Destabilized are 3' utrs of tead1 and yap1 as pan cancer therapeutics
Patent Information
- Application Number
- ZA202607803
- Authority / Receiving Office
- ZA · ZA
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-09
- Filing Date
- 2026-07-29
- Publication Date
- 2026-08-26
AI Technical Summary
Current therapeutic treatments are elusive for diseases and disorders associated with aberrant YAP1/TEAD1 expression, particularly in cancer, obesity, and liver diseases, due to the incomplete understanding of the Hippo pathway and the difficulty in targeting transcription factor/cofactor complexes.
Development of destabilized 3' UTR RNA molecules encoding TEAD1 or YAP1 proteins, which are reverse transcribed into DNA and transfected into vectors, leading to the outcompeting and degradation of wildtype RNA transcripts, thereby reducing TEAD1/YAP1 expression.
The approach effectively decreases TEAD1/YAP1 expression, inducing cellular size reduction and migration inhibition, and is applicable for treating various diseases including cancer, obesity, and liver diseases.
Abstract
Description
DESTABILIZED ARE 3’ UTRS OF TEAD1 AND YAP1 AS PAN CANCER THERAPEUTICS AND FOR THERAPEUTIC TARGETING OF HIPPO PATHWAY IN OBESITY, NASH (MASH), AFLD, NAFLD, AND STEATOSIS AND LIVER DISEASESCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This Application claims the benefit of U.S. Application No. 63 / 551,919, filed on February 09, 2024, the contents of which are incorporated herein by reference in their entirety.REFERENCE TO SEQUENCE LISTING
[0002] This Sequence Listing submitted February 07, 2025 as a .xml file named“38331. OOOlPl.xml,” created on February 03, 2025, and having a size of 151,552 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).BACKGROUND
[0003] Originally described as an organ size and tissue growth control mechanism (Huang et al. (2005) Cell 122: 421-434), the Hippo pathway has gained recognition in the fields of regenerative medicine and oncology in the past several years. Hippo functions as a tissue growth and cell proliferation inhibitory pathway. Extracellular stimuli activate the core kinase cascade that results in the phosphorylation of the transcriptional coactivators yes-associated protein 1 (YAP1) and transcriptional coactivator with PDZ-binding motif (TAZ, gene name WWTRJ), resulting in their sequestration in the cytoplasm (Hippo-on state). When in the nucleus, YAP1 and TAZ interact with the Transcription Enhanced Associated Domain (TEAD) transcription factors (TEAD1-4), the most well-known transcriptional mediators of the YAP1 and TAZ function (Hippo-off state) (Dey et al. (2020) Nat. Rev. Drug Discov. 19: 480-494). In the Hippo- off state, the YAP1 / TAZ-TEAD complex drives the induction of genes involved in proliferation and cell survival (Piccolo et al. (2014) Physiol. Rev. 94: 1287-1312). This interaction with TEADs is necessary for the growth-promoting properties of YAP1 and TAZ as many of the effects of the YAP1 transcriptional activity can be blunted by eliminating the YAP1-TEAD interaction (Wu et al. (2008) Dev. Cell 14: 388-398; Kapoor et al. (2014) Cell 158: 185-197;Schlegelmilch et al. (2011) Cell 144: 782-795; Zhao et al. (2008) Genes Dev. 22: 1962-1971).Many of the growth-promoting phenotypes observed after YAP1 activation are capable of leading to tumor formation, and, thus, TEADs likely play an integral role in this process (Dong et al. 2007; Schlegelmilch et al. 2011; Zhang et al. (2010) Dev. Cell 19: 27-38; Lamar et al. (2012) Proc. Natl. Acad. Sci. USA 109: E2441-E2450). Whether the four TEAD protein family members, TEAD 1-4, have the same or slightly different functions in this process is not yet understood and still a matter of research (reviewed in Currey et al. (2021) Development 148: 196675). From the structure and sequence points of view, all TEAD proteins share the same domain structures and are highly homologous in their YAP 1 -binding domain (Zhou et al. (2016) Ini. J. Mol. Sci. 17: 138).
[0004] Overexpression of, or increased levels of nuclear localized YAP1 have been found in numerous solid tumor types. In addition to general overexpression or accumulation of YAP1 staining in tumor cells (often termed “YAP1 activation”), several members of the Hippo pathway are known to be altered in human cancer at the DNA level, including amplification of YAP1 and TAZ, as well as genomic deletions or truncating mutations in NF2,LATS1 &n LATS2 (Sanchez-Vega et al. (2018) Cell 173: 321-337; Wang et al. (2018) Cell Rep. 25: 1304-1317).
[0005] Although much of the early research related to the oncogenic potential of YAP 1 and TAZ centered on their role as cell-autonomous drivers, there is growing evidence that these transcriptional cofactors might play a much wider function than simply stimulating proliferation or inducing antiapoptotic factors. It is becoming clear that YAP1 and TAZ are multifaceted regulators of the processes driving tumor growth. Some of these attributes include, but are not limited to: (1) broadly regulating the tumor microenvironment (TME), including impacting antitumor immunity; (2) driving resistance to a wide array of drugs (including cytotoxic and targeted agents); and (3) acting as a tumor-intrinsic oncogenic driver (Dey et al. 2020; Zanconato et al. (2019) Nat. Rev. Cancer 19: 454-464; Huh et al. (2019) Cells 8: 600).
[0006] Generally considered to be extremely difficult or impossible to target by traditional small-molecule approaches, transcription factor / cofactor complexes are of critical importance to cellular differentiation, as well as a variety of diseases, including cancer, obesity, liver diseases, and cardiac diseases, and, thus, represent highly attractive drug targets (Henley et al. (2021) Nat. Rev. Drug Discov. 20: 669-688). This wide array of biological functions has sparked a plethoraof research targeting the pathway, and in particular the YAP1-TEAD interaction. Unfortunately, despite this research, therapeutic treatments to target TEAD1 and YAP1 have remained elusive. A key limiting factor is the incomplete understanding of the physiological functions of the Hippo pathway. Thus, there is a need for molecules, compositions, and methods to treat diseases and disorders in which aberrant YAP1 / TEAD1 expression is a contributing factor.SUMMARY
[0007] The invention, in one aspect, relates to destabilized 3’UTRs of ribonucleic acid (RNA) molecules that encode for TEAD1 or YAP1 protein. The destabilization occurs in an untranslated adenylate-uridylate rich element (ARE) stabilizing motif of the 3’UTR of the RNA molecule. The destabilized RNA molecule can be used to reverse transcribe a deoxyribonucleic acid (DNA) molecule, which can then be transfected into a vector that can be formulated as a pharmaceutical composition. Upon administration (e. , to a cell, to a subject), the DNA construct transcribes the destabilized 3’UTR of mRNA molecules that outcompete the wildtype RNA molecules that encode TEAD1 or YAP1 protein, resulting in the rapid degradation of the transcripts of the wildtype RNA transcripts, which are outcompeted by the destabilized RNA 3’UTR transcripts. Thus, the disclosed RNA molecules, DNA molecules, vectors, and compositions can be useful in the treatment of a variety of diseases and disorders for which dysregulation of the Hippo pathway is implicated including, but not limited to, cancer, obesity, liver diseases, and cardiac diseases.
[0008] Disclosed are ribonucleic acid (RNA) molecules comprising a 3 ’-untranslated region (3’ UTR) of an mRNA encoding a TEA domain transcription factor 1 (TEAD1) protein, in which one or more adenylate-uridine rich element (ARE) poly(uridylic acid) (poly(U)) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. The 3’ UTR destabilized RNA molecules of the invention may be present with or without being linked to other nucleotide sequences including sequences encoding for the amino acids of the TEAD1 protein.
[0009] Also disclosed are ribonucleic acid (RNA) molecules comprising a 3 ’-untranslated region (3’ UTR) of an mRNA encoding a yes-associated protein 1 (YAP1) protein, in which one or more adenylate-uridine rich element (ARE) poly(uridylic acid) (poly(U)) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ IDNO: 2, and SEQ ID NO: 3. The 3’ UTR destabilized RNA molecules of the invention may be present with or without being linked to other nucleotide sequences including sequences encoding for the amino acids of the YAP1 protein.
[0010] Also disclosed are methods of making a complementary deoxyribonucleic acid (cDNA) molecule, the method comprising reverse transcribing a disclosed RNA molecule to produce the cDNA molecule.
[0011] Also disclosed are cDNA molecules prepared from a disclosed RNA molecule.
[0012] Also disclosed are deoxyribonucleic acid (DNA) molecules comprising in the 5’ -> 3’ direction of transcription relative to synthesis of a disclosed messenger RNA (mRNA) molecule comprising a 3’ UTR of an mRNA encoding a TEAD1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR of a TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
[0013] Also disclosed are deoxyribonucleic acid (DNA) molecules comprising in the 5’ -> 3’ direction of transcription relative to synthesis of a disclosed messenger RNA (mRNA) molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3 ’UTR of a YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
[0014] Also disclosed are plasmid vectors comprising a disclosed DNA molecule.
[0015] Also disclosed are methods of reducing TEAD1 expression in a cell expressing TEAD1, the method comprising transfecting the cell with an amount of a disclosed vector to cause a reduction of TEADl expression.
[0016] Also disclosed are a methods of reducing YAP1 expression in a cell expressing YAP1, the method comprising transfecting the cell with an amount of a disclosed vector to cause a reduction of YAP 1 expression.
[0017] Also disclosed are methods of reducing TEAD1 expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a disclosed vector.
[0018] Also disclosed are methods of reducing YAP1 expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a disclosed vector.
[0019] Also disclosed are pharmaceutical compositions comprising a disclosed plasmid vector and a pharmaceutically acceptable carrier.
[0020] Also disclosed are methods of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a disclosed pharmaceutical composition, wherein the disease or disorder is selected from cancer, obesity, a liver disease, and a cardiac disease.BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The above and other objects, features and advantages of the present invention will become more apparent to those of ordinary skill in the art by describing in detail exemplary aspects thereof with reference to the accompanying drawings.
[0022] FIG. 1A and FIG. IB show representative exemplary nucleotide sequences of the TEAD1 3’ UTR and YAP1 3’ UTR when converted to mRNA. Sequences in grey are the mRNA 3’ polyU stabilizing sequences.
[0023] FIG. 2A and FIG. 2B show representative data illustrating the destabilized 3 ’ UTR of TEAD1 (with destabilizing mRNA sequences marked in grey) and the engineered destabilized 3’ UTR TEAD1 that passed gblock synthesis quality check, which was synthesized by IDT, Inc. The sequences marked in grey show the minimal DCP1A promoter sequences, while the sequences in black represent the engineered destabilized 3’ UTR TEAD1.
[0024] FIG. 3 shows a representative RNA structure of the engineered destabilized 3 ’ UTR TEAD1 in the 5’ to 3’ direction.
[0025] FIG. 4 shows a representative depiction of the 3’ UTR of YAP 1 with polyU sequences changed to destabilized 3; UTR elements are marked in grey.
[0026] FIG. 5 shows a representative depiction of the engineered destabilized 3’ UTR of YAP 1. Sequences marked in grey denote the DCP1A promoter and sequences in black are the engineered destabilized 3’ UTR of YAP 1.
[0027] FIG. 6 shows a representative RNA structure of the engineered destabilized 3’ UTR YAP1 in the 5’ and 3’ direction.
[0028] FIG. 7A and FIG. 7B show representative images illustrating the agarose gel resolution of the vector cut and uncut (FIG. 7A) and PCR amplification of synthetic engineered destabilized 3’ UTR of TEAD1, YAP1, and JUN (FIG. 7B).
[0029] FIG. 8 shows representative images of colonies obtained from ligated TEAD1 vector (left) and YAP1 vector (right).
[0030] FIG. 9 shows representative data illustrating colony PCR amplification of TEAD1 engineered destabilized constructs cloned into the vector.
[0031] FIG. 10 shows representative data illustrating colony PCR amplification of YAP 1 engineered destabilized constructs cloned into the vector.
[0032] FIG. 11 shows representative data illustrating that Clone TD1 or 3’ UTR TEAD1-T1 successfully maps to the 3’ UTR of TEAD1 (left) and minimal promoter of DCP1A (right). The portion of the target gene that matches to Clone TD1 is indicated with an arrow.
[0033] FIG. 12 shows representative data illustrating that Clone TD3 or 3’ UTR TEAD1-T3 successfully maps to the 3’ UTR of TEAD1 (left) and minimal promoter of DCP1A (right). The portion of the target gene that matches to Clone TD3 is indicated with an arrow.
[0034] FIG. 13 shows representative data illustrating that Clone TD4 or 3’ UTR TEAD1-T4 successfully maps to the 3’ UTR of TEAD1 (left) and minimal promoter of DCP1A (right). The portion of the target gene that matches to Clone TD4 is indicated with an arrow.
[0035] FIG. 14 shows representative data illustrating that Clone TD5 or 3’ UTR TEAD1-5 successfully maps to the 3’ UTR of TEAD1 (left) and minimal promoter of DCP1A (right). The portion of the target gene that matches to Clone TD5 is indicated with an arrow.
[0036] FIG. 15 shows representative data illustrating that Clone YP1 or 3’ UTR YAP1-Y1 successfully maps to the 3’ UTR of YAP 1. The portion of the target gene that matches to Clone YP1 is indicated with an arrow.
[0037] FIG. 16 shows representative data illustrating that Clone YP2 or 3’ UTR YAP-Y2 successfully maps to the YAP1 3’ UTR. The portion of the target gene that matches to Clone YP2 is indicated with an arrow.
[0038] FIG. 17 shows representative data illustrating that Clone YP4 or 3’ UTR YAP-Y4 successfully maps to the YAP1 3’ UTR. The portion of the target gene that matches to Clone YP4 is indicated with an arrow.
[0039] FIG. 18 shows representative data illustrating that Clone YP8 or 3’ UTR YAP-Y8 successfully maps to the YAP1 3’ UTR. The portion of the target gene that matches to Clone YP8 is indicated with an arrow.
[0040] FIG. 19 shows representative data illustrating that Clone YP9 or 3’ UTR YAP-Y9 successfully maps to the YAP1 3’ UTR. The portion of the target gene that matches to Clone YP9 is indicated with an arrow.
[0041] FIG. 20 shows representative data illustrating that Clone Y13 or 3’ UTR YAP-Y13 successfully maps to the YAP1 3’ UTR. The portion of the target gene that matches to Clone Y13 is indicated with an arrow.
[0042] FIG. 21 shows representative images of triple negative breast cancer cell lines that are ethnically diverse (MDA-MB231 and MDA-MB468). Cells are either WT, transduced with vector, or treated with 3’ UTR TEAD1-T1, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1-T5.
[0043] FIG. 22 shows representative images of prostate cancer cell line PC3 and ovarian cancer cell line SKOV3. Cells are either WT, transduced with vector, or treated with 3’ UTR TEAD1- Tl, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1-T5.
[0044] FIG. 23A and 23B show representative images illustrating cancer cell size reduction of triple negative breast cancer cells (MDA-MB468) treated with vector and 3’ UTR TEAD1-T5 construct in a dose dependent manner starting from 2.5 pg, 5 pg, 10 pg, 20 pg, and 40 pg (FIG. 23A) and quantification of the cell size (FIG. 23B).
[0045] FIG. 24A and 24B show representative data illustrating IC50 determination of the engineered destabilized 3’ UTRTEAD1-T5 construct reduction of cancer cell size.
[0046] FIG. 25 shows representative panels of a triple negative breast cancer cell line (MDA- MBA468), a prostate cancer cell line (PC3), and an ovarian cancer cell line (A2780). Cells are WT, transduced with vector, or treated with 3’ UTR YAP1-Y1, Y2, or Y4.
[0047] FIG. 26A-D show a representative heat map illustrating the global gene expression pattern of the MDA-MB468 WT, the MDA-MB468 transduced with vector, and the same cells treated with 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1-T5 constructs.
[0048] FIG. 27A and FIG. 27B show a representative heat map illustrating the global gene expression pattern of theMDA-MB231 WT, the MDA-MB231 transduced with vector, and the same cells treated with 3’ UTR YAP1-T2 or 3’ UTR YAP1-T4 constructs.
[0049] FIG. 28A-E show representative bar graphs of quantitative reverse transcription polymerase chain reaction validation of TEAD1 by engineered destabilized 3’ UTR of TEAD1 in various cancer cell lines.
[0050] FIG. 29A and FIG. 29B show representative bar graphs of normalized TE D1 expression in a dose dependent manner in untreated, vector, and 3’ UTR TEAD1-T5 construct- treated breast cancer cell lines.
[0051] FIG. 30A-C show representative bar graphs of TEAD2, TEAD3, and TEAD4 expression in untreated, vector, and 3’ UTR TEAD1 construct-treated breast and prostate cancer cell lines.
[0052] FIG. 31A and FIG. 31B show representative bar graphs of YAP1 expression in untreated, vector, and 3’ UTR TEAD1 construct-treated prostate cancer cell lines.
[0053] FIG. 32A-D show representative bar graphs of c-MYC or JUN expression in untreated, vector, and 3’ UTR TEADl construct-treated breast and prostate cancer cell lines.
[0054] FIG. 33A and FIG. 33B show representative bar graph of JUN and FOSL1 expression in untreated, vector, and 3’ UTR TEADl construct-treated breast cancer cell lines.
[0055] FIG. 34 shows a representative bar graph of YAP 1 expression in untreated, vector, and 3’ UTR YAP1-Y1-, 3’ UTR YAP1-Y3-, and 3’ UTR YAP 1 - Y4-treated prostate cancer cells.
