehyde-Guanosine< 109.7 uM (±12.1)> 6000 uM> 54.7Acyclic diol-Inosine<1273 uM (±112.4)> 10000 uM> 7.9Acyclic diol-Xanthosine<2603 uM (±265.2)> 10000 uM> 3.8Acyclic diol-Guanosine<2244 uM (±178.9)> 10000 uM> 4.5

[0104]

[0105] Example 5: Canine adenovirus (CAV)

[0106] To evaluate the virus infection and inhibitory efficacy of inosine, xanthosine, and guanosine in the dialdehyde form and acyclic diol form against canine coronavirus (CAV), monkey kidney cells (Vero cell line) were seeded at 2x10 in a 96-well plate. 4 After seeding cells / well, culture for one day. The next day, 100 TCID 50 / well CAV and dialdehyde and acyclic diol forms of inosine, xanthosine, and guanosine were simultaneously treated to cells, and after 2 days, DNA was extracted from the infected cells using a commercially available Viral gene (DNA / RNA) extraction kit (iNtRON, 101410754). The antiviral efficacy of the materials was verified using the extracted DNA with CAV-specific primers (F-CGCTGAACATTACTACCTTGTC, R-GCAGAGTCTAGAACAAATGGC) and real-time RT-qPCR experiment (95℃, 5 min, 1 cycle, 95℃, 15 sec, 60℃, 30 sec, 40 cycles).

[0107] As shown in [Table 5], the inhibitory effects of CAV infection and proliferation by inosine, xanthosine, and guanosine in dialdehyde form and acyclic diol form were confirmed. The best effect (IC) was observed in the dialdehyde form of guanosine. 50 : 85.9 μM), and showed antiviral effects in the order of xanthosine and inosine. Additionally, in the acyclic diol form, xanthosine, inosine, and guanosine showed antiviral effects in the order of xanthosine, inosine, and guanosine, and had a relatively high IC compared to the dialdehyde form. 50 The value was indicated.

[0108] CAV infection inhibition concentration, cytotoxicity, and selectivity index (IC) of inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms 50 CC 50SIDialdehyde-Inosine< 325.6 uM (±119.3)> 10000 uM> 30.7Dialdehyde-Xanthosine< 129.5 uM (±1.4)> 10000 uM> 77.2Dialdehyde-Guanosine< 85.9 uM (±0.3)> 6000 uM> 69.8Acyclic diol-Inosine< 1779 uM (±86.3)> 10000 uM> 5.6Acyclic diol-Xanthosine< 1353 uM (±157.0)> 10000 uM> 7.4Acyclic diol-Guanosine< 4133 uM (±755.9)> 10000 uM> 2.4

[0109]

[0110] Example 6: Canine distemper virus (CDV)

[0111] To evaluate the virus infection and inhibitory efficacy of inosine, xanthosine, and guanosine in the dialdehyde form and acyclic diol form against canine coronavirus (CDV), monkey kidney cells (Vero cell line) were seeded at 2x10 in a 96-well plate. 4 After seeding cells / well, culture for one day. The next day, 100 TCID 50 / well of CAV and dialdehyde and acyclic diol forms of inosine, xanthosine, and guanosine were simultaneously treated to cells, and RNA was extracted from the infected cells after 3 days using a commercially available Viral RNA extraction kit (Ribospin™ vRD Ⅱ). The antiviral efficacy of the materials was verified using the extracted RNA with CDV-specific primers (F-GCTTACTTCAGACTCGGGCAAGAAATGGTTA, R-CAGTAGCTCGAATTGTCCGGTCCTCTGTTGT) and real-time RT-qPCR experiment (95℃, 10 min, 1 cycle, 95℃, 15 sec, 60℃, 30 sec, 72℃, 30 sec, 40 cycles).

[0112] As can be seen in [Table 6], the dialdehyde form of xanthosine showed the best efficacy (IC 50 : 79.9 μM), and the inhibitory effects on virus infection and proliferation were confirmed in the order of inosine and guanosine. The material in the form of acyclic diol showed a slightly higher concentration of IC than the material in the form of dialdehyde. 50 The values ​​showed antiviral efficacy, and the efficacy ranking was confirmed to be xanthosine, guanosine, and inosine.