[0056] FIG. 35A-F show representative graphs illustrating that ICso of 3’ UTR TEADl -T5 treatment compared to standard of care chemotherapeutic agents in cancer cell lines.
[0057] FIG. 36A-F show representative bar graphs comparing cancer cell size of untreated, vector, and 3’ UTR TEADl and 3’UTR YAP1 construct-treated cancer cell lines.
[0058] FIG. 37A and FIG. 37B show representative bar graphs illustrating cell viability in vector and 3’ UTR TEADl construct-treated breast and prostate cancer cell lines.
[0059] FIG. 38A-E show representative bar graphs illustrating the distance of wound healing in untreated, vector, and 3’ UTR TEADl construct-treated cancer cells.
[0060] FIG. 39 shows representative images of wound healing distance (closure) in MDA- MB468 from Day 0 to Day 3 in untreated, vector, and 3’ UTR TEADl -T1-, 3’ UTR TEADl -T3- , 3’ UTR TEADl -T4-, and 3’ UTR TEAD1-T5 -treated cells.
[0061] FIG. 40 shows representative microscopic images of wound healing distance (closure) in 22RV1 from Day 0 to Day 3 in untreated, vector, and 3’ UTR TEADl -T1-, 3’ UTR TEADl -T3-, - 3’ UTR TEADl -T4-, and 3’ UTR TEAD1-T5 -treated cells.
[0062] FIG. 41 shows representative microscopic images of wound healing distance (closure) in A2780 from Day 0 to Day 3 in untreated, vector, and 3’ UTR TEAD1-T3-, 3’ UTR TEAD1-T4-, and 3’ UTR TEADl-T5-treated cells.
[0063] FIG. 42A-C show representative bar graphs illustrating the quantified distance of wound healing of untreated, vector, and 3’ UTR YAP1-Y1-, 3’ UTR YAP1-Y2-, and 3’ UTR YAP1- Y4-treated cancer cell lines.
[0064] FIG. 43A-C show representative Western blot images of TEAD1, GAPDH, MYC, and YAP1 expression in untreated, vector, and 3’ UTRTEAD1 construct-treated cancer cell lines.
[0065] FIG. 44 shows representative immunofluorescence images of YAP1 expression in untreated, vector, and 3’ UTR YAPl-Y2-treated PC3 cells.
[0066] FIG. 45 shows a representative lentiviral vector backbone into which the destabilized 3’ UTR constructs are cloned.
[0067] FIG. 46 shows a representative segment of a vector backbone depicting components near the multiple cloning site, which contains a DCP1 A promoter and a destabilized 3’ UTR TEAD1 DNA sequence.
[0068] FIG. 47 shows a representative segment of a vector backbone depicting components near the multiple cloning site, which contains a DCP1A promoter and a destabilized 3’ UTR YAP1 DNA sequence.
[0069] FIG. 48 shows a representative volcano plot demonstrating that 3’ UTR TEAD1-T5- treated cells down regulate key genes involved in fatty acid, cholesterol, insulin resistance, and metabolic pathways (left-side plot, gray shaded markers.
[0070] FIG. 49 shows a representative list of pathways that are downregulated upon treatment with 3’ UTR TEAD1-T5.
[0071] FIG. 50 shows representative data illustrating that 3’ UTR TEAD1-T5 reduces the viability of the inguinal fat cells X9 in a dose dependent manner.
[0072] FIG. 51A and FIG. 51B show representative data illustrating that 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, and 3’ UTR TEAD1-T5 are specific, and do not impact unrelated oncogenes such as ERBB2.
[0073] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.DETAILED DESCRIPTION
[0074] Herein, it has been demonstrated that translation of endogenous, oncogenic TEAD1 and YAP1 transcripts can be controlled via expression of the recombinant 3’ UTR of TEAD1 and YAP1. Briefly, TEAD1 and YAP1 mRNA transcripts from various cancer types were analyzed to confirm the stabilizing sequences. It was found that the 3’ UTR of TEAD1 and YAP1 are enriched with poly(U) sequences that act as stabilizing AU-rich elements (AREs). One or more of these poly(U) sequences were then replaced with a destabilized ARE element such as CUGC (SEQ ID NO: 1), CCUC (SEQ ID NO: 2), UAAGUUAU (SEQ ID NO: 3), AUUUU (SEQ ID NO: 50), UAACUUAU (SEQ ID NO: 51), and GUAAAUAG (SEQ ID NO: 52), as further detailed herein, to afford a destabilized mRNA construct composed of the 3’ UTR of either TEAD1 or YAP1 (z.e., a disclosed RNA molecule). These destabilized 3’ UTR mRNA constructs were then used to reverse transcribe 3’ UTR DNA constructs (i.e., a disclosed DNA molecule), which were inserted into a lentiviral vector following a promoter (e. , a DCP1A promoter). Upon transfection, the 3’ UTR DNA constructs transcribe destabilized 3’ UTR mRNA constructs in vivo. Overexpression of the destabilized 3’ UTR mRNAs then triggers nonsense mediated decay of the endogenous TEAD1 / YAP1 transcripts. Applying this treatment to cancer cells can induce decreased expression of the TEAD1 / YAP1 interactome, cellular size, and migration capabilities.
[0075] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein may be different from the actual publication dates, which can require independent confirmation.A. DEFINITIONS
[0076] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example,reference to “a molecule,” “an adenylate-uridine rich element,” or “a poly(uridylic acid)” includes mixtures of two or more such molecules, adenylate-uridine rich elements, or poly(uridylic acid)s, and the like.
[0077] As used herein, the terms “about” and “at or about” mean that the amount or value in question can be the value designated some other value approximately or about the same. It is generally understood, as used herein, that it is the nominal value indicated ±10% variation unless otherwise indicated or inferred. The term is intended to convey that similar values promote equivalent results or effects recited in the claims. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but can be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about” or “approximate” whether or not expressly stated to be such. It is understood that where “about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.
[0078] The term “nucleic acid,” as used herein, in addition to DNA and RNA, also comprises a chemical derivatization of a nucleic acid on a nucleotide base, on the sugar or on the phosphate, as well as nucleic acids containing non-natural nucleotides and nucleotide analogs.
[0079] “Fragment” or “fragment of a nucleic acid sequence” relates to a part of a nucleic acid sequence, z.e., a sequence that represents the nucleic acid sequence shortened at the 5'- and / or 3'- end(s). Preferably, a fragment, when it replaces said nucleic acid sequence in a RNA or DNA molecule, retains the destabilizing efficiency. Preferably, a fragment of a nucleic acid sequence comprises at least 80%, preferably at least 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% of the nucleotide residues from said nucleic acid sequence.
[0080] The term “variant” with respect to, for example, nucleic acid sequences, includes any variants, in particular mutants, splice variants, conformations, isoforms, allelic variants, species variants, and species homologs, in particular those that are naturally present. An allelic variant relates to an alteration in the normal sequence of a gene, the significance of which is often unclear. Complete gene sequencing often identifies numerous allelic variants for a given gene. A species homolog is a nucleic acid or amino acid sequence with a different species of origin from that of a given nucleic acid or amino acid sequence. The term “variant” also includes degeneratenucleic acid sequences, wherein a degenerate nucleic acid is a nucleic acid that differs from a reference nucleic acid in codon sequence due to the degeneracy of the genetic code.
[0081] According to the invention, nucleic acid variants include single or multiple nucleotide deletions, additions, mutations, and / or insertions in comparison with the reference nucleic acid. Deletions include removal of one or more nucleotides from the reference nucleic acid. Addition variants comprise 5'- and / or 3'-terminal fusions of one or more nucleotides, such as 1, 2, 3, 5, 10, 20, 30, 50, or more nucleotides. Mutations can include, but are not limited to, substitutions, wherein at least one nucleotide in the sequence is removed and another nucleotide is inserted in its place (such as transversions and transitions), abasic sites, crosslinked sites, and chemically altered or modified bases. Insertions include the addition of at least one nucleotide into the reference nucleic acid.
[0082] The terms “degree of identity” and “% identical” refer, in particular, to a percentage of nucleotides that are identical in an optimal alignment between two sequences to be compared, with said percentage being purely statistical, and the differences between the two sequences can be randomly distributed over the entire length of the sequence. Thus, the degree of identity between a given nucleic acid sequence and a nucleic acid sequence that is a variant of said given nucleic acid sequence will be at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or least 70%. Preferably, the degree of identity will be at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90% or most preferably at least 95%, 96%, 97%, 98%, 99%, or even greater than 99%. The degree of identity is preferably given for a region of at least about 30, at least about 50, at least about 70, at least about 90, at least about 100, at least about 150, at least about 200, at least about250, at least about 300, at least about 350, at least about 400, at least about 450, at least about500, at least about 550, at least about 600, at least about 650, at least about 700, at least about750, at least about 800, at least about 850, at least about 900, at least about 950, at least about1000, at least about 1050, at least about 1100, at least about 1150, at least about 1200, at least about 1250, or at least about 1300 nucleotides. In preferred aspects, the degree of identity is given for the entire length of the reference nucleic acid sequence. Percentage identity is obtained by determining the number of identical positions in which the sequences to be compared correspond, dividing this number by the number of positions compared, and multiplying thisresult by 100. For example, the BLAST program “BLAST 2 sequences,” which is available on the website http: / / www.ncbi.nlm.nih.gov / blast / bl2seq / wblast2.cgi can be used.
[0083] “Sequence similarity” indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. “Sequence identity” between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences.
[0084] The term “derivative” comprises any chemical derivatization of a nucleic acid on a nucleotide base, on the sugar, or on the phosphate. The term “derivative” also comprises nucleic acids that contain nucleotides and nucleotide analogs not occurring naturally. Preferably, a derivatization of a nucleic acid decreases its stability.
[0085] Fragments or variants of specific nucleic acid sequences or nucleic acid sequences having a particular degree of identity to specific nucleic acid sequences preferably have at least one functional property of said specific sequences and preferably are functionally equivalent to said specific sequences, e.g., nucleic acid sequences encoding the some protein or gene similar to those of the specific nucleic acid sequences, or which can account for the degeneracy of the code.
[0086] In various aspects, if a specific nucleic acid sequence is active so as to decrease the translation efficiency and / or the stability of another nucleic acid sequence, a fragment or variant of the specific nucleic acid sequence or a nucleic acid sequence having a particular degree of identity to the specific nucleic acid sequence is also active so as to decrease the translation efficiency and / or the stability of the another nucleic acid sequence (when it replaces the specific nucleic acid sequence). A fragment or variant of the specific nucleic acid sequence or a nucleic acid sequence having a particular degree of identity to the specific nucleic acid sequence can be as active as or more active than the specific nucleic acid sequence. Alternatively, the activity of a fragment or variant of the specific nucleic acid sequence or of a nucleic acid sequence having a particular degree of identity to the specific nucleic acid sequence can be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, or at least 95%, or at least 99% of the activity of the specific nucleic acid sequence.
[0087] As used herein, a “nucleic acid sequence which is derived from a nucleic acid sequence” refers to a nucleic acid which is a variant of the nucleic acid from which it is derived.
[0088] As used herein, the term “expression” is used in its most general meaning and comprises production of RNA or of RNA and protein. It also comprises partial expression of nucleic acids. Furthermore, expression can be transient or stable.
[0089] The nucleic acids described herein can be recombinant and / or endogenous.
[0090] An “isolated molecule,” as used herein, refers to a molecule that is substantially free of other molecules such as other cellular material. The term “isolated nucleic acid” means that the nucleic acid has been (i) amplified in vitro, for example by polymerase chain reaction (PCR), (ii) recombinantly produced by cloning, (iii) purified, for example, by cleavage and gel- electrophoretic fractionation, or (iv) synthesized, for example, by chemical synthesis. An isolated nucleic acid is a nucleic acid available to manipulation by recombinant DNA techniques.
[0091] The term “recombinant” means “made through genetic engineering.”
[0092] As used herein, the phrase “nucleic acid sequence encoding a 3’ UTR in the mRNA molecule” means a nucleic acid sequence containing a DNA template strand coding for said 3'- UTR. Preferably, said nucleic acid sequence comprises a coding strand comprising the same nucleic acid sequence as said 3 '-UTR of the RNA transcript produced (although with thymine replaced for uracil). Thus, as disclosed herein, a “nucleic acid sequence encoding a 3’ UTR in the mRNA molecule,” comprises a coding strand comprising a 3'-UTR as specified herein (although with thymine replaced for uracil).
[0093] The terms “operable linkage” and “operatively linked” mean a connection within a functional relationship. A nucleic acid is “operatively linked” if it is functionally related to another nucleic acid sequence. For example, a promoter is functionally linked to a nucleic acid sequence (e.g., a nucleic acid sequence encoding a 3’ UTR in a mRNA molecule) if it influences transcription of said nucleic acid sequence. Operatively linked nucleic acids are typically adjacent to one another, or, where appropriate, separated by further nucleic acid sequences, and, in particular aspects, are transcribed by RNA polymerase to give a single RNA molecule (the mRNA molecule; a common transcript). Preferably, a sequence that is a variant with respect to a specific sequence, when it replaces the specific sequence in a RNA molecule, retains RNA stability (or lack thereof) and / or translational efficiency.
[0094] The “3' end of a DNA molecule” means, as used herein, the end of the molecule that has a free hydroxy group. As shown below, in a diagrammatic representation of double-stranded nucleic acids, in particular DNA, the 3' end is always on the right-hand side. The “5' end of aDNA molecule” means, as used herein, the end of the molecule that has a free phosphate group. As shown below, in a diagrammatic representation of a double-stranded nucleic acid, in particular DNA, the 5' end is always on the left-hand side.5' end 5 '-P-NNNNNNN-0H-3 ' 3' end3 '-H0-NNNNNNN-P-5 '
[0095] In various aspects, a nucleic acid is operatively linked according to expression control sequences (e.g, promoter sequences) that can be homologous or heterologous with respect to the nucleic acid.
[0096] A transcribable nucleic acid sequence, in particular a nucleic acid sequence coding for a peptide or protein, and an expression control sequence are “operatively” linked to one another if they are covalently linked to one another in such a way that transcription or expression of the transcribable nucleic acid sequence is under the control or influence of the expression control sequence. If the nucleic acid sequence is to be translated into a functional peptide or protein, induction of an expression control sequence operatively linked to the nucleic acid coding sequence results in transcription of said nucleic acid coding sequence, without causing a frame shift in the coding sequence or the coding sequence being unable to be translated into the desired peptide or protein.
[0097] The term “expression control sequence” means, as used herein, promoters, ribosomebinding sequences, and other control elements that control transcription of a gene or translation of the derived RNA. In various aspects, the expression control sequences can be regulated. The precise structure of expression control sequences can vary depending on the species or cell type but usually includes 5 '-untranscribed and 5'- and 3 '-untranslated sequences involved in initiating transcription and translation, respectively, such as TATA box, capping sequence, CAAT sequence, and the like. More specifically, 5 '-untranscribed expression control sequences include a promoter region that encompasses a promoter sequence for transcription control of the operatively linked gene. Expression control sequences can also include enhancer sequences or upstream activator sequences.B. RNA MOLECULES
[0098] In one aspect, disclosed are ribonucleic acid (RNA) molecules comprising a 3’- untranslated region (3’ UTR) of an mRNA encoding a TEA domain transcription factor 1 (TEAD1) protein, in which one or more adenylate-uridine rich element (ARE) poly(uridylic acid) (poly(U)) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
[0099] In one aspect, disclosed are ribonucleic acid (RNA) molecules comprising a 3’- untranslated region (3’ UTR) of an mRNA encoding a yes-associated protein 1 (YAP1) protein, in which one or more adenylate-uridine rich element (ARE) poly(uridylic acid) (poly(U)) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
[0100] Disclosed herein is an innovative approach for treating various diseases and disorders associated with dysregulation of the Hippo signaling pathway. Specifically, mRNA constructs were engineered in which the stabilization motifs corresponding to those identified in the cDNA sequences were replaced with destabilized ARE consensus motifs. Exemplary mRNA stabilization and destabilization motifs are shown in Table 1.TABLE 1.
[0101] As detailed herein, the 3’ UTR of TEAD1 and YAP1 in oncogenic cells expressing TEAD1 and / or YAP1, respectively, are enriched with poly(U) sequences that are stabilizing AU rich elements. A poly(U) sequence can contain, for example, at least four consecutive U’s, at least five consecutive U’s, or more than five consecutive U’s. Thus, the disclosed TEAD1 or YAP1 related RNA molecules of the invention have a 3’ UTR region in which one or more poly(U) stabilizing motifs have been replaced with a destabilizing motif, such as, for example, SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 5. In this way, the disclosed RNA molecules, once reverse transcribed into DNA and transfected into a vector, become integrated into the genome and outcompete the endogenous RNA molecules comprising a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, thereby degrading its transcript and protein.
[0102] Referring to FIG. 2A, a sequence is shown, which comprises a 3’ UTR of a TEAD1 mRNA in which one or more ARE poly(U) stabilizing motifs of the TEAD1 mRNA have been substituted with a desabilizing motif (the disclosed destabilized ARE 3’ UTRs). Referring to FIG. 4, a sequence is shown, which comprises a 3’ UTR of a YAP1 mRNA in which one or more ARE poly(U) stabilizing motifs of the YAP1 mRNA have been substituted with a destabilizing motif (the disclosed destabilized ARE 3’ UTRs). See also Table 2, which lists exemplary engineered destabilized TEAD1 and YAP1 mRNA constructs, with destabilization motifs bolded.TABLE 2.
[0103] The terms “TEA domain transcription factor 1” and “TEAD1” refer to a ubiquitous transcriptional enhancer factor that is a member of the TEA / ATTS domain family. This gene encodes for a protein with a DNA binding domain and YAP / TAZ binding domain. The encoded protein directs the transactivation of a wide variety of genes. TEAD1 can regulate cellular proliferation and size through the Hippo pathway.
[0104] The terms “Yes-associated protein 1” and “YAP1” refer to a downstream nuclear effector of the Hippo signaling pathway, which is involved in development, growth, repair, and homeostasis. This gene encodes for a protein that contains a TEAD interacting domain, WW domain, SH3 binding motif, transactivation domain, and PDZ binding motif. The protein plays a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment.
[0105] As used herein, the term “RNA” relates to a molecule which comprises ribonucleotide residues and preferably being entirely or substantially composed of ribonucleotide residues. The term “ribonucleotide” relates to a nucleotide with a hydroxyl group at the 2'-position of a P-D- ribofuranosylgroup. The term “RNA” comprises double-stranded RNA, single stranded RNA, isolated RNA such as partially or completely purified RNA, essentially pure RNA, synthetic RNA, and recombinantly generated RNA such as modified RNA, which differs from naturallyoccurring RNA by addition, deletion, substitution, and / or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of a RNA or internally, for example, at one or more nucleotides of the RNA. Nucleotides in RNA molecules can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides. These altered RNAs can be referred to as analogs, particularly analogs of naturally-occurring RNAs. As used herein, RNA includes mRNA.
[0106] The term “mRNA” means “messenger-RNA” and relates to a transcript that is generated by using a DNA template and encodes a peptide or protein. Typically, mRNA comprises a 5'- UTR, a protein coding region, a 3'-UTR, and a poly(A) sequence. mRNA may be generated by in vitro transcription from a DNA template. The in vitro transcription methodology is known to one skilled in the art. For example, there are a variety of in vitro transcription kits commercially available. As detailed herein, mRNA can be modified by incorporating various destabilizing modifications into the 3’ UTR region (e.g, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4).
[0107] The terms “3 '-untranslated region” and “3’ UTR,” as used herein, relate to a region that is located at the 3' end of an RNA molecule, preferably an mRNA molecule, downstream of the termination codon of a protein-encoding region, and that is transcribed but is not translated into an amino acid sequence. According to the invention, a first polynucleotide region is considered to be located downstream of a second polynucleotide region, if the 5' end of said first polynucleotide region is the part of said first polynucleotide region closest to the 3' end of said second polynucleotide region.
[0108] The 3 '-untranslated region typically extends from the termination codon for a translation product to the poly(A) sequence, which is usually attached after the transcription process. The 3'- untranslated regions of mammalian mRNA typically have a homology region known as the AAUAAA hexanucleotide sequence. This sequence is presumably the poly(A) attachment signal and is frequently located from 10 to 30 bases upstream of the poly(A) attachment site. 3'- untranslated regions can contain one or more inverted repeats, which can fold to give stem-loop structures that act as barriers for exoribonucleases or interact with proteins known to increase RNA stability (e.g., RNA-binding proteins). The average length of human 3 '-untranslated regions is between 800-1000 nucleotides. As would be understood by one of skill in the art, thelength of the 3’ UTR plays an important role in determining both translational efficiency and the stability of an mRNA.
[0109] As would be understood by one of skill in the art, it can be determined whether a 3'- untranslated region or a nucleic acid sequence derived therefrom decreases the stability and / or translation efficiency of RNA, by incorporating the 3 '-untranslated region or the nucleic acid sequence derived therefrom into the 3 '-untranslated region of a mRNA and measuring whether said incorporation decreases the amount of protein synthesized.
[0110] The terms “poly(uridylic acid) sequence,” “poly(U) sequence,” and “poly(U) stabilizing motif’ refer to a sequence of uridylic acid residues that are typically located at the 3' end of an RNA molecule. Generally, the poly(A) sequence at the end of the 3’ UTR is important for the nuclear export, translation, and stability of mRNA. The sequence is shortened over time, and, when it is short enough, the mRNA is enzymatically degraded. To counteract poly(A) mediated degradation, poly(U) sequences can interact with poly(A) tails to inhibit the association of poly(A) binding protein and to confer increased stability upon introduction into ectopic transcripts. Poly(U) and poly(A) interactions can prevent negative regulation of mRNA. As detailed herein, in various aspects, a poly(U) sequence can have at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more than ten consecutive uridylic acid residues [0U1] The terms “adenylate-uridylate-rich elements,” “AU-rich elements,” and “AREs” refer to sequences that are rich in adenosine and uridine bases, typically located within the 3’ UTR of a RNA molecule. These elements are binding sites for proteins, which proteins, in response to different intracellular and extracellular signals, can promote mRNA decay, effect mRNA stability, or promote translation.
[0112] As would be appreciated by one of ordinary skill, the mRNA decay rate is a key determinant of steady-state mRNA abundance and mRNA turnover. At any given time in the cell, mRNA is synthesized by polymerases and destroyed by nucleases. When these two events occur at a constant rate, they give rise to a steady-state mRNA population for each unique transcript. Variations in mRNA transcription rates are generally recognized for their central importance in regulating gene expression. UTRs, particularly the 3’ UTR, play a role in transcript expression regulation by controlling mRNA stability, decay, and translation. Transcript stability can be affected by various c / .s-elements, such as AREs, in the 3’ UTR. Thus, in various aspects, the stability of a RNA molecule (e.g., a RNA molecule of the invention comprising a 3’UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3) can be evaluated by measuring the decay rate of the RNA molecule relative to the decay rate of a wildtype RNA molecule comprising a 3’ UTR encoding a TEAD1 or YAP1 protein.
[0113] In various aspects, the RNA molecule comprising a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, is destabilized compared to a wildtype RNA molecule comprising a 3’ UTR encoding a TEAD1 protein. For example, the disclosed RNA molecule can be at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, or more than 50% destabilized compared to wildtype RNA molecules comprising a 3’ UTR encoding a TEAD1 protein. Methods of determining whether a RNA molecule is destabilized relative to a wildtype RNA molecule are well-known in the art. See, e.g., Koh et al. (2019) Scientific reports vol. 9(1): 5976.
[0114] In various aspects, the RNA molecule comprising a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, destabilizes a wildtype RNA molecule comprising a 3’ UTR encoding a TEAD1 protein, such that the destabilized wildtype RNA molecule is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, or more than 50% destabilized compared to a wildtype RNA molecule comprising a 3’ UTR encoding a TEAD1 protein that has not been destabilized by a RNA molecule of the invention.
[0115] In various aspects, the RNA molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, is destabilized compared to a wildtype RNA molecule comprising a 3’ UTR encoding a YAP1 protein. For example, the disclosed RNA molecule can be at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, or more than 50% destabilized compared to wildtype RNA molecules comprising a 3’ UTRencoding a YAP1 protein. Methods of determining whether a RNA molecule is destabilized relative to a wildtype RNA molecule are well-known in the art. See, e.g., Koh et al. (2019).
[0116] In various aspects, the RNA molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, destabilizes a wildtype RNA molecule comprising a 3’ UTR encoding a YAP1 protein, such that the destabilized wildtype RNA molecule is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, or more than 50% destabilized compared to a wildtype RNA molecule comprising a 3’ UTR encoding a YAP1 protein that has not been destabilized by a RNA molecule of the invention.
[0117] In various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least three consecutive U’s. In various further aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least four consecutive U’s. In a still further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least five consecutive U’s. In a yet further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least six consecutive U’s. In an even further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least seven consecutive U’s. In a still furtheraspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least eight consecutive U’s. In yet a further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least nine consecutive U’s. In an even further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least ten consecutive U’s. In a still further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise more than ten consecutive U’s.
[0118] In various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise SEQ ID NO: 4.
[0119] In various aspects, the RNA molecule is destabilized in at least two ARE poly(U) stabilizing motifs. In a further aspect, the RNA molecule is destabilized in at least three ARE poly(U) stabilizing motifs. In a still further aspect, the RNA molecule is destabilized in at least four ARE poly(U) stabilizing motifs. In an even further aspect, every ARE poly(U) stabilizing motif is destabilized. In a still further aspect, the 3’ UTR is SEQ ID NO: 5 or SEQ ID NO: 28. In a still further aspect, the 3’ UTR is SEQ ID NO: 5. In yet a further aspect, the 3’ UTR is SEQ ID NO: 28.
[0120] In various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR aresubstituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are transcribed from Chromosome 11. Thus, in various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 12,964,000 to about 12,966,000, from about 12,964,500 to about 12,966,000, from about 12,965,000 to about 12,966,000, from about 12,965,500 to about 12,966,000, from about 12,964,000 to about 12,965,500, from about 12,964,000 to about 12,965,000, from about 12,964,000 to about 12,964,500, or from about 12,964,500 to about 12,965,500. In various further aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 12,964,830 to about 12,965,225 or from about 12,964,837 to about 12,965,223. In a still further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 12,965,220 to about 12,965,295 or from about 12,965,223 to about 12,965,419. In yet a further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 12,965,220 to about 12,965,415 or from about 12,965,223 to about 12,965,419. In an even further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 12,965,220 to about 12,965,535 to about 12,965,223 to about 12,965,537. In a still further aspect, the RNA molecule comprises a 3’ UTR of an mRNAencoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 12,965,230 to about 12,966,030 or from about 12,965,233 to about 12,966,034. In yet a further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 12,965,230 to about 12,966,130 or from about 12,965,233 to about 12,966,131.
[0121] In various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are transcribed from Chromosome 11. Thus, in various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 102,100,500 to about 102,103,500, from about 102,101,000 to about 102,103,500, from about 102,101,500 to about 102,103,500, from about 102,102,000 to about 102,103,500, from about 102,102,500 to about 102,103,500, from about 102,103,000 to about 102,103,500, from about 102,100,500 to about 102,103,000, from about 102,100,500 to about 102,102,500, from about 102,100,500 to about 102,102,000, from about 102,100,500 to about 102,101,500, from about 102,100,500 to about 102,101,000, from about 102,101,000 to about 102,103,000, or from about 102,101,500 to about 102,102,500. In various further aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 102,101,450 to about 102,101,600 or from about 102,101,498 to about 102,101,555. In a still further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a YAP1 protein, in which one ormore ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 102,101,450 to about 102,101,700 or from about 102,101,498 to about 102,101,658. In yet a further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 102,101,450 to about 102,101,700 or from about 102,101,498 to about 102,101,686. In an even further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs are derived from an amino acid position of from about 102,101,450 to about 102,102,600 to about 102,101,498 to about 102,102,597.
[0122] In various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein at least of the ARE poly(U) stabilizing motifs is a penta poly(U) motif. In a further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein at least of the ARE poly(U) stabilizing motifs is a hexa poly(U) motif. In a still further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein at least of the ARE poly(U) stabilizing motifs is a hepta poly(U) motif. In an even further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein at least of the ARE poly(U) stabilizing motifs is a octa poly(U) motif. In a still further aspect, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 orYAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein at least of the ARE poly(U) stabilizing motifs is a deci poly(U) motif.
[0123] In various aspects, the 3’ UTR of the mRNA encoding a TEAD1 protein is SEQ ID NO: 5. In a further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 1% identical to SEQ ID NO: 5. Thus, in various aspects, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 5. In yet a further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 20% identical to SEQ ID NO: 5. In an even further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 80% identical to SEQ ID NO: 5. In a still further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 85% identical to SEQ ID NO: 5. In a yet further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 90% identical to SEQ ID NO: 5. In an even further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 95% identical to SEQ ID NO: 5. In a still further aspect, the 3’ UTR i of the mRNA encoding a TEAD1 protein s at least 99% identical to SEQ ID NO: 5.
[0124] In various aspects, the 3’ UTR of the mRNA encoding a YAP1 protein is SEQ ID NO: 28. In a further aspect, the 3 ’ UTR of the mRNA encoding a YAP1 protein is at least 1% identical to SEQ ID NO: 28. Thus, in various aspects, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 1%, at least 32%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 28. In yet a further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 20% identical to SEQ ID NO: 28. In an even further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 80% identical to SEQ ID NO: 28. In a still further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 85% identical to SEQ ID NO: 28. In a yet further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 90% identical to SEQ ID NO: 28. In an even further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 95% identical to SEQ ID NO: 28.In a still further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 99% identical to SEQ ID NO: 28.
[0125] In various aspects, the RNA molecule of the invention is SEQ ID NO: 5. In a further aspect, the RNA molecule is at least 1% identical to SEQ ID NO: 5. Thus, in various aspects, the RNA molecule is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 5. In yet a further aspect, the RNA molecule is at least 20% identical to SEQ ID NO: 5. In an even further aspect, the RNA molecule is at least 80% identical to SEQ ID NO: 5. In a still further aspect, the RNA molecule is at least 85% identical to SEQ ID NO: 5. In a yet further aspect, the RNA molecule is at least 90% identical to SEQ ID NO: 5. In an even further aspect, the RNA molecule is at least 95% identical to SEQ ID NO: 5.
[0126] In various aspects, the RNA molecule of the invention is SEQ ID NO: 28. In a further aspect, the RNA molecule is at least 1% identical to SEQ ID NO: 28. Thus, in various aspects, the RNA molecule is at least 1%, at least 32%, at least 10%, at least 132%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 28. In yet a further aspect, the RNA molecule is at least 20% identical to SEQ ID NO: 28. In an even further aspect, the RNA molecule is at least 80% identical to SEQ ID NO: 28. In a still further aspect, the RNA molecule is at least 85% identical to SEQ ID NO: 28. In a yet further aspect, the RNA molecule is at least 90% identical to SEQ ID NO: 28. In an even further aspect, the RNA molecule is at least 95% identical to SEQ ID NO: 28.
[0127] In various aspects, the RNA molecule further comprises a polyadenyl (poly A) sequence (e.g, AAAA (SEQ ID NO: 19), AAAAA (SEQ ID NO: 60), AAAAAA (SEQ ID NO: 61)). In various further aspects, the polyadenyl sequence is located at the 3’ end of the RNA molecule.
[0128] In various aspects, the RNA molecule further comprises a 5’ Cap.
[0129] In various aspects, the disclosed sequences can be reverse transcribed to engineer a DNA molecule (c.g, a cDNA molecule) as detailed elsewhere herein. In various further aspects, the reverse transcription is carried out in vitro.
[0130] In various aspects, the RNA molecule of the invention comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the mRNA encoding the TEAD1 protein is at least 80% identical to SEQ ID NO: 5. Thus, in various aspects, the RNA molecule of the invention can include, in addition to the 3’ UTR of an mRNA encoding a TEAD1 protein, additional sequences that may or may not code for the TEAD1 protein.
[0131] In various aspects, the RNA molecule of the invention consists essentially of a 3’ UTR of an mRNA encoding a TEAD1 protein, in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the mRNA encoding the TEAD1 protein is at least 80% identical to SEQ ID NO: 5. Thus, in various aspects, the RNA molecule of the invention is just the 3’ UTR of an mRNA encoding a TEAD1 protein.
[0132] In various aspects, the RNA molecule of the invention comprises a 3’ UTR of an mRNA encoding a YAP1 protein, in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the mRNA encoding the YAP1 protein is at least 80% identical to SEQ ID NO: 28. Thus, in various aspects, the RNA molecule of the invention can include, in addition to the 3’ UTR of an mRNA encoding a YAP1 protein, additional sequences that may or may not code for the YAP1 protein.
[0133] In various aspects, the RNA molecule of the invention consists essentially of a 3’ UTR of an mRNA encoding a YAP1 protein, in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the mRNA encoding the YAP1 protein is at least 80% identical to SEQ ID NO: 28. Thus, in various aspects, the RNA molecule of the invention is just the 3’ UTR of an mRNA encoding a YAP1 protein.C. DNA MOLECULES
[0134] In one aspect, disclosed are deoxyribonucleic acid (DNA) molecules comprising in the 5’ 3’ direction of transcription relative to synthesis of a messenger RNA (mRNA) molecule comprising a 3’ UTR of an mRNA encoding a TEAD1 protein: (a) a promoter, operativelylinked to (b) a nucleic acid sequence encoding a 3’ UTR of a TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
[0135] In one aspect, disclosed are deoxyribonucleic acid (DNA) molecules comprising in the 5’ 3’ direction of transcription relative to synthesis of a messenger RNA (mRNA) molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR of a YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
[0136] As detailed herein, the disclosed DNA molecules can be cloned into a vector for use as a therapeutic agent to target TEAD1 and YAP1 gene (e.g. oncogene) overexpression. Such overexpression is observed in a variety of diseases and disorders for which dysregulation of the Hippo signaling pathway is implicated including, but not limited, to cancers (e.g., breast cancer such as trastuzumab-resistant breast cancers and triple negative breast cancer, colon cancer, lung cancer, prostate cancer, cervical squamous cell carinomas, endometrial carcinoma, neuroblastoma, meningioma, melanoma, squamous cell carcinoma of the skin, ovarian cancer, osteosarcoma, acute myeloma leukemia, head and neck squamous cell carcinoma, and other cancers where the TEAD1 / YAP1 oncogene is a key driver of cancer pathogenesis), obesity, liver disease (e.g., non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, biliary atresia, primary sclerosing cholangtitis), and cardiac diseases (e.g., atherosclerosis, angiogenesis, restenosis, pulmonary hypertension, myocardial hypertrophy, and myocardial fibrosis).