[0113] CDV infection inhibition concentration, cytotoxicity, and selectivity index (IC) of inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms 50 CC 50SIDialdehyde-Inosine< 106.5 uM (±8.9)> 10000 uM> 93.9Dialdehyde-Xanthosine< 79.9 uM (±21.8)> 10000 uM> 125.1Dialdehyde-Guanosine< 129.0 uM (±39.5)> 6000 uM> 46.5Acyclic diol-Inosine< 2698 uM (±206.5)> 10000 uM> 3.7Acyclic diol-Xanthosine< 2046 uM (±545.2)> 10000 uM> 4.9Acyclic diol-Guanosine< 2121 uM (±125.2)> 10000 uM> 4.7

[0114]

[0115] Example 7: Feline parvovirus (FPV)

[0116] To evaluate the viral infection and inhibitory efficacy of inosine, xanthosine, and guanosine in the dialdehyde form and acyclic diol form against feline parvovirus (FPV), feline kidney cells (CRFK cell line) were seeded in 48-well plates at a density of 3x10 4 Cells were seeded per well and cultured for one day. The next day, 100 TCID 50 / well FPV and inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms were simultaneously treated to cells, and after 2 days, DNA was extracted from the infected cells using a commercially available Viral gene (DNA / RNA) extraction kit (iNtRON, 101410754). The antiviral efficacy of the materials was verified using FPV-specific primers (F-AGAGCATTGGGCTTACCACC, R-CCCCATTTGAGTTACACCACG) and real-time RT-qPCR experiment (95℃, 15 min for 1 cycle, 95℃, 20 s, 58℃, 30 s, 72℃, 30 s for 40 cycles).

[0117] As can be seen in [Table 7], when inosine, xanthosine, and guanosine in the dialdehyde form and acyclic diol form were treated to cells, it was confirmed that infection and proliferation of FPV were inhibited. The dialdehyde form of xanthosine showed the greatest efficacy (IC 50 : 31.0 μM) and confirmed excellent effects in the order of guanosine and inosine. In addition, in the acyclic diol form, IC was in the order of guanosine, inosine, and xanthosine. 50 I was able to check the value.

[0118] Inhibitory concentrations, cytotoxicity, and selectivity indices (IC) of inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms against FPV infection 50 CC 50SIDialdehyde-Inosine< 52.0 uM (±1.6)> 10000 uM> 192Dialdehyde-Xanthosine< 31.0 uM (±7.9)> 8000 uM> 258Dialdehyde-Guanosine< 38.0 uM (±21.8)> 6000 uM> 158Acyclic diol-Inosine< 1867 uM (±241.7)> 10000 uM> 5.4Acyclic diol-Xanthosine< 5750 uM (±246.1)> 10000 uM> 1.7Acyclic diol-Guanosine< 530 uM (±594.0)> 10000 uM> 1.9

[0119]

[0120] Example 8: Verification of Infection Inhibition Efficacy Against Feline Calicivirus (FCV)

[0121] To evaluate the viral infection and inhibitory efficacy of inosine, xanthosine, and guanosine in the dialdehyde form and acyclic diol form against feline calicivirus (FCV), feline kidney cells (CRFK cell line) were seeded at 3x10 in a 48-well plate. 4 Cells were seeded per well and cultured for one day. The next day, 100 TCID 50 / well FCV and inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms were simultaneously treated in cells, respectively, and RNA was extracted from the infected cells 24 hours later using a commercially available Viral RNA extraction kit (Ribospin™ vRD Ⅱ). The antiviral efficacy of the materials was verified using FCV-specific primers (F-GCAAAGATCCGGCTTGCCTC, R-CGCTGTTGACCAAGTGCAGC) and real-time RT-qPCR experiment (95℃, 15 min, 1 cycle, 95℃, 20 s, 58℃, 30 s, 72℃, 30 s, 40 cycles).