[0137] In various aspects, the disclosed DNA molecules (e.g., a disclosed cDNA molecule) can be prepared by reverse transcribing a disclosed RNA molecule. Thus, in various aspects, disclosed are DNA (e.g., cDNA) molecules prepared from a disclosed RNA molecule. In various further aspects, reverse transcription is carried out in vitro. In this way, the TEAD1 / YAP1 3’ UTR are destabilized and their expression can be driven by a promoter (e.g., a de-capping promoter such as DCP1 A) to specifically degrade the transcript and protein through nonsense mediated decay.
[0138] Exemplary destabilization sequences are shown in Table 3 below.TABLE 3.
[0139] Exemplary signal sequences, exemplary promoter sequences, and exemplary restriction sequences are shown in Table 4 below.TABLE 4.
[0140] Exemplary destabilized TEAD1 and YAP1 DNA constructs are shown in Table 5 below.TABLE 5.
[0141] As used herein, the terms “promoter,” “promoter region,” and “promoter sequence” refer to a DNA sequence upstream (5') of the coding sequence of a gene (e.g., the nucleic acid sequence encoding a 3’ UTR in the mRNA molecule), which controls expression of said coding sequence by providing a recognition and binding site for RNA polymerase. The promoter region can include further recognition or binding sites for further factors involved in regulating transcription of said gene. A promoter can control transcription of a prokaryotic or eukaryotic gene. A promoter can be “inducible” and initiate transcription in response to an inducer, or can be “constitutive” if transcription is not controlled by an inducer. An inducible promoter is expressed only to a very small extent or not at all, if an inducer is absent. In the presence of the inducer, the gene is “switched on,” or the level of transcription is increased. This is usually mediated by binding of a specific transcription factor.
[0142] In various aspects, the promoter sequence can be selected from known promoter sequences. Suitable examples include, but are not limited to, a DCP1A promoter, a DCP2 promoter, and a ZFP36 promoter. In various aspects, the promoter sequence is between onehundred forty and one hundred seventy residues. In various further aspects, the promoter sequence is between one hundred fifty and one hundred sixty residues.
[0143] The term “reporter” relates to a molecule, typically, a peptide or protein, which is encoded by a reporter gene and measured in a reporter assay. Conventional systems usually employ an enzymatic reporter and measure the activity of said reporter. Examples of reporters include, but are not limited to, red fluorescent protein (RFP) and green fluorescent protein (GFP).
[0144] The term “multiple cloning site” refers to a nucleic acid region containing restriction enzyme sites, any one of which can be used for cleavage of, for example, a vector, and insertion of a nucleic acid.
[0145] The term “transcription” means a process wherein the genetic code in a DNA sequence is transcribed into RNA. Subsequently, the RNA can be translated into protein. As used herein, the term “transcription” includes “zzz vitro transcription,” wherein the term “z z vitro transcription” relates to a process wherein RNA, in particular, mRNA, is in vitro synthesized in a cell-free system. Preferably, cloning vectors are applied for the generation of transcripts. These cloning vectors are generally designated as transcription vectors and are encompassed by the term “vector,” as used herein. RNA includes in vitro transcribed RNA (1VT-RNA) and can be obtained by in vitro transcription of an appropriate DNA template. The promoter for controlling transcription can be any promoter for any RNA polymerase. A DNA template for in vitro transcription can be obtained by cloning of a nucleic acid, in particular, cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA can be obtained by reverse transcription of RNA such as, for example, a disclosed RNA comprising a 3’ UTR encoding a TEAD1 gene, in which one or more ARE poly(U) stabilizing motifs are substituted with a nucleic acid sequence selected from SEQ ID NOS: 1 to 3.
[0146] According to the invention, two elements such as nucleotides or amino acids are consecutive, if they are directly adjacent to one another, without any interruption. For example, a sequence of x consecutive nucleotides N refers to the sequence (N)x.
[0147] ‘ ‘Restriction endonuclease” or “restriction enzyme” refers to a class of enzymes that cleave phosphodiester bonds in both strands of a DNA molecule within specific base sequences. They recognize specific binding sites, referred to as recognition sequences, on a double-stranded DNA molecule. The sites at which said phosphodiester bonds in the DNA are cleaved by saidenzymes are referred to as cleavage sites. In the case of type IIS enzymes, the cleavage site is located at a defined distance from the DNA binding site. According to the invention, the term “restriction endonuclease” comprises, for example, the enzymes SapI, Ecil, Bpil, Aarl, Alol, Bael, BbvCI, Ppil and PsrI, BsrDl, BtsI, Earl, BmrI, Bsal, BsmBI, Faul, BbsI, BciVI, BfuAI, BspMI, BseRI, Ecil, BtgZI, BpuEI, Bsgl, Mmel, CspCI, Bael, BsaMI, Mval269I, PctI, Bse3DI, BseMI, Bst6I, Eaml 1041, Ksp632I, Bfil, Bso31I, BspTNI, Eco31I, Esp3I, Bful, Acc36I, Aarl, Eco57I, Eco57MI, Gsul, Alol, Hin4I, Ppil, and PsrI.
[0148] The DNA molecules of the invention, when used for the treatments described herein, can be present in the form of a pharmaceutical composition or kit comprising the DNA molecule and, optionally, one or more pharmaceutically acceptable carriers, diluents, and / or excipients.
[0149] Driver mutations in cancer-associated genes alter downstream signaling and transcription patterns, which are critical in tumor progression. Deregulation of TEAD transcriptional output has been demonstrated to mediate the pathology of critical oncogenes and tumor suppressor genes including NF2, BRAF, KRAS, MYC, PTEN, LKB 1, and PKA.
[0150] The Hippo pathway functions as a tumor suppressor pathway, whose activity is deregulated in many cancers (Lin et al. (2018) Annu. Rev. Cancer Biol. 9: 107623-10344). However, mutations directly linked to alterations in the Hippo-YAP / TAZ pathway are uncommon. Inhibition of the core Hippo pathway components via point mutations and epigenetic alterations are found in subsets of human cancers including mutations in NF2 (Sourbier et al. (2018) Oncotarget 9: 10723-10733; Rouleau et al. (1993) Nature 363: 515-521), MST1 / 2 (Abdollahpour et al. (2012) Blood 119: 3450-3457), SAV1 (Tapon et al. (2002) Cell 110: 467-478), MOB1A / B (Lai et al. (2005) Cell 120: 675-685), LATS1 (Rutherford et al. (2006) Cancer Lett. 236; 309-317; Oh et al. (2015) J. Neuropath. Exp. Neur. 74: 952-959), and LATS2 (Fujii et al. (2012) J. Exp. Med. 209: 479-494; Kuijjer et al. (2012) Cancer Res. 72;Takahashi et al. (2005) Clin. Cancer Res. 11: 1380-1385). Moreover, gain-of-function mutations were recently found in YAP and TAZ. For example, hyperactivating mutations in YAP were identified in melanoma and lung cancer patients (Zhang et al. (2019) Mol. Cancer Res.1435-1449; Menzel et al. (2014) Pigm. Cell Melanoma R. 27(4): 671-3; Chen et al. (2015) J. Clin. Oncol. 33: 2303-2310). See also Zanconato et al. (2015) Nature Cell Biology 17: 1218— 1227. Thus, in various aspects, disclosed are DNA molecules comprising in the 5’ -> 3’ direction of transcription relative to synthesis of a mRNA molecule comprising a 3’ UTR of anmRNA encoding a TEAD1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR of a TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the TEAD1 gene is a TEAD1 oncogene. In various further aspects, disclosed are DNA molecules comprising in the 5’ -> 3’ direction of transcription relative to synthesis of a mRNA molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR of a YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the YAP1 gene is a YAP1 oncogene.
[0151] As detailed herein, modification, and, thereby, destabilization is driven by degrading endogenous mRNA coupled with an increase in transcription of the destabilized mRNA construct relative to the wildtype RNA (z.e., transcription of the destabilized mRNA is more efficient such that the destabilized 3’ UTR outcompetes the wildtype RNA).
[0152] Thus, in various aspects, the DNA molecules of the invention comprise a nucleic acid sequence that encodes a 3’ UTR of a TEAD1 or YAP1 gene in an mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a destabilizing motif, as further described herein. This destabilized ARE of the 3’ UTR of the mRNA will be driven by an mRNA decapping protein, e.g., DCP1A, which will specifically upregulate the mRNA decay pathway and trigger the deadenylase CNOT1 and the cleavage enzyme XRN1 to degrade the RNA transcript of interest e.g., the TEAD1 RNA transcript or the YAP1 RNA transcript).
[0153] In various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least three consecutive U’s. In various further aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifscomprise at least four consecutive U’s. In various further aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise at least five consecutive U’s.
[0154] In various aspects, the RNA molecule comprises a 3’ UTR of an mRNA encoding a TEAD1 or YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the one or more ARE poly(U) stabilizing motifs comprise SEQ ID NO:4.
[0155] In various aspects, at least two ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. In a further aspect, at least four ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. In a still further aspect, at least four ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
[0156] In various aspects, every ARE poly(U) stabilizing motif of the 3’ UTR of the mRNA is substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
[0157] In various aspects, the 3’ UTR of the mRNA encoding a TEAD1 protein is SEQ ID NO:5. In a further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 1% identical to SEQ ID NO: 5. Thus, in various aspects, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 5. In yet a further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 20% identical to SEQ ID NO: 5. In an even further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 80% identical to SEQ ID NO: 5. In a still further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 85% identical to SEQ ID NO: 5. In a yet further aspect, the 3’ UTR of the mRNAencoding a TEAD1 protein is at least 90% identical to SEQ ID NO: 5. In an even further aspect, the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 95% identical to SEQ ID NO: 5. In a still further aspect, the 3’ UTR of the mRNA encoding a TEAD 1 protein is at least 99% identical to SEQ ID NO: 5.
[0158] In various aspects, the 3’ UTR of the mRNA encoding a YAP1 protein is SEQ ID NO: 28. In a further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 1% identical to SEQ ID NO: 28. Thus, in various aspects, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 28. In yet a further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 20% identical to SEQ ID NO: 28. In an even further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 80% identical to SEQ ID NO: 28. In a still further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 85% identical to SEQ ID NO: 28. In a yet further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 90% identical to SEQ ID NO: 28. In an even further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 95% identical to SEQ ID NO: 28. In a still further aspect, the 3’ UTR of the mRNA encoding a YAP1 protein is at least 99% identical to SEQ ID NO: 28.
[0159] In various aspects, the promoter sequence is selected from a DCP1A promoter, a DCP2 promoter, and a ZFP36 promoter. In a further aspect, the promoter sequence is a DCP1A promoter. In an even further aspect, the DCP1 A promoter is SEQ ID NO: 6.
[0160] In various aspects, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene or the YAP1 gene comprises SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
[0161] In various aspects, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is selected from SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. Thus, in various aspects, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 10, SEQ ID NO: 1 1, SEQ ID NO: 12, or SEQ ID NO: 13. In yet afurther aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least at least 20% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In an even further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 80% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In a still further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 85% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In a yet further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 90% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In an even further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 95% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In a still further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 99% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
[0162] In various aspects, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is selected SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, or SEQ ID NO: 35. Thus, in various aspects, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, or SEQ ID NO: 35. In yet a further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least at least 20% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35. In an even further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 80% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35. In a still further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 85% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35. In a yet further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 90% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35. In an even further aspect, the nucleic acid sequence encoding the 3’UTR of the YAP1 gene is at least 95% identical SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35. In a still further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 99% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35.
[0163] In various aspects, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene comprises SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17. Thus, in various aspects, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17. In yet a further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least at least 20% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17. In an even further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 80% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17. In a still further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 85% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17. In a yet further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 90% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17. In an even further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 95% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17. In a still further aspect, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 99% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
[0164] In various aspects, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene comprises SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40. Thus, in various aspects, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or greater than 99% identical to SEQ ID NO: SEQ ID NO:35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40. In yet a further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least at least 20% identical SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40. In an even further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 80% identical to SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40. In a still further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 85% identical to SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40. In a yet further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 90% identical to SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40. In an even further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 95% identical to SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40. In a still further aspect, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 99% identical to SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40.
[0165] In various aspects, the DNA molecule is selected from SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, and SEQ ID NO: 46.
[0166] In various aspects, DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, which is operatively linked to a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. In various further aspects, the first signal sequence generally contains from five through eleven residues. In various further aspects, the first signal sequence can function to stop transcription of the RFP or other reporter sequence, when present. In various further aspects, the first signal sequence is SEQ ID NO: 18. In a still further aspect, first polyA sequence is SEQ ID NO: 19. In a further aspect, the DNA molecule is SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, or SEQ ID NO: 65.
[0167] In various aspects, DNA molecule comprises, in the 5’ - 3’ direction of transcription relative to synthesis of the mRNA molecule, a first signal sequence encoding a first polyAsequence, operatively linked to a promoter, which is operatively linked to a nucleic acid sequence encoding the 3’ UTR of the YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. In various further aspects, the first signal sequence generally contains from five through eleven residues. In various further aspects, the first signal sequence can function to stop transcription of the RFP or other reporter sequence, when present. In various further aspects, the first signal sequence is SEQ ID NO: 18. In a still further aspect, first polyA sequence is SEQ ID NO: 19. In a further aspect, the DNA molecule is SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, or SEQ ID NO: 83.
[0168] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, which is operatively linked to a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. In various aspects, the first restriction sequence has between four and seven residues. In various aspects, the first restriction sequence can be selected from known restriction sequences. Suitable examples include, but are not limited to, a BstBl restriction site, a BamHl restriction site, an Apal restriction site, a PspOMl restriction site, and the like. Thus, in various aspects, the first restriction sequence is a BstBl sequence. In various further aspects, the first restriction sequence is SEQ ID NO: 20. In a further aspect, the DNA molecule is SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, or SEQ ID NO: 69.
[0169] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, which is operatively linked to a nucleic acid sequence encoding the 3’ UTR of the YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. In various aspects, the first restriction sequence has between four and seven residues. In various aspects, the first restriction sequence can be selected from knownrestriction sequences. Suitable examples include, but are not limited to, a BstBl restriction site, a BamHl restriction site, an Apal restriction site, a PspOMl restriction site, and the like. Thus, in various aspects, the first restriction sequence is a BstBl sequence. In various further aspects, the first restriction sequence is SEQ ID NO: 20. In a further aspect, the DNA molecule is SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, or SEQ ID NO: 89.
[0170] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, which is operatively linked to a second signal sequence encoding a second polyA sequence. In various aspects, the second polyA sequence contains between five and eleven residues. In various further aspects, the first polyA sequence and the second polyA sequence can be the same or different. In various further aspects, the second polyA sequence functions to stop transcription. In a further aspect, the second signal sequence is SEQ ID NO: 21. In a still further aspect, the second polyA sequence is SEQ ID NO: 22. In a further aspect, the DNA molecule is SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, or SEQ ID NO: 73.
[0171] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, which is operatively linked to a second signal sequence encoding a second polyA sequence. In various aspects, the second polyA sequence contains between five and eleven residues. In various further aspects, the first polyA sequence and the second polyA sequence can be the same or different. In various further aspects, the second polyA sequence functions to stop transcription. In a further aspect, the second signal sequence is SEQ ID NO: 21. In a still further aspect, the second polyA sequence is SEQ ID NO: 22. In a further aspect,the DNA molecule is SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95.
[0172] In various aspects, the DNA molecule comprises, in the3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, operatively linked to a second signal sequence encoding a second polyA sequence, which is operatively linked to a second restriction sequence. In various further aspects, the second restriction sequence can be selected from known sequences. Suitable examples include a BamHl restriction site. In various aspects, both the first restriction sequence and the second restriction sequence are different. In various further aspects, the second restriction sequence is a BamHl sequence. In various further aspects, the second restriction sequence is SEQ ID NO: 23. In various further aspects, the first restriction sequence is a BstBl sequence and the second restriction sequence is a BamHl sequence. In a further aspect, the DNA molecule is SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, or SEQ ID NO: 77.
[0173] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, operatively linked to a second signal sequence encoding a second polyA sequence, which is operatively linked to a second restriction sequence. In various further aspects, the second restriction sequence can be selected from known sequences. Suitable examples include a BamHl restriction site. In various aspects, both the first restriction sequence and the second restriction sequence are different. In various further aspects, the second restriction sequence is a BamHl sequence. In various further aspects, the second restriction sequence is SEQ ID NO: 23. In various further aspects, the first restriction sequence is a BstBl sequence and the second restriction sequence is a BamHl sequence. In a further aspect, theDNA molecule is SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, or SEQ ID NO: 101.
[0174] In various aspects, the DNA molecule further comprises a first digestion enhancing sequence. In various aspects, the first digestion enhancing sequence is located at the 5’ end and can be selected from known digestion enhancing sequences. Suitable examples include, but are not limited to, GGACCCGCCCGAGC (SEQ ID NO: 132), GGGCCGGCCCCGCCG (SEQ ID NO: 133), and GCCCGCGAGGACCCGCCCGAGC (SEQ ID NO: 134). In various aspects, the first digestion enhancing sequence is between five and one hundred residues. In various further aspects, the first digestion enhancing sequence is between five and fifty residues. In various further aspects, the first digestion enhancing sequence is SEQ ID NO: 132. In various further aspects, the first digestion enhancing sequence is SEQ ID NO: 133. In an even further aspect, the first digestion enhancing sequence is SEQ ID NO: 134.