[0122] As shown in [Table 8], when inosine, xanthosine, and guanosine in dialdehyde form and acyclic diol form were treated to cells, it was confirmed that infection and proliferation of FCV were inhibited. The dialdehyde form of guanosine showed the greatest efficacy (IC 50 : 18.2 μM), and the excellent effects were confirmed in the order of xanthosine and inosine. In addition, in the material in the form of acyclic diol, the efficacy was shown in the order of guanosine, xanthosine, and inosine.

[0123] Inhibitory concentration, cytotoxicity, and selectivity index (IC) of FCV by inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms 50 CC 50SIDialdehyde-Inosine< 26.0 uM (±12.4)> 10000 uM> 384.6Dialdehyde-Xanthosine< 20.1 uM (±3.4)> 8000 uM> 398.0Dialdehyde-Guanosine< 18.2 uM (±3.7)> 6000 uM> 329.7Acyclic diol-Inosine< 362.4 uM (±116.0)> 10000 uM> 27.6Acyclic diol-Xanthosine< 155.1 uM (±67.2)> 10000 uM> 64.5Acyclic diol-Guanosine< 133.1 uM (±30.8)> 10000uM>75.1

[0124]

[0125] Example 9: Feline infectious peritonitis virus (FIPV)

[0126] To evaluate the virus infection and inhibitory efficacy of inosine, xanthosine, and guanosine in dialdehyde form and acyclic diol form against feline peritonitis virus (FIPV), feline fetal cells (FCWF-4 cell line) were seeded in 96-well plates at a density of 2x10 4 After seeding cells / well, culture for one day. The next day, 100 TCID 50 / well of FIPV and dialdehyde and acyclic diol forms of inosine, xanthosine, and guanosine were simultaneously treated to cells, and RNA was extracted from the infected cells after 2 days using a commercially available Viral RNA extraction kit (Ribospin™ vRD Ⅱ). The antiviral efficacy of the materials was verified using the extracted RNA with FIPV-specific primers (F-TGGCATCTTGCTAACTGGAACT, R-TGCCATAAACGAGCCAGCTA) and real-time RT-qPCR experiment (95℃, 15 min for 1 cycle, 95℃, 30 sec, 58℃, 40 sec for 40 cycles).

[0127] As can be seen in [Table 9], the dialdehyde form of inosine showed excellent infection and proliferation inhibition efficacy (IC) against FIPV. 50 : 45.5 μM), and the most effective were confirmed in the order of guanosine and xanthosine. Nevertheless, the IC between each material 50 The difference in values ​​was not significant. In addition, the acyclic diol form showed antiviral efficacy against FIPV in the order of inosine, xanthosine, and guanosine.

[0128] Inhibitory concentrations, cytotoxicity, and selectivity indices (IC) of FIPV infection by inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms. 50 CC 50SIDialdehyde-Inosine< 45.5 uM (±1.8)> 10000 uM> 219.9Dialdehyde-Xanthosine< 55.1 uM (±12.7)> 10000 uM> 181.4Dialdehyde-Guanosine< 52.8 uM (±14.3)> 6000 uM> 113.7Acyclic diol-Inosine<872.3 uM (±0)> 10000 uM> 11.5Acyclic diol-Xanthosine<1025 uM (±78.5)> 10000 uM> 9.8Acyclic diol-Guanosine<1511 uM (±880.4)> ​​10000 uM> 6.6

[0129]

[0130] Example 10: Foot and Mouth Disease Virus (FMDV)

[0131] To evaluate the inhibitory effects of dialdehyde forms of inosine, guanosine, and acyclic diol forms of inosine, xanthosine, and guanosine on foot-and-mouth disease virus (FMDV) infection, hamster kidney cells (BHK-21 cell line) were seeded at 5x10 in 48-well plates. 4After seeding cells / well, culture was performed for one day. The following day, the cells were simultaneously treated with FMDV at an MOI of 0.01 and inosine in the dialdehyde form, guanosine, and inosine, xanthosine, and guanosine in the acyclic diol form. After 36 hours, RNA was extracted from the infected cells using a commercially available Viral RNA extraction kit (Ribospin™ vRD Ⅱ). The antiviral efficacy of the extracted RNA was verified using FMDV-specific primers (F-CCGACCCCTCATTCAGCAGACCTC, R-GAGGGTTCTTTTCCGCGTCGCC) and real-time RT-qPCR experiment (95℃, 5 min 1 cycle, 95℃, 10 sec, 60℃, 30 sec, 40 cycles, 95℃, 15 sec, 60℃, 60 sec, 95℃, 15 sec, 1 cycle melting curve).