[0175] In various aspects, the DNA molecule further comprises a second digestion enhancing sequence. In various aspects, the second digestion enhancing sequence is located at the 5’ end and can be selected from known digestion enhancing sequences. Suitable examples include, but are not limited to, GGACCCGCCCGAGC (SEQ ID NO: 132), GGGCCGGCCCCGCCG (SEQ ID NO: 133), and GCCCGCGAGGACCCGCCCGAGC (SEQ ID NO: 134). In various aspects, the second digestion enhancing sequence is between five and one hundred residues. In various further aspects, the second digestion enhancing sequence is between five and fifty residues. In various further aspects, both the first digestion enhancing sequence and the second digestion enhancing sequence are the same. In various further aspects, both the first digestion enhancing sequence and the second digestion enhancing sequence are different. In various further aspects, the second digestion enhancing sequence is SEQ ID NO: 132. In various further aspects, the second digestion enhancing sequence is SEQ ID NO: 133. In an even further aspect, the second digestion enhancing sequence is SEQ ID NO: 133.
[0176] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first digestion enhancing sequence, operatively linked to a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acidsequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, operatively linked to a second signal sequence encoding a second polyA sequence, operatively linked to a second restriction sequence, which is operatively linked to a second digestion enhancing sequence. In a further aspect, the DNA molecule is SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27.
[0177] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first digestion enhancing sequence, operatively linked to a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, operatively linked to a second signal sequence encoding a second polyA sequence, operatively linked to a second restriction sequence, which is operatively linked to a second digestion enhancing sequence. In a further aspect, the DNA molecule is selected from SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, and SEQ ID NO: 46.
[0178] In various aspects, the DNA molecule consists of, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, operatively linked to a second signal sequence encoding a second polyA sequence, which is operatively linked to a second restriction sequence.
[0179] In various aspects, the DNA molecule consists of, in the 5 ’3 ’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, operatively linked to a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the YAP 1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ IDNO: 2, and SEQ ID NO: 3, operatively linked to a second signal sequence encoding a second polyA sequence, which is operatively linked to a second restriction sequence.
[0180] In various aspects, the DNA molecule comprises, in the3’ direction of transcription relative to synthesis of the mRNA molecule, a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, which is operatively linked to a second signal sequence encoding a second polyA sequence. In a further aspect, the DNA molecule is SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, or SEQ ID NO: 105.
[0181] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, which is operatively linked to a second signal sequence encoding a second polyA sequence. In a further aspect, the DNA molecule is selected from SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, and SEQ ID NO: 115.
[0182] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, operatively linked to a second signal sequence encoding a second polyA sequence, which is operatively linked to a second restriction sequence. In a further aspect, the DNA molecule is SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, or SEQ ID NO: 109.
[0183] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first signal sequence encoding a first polyA sequence, operatively linked to a promoter, operatively linked to a nucleic acid sequenceencoding the 3’ UTR of the YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, operatively linked to a second signal sequence encoding a second polyA sequence, which is operatively linked to a second restriction sequence. In a further aspect, the DNA molecule is selected from SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, and SEQ ID NO: 121.
[0184] In various aspects, the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a promoter, a nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a second signal sequence encoding a second polyA sequence, and a second restriction sequence. In various further aspects, the second restriction sequence is a BamHl sequence. In a further aspect, the DNA molecule is selected from SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, and SEQ ID NO: 125.
[0185] In various aspects, the DNA molecule comprises, in the 5’ - 3’ direction of transcription relative to synthesis of the mRNA molecule, a promoter, a nucleic acid sequence encoding the 3’ UTR of the YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a second signal sequence encoding a second polyA sequence, and a second restriction sequence. In various further aspects, the second restriction sequence is a BamHl sequence. In a further aspect, the DNA molecule is selected from SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, and SEQ ID NO: 131.
[0186] In various aspects, the DNA molecule of the invention comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of a mRNA molecule comprising a 3’ UTR of an mRNA encoding a TEAD1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR of a TEAD1 gene in the mRNA molecule in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’UTR of the TEAD1 gene is at least 80% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
[0187] In various aspects, the DNA molecule of the invention consists essentially of, in the 5’3’ direction of transcription relative to synthesis of a mRNA molecule comprising a 3’ UTR of an mRNA encoding a TEAD1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR of a TEAD1 gene in the mRNA molecule in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the TEAD1 gene is at least 80% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
[0188] In various aspects, the DNA molecule of the invention comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of a mRNA molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR of a YAP1 gene in the mRNA molecule in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the TEAD1 gene is at least 80% identical to SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40.
[0189] In various aspects, the DNA molecule of the invention consists essentially of, in the 5’3’ direction of transcription relative to synthesis of a mRNA molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR of a YAP1 gene in the mRNA molecule in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the TEAD1 gene is at least 80% identical to SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40.D. METHODS OF MAKING cDNA MOLECULES
[0190] In one aspect, disclosed are methods of making a DNA molecule (e.g., a complementary deoxyribonucleic acid or cDNA molecule), the method comprising reverse transcribing a RNAmolecule of the invention to produce the DNA molecule. In a further aspect, the DNA molecule is a cDNA molecule.
[0191] In one aspect, disclosed are DNA molecules (e.g., cDNA molecules) prepared by a disclosed method.
[0192] In one aspect, disclosed are DNA molecules (e.g., cDNA molecules) prepared from a disclosed RNA molecule. cDNA is distinct from genomic DNA, as the derivative template RNA transcript lacks promoters and introns. As would be understood by one of skill in the art, cDNA can be synthesized via reverse transcription, in which mRNA or miRNA is used as a template together with a reverse transcription enzyme and a thermostable primer that is complementary to the 3’ end of the RNA template to generate a cDNA product that is a complementary copy of the mRNA. This cDNA product can then be used as a template to produce a second DNA strand using polymerase chain reaction (PCR) assays.
[0193] Briefly, the RNA samples (e.g., a RNA molecule as disclosed herein) are prepared and any remaining genomic DNA is removed. The sample is then combined with the reverse transcriptase enzyme and various other components (e.g., dNTPs, DTT, buffer, RNAse inhibitors, RNase-free water), followed by primer annealing, DNA polymerization, and enzyme activation. Reverse transcription kits are well-known by those of skill (e.g., Qiagen reverse transcription kit, catalog no. 205311) and can be used to facilitate the transformation using the manufacturer’s protocol. In this way, cDNA comprising, in the 5’ -> 3’ direction of transcription, a promoter, operatively linked to a nucleic acid sequence encoding a 3’ UTR of a TEAD1 or YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 can be generated.
[0194] As used herein, the term “reverse transcription” means a process wherein the genetic code in an RNA sequence (e.g., an RNA molecule as described herein) is reverse transcribed into DNA. See, e.g., Sissaoui et al. (2020) Circ. Res. 126(7): 875-888. Subsequently, the DNA can be incorporated into a vector and then, transfected into cells. As used herein, the term “reverse transcription” includes “in vitro reverse transcription,” wherein the term “in vitro reverse transcription” relates to a process wherein DNA, in particular, cDNA, is in vitro synthesized in a cell-free system.
[0195] In various aspects, the RNA molecule used to synthesize the DNA molecule of the invention comprises a 3’ UTR of an mRNA encoding a TEAD1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Thus, in various aspects, the RNA molecule of the invention can include, in addition to the 3’ UTR of an mRNA encoding a TEAD1 protein, additional sequences that may or may not code for the TEAD1 protein. In various further aspects, the RNA molecule of the invention is just the 3’ UTR of an mRNA encoding a TEAD1 protein.
[0196] In various aspects, the RNA molecule used to synthesize the DNA molecule of the invention comprises a 3’ UTR of an mRNA encoding a YAP1 protein, in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Thus, in various aspects, the RNA molecule of the invention can include, in addition to the 3’ UTR of an mRNA encoding a YAP1 protein, additional sequences that may or may not code for the YAP 1 protein. In various further aspects, the RNA molecule of the invention is just the 3’ UTR of an mRNA encoding a YAP1 protein.
[0197] In various aspects, the DNA molecule of the invention is prepared by reverse transcribing a RNA molecule comprising a 3’ UTR of an mRNA encoding a TEAD1 protein, in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the mRNA encoding the TEAD1 protein is at least 80% identical to SEQ ID NO: 5.
[0198] In various aspects, the DNA molecule of the invention is prepared by reverse transcribing a RNA molecule consisting essentially of a 3’ UTR of an mRNA encoding a TEAD1 protein, in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the mRNA encoding the TEAD1 protein is at least 80% identical to SEQ ID NO: 5.
[0199] In various aspects, the DNA molecule of the invention is prepared by reverse transcribing a RNA molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein, in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the mRNA encoding the YAP1 protein is at least 80% identical to SEQ ID NO: 28.
[0200] In various aspects, the DNA molecule of the invention is prepared by reverse transcribing a RNA molecule consisting essentially of a 3’ UTR of an mRNA encoding a YAP1 protein, in which at least four ARE poly(U) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and wherein the 3’ UTR of the mRNA encoding the YAP1 protein is at least 80% identical to SEQ ID NO: 28.E. PLASMID VECTORS
[0201] In one aspect, disclosed are plasmid vectors comprising a DNA molecule of the invention. As used herein, the term “vector” means any vehicle for carrying a nucleic acid that can, for example, enable said nucleic acid to be introduced into prokaryotic and / or eukaryotic host cells and, where appropriate, to be integrated into a genome. Such vectors are preferably replicated and / or expressed in the cell. Vectors comprise plasmids, phagemids, and virus genomes. The term “plasmid,” as used herein, generally relates to a construct of extrachromosomal genetic material, usually a circular DNA duplex, which can replicate independently of chromosomal DNA.
[0202] The term “plasmid vector” means a small, single or double-stranded circular extrachromosomal DNA or RNA molecule. Plasmid vectors can consist of the transgene insert and an origin of replication, a promoter region, optionally a selectable marker, and convenient restriction sites. These features allow for semi-independent replication of the plasmid in the host (e.g., hundreds of copies can be made per cell) and convenient restriction sites. In certain embodiments as used here the term “vector” may refer to double stranded DNA plasmid vectors used to carry DNA encoding for the lentiviral plasmid vector.
[0203] Vectors derived from retroviruses such as the lentivirus (e.g, a lentiviral vector) are suitable tools to achieve long-term gene transfer since they allow long term, stable integration of a transgene and its propagation in daughter cells. These vectors have emerged as promising tools for both gene therapy and immunotherapy purposes, because they exhibit several advantages over other viral systems. For example, unlike vectors derived from onco-retroviruses, retroviral vectors can transduce non-proliferating cells, such as hepatocytes. Additionally, they are nontoxic to target cells. In in vivo applications, lentiviral vectors have the added advantage of low immunogenicity. Moreover, lentiviral vectors, in particular, are also advantageous because theycan deliver genes to cell types that previous retrovirus vectors could not, such as neurons, lymphocytes, and macrophages.
[0204] Lentiviruses represent a genus of slow viruses of the Retroviridae family, which includes the human immunodeficiency viruses (HIV), the simian immunodeficiency virus (SIV), the equine infectious encephalitis virus (EIAV), the caprine arthritis encephalitis virus (CAEV), the bovine immunodeficiency virus (BIV), and the feline immunodeficiency virus (FIV). Lentiviruses can persist indefinitely in their hosts and replicate continuously at variable rates during the course of the lifelong infection. Persistent replication of the viruses in their hosts depends on their ability to circumvent host defenses.
[0205] The design of recombinant integrating lentiviral vectors is based on the separation of the cis- and trans-acting sequences of the lentivirus. Efficient transduction in non-dividing cells requires the presence of two cis-acting sequences in the lentiviral genome, the central polypurine tract (cPPT) and the central termination sequence (CTS). These lead to the formation of a triplestranded DNA structure called the central DNA “flap”, which maximizes the efficiency of gene import into the nuclei of non-dividing cells, including dendritic cells (DCs) (Zennou et al. (2000) Cell 101(2) 173-85; Arhel et al. (2007) EMBO J 26(12): 3025-37).
[0206] A vital component of the integration complex of LV is the viral integrase enzyme (IN) that catalyzes viral DNA integration into the host genome, as it mediates the integration between vector and host DNA. However, this process carries predictable risks of harmful insertional mutagenesis, prompting an examination of alternatives to vector-mediated integration. To address this, non-integrating lentiviral vectors (NILVs) were established. NILVs can stably express transgenes from the extrachromosomal DNA in non-dividing cells or transiently if the target cells divide both in vitro and in vivo.
[0207] Lentiviral particles containing lentiviral vectors can be produced, by example, by recombinant technology upon transient transfection of cells e.g., HEK 293 T human cultured cells) by a plasmid DNA such as, for example, a DNA plasmid of the invention. In this way, transient production of lentiviral particle vectors can be obtained from the transfected cells. Alternatively, lentiviral particle vectors can also be continuously produced by cells by stably inserting the packaging genes, the plasmid DNA (e.g., a DNA plasmid of the invention), and the envelope gene into the cellular genome. This allows for the continuous production of lentiviralparticle vectors by the cells without the need for transient transfection. It is also possible to use a combination of these procedures, as would be understood by those of ordinary skill.
[0208] The plasmid vectors of the invention can be formulated for administration according to a variety of different techniques, which are known to those of ordinary skill in the art. For example, the disclosed plasmid vector can be formulated for administration via a lipid nanoparticle, nanodiamonds, liposomes, microspheres, polymeric micelles, GalNac-conjugation, as a dextran formulations, as a polyethylene glycol (PEG) formulation, as an exosome formulation, and any other similar formulation know to those of ordinary skill.1. NANOPARTICLE FORMULATIONS
[0209] In various aspects, the plasmid vectors of the invention can be formulated for administration via a nanoparticle or nanoparticulate formulation.
[0210] As used herein, the term “nanoparticle” refers to any particle having a diameter making the particle suitable for systemic, in particular, parenteral, administration, of, in particular, nucleic acids, typically a diameter of less than 1000 nanometers (nm). In some aspects, a nanoparticle has a diameter of less than 600 nm. In some aspects, a nanoparticle has a diameter of less than 400 nm.
[0211] As used herein, the term “nanoparticulate formulation” or similar term refer to any substance that contain at least 0.2 pg, at least 1.0 pg, at least 5.0 pg, at least 10 pg, at least 15 pg or at least 20 pg of nanoparticles. In some aspects, a nanoparticulate composition is a uniform collection (e.g., from about 0.2 pg to about 20 pg) of nanoparticles. In some aspects, nanoparticulate compositions are dispersions or emulsions. In general, a dispersion or emulsion is formed when at least two immiscible materials are combined.
[0212] The nanoparticulate carriers such as lipid carriers contemplated for use in the present invention include any substances or vehicles with which a nucleic acid such as DNA can be associated, e.g., by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated. This can result in increased stability of the nucleic acid compared to a naked nucleic acid. In particular, stability of the nucleic acid in blood may be increased. In various aspects, the ratio of DNA, e.g., a DNA molecule of the invention, to lipid particle is from about 1 :2 to about 2: 1. In various further aspects, the ratio of DNA to lipid particle is about 1 : 1.
[0213] Nanoparticulate nucleic acid preparations for use in the present invention can be obtained by various protocols and from various nucleic acid complexing compounds. Lipids, polymers, oligomers, and amphipiles are typical complexing agents. In various aspects, the complexing compound comprises at least one agent selected from the group consisting protamine, polyethyleneimine, a poly-L-lysine, a poly-L-arginine, and a histone.
[0214] In addition, the nanoparticles described herein can further include a neutral lipid in view of structural stability and the like. The neutral lipid can be appropriately selected in view of the delivery efficiency of the nucleic acid-lipid complex. Examples of neutral lipids include, but are not limited to, l,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), 1,2- dioleoyl-sn-glycero-3 -phosphocholine (DOPC), diacylphosphatidyl choline, diacylphosphatidyl ethanol amine, ceramide, sphingoemyelin, cephalin, sterol, and cerebroside. In the case where a cationic liposome includes both a cationic lipid and a neutral lipid, the molar ratio of the cationic lipid to the neutral lipid can be appropriately determined in view of stability of the liposome and the like. See, e.g., Piotrowski-Daspit et al. (2020); Kulkarni et al. (2021); Zhong et al. (2023).
[0215] According to one aspect, the nanoparticles described herein can comprise phospholipids. The phospholipids can be a glycerophospholipid. Examples of glycerophospholipid include, but are not limited to, three types of lipids: (i) zwitterionic phospholipids, which include, for example, phosphatidylcholine (PC), egg yolk phosphatidylcholine, soybean-derived PC in natural, partially hydrogenated or fully hydrogenated form, dimyristoyl phosphatidylcholine (DMPC) sphingomyelin (SM); (ii) negatively charged phospholipids: which include, for example, phosphatidylserine (PS), phosphatidylinositol (PI), phosphatidic acid (PA), phosphatidylglycerol (PG) dipalmipoyl PG, dimyristoyl phosphatidylglycerol (DMPG); synthetic derivatives in which the conjugate renders a zwitterionic phospholipid negatively charged such is the case of methoxy-polyethylene, glycol-distearoyl phosphatidylethanolamine (mPEG-DSPE); and (iii) cationic phospholipids, which include, for example, phosphatidylcholine or sphingomyelin of which the phosphomonoester was O-methylated to form the cationic lipids.
[0216] Association of nucleic acid to the lipid carrier can occur, for example, by the nucleic acid filling interstitial spaces of the carrier, such that the carrier physically entraps the nucleic acid, or by covalent, ionic, or hydrogen bonding, or by means of adsorption by non-specific bonds. Whatever the mode of association, the nucleic acid must retain its therapeutic properties.2. LIPOSOMAL FORMULATIONS
[0217] Liposomes are microscopic lipidic vesicles often having one or more bilayers of a vesicle-forming lipid, such as a phospholipid, and are capable of encapsulating a drug. Different types of liposomes can be employed in the context of the present invention, including, but not limited to, multilamellar vesicles (MLV), small unilamellar vesicles (SUV), large unilamellar vesicles (LUV), sterically stabilized liposomes (SSL), multivesicular vesicles (MV), and large multivesicular vesicles (LMV), as well as other bilayered forms known in the art. The size and lamellarity of the liposome will depend on the manner of preparation and the selection of the type of vesicles to be used will depend on the preferred mode of administration. There are several other forms of supramol ecul ar organization in which lipids can be present in an aqueous medium, comprising lamellar phases, hexagonal and inverse hexagonal phases, cubic phases, micelles, and reverse micelles composed of monolayers. These phases can also be obtained in the combination with DNA or RNA, and the interaction with RNA and DNA can substantially affect the phase state. The described phases can be present in the nanoparticulate nucleic acid formulations of the present invention. See, e.g., Piotrowski-Daspit et al. (2020) Advanced Drug Delivery Reviews 156: 119-132; Kulkami et al. (2021) Nature Nanotechnology 16 630-643; Zhong et al. (2023) Nature Materials 22: 818-831.
[0218] For formation of nucleic acid lipoplexes from nucleic acid and liposomes, any suitable method of forming liposomes can be used so long as it provides the envisaged nucleic acid lipoplexes. Liposomes may be formed using standard methods such as, for example, the reverse evaporation method (REV), the ethanol injection method, the dehydrati on-rehydration method (DRV), sonication, and other suitable methods. After liposome formation, the liposomes can be sized to obtain a population of liposomes having a substantially homogeneous size range. See, e.g., Piotrowski-Daspit et al. (2020); Kulkarni et al. (2021); Zhong et al. (2023).
[0219] Bilayer-forming lipids typically have two hydrocarbon chains, particularly acyl chains, and a head group, either polar or nonpolar. Bilayer-forming lipids are either composed of naturally-occurring lipids or of synthetic origin, including the phospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatide acid, phosphatidylinositol, and sphingomyelin, where the two hydrocarbon chains are typically between about 14-22 carbon atoms in length, and have varying degrees of unsaturation. Other suitable lipids for use in the composition of the present invention include glycolipids and sterols such as cholesterol and its various analogs which can also be used in the liposomes.
[0220] The terms “lipoplex” and “nucleic acid lipoplex,” in particular, “DNA lipoplex,” means a complex of lipids and nucleic acids, in particular RNA. Lipoplexes are formed spontaneously when cationic liposomes, which often also include a neutral “helper” lipid, are mixed with nucleic acids.
[0221] Cationic lipids typically have a lipophilic moiety, such as a sterol, an acyl or diacyl chain, and have an overall net positive charge. The head group of the lipid typically carries the positive charge. The cationic lipid preferably has a positive charge of 1 to 10 valences, more preferably a positive charge of 1 to 3 valences, and more preferably a positive charge of 1 valence. Examples of cationic lipids include, but are not limited to, l,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA); dimethyldioctadecylammonium (DDAB); l,2-dioleoyl-3- trimethylammonium-propane (DOTAP); l,2-dioleoyl-3-dimethylammonium-propane (DODAP); l,2-diacyloxy-3-dimethylammonium propanes; l,2-dialkyloxy-3 -dimethylammonium propanes; dioctadecyldimethyl ammonium chloride (DODAC), l,2-dimyristoyloxypropyl-l,3- dimethylhydroxyethyl ammonium (DMRIE), and 2,3-dioleoyloxy-N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-l-propanamium trifluoroacetate (DOSPA).
[0222] Cationic lipids, cationic polymers, and other substances with positive charges can form complexes with negatively charged nucleic acids. These cationic molecules can be used to complex nucleic acids, thereby forming, e.g., so-called lipoplexes or polyplexes, respectively. These complexes have been shown to deliver nucleic acids into cells.F. COMPOSITIONS
[0223] In one aspect, disclosed are pharmaceutical compositions comprising a plasmid vector of the invention and a pharmaceutically acceptable carrier. Pharmaceutical compositions are preferably sterile and contain an effective amount (e.g., a therapeutically effective amount) of the nucleic acid (e.g., the DNA molecule of the invention encoding for a destabilizing TEAD1 or YAP1 3’ UTR). Pharmaceutical compositions are usually provided in a uniform dosage form and can be prepared in a manner known in the art. The pharmaceutical composition can, for example, be in the form of a solution or suspension.
[0224] The term “pharmaceutically acceptable” describes a material that is not biologically or otherwise undesirable, i.e., without causing an unacceptable level of undesirable biological effects or interacting in a deleterious manner.
[0225] As used herein, the term “pharmaceutically acceptable carrier” refers to sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. The injectable formulations can be sterilized, for example, by filtration through a bacterial- retaining filter or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.
[0226] The pharmaceutical composition can comprise salts, buffer substances, preservatives, carriers, diluents and / or excipients, all of which are preferably pharmaceutically acceptable. Salts that are not pharmaceutically acceptable can yet be used for preparing pharmaceutically acceptable salts and are included in the invention. Pharmaceutically acceptable salts of this kind comprise, in a non-limiting way, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic acids, and the like. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, including, but not limited to, sodium salts, potassium salts, and calcium salts.
[0227] Suitable buffer substances for use in the disclosed pharmaceutical composition include, but are not limited to, acetic acid in a salt, citric acid in a salt, boric acid in a salt, and phosphoric acid in a salt.
[0228] Suitable preservatives for use in the disclosed pharmaceutical composition include, but are not limited to, benzalkonium chloride, chlorobutanol, paraben, and thimerosal.
[0229] The term “excipient,” as used herein, refers to an organic or inorganic component, of a natural or non-natural (synthetic) nature, with which the active component is combined in order to facilitate, enhance, or enable application. As used herein, the term “excipient” also includes one or more compatible solid or liquid fdlers, diluents, or encapsulating substances, which are suitable for administration to a patient.
[0230] Possible carrier substances for parenteral administration include, but are not limited to, sterile water, glucose solutions, Ringer, Ringer lactate, sterile sodium chloride solution, polyalkylene glycols, hydrogenated naphthalenes and, in particular, biocompatible lactide polymers, lactide / glycolide copolymers, and polyoxyethylene / polyoxy-propylene copolymers.
[0231] The term “excipient” means all substances that can be present in a pharmaceutical composition and which are not active ingredients. Exemplary excipients include, but are not limited to, carriers, binders, lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffers, flavoring agents, and colorants.
[0232] The pharmaceutical compositions described herein can be administered via any conventional route including, but not limited to, parenteral administration including by injection or infusion. Administration is preferably parenterally, e.g., intravenously, intraarterially, subcutaneously, in the lymph node, intradermally, or intramuscularly, although alternative routes of administration (e.g., oral administration, intraperitoneal, subcutaneous, transuretheral, transperineal, transrectal) are also envisioned.
[0233] The molecules, vectors, and compositions disclosed herein are preferably administered in effective amounts. An “effective amount” means the amount that achieves a desired reaction or a desired effect alone or together with further doses. In the case of treatment of a particular disease or of a particular condition, the desired reaction preferably relates to inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in particular, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a disease or of a condition can also be delay of the onset or prevention of the onset of said disease or said condition.
[0234] As used herein, the terms “effective amount” and “amount effective” refer to an amount that is sufficient to achieve the desired result or to have an effect on an undesired condition. Forexample, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result (e.g., CS or complete response, PR or partial response, PFS or progression free survival, OS or overall survival) or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration.
[0235] An effective amount of an agent or composition described herein will depend on a variety of factors including, but not limited to, the condition to be treated, the severeness of the disease, the individual parameters of the patient, including age, physiological condition, size, and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration, and other similar factors. Accordingly, the doses administered of the agents, molecules, vectors, and compositions described herein may depend on several of these parameters. In the case that a reaction in a patient is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) can be used.
[0236] In various aspects, the plasmid vector comprises a disclosed DNA molecule of the invention. Plasmid DNA vectors can be used as either a preventative or therapeutic DNA vaccine for a wide range of indications, from viral, bacterial, and parasitic disease to cancer and as gene therapy products. See, e.g., Williams et al. (2009) Biotechnol. Adv. 27(4): 353-370. Processes for manufacturing plasmid DNA (pDNA) are well-known by those of skill in the art. See, e.g., Williams et al. (2009). Briefly, E. coli cells expressing the plasmid (e.g., a plasmid vector of the invention) are fermented before being harvested by, for example centrifugation or microfdtration tangential flow filtration (MF-TFF). The cell membrane is broken down (e.g., via cell lysis) to reveal a mixture of cellular contents including the plasmid DNA (e.g., a DNA molecule of theinvention), genomic DNA, proteins, RNA, and other cell debris. Contaminants are removed (e. ., via precipitation or flocculation) as is any solid content that arose during the chemical lysis and neutralization of the feed stream. The plasmid is further purified using, for example, anion exchange chromatography, hydrophobic ineraction chromatography, and / or size exclusion chromatography, before being separated (e.g., via ultrafiltration or diafiltration), concentrated, washed, and resuspended in an appropriate buffer. Finally, sterile filtration is used to remove any microbial contaminants that may have been introduced via processing. Once the pDNA satisfies quality specifications set by regulatory agencies, it can be packaged into a vaccine (e.g., as a pharmaceutical composition of the invention) and subsequently introduced into a patient by, for example, intramuscular injection or particle bombardment. See, e.g., Mor (1998) Biochemical Pharmacology 55(8): 1151-1153.G. METHODS OF REDUCING TEAD1 OR YAP1 EXPRESSION IN A CELL
[0237] In one aspect, disclosed are methods of reducing TEAD1 expression in a cell expressing TEAD1, the method comprising transfecting the cell with an amount of a vector of the invention to cause a reduction of TEAD1 expression.
[0238] In one aspect, the methods of the invention include reducing YAP1 expression in a cell expressing TEAD1, the method comprising transfecting the cell with an amount of a vector according to the invention to cause a reduction of YAP1 expression.
[0239] As used herein, the term “cell” means any cell that can be transformed or transfected with an exogenous nucleic acid. Particular preference is given to mammalian cells including, but not limited to, cells from humans, mice, hamsters, pigs, goats, and primates. The cells can be derived from a multiplicity of tissue types and include primary cells and cell lines. Exemplary cells include, but are not limited to, keratinocytes, peripheral blood leukocytes, bone marrow stem cells, and embryonic stem cells. A nucleic acid (e.g., a DNA molecule) can be present in the cell in a single or in several copies and, in various aspects, is expressed in the cell.
[0240] E. coh is a gram-negative, facultatively anaerobic, rod-shaped bacterium of the genus Escherichia that is commonly found in the lower intestine of warm-blooded organisms. The bacterium can be grown easily and inexpensively in a laboratory setting, and has been intensively investigated for over 60 years. E. coli is the most widely studied prokaryotic model organism, and an important species in the fields of biotechnology and microbiology, where it hasserved as the host organism for the majority of work with recombinant DNA. Exemplary E. coli strains include, but are not limited to, AG1, AB1157, B2155, BL21, BNN93, BNN97, BW26434, C600, CSH50, D1210, DB3.1, DH1, DH5a, DH10B, DH12S, DM1, E. cloni(r), E. coli K12 ER2738, ER2566, ER2267, HB101, IJ1126, IJ1127, JM83, JM101, JM103, JM105, JM106, JM107, JM108, JM109, JM110, JM2.300, LE392, Maehl, MC1061, MC4100, MFDpir, MG1655, 0mniMAX2, RR1, RV308, SOLR, SS320, STBL2, STBL3, STBL4, SURE, SURE2, TGI, TOPIO, ToplOF', W3110, WM3064, XLl-Blue, XL2-Blue, XLl-Red, and XLIO-Gold.
[0241] In various aspects, the disclosed DNA molecules can be administered to a patient by ex vivo methods, i.e., by removing cells from a patient, genetically modifying said cells, and reintroducing the modified cells into the patient. Transfection and transduction methods are known to those of ordinary skill.
[0242] The term “transfection” means the introduction of nucleic acids, in particular, DNA, into a cell. As used herein, the term “transfection” also includes the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such cell, wherein the cell can be present in a subject, e.g., a patient. Thus, according to the invention, a cell for transfection of a nucleic acid according to the invention described herein can be present in vitro or in vivo, e.g., the cell can form part of an organ, a tissue, and / or an organism of a patient. As used herein, transfection can be transient or stable. For some applications of transfection, it is sufficient if the transfected genetic material is only transiently expressed. Cells allowing episomal amplification of nucleic acids greatly reduce the rate of dilution. If it is desired that the transfected nucleic acid actually remains in the genome of the cell and its daughter cells, a stable transfection must occur. Any technique useful for introducing, i.e., transferring or transfecting, nucleic acids into cells can be used. Preferably, DNA is transfected into cells by standard techniques. Such techniques include, but are not limited to, electroporation, lipofection, and microinjection. In various aspects, DNA is introduced into cells by electroporation. Electroporation or electropermeabilization relates to a significant increase in the electrical conductivity and permeability of the cell plasma membrane caused by an externally applied electrical field. It is usually used in molecular biology as a way of introducing some substance into a cell. Introduction of nucleic acid encoding a 3’ UTR encoding a TEAD1 gene in a mRNA molecule in which one or more ARE poly(U) stabilizing motifs are destabilized, as detailed further herein, results in transcription of a mRNA moleculethat is destabilized compared to a wildtype mRNA molecule expressing a 3’ UTR encoding a TEAD1 protein.
[0243] In various aspects, the cell is mammalian. In a further aspect, the cell is human.
[0244] In various aspects, the cell has been isolated from a mammal prior to the transfecting step.
[0245] In various aspects, the cell is a cancer cell. In a further aspect, the cancer cell is a breast cancer cell, an ovarian cancer cell, a pancreatic cancer cell, or a prostate cancer cell. In a still further aspect, the cancer cell is trastuzumab-resistant. In yet an even further aspect, the cancer cell is a triple negative breast cancer cell. In an even further aspect, the cancer cell is a colon cancer cell, a lung cancer cell, a cervical cancer cell, an endometrial cancer cell, a neuroblastoma cell, a meningioma cell, a melanoma cell, a squamous cell carcinoma cell, a bone cancer cell, white blood cell cancer, or a throat cancer cell. In a still further aspect, the cell is a cancer cell where TEAD1 / YAP1 oncogenes are key drivers of pathogenesis. In a still further aspect, the cancer cell is resistant to a chemotherapeutic drug. In yet a further aspect, the chemotherapeutic drug to which resistance has developed is selected from paclitaxel, cisplatin, olaparib, doxorubicin, bevacizumab, trastuzumab, trastuzumab dexrutecan, fluorouracil, methotrexate, capecitabine, carboplatin, cyclophosphamide, oxaliplatin, altretamine, bendamustine, busulfan, chlorambucil, daunorubicin, gemcitabine, idarubicin, ifosfamide, mitoxantrone, cabazitaxel, ceritinib, cladribine, dacarbazine, and docetaxel. In an even further aspect, the cancer cell is resistant to an immunotherapeutic. In a still further aspect, the immunotherapeutic is an anti-PD- 1 monoclonal antibody, an anti-PD-Ll monoclonal antibody, or a checkpoint inhibitor. In yet a further aspect, the immunotherapeutic is pembrolizumab, nivolumab, brexucabtagene autoleucel, ado-trastuzumab emtansine, aldesleukin, amivantamab-vmjw, atezolizumab, axicabtagene ciloleucel, bevacizumab, blinatumomab, cetuximab, daratumumab, durvalumab, elotuzumab, gemtuzumab ozogamicin, ipilimumab, mogamulizumab, naxitamab, obinutuzumab, ramucirumab, siltuximab, and trastuzumab.
[0246] In various aspects, transfecting is via administration to a mammal. For example, as detailed herein, a DNA molecule of the invention can be cloned into a vector (e.g., a vector of the invention) and, thereafter, transfected into a cell. In various aspects, the cell is in a mammal, in which case transfection can be accomplished by formulating the vector as a pharmaceutical composition (e.g., a pharmaceutical composition of the invention) and thereafter administeringthe pharmaceutical composition to the mammal. Thus, transfection of the cell is accomplished by virtue of administering the pharmaceutical composition comprising the plasmid DNA.H. METHODS OF REDUCING TEAD1 OR YAP1 EXPRESSION IN A SUBJECT
[0247] In one aspect, disclosed are methods of reducing TEAD1 expression in a subject in need thereof, the method comprising transfecting the cell with an amount of a disclosed vector to cause a reduction of TEAD1 expression.
[0248] In one aspects, disclosed are methods of reducing YAP1 expression in a subject thereof, the method comprising transfecting the cell with an amount of a disclosed vector to cause a reduction of YAP 1 expression.
[0249] As used herein, the term “subject” can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human, nonhuman primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. In one aspect, the subject is a mammal. A patient refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects.
[0250] As used herein, the terms “administering” and “administration” refer to any method of providing a pharmaceutical preparation to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intracerebral administration, rectal administration, transuretheral administration, transperineal administration, transrectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can be continuous or intermittent. In various aspects, a preparation can be administered therapeutically; that is, administered to treat an existing disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.
[0251] Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease or condition.
[0252] In various aspects, the DNA molecule comprises in the 5’ -> 3’ direction of transcription relative to synthesis of a messenger RNA (mRNA) molecule comprising a 3’ UTR encoding a TEAD1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR encoding a TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the mRNA molecule encoded by the DNA molecule is destabilized compared to a wildtype mRNA molecule comprising a 3’ UTR encoding a TEAD1 protein.
[0253] In various aspects, the DNA molecule comprises in the 5’ -> 3’ direction of transcription relative to synthesis of a messenger RNA (mRNA) molecule comprising a 3’ UTR encoding a YAP1 protein: (a) a promoter, operatively linked to (b) a nucleic acid sequence encoding a 3’ UTR encoding a YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, wherein the mRNA molecule encoded by the DNA molecule is destabilized compared to a wildtype mRNA molecule comprising a 3’ UTR encoding a YAP1 protein.