[0132] As can be seen in [Table 10], the dialdehyde form of guanosine showed excellent infection and proliferation inhibition efficacy (IC) against FMDV. 50 : 114.8 μM). In the acyclic diol form, inosine, xanthosine, and guanosine showed antiviral efficacy against FMDV in that order, but had a slightly higher IC than the dialdehyde form. 50 The value was indicated.

[0133] FMDV infection inhibition concentration, cytotoxicity, and selectivity index (IC) of inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms 50 CC 50SIDialdehyde-Inosine< 436.5 uM (±0.037)> 10000 uM> 22.9Dialdehyde-Guanosine< 114.8 uM (±0.021)> 6000 uM> 52.3Acyclic diol-Inosine< 1202.3 uM (±0.026)> 10000 uM> 8.3Acyclic diol-Xanthosine< 1995.3 uM (±0.041)> 10000 uM> 5.0Acyclic diol-Guanosine< 2060.6 uM (±0.016)> 10000 uM> 4.9

[0134]

[0135] Example 11: Evaluation of the immune-enhancing efficacy of nucleic acid-derived nucleoside analogs.

[0136] In order to confirm the efficacy of nucleoside analogues in enhancing the expression of interferon stimulating genes, which is one of the representative antiviral mechanisms (Johnson YN Lau, et al. 2002. Mechanism of action of Ribavirin in the combination treatment of chronic HCV infection. Hepatology. 35(5):1002-9. Doi: 10.1053 / jhep.2002.32672, Paeshuyse J., et al., 2011. Ribavirin for the treatment of chronic hepatitis C virus infection: a review of the proposed mechanism of action. Curr. Opin. Virol. 1: 590-598. Doi: 10.1016 / j.coviro.2011.10.030), dialdehyde forms of inosine, xanthosine, and guanosine and acyclic The effect of increasing the expression of ISG15, Mx1, and RNaseL, which are representative interferon-stimulating genes that are very important in inducing an antiviral immune state, was evaluated using inosine, xanthosine, and guanosine in diol form. Porcine alveolar macrophages (PAM cell line) were seeded in 48-well plates at a density of 1x10 5After seeding cells / well, culture was performed for one day. The next day, the cells were treated with inosine, xanthosine, and guanosine in dialdehyde form and inosine, xanthosine, and guanosine in acyclic diol form, and after 12 hours, RNA was extracted from the infected cells using a commercial easy-spin [DNA free] total RNA extraction kit (iNtRON). The extracted RNA was quantified to the same amount of genes using porcine beta-actin (F- GACCACCTTCAACTCGATCA, R-GTGTTGGCGTAGAGGTCCTT), and then the expression rate of the immunomodulatory factors of the materials was verified using real-time RT-qPCR experiment (95℃, 5 min 1 cycle, 95℃, 10 sec, 65℃, 30 sec, 56℃, 60 sec 40 cycles) using ISG15, Mx1, and RNaseL specific primers (ISG15: F-GGTGCAAAGCTTCAGAGACC, R-GTCAGCCAGACCTCATAGGC / Mx1: F-AGCGCAGTGACACCAGCGAC, R-GCCCGGTTCAGCCTGGGAAC / RNaseL: F-GCCAGACCTAGTGGCTTCTG, R-AGAGGCCCAGAGAGTTGTGA).