[0254] In various aspects, the subject is a mammal. In further various aspects, the subject is a human.
[0255] In various aspects, administering is via oral, intraveneous, intraperitoneal, subcutaneous, or intramuscular administration.
[0256] In various aspects, the subject has been diagnosed with a need for inhibition of TEAD1 expression prior to the administering step.
[0257] In various aspects, the subject has been diagnosed with a need for inhibition of YAP 1 expression prior to the administering step.I. METHODS OF TREATING A DISEASE OR DISORDER
[0258] In one aspect, disclosed are methods of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a disclosed pharmaceutical composition, wherein the disease or disorder is selected from cancer, obesity, a liver disease, and a cardiac disease. In a further aspect, the disease or disorder is associated with Hippo pathway dysfuction, as further described herein.
[0259] The term “disease” refers to an abnormal condition that affects the body of an individual. A disease is often construed as a medical condition associated with specific symptoms and signs. A disease can be caused by factors originally from an external source, such as, for example, an infectious disease, or it can be caused by internal dysfunctions, such as, for example, autoimmune diseases.
[0260] As disclosed herein, the term “disease” also refers to cancer diseases. The terms “cancer disease” and “cancer” (medical term: malignant neoplasm) refers to a class of diseases in which a group of cells display uncontrolled growth (division beyond the normal limits), invasion (intrusion on and destruction of adjacent tissues), and sometimes metastasis (spread to other locations in the body via lymph or blood). These three malignant properties of cancers differentiate them from benign tumors, which are self-limited, and do not invade or metastasize. Most cancers form a tumor, i.e., a swelling or lesion formed by an abnormal growth of cells (called neoplastic cells or tumor cells), but some, like leukemia, do not. Examples of cancers include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, glioma and leukemia. More particularly, examples of such cancers include bone cancer, blood cancer, lung cancer, liver cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, colon cancer, breast cancer, prostate cancer, uterine cancer, carcinoma of the sexual and reproductive organs, Hodgkin's disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the bladder, cancer of the kidney, renal cell carcinoma, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), neuroectodermal cancer, spinal axis tumors, glioma, meningioma, and pituitary adenoma. The term “cancer” also includes cancer metastases.
[0261] The term “disorder” means a condition or set of conditions that disrupts normal or regular body function. In various aspects, a disorder can be a result of a disease. For example, disorders that result from cardiovascual diseases include an arrhythmias or irregular heartbeats. Additional examples of disorders include, but are not limited to, arthritis, autism spectrum disorder, and ataxia.
[0262] As used herein, the term “liver disease” refers to a variety of different conditions that stop the liver from working or otherwise prevent it from functioning well. Exemplary liver diseases include, but are not limited to, hepatitis, fatty liver, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), cholestatic liver diseases or graft-versus-host disease of the liver, and cirrhosis.
[0263] As used herein, the terms “cardiac disease,” “cardiovascular disease,” and “heart disease” refer to a range of conditions that affect the structures or function of the heart and blood vessels, including, but not limited to, obesity, diabetes, coronary artery disease, congestive heart failure, cardiomegaly, rheumatic heart disease, and cerebrovascular disease.
[0264] As used herein, the term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. In various aspects, the term covers any treatment of a subject, including a mammal (e.g., a human), and includes: (i) preventing the disease from occurring in a subject that can be predisposed to the disease but has not yet been diagnosed as having it; (ii) inhibiting the disease, i.e., arresting its development; or (iii) relieving the disease, i.e., causing regression of the disease. In one aspect, the subject is a mammal such as a primate, and, in a further aspect, the subject is a human. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock(e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.).
[0265] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.
[0266] As used herein, the term “diagnosed” means having been subjected to a physical examination by a person of skill, for example, a physician, and found to have a condition that can be diagnosed or treated by the molecules, vectors, compositions, or methods disclosed herein.
[0267] As used herein, “dosage form” means a pharmacologically active material in a medium, carrier, vehicle, or device suitable for administration to a subject. A dosage forms can comprise inventive a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, in combination with a pharmaceutically acceptable excipient, such as a preservative, buffer, saline, or phosphate buffered saline. Dosage forms can be made using conventional pharmaceutical manufacturing and compounding techniques. Dosage forms can comprise inorganic or organic buffers (e.g., sodium or potassium salts of phosphate, carbonate, acetate, or citrate) and pH adjustment agents (e.g., hydrochloric acid, sodium or potassium hydroxide, salts of citrate or acetate, amino acids and their salts) antioxidants (e.g., ascorbic acid, alpha-tocopherol), surfactants (e.g., polysorbate 20, polysorbate 80, polyoxyethylene 9-10 nonyl phenol, sodium desoxy cholate), solution and / or cryo / lyo stabilizers (e.g., sucrose, lactose, mannitol, trehalose), osmotic adjustment agents (e.g., salts or sugars), antibacterial agents (e.g., benzoic acid, phenol, gentamicin), antifoaming agents (e.g., polydimethylsilozone), preservatives (e.g., thimerosal, 2-phenoxyethanol, EDTA), polymeric stabilizers and viscosity-adjustment agents (e.g., polyvinylpyrrolidone, poloxamer 488, carboxymethylcellulose) and co-solvents (e.g., glycerol, polyethylene glycol, ethanol). A dosage form formulated for injectable use can have a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, suspended in sterile saline solution for injection together with a preservative.
[0268] In various aspects, the subject is a mammal. In further various aspects, the subject is a human.
[0269] In various aspects, the disease or disorder is cancer. Examples of cancers include, but are not limited to, a sarcoma (e.g., a cholangiosarcoma), a carcinoma (e.g., a hepatocellularcarcinoma), a blastoma (e.g., a hepatoblastoma), a gastric adenoma, a hematological cancer, a solid tumor, breast cancer, cervical cancer, gastrointestinal cancer, colorectal cancer, brain cancer, skin cancer, prostate cancer (e.g., neuroendocrine prostate cancer), ovarian cancer, nonsmall cell lung carcinoma, thyroid cancer, testicular cancer, pancreatic cancer, liver cancer, endometrial cancer, melanoma, a glioma (e.g., astrocytoma, oligodendroglioma, oligoastrocytoma, glioblastoma), leukemia, lymphoma, chronic myeloproliferative disorder, myelodysplastic syndrome, myeloproliferative neoplasm, and plasma cell neoplasm (myeloma).
[0270] In various aspects, the disease or disorder is obesity.
[0271] In various aspects, the disease or disorder is the liver disease. Examples of liver diseases include, but are not limited to, fatty liver disease, steatosis, non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, non-alcoholic steatohepatitis (NASH), and alcohol steatohepatitis.
[0272] In various aspects, the disease or disorder is the cardiac disease. In further various aspects, the cardiac disease is cardiomegaly.
[0273] Also provided are the uses of the disclosed molecules, vectors, pharmaceutical compositions, and products. In one aspect, the invention relates to use of at least one disclosed molecule or at least one disclosed vector. In a further aspect, the molecule or vector used is a product of a disclosed method of making.
[0274] In various aspects, the use relates to a treatment of disorder associated with dysregulation of the Hippo pathway. In one aspect, the use is characterized in that the subject is a human. In one aspect, the use is characterized in that the disorder is selected from cancer, obesity, liver diseases, and cardiac diseases.
[0275] In a further aspect, the use relates to a process for preparing a pharmaceutical composition comprising a therapeutically effective amount of a disclosed molecule or vector or a product of a disclosed method of making, for use as a medicament.
[0276] In a further aspect, the use relates to a process for preparing a pharmaceutical composition comprising a therapeutically effective amount of a disclosed molecule or vector or a product of a disclosed method of making, wherein a pharmaceutically acceptable carrier is intimately mixed with a therapeutically effective amount of the molecule or vector or the product of a disclosed method of making.
[0277] In a further aspect, the invention relates to the use of a disclosed molecule, a disclosed vector, a disclosed pharmaceutical composition, or a disclosed product in the manufacture of a medicament for the treatment of a disease disorder associated with dysregulation of the Hippo pathway in a mammal. In a further aspect, the disorder is selected from cancer, obesity, a liver disease, and a cardiac disease.J. EXAMPLES
[0278] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and / or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric.
[0279] Briefly, as detailed herein, it has been found that the 3’ UTR of the oncogenes TEAD1 and YAP1 is enriched with poly(U) sequences in various cancer cell lines, including, but not limited to, breast, prostate, ovarian, and pancreatic cancer cell lines. These poly(U) sequences act as a mRNA stabilizing motif. It is, therefore, hypothesized that nonsense mediated decay of the transcript can be achieved by engineering unstable forms driven by mRNA decapping promoters. As detailed herein, TEAD1 and YAP1 constructs were engineered in which poly(U) stabilizing motifs were converted to destabilizing motifs. Using these constructs, it has been demonstrated in vivo in multiple cancer types that destabilization of the TEAD1 and YAP1 3’ UTR poly(U) motif leads to degradation of their oncogenic transcript and impairs their growth, proliferation, and metastasis, offering an improved survival outcome.
[0280] The Examples are provided herein to illustrate the invention, and should not be construed as limiting the invention in any way. Examples are provided herein to illustrate the invention and should not be construed as limiting the invention in any way.3. IDENTIFICATION OF THE MRNA 3’ UTR POLY U SEQUENCES OF TEAD1 ANDYAP1 ONCOGENES
[0281] The 3’ UTR of TEAD1 and YAP1 was searched on genome browsers. This led to the identification of the mRNA polyU sequences as shown in Table 6 below (with polyU stabilizing sequences bolded). See also FIG. 1A and FIG. IB.TABLE 6.4. DESIGN AND SYNTHESIS OF THE DESTABILIZED 3’ UTR OF TEAD1
[0282] To design the destabilized 3’ UTR of YAP1 and TEAD1, consensus stabilized UUUUU motifs were replaced with destabilized consensus motifs of CUGU and CCUC (FIG 2A). See Table 2 above, with the destabilizing mRNA sequences bolded.
[0283] To synthesize the engineered destabilized TEAD1 3’ UTR, a modular design of the DCP1 A promoter was placed in the 5’ end of the destabilized construct. This sequence is a minimum DCP1A promoter to drive the engineered destabilized construct and trigger nonsense mediated decay of the transcript specifically on a spatial and temporal scale (FIG. 2B).
[0284] Referring to FIG. 2B, the engineered destabilized 3’ UTR TE D1 construct was synthesized by IDT, Inc. USA, and passed gblock synthesis quality. Sequences marked in grey show minimal DCP1 A promoter sequence while sequences in black illustrate the destabilized 3’ UTR of TEAD1. The structure of the engineered destabilized 3’ UTR of TEAD1 is shown inFIG. 3 and was obtained from RNA Structure software (Reuter and Mathews (2010) BMC Bioinformatics 11: 129).5. DESIGN AND SYNTHESIS OF THE DESTABILIZED 3’ UTR OF YAP1
[0285] To design the destabilized 3’ UTR of YAP1, consensus stabilized UUUUU motifs were replaced with destabilized consensus motifs of CUGU (SEQ ID NO: 1) and CCUC (SEQ ID NO: 2) (FIG. 4). See also Table 2 above, with the destabilizing mRNA sequences bolded.
[0286] To synthesize the engineered destabilized 3’ UTR YAP1, a modular design of the minimal DCP1A promoter is placed in the 5’ of the engineered destabilized 3’ UTR YAP1. This sequence drives the destabilized construct and triggers nonsense mediated decay of YAP1 mRNA specifically upon destabilization and enables the degradation of YAP 1 transcript and protein in spatial and temporal scale (FIG. 5).
[0287] Referring to FIG. 5, the engineered destabilized 3’ UTR YAP1 construct was synthesized by IDT, Inc. USA and passed gblock synthesis quality. Sequences marked in grey show minimal DCP1A promoter sequence while sequences in black illustrate the destabilized 3’ UTR of YAP1. The structure of the engineered destabilized 3’ UTR of TEAD1 is shown in FIG. 6 and was obtained from RNA Structure software (Reuter and Mathews (2010) BMC Bioinformatics 11: 129).6. CLONING AND GENERATION OF DESTABILIZED 3’ UTR TEAD1 AND YAP1
[0288] Destabilized 3’ UTR of TEAD1 and YAP1 were cloned into pLenti-CMVSP6-nEGFP- SV40-PURO in the following steps: (1) Miniprep of vector, (2) digestion of vector, (3) gel extraction of vector, (4) PCR amplification of engineered destabilized 3’ UTR, (5) insertion of engineered destabilized 3’ UTR into vector, (6) transformation of E. coli, (7) colony selection and Miniprep, (8) gel extraction of engineered destabilized 3’ UTR, (9) Sanger sequencing A stab of the vector was inoculated into LB media and grown over night shaking at 250rpm at 37 °C. The plasmid vector gDNA was extracted using the Qiagen Midikit (Cat no: 12943).1 pl (400 ng) of vector was digested using 1 pl BstBi and 1 pl BamHl with 3 pl of buffer, 25 p 1 of H2O. The reaction was incubated at 37 °C for 15 minutes and at 65 °C for 15 minutes using NEB buffer rSmart. The digested vector was gel extracted using Qiagen gel extraction kit (Cat no28704) (FIG. 7A).
[0289] PCR amplification of engineered destabilized 3’ UTR of TEAD1 and YAP1 was completed using the following cycle: (1) 94 °C for 2 minutes; (2) 94 °C for 15 seconds; (3) 55 °C for 30 seconds; (4) 68-72 °C for 1 minute; (5) Repeat steps (2)-(4) for 40 cycles; and (5) hold at4 °C. The PCR set up included the following: 20 pL of H2O, 1 pl TEAD1 or YAP1 Forward primers, 1 pL TEAD1 or YAP1 Reverse primers, 2 pL of gblock engineered destabilized 3’ UTR TEAD1 or YAP1 (200 ng), and 12 pL of NEBNext® Ultra™ II Q5® Master Mix (Cat #: M0544S).
[0290] PCR amplicons were then separated on 2% agarose gel (FIG 7B). The digested vector and the amplified synthetic gblock containing the engineered destabilized TEAD1 and YAP1 3’ UTR were gel extracted using Qiagen gel extraction kit (Cat no: 28704).
[0291] Ligation. To insert engineered destabilized 3’ UTR of TEAD1 and YAP1 into pLenti- CMVSP6-nEGFP-SV40-PURO, plasmid ligation reaction contained the following: T4 ligase buffer 2 pl, Plasmid vector 0.5 pl, 2 pl of insert (synthetic gblock TEAD1 or YAP1), 4 pl Nuclease free water 20 pl, and T4 ligase 1 pl (NEB). The ligation reaction mix was incubated 16 °C overnight.
[0292] Transformation , Competent E. coli were transformed using the following protocol: 25 pL of cells were incubated on ice with 5 pL of ligation mix for 30 minutes. Cells were then heat shocked in water bath at 42 °C for 30 seconds. Tubes were placed back on ice for 2 minutes and 900 pL SOC media was added. Cells were then incubated at 37 °C shaking for 1 hour at 250 rpm. Mixture was then plated on LB agar plates containing ampicillin, which were then incubated overnight at 37 °C (FIG. 8).
[0293] Colony pickins and Miniprep. Colonies were picked with pipette tips and inoculated into5 ml LB media containing ampicillin and incubated overnight at 37 °C shaking at 250 rpm. The pellets were centrifuged and gDNA was extracted using the Qiagen Midikit (Cat no: 12943) and subsequently quantified using a nanodrop machine.
[0294] Colony PCR with TEAD1 3 ’ UTR primers. To validate successful insertion and amplification, PCR was performed using previously described protocol. Seven clones were obtained from pLenti-YAPl transformed E. coli and denoted TD1-7 or 3’ UTRTEAD1-T1 to T7 (FIG. 9). The sequences of the 3’ UTR TEAD1 clones are shown in Table 5 above.
[0295] Colony PCR with YAP1 3 ' UTR primers. PCR was performed with the 3’ UTR YAP1 primers using previously described protocol. Twenty clones were obtained from pLenti-YAPltransformed E. coli and denoted as YP1-20 or 3’ UTRYAP1-Y1 to Y20 (FIG. 10). The sequences of the 3’ UTR YAP1 clones are shown in Table 5 above.
[0296] Gel Extraction. Colony products of destabilized 3’ UTR TEAD1 and YAP1 were extracted using Qiagen gel extraction kit (Cat no: 28704). Cloned gblock amplicons of TEAD1, YAP1, and DCP1A 3’ UTR were sequenced by Sanger Sequencing with Psomagen, Inc., Brooklyn, New York using the primers described above.
[0297] Referring to FIG. 11-14, the destabilized 3’ UTR TEAD1 clones TD1, TD3, TD4, and TD5 all successfully mapped to the 3’ UTR of TEAD1 and minimal promoter of DCP1A.