[0137] As shown in [Table 11], it was confirmed that the expression of Interferon stimulating genes (ISG15, Mx1, RNaseL) was increased by inosine, xanthosine, and guanosine in the dialdehyde form and acyclic diol form. It was observed that the expression of the ISG15 gene increased 4-4.7 times, the expression of the Mx1 gene increased 3.5 times, and the expression of the RNaseL gene increased 2.5-3.4 times by inosine, xanthosine, and guanosine in the dialdehyde form. Inosine, xanthosine, and guanosine in the form of acyclic diol increased the expression of the ISG15 gene by 4.2 to 6.3 times, the expression of the Mx1 gene by 2.8 to 4.0 times, and the expression of RNaseL by 1.7 to 3.0 times. This increase in interferon-stimulating genes indicates that dialdehyde- and acyclic diol-type materials have an immune-enhancing effect for inducing antiviral efficacy.

[0138] Expression levels of interferon stimulating genes by inosine, xanthosine, and guanosine in dialdehyde and acyclic diol forms (2 -ΔΔCt value) ClassificationFold change (fold increase compared to the control group)ISG15Mx1RNaseLDialdehyde-Inosine (400 uM)4.0 (±0.6)3.5 (±1.1)3.0 (±0.2)Dialdehyde-Xanthosine (400 uM)4.5 (±0.4)3.5 (±1.0)3.4 (±0.2)Dialdehyde-Guanosine (400 uM)4.7 (±0.3)3.5 (±0.7)2.5 (±0.1)Acyclic diol-Inosine (4000 uM)6.3 (±0.4)2.8 (±0.9)2.0 (±0.3)Acyclic diol-Xanthosine (4000 uM)4.7 (±1.3)2.7 (±1.4)1.7 (±0.3)Acyclic diol-Guanosine (4000 uM)4.2 (±1.5)4.0 (±1.2)3.0 (±0.8)Positive control (INF-β, 20 ng)21.1 (±8.81)20.0 (±3.1)2.9 (±0.9)

Claims

1. An antiviral composition comprising at least one nucleoside analog selected from the group consisting of nucleoside analogs of the following chemical formulas 1 to 6 and pharmaceutically acceptable salts thereof: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] [Chemical Formula 5] [Chemical Formula 6] .

2. A composition according to claim 1, wherein the virus is at least one virus selected from the group consisting of African Swine Fever Virus (ASFV), Classical Swine Fever Virus (CSFV), Low pathogenic Avian influenza virus (LPAIV), Canine coronavirus (CCoV), Canine adenovirus (CAV), Canine distemper virus (CDV), Feline parvovirus (FPV), Feline Calicivirus (FCV), Feline infectious peritonitis virus (FIPV, also known as Feline Coronavirus (FCoV), and Foot and Mouth disease virus (FMDV).

3. An immunomodulatory composition comprising at least one nucleoside analog selected from the group consisting of nucleoside analogs of the following chemical formulas 1 to 6 and pharmaceutically acceptable salts thereof: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] [Chemical Formula 5] [Chemical Formula 6] .

4. A composition according to claim 1 or 2, characterized in that it is a pharmaceutical composition or a food composition.

5. A feed additive comprising at least one nucleoside analog selected from the group consisting of nucleoside analogs of the following chemical formulas 1 to 6 and pharmaceutically acceptable salts thereof: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] [Chemical Formula 5] [Chemical Formula 6] .

6. A feed additive for mammals, birds, fish or arthropods according to paragraph 5.

7. Feed comprising at least one nucleoside analog selected from the group consisting of nucleoside analogs of the following chemical formulas 1 to 6 and pharmaceutically acceptable salts thereof: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] [Chemical Formula 5] [Chemical Formula 6] .

8. Feed according to paragraph 7, which is for mammals, birds, fish or arthropods.

9. A method for preventing, improving or treating a virus, comprising administering to a subject at least one nucleoside analog selected from the group consisting of nucleoside analogs of the following chemical formulae 1 to 6 and pharmaceutically acceptable salts thereof: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] [Chemical Formula 5] [Chemical Formula 6] .

10. An immunomodulatory method comprising administering to a subject at least one nucleoside analog selected from the group consisting of nucleoside analogs of the following chemical formulae 1 to 6 and pharmaceutically acceptable salts thereof: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] [Chemical Formula 5] [Chemical Formula 6] .