[0298] Referring to FIG. 15-20, the destabilized 3’ UTR YAP1 clones YP1, YP4, YP8, YP9, and YP13 all successfully mapped to 3’ UTR of YAP1 and minimal promoter of DCP1 A.7. EXPERIMENTAL VALIDATION OF THE ENGINEERED DESTABILIZED 3’ UTR TEAD1 CONSTRUCTS
[0299] To investigate the effect of engineered destabilized 3’ UTR TEAD1 in cancer cells, triple negative breast cancer cell lines (MDA-MB231 and MDA-MB468), prostate cancer cells (PC3), and ovarian cancer cells (SKOV3) were transfected with empty vector, 3’ UTRTEAD1-T1, 3’ UTRTEAD1-T3, 3’ UTRTEAD1-T4, or 3’ UTRTEAD1-T5. Compared to wild-type and empty vector treated cells, cells treated with constructs displayed cell shrinkage, reduction, and loss of architecture (FIG. 21 and FIG. 22). Without wishing to be bound by theory, these data suggest that the constructs directly target the Hippo pathway, which is responsible for cell size regulation.8. EVALUATION OF DESTABILIZED 3’ UTR TEAD1 CONSTRUCT DOSAGE
[0300] To evaluate the effect of construct dosage, MDA-MB468 were treated with various dosages of 3’ UTR TEAD1-T5 or empty vector: 2.5 pg, 5 pg, 10 pg, 20 pg, and 40 pg. Cell size was quantified and destabilized 3’ UTR TEAD1 targeted and reduced cancer cell size in a titratable dose dependent manner (FIG. 23).9. DETERMINATION OF ICSO OF THE DESTABILIZED 3’ UTR TEAD1
[0301] To evaluate the ICso of the engineered destabilized 3' UTR TEAD1, MDA-MB468 were treated with empty vector or various concentrations of 3’ UTR TEAD1-T5 (2.5 pg, 5 pg, 10 pg,20 ng, and 40 pg). Cell size was quantified and used to create dose response curves, where ICso was determined to be 3.1291 pg (FIG. 24).10. EVALUATION OF DESTABILIZED 3’ UTR YAP1 CONSTRUCTS
[0302] To determine the effect of engineered destabilized 3’ UTR YAP1, MDA-MD231, PC3, and A2780 were treated with empty vector, 3’ UTR YAP1-Y1, 3’ UTR YAP1-Y2, or 3’ UTR YAP1-Y4. Compared to wild-type and empty vector, treated cells exhibited drastic reduction, shrinkage, and loss of cellular architecture (FIG. 25). Without wishing to be bound by theory, these data suggest that the constructs directly target the Hippo pathway, which is responsible for cell size regulation.11. EVALUATION OF YAP1, TEAD1, AND INTERACTOME UPON TREATMENT WITH ENGINEERED DESTABILIZED 3’ UTR TEAD1 AND YAP CONSTRUCTS
[0303] In order to show the specificity of the engineered destabilized 3’ UTR TEAD1, RNA- sequencing of MDA-MB231 and MDA-MB468 was performed. Cells were treated with empty vector (untreated) or treated with 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1- T5. RNA-seq analysis showed that constructs specifically downregulated TEAD1, TEAD2, TEAD3, and proteins within its interactome including YAP1, JUN, JUND, STAT3, STAT6, STAT1, FOS, FOSB, MYC, CD274, CCN1, and CCN2 (FIG. 26A-D).
[0304] Referring to FIG. 16A and FIG. 16B, heat maps showing the global gene expression pattern of the MDA-MB231 (FIG. 16A) and MDA-MB468 (FIG. 16B) WT, vector, and the same cells treated with the 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1-T5 are shown. Referring to FIG. 16C and FIG. 16D, heat maps show greater than 2-fold downregulation of TEAD1, TEAD3, YAP1, JUND, STAT3 and STAT6 in the MDAMB231 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, and 3’ UTR TEAD1-T5 treated cells (FIG. 16C) and greater than 2-fold downregulation of TEAD1, TEAD2, TEAD3, YAP1, JUNB, JUN, JUND, STAT1, FOS, FOSB, MYC, CD274, CCN1 and CCN2 in the MDAMB468 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, and 3’ UTR TEAD1-T5 treated cells.
[0305] RNA-seq was also performed to determine specificity of engineered destabilized 3’ UTR YAP1. Briefly, MDA-MB231 were untreated or treated with empty vector, 3’ UTR YAP1-Y2, or 3’ UTR YAP1-Y4. Cancer cells treated with constructs exhibited decreased YAP1 and direct interactor TEAD1 (FIG. 27A and FIG. 27B).
[0306] Referring to FIG. 27A, a heat map of the global gene expression pattern in the MDA- MB231 cells untreated, vector treated, or treated with either 3’ UTR YAP1-Y2 or 3’ UTR YAP1-Y4 is shown. Referring to FIG. 27B, heat maps illustrate the downregulation of the YAP1 transcript and its direct interactor TEAD1 in the 3’ UTR YAP1-Y2 and -Y4 treated cells.12. QUANTITATIVE REVERSE TRANSCRIPT POLYMERASE CHAIN REACTION (QRT- PCR) VALIDATES THAT THE DESTABILIZED 3’ UTR TEAD1 CONSTRUCTS DOWNREGULATE PAN CANCERS
[0307] To validate knockdown of endogenous TEAD1 and RNA-seq analysis, qRT-PCR was performed. RNA was isolated from multiple treated and untreated cancer cell lines (MDA- MB468, MDA-MD231, PC3, SKOV3, and A2780). Across all cell types, the constructs downregulated TEAD1 (FIG. 28A-E).
[0308] Referring to FIG. 28A-E, the constructs 3’ UTR TEAD1-T3 and -T5 downregulateTEAD1 in the triple negative breast cancer cell lines MDA-MB468 (FIG. 28A) and MDA- MB231 (FIG. 28B), in the androgen independent prostate cancer PC3 (FIG. 28C), in the ovarian cancer SKOV3 (FIG. 28D), and in the drug resistant ovarian cancer cell line A2780.13. DOWNREGULATION OF THE TEAD1 MRNA BY THE DESTABILIZED 3’ UTR TEAD1 CONSTRUCTS ARE SPECIFIC, TITRATABLE, AND DOSE DEPENDENT
[0309] Expression of TEAD1 was evaluated in MDA-MB468 and MDA-MB231 cells in a dose dependent manner. Specifically, triple negative breast cancer cells were treated with various concentrations of empty vector or 3’ UTR TEAD1-T5 (2.5 pg, 5 pg, 10 pg, 20 pg, or 40 pg). After 72 hours, cells were harvested and mRNA was extracted using RNA Mini kit (Qiagen cat no 74104). First cDNA strand synthesis was completed using reverse transcription kit superscript III first strand synthesis system (Thermofisher Cat no: 18080051) and qRT-PCR was subsequently done. TEAD1 expression was normalized to GAPDH housekeeping gene. The constructs downregulated TEAD1 in a specific dose dependent manner (FIG. 29A and FIG.29B)
[0310] Referring to FIG. 29A and FIG. 29B, the normalized TEAD1 expression is shown in a dose dependent manner with the construct treated and vector treated MDA-MB231 (FIG. 29A) and MDA-MB468 (FIG. 29B) cells.14. THE ENGINEERED DESTABILIZED 3’ UTR TEAD1 DOWNREGULATES PANTEAD (2, 3, AND 4) ACROSS MULTIPLE CANCERS
[0311] To evaluate the effect of engineered destabilized on pan-TEAD (TEAD2, TEAD3, and TEAD4), transcript expression was evaluated using qRT-PCR in MDA-MD468, MDA-MB231, and PC3 cells. Cancer cells were untreated or treated with vector, 3’ UTR TEAD1-T1, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1-T5. Cells treated with constructs showed downregulated TEAD2, TEAD3, and TEAD4 mRNA expression across all cancer cell types tested (FIG. 30A-C).15. YAP1, c-MYC, JUN, AND FOSL1 EXPRESSION IS DOWNREGULATED IN THE TEAD1 DESTABILIZED CELLS
[0312] In order to validate RNA-seq data of TEAD1 interactome, YAP1, MYC, JUN, and FOSL1 mRNA expression was evaluated in PC3, SKOV3, MDA-MD468, and MDA-MB231 cancer cell lines. Cells were untreated or treated with vector, 3’ UTR TEAD1-T1, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1-T5. RT-PCR showed decreased mRNA expression of TEAD 1 interactome in 3’ UTR TEAD1 constructs (FIG. 31-33).16. THE ENGINEERED DESTABILIZED 3’ UTR YAP1 CONSTRUCTS LEAD TO THE DOWNREGULATION OF YAP1 MRNA
[0313] To show that YAP1 mRNA is downregulated by the engineered 3’ UTR YAP1, YAP1 mRNA expression was evaluated using qRT-PCR in PC3 treated with vector, 3’ UTR YAP1-Y1, 3’ UTR YAP1-Y2, or 3’ UTR YAP1-Y4. Compared to wild-type and vector treated, YAP1 expression was downregulated (FIG. 34).17. DETERMINATION OF THE ICSO OF THE 3’ UTR TEAD1-T5 IN A HEAD-TO-HEAD COMPARISON WITH STANDARD OF CARE CHEMOTHERAPEUTIC AGENTS IN PAN CANCER CELL LINES
[0314] To determine the ICso of the engineered destabilized 3’ UTR TEAD1-T5 in comparison to standard of care chemotherapeutic agents (Olaparib, Cisplatin, Epirubicin, Paclitaxel, Enzalutamide, Abiterone), six cancer cell lines were examined (MDAMB231, MDAM468, PC3, 22RV1, MIAPACA2, and A2780). The ICso of 3’ UTR TEAD1-T5 is superior in MIAPACA2(pancreatic cancer), MDAMB468 (triple negative breast cancer, black woman), and PC3 (androgen independent prostate cancer) compared to the standard of care drugs (FIG. 35A-E).
[0315] Referring to FIG. 35A-E, dose response curves comparing 3’ UTR TEAD1-T5 to standard of care drugs in MDA-MB231 (triple negative breast cancer, Caucasian woman; FIG. 35A), MDA-MB468 (triple negative breast cancer, black woman; FIG. 35B), MIAPACA2 (pancreatic cancer; FIG. 35C), PC3 (androgen independent prostate cancer; FIG. 35D), 22RV1 (androgen independent prostate cancer; FIG. 35E), and A2780 (cisplatin and paclitaxel resistant ovarian cancer; FIG. 35F)18. ENGINEERED DESTABILIZED 3’ UTR TEAD1 AND 3’ UTR YAP1 CONSTRUCTS REDUCE CANCER CELL SIZE IN MULTIPLE CANCERS
[0316] The Hippo pathway, mediated by TEAD1 and YAP1, regulates cell sizes. Cancers dysregulate this mechanism to proliferate, increase in size, and metastasize. Cell size was measured across multiple cell types, including MDA-MB231, MDA-MB468, PC3, and SKOV3. Cells were treated with vector, 3’ UTR TEAD1-T1, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, 3’ UTR TEAD1-T5, 3’ UTR 3’ UTR YAP1-Y1, 3’ UTR YAP1-Y2, or 3’ UTR YAP1-Y4. The engineered destabilized 3’ UTR TEAD1 and YAP1 decreased the cancer cell size across MDA- MB231 (triple negative breast cancer, Caucasian woman), MDA-MB468 (Triple negative breast cancer, black woman), PC3 (androgen independent prostate cancer), and SKOV3 (ovarian cancer) (FIG. 36).19. ENGINEERED DESTABILIZED 3’ UTR TEAD1 CONSTRUCTS IMPAIR CANCER CELL VIABILITY
[0317] To determine if engineered destabilized 3’ UTR TEAD1 impairs cancer cell viability, a cell viability assay was performed using Promega Cell Titre Gio. MDA-MB231 and PC3 were treated with vector, 3’ UTR TEAD1-T1, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1-T5. Treated cells exhibited decreased viability compared to the wild-type and empty vector treated controls (FIG. 37).20. ENGINEERED DESTABILIZED 3’ UTR TEAD1 AND 3’ UTR YAP1 CONSTRUCTS IMPAIR CANCER CELL MIGRATION ACROSS MANY CANCERS
[0318] To determine the ability of the engineered destabilized 3’ UTR of TEAD1 and YAP1 to inhibit cancer cell migration, wound healing assays were performed on multiple cancer cells. Cancer cells were treated with vector, 3’ UTR TEAD1-T1, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, 3’ UTR TEAD1-T5, 3’ UTR 3’ UTR YAP1-Y1, 3’ UTR YAP1-Y2, or 3’ UTR YAP1-Y4. The rate of wound healing closure was measured from Day 0 to Day 4. Cancer cells treated with constructs illustrated impaired migration (FIG. 38A-E, FIG. 39-41, and FIG. 42A- C).21. ENGINEERED DESTABILIZED 3’ UTR TE D1 CONSTRUCTS DEGRADE TEAD1 PROTEIN AND INTERACTORS C-MYC AND YAP1
[0319] To confirm that the engineered destabilized 3’ UTR of TEAD1 induces loss of TEAD1 protein and interactome c-MYC and YAP1, Western blot assays were conducted. Cancer cells were treated with vector, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, or 3’ UTR TEAD1-T5. Protein expression of TEAD1, MYC, and YAP1 was reduced in construct-treated cancer cells, while GAPDH remained unaffected (FIG. 43A-C).
[0320] Referring to FIG. 43A-C, protein expression of TEAD1, GAPDH, MYC, and YAP1 in multiple independent experiments is shown, illustrating that 3’ UTR TEAD1-T3 and -T5 completely degrade the TEAD1 protein, which leads to the reduction of c-MYC and YAP1. The house-keeping gene GAPDH is unaffected.22. ENGINEERED DESTABILIZED 3’ UTR YAP1 CONSTRUCTS DEGRADE YAP1 PROTEIN IN CANCER
[0321] To establish if the engineered destabilized YAP1 constructs degrade YAP1, immunofluorescence was performed. PC3 cells were treated with empty vector or 3’ UTR YAP1-Y2 and compared to wild-type. Cells were stained with anti-YAPl antibody and nuclear stain DAPI. PC3 treated with the 3’ UTR YAP1-Y2 treated cells showed loss of YAP1 expression (FIG. 44)23. ENGINEERED DESTABILIZED 3’ UTR TEAD1 CONSTRUCTS DOWNREGULATEKEY GENES THAT ARE IMPLICATED IN INSULIN RESISTANCE, CHOLESTOROLMETABOLISM, AND FATTY ACID SYNTHESISI l l
[0322] To determine whether the engineered destabilized 3’ UTR TEAD1 constmcts can be useful in regulating the abnormal expression of metabolic pathways involved in Hippo signaling that is observed in insulin resistance and cholesterol metabolism, RNA sequencing was performed on various human cells, and a volcano plot and Kegg and Wiki pathway plot was generated (FIG. 48). As shown in FIG. 48, cells treated with 3’ UTR TEAD1-T5 down- regulated key genes (z.e., PCSK9, INSIGI, FASN,FADS1, SREBF1, ALDHA2, TNSF16, SPINK4, VGLL1) involved in regulating fatty acid and cholesterol levels. See also FIG. 49.24. ENGINEERED DESTABILIZED 3’ UTR TEAD1 CONSTRUCTS DOWNREGULATE PROTEINS THAT ARE IMPLICATED IN OBESITY AND VARIOUS LIVER DISEASES
[0323] Table 7 below illustrates that downregulation of TEAD1 and YAP1 results in downregulation of leptin, leptin receptor, ALDHA1, 6A1, 1A2, 3B2, 1L2, and 4A1, which are implicated in obesity as well as in various liver disease such as NASH, MASH, steatosis, NAFLD, and AFLD, among others.TABLE 7.
[0324] Referring to FIG. 50, the engineered destabilized construct 3’ UTR TEAD1-T5 reduces the viability of inguinal fat cells X9 in a dose-dependent manner.25. ENGINEERED DESTABILIZED 3’ UTR TEAD1 CONSTRUCTS ARE SPECIFIC
[0325] The engineered destabilized TEAD1 constructs were evaluated to determine whether the constructs are specific. As shown in FIG. 51A and FIG. 51B, 3’ UTR TEAD1-T3, 3’ UTR TEAD1-T4, and 3’ UTR TEAD1-T5 do not impact unrelated oncogenes such as ERBB2.
[0326] It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention.Other aspects of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
Claims
CLAIMSWhat is claimed is:
1. A ribonucleic acid (RNA) molecule comprising a 3 ’-untranslated region (3’ UTR) of an mRNA encoding a TEA domain transcription factor 1 (TEAD1) protein, in which one or more adenylate-uridine rich element (ARE) poly(uridylic acid) (poly(U)) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
2. The RNA molecule of claim 1, wherein the one or more ARE poly(U) stabilizing motifs of the 3’ UTR comprise SEQ ID NO: 4.
3. The RNA molecule of claim 1 or claim 2, wherein the RNA molecule is destabilized in at least two ARE poly(U) stabilizing motifs of the 3’ UTR.
4. The RNA molecule of claim 1 or claim 2, wherein the RNA molecule is destabilized in at least three ARE poly(U) stabilizing motifs of the 3’ UTR.
5. The RNA molecule of claim 1 or claim 2, wherein the RNA molecule is destabilized in at least four ARE poly(U) stabilizing motifs of the 3’ UTR.
6. The RNA molecule of claim 5, wherein the 3’ UTR of the mRNA encoding a TEAD1 protein is SEQ ID NO: 5.
7. The RNA molecule of claim 1 or claim 2, wherein every ARE poly(U) stabilizing motif of the 3’ UTR is destabilized.
8. The RNA molecule of claim 1, wherein the 3’ UTR of the mRNA encoding a TEAD1 protein is SEQ ID NO: 5.
9. The RNA molecule of claim 8, wherein the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 20% identical to SEQ ID NO: 5.
10. The RNA molecule of claim 8, wherein the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 80% identical to SEQ ID NO: 5.
11. The RNA molecule of claim 8, wherein the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 85% identical to SEQ ID NO: 5.
12. The RNA molecule of claim 8, wherein the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 90% identical to SEQ ID NO: 5.
13. The RNA molecule of claim 8, wherein the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 95% identical to SEQ ID NO: 5.
14. The RNA molecule of claim 8, wherein the 3’ UTR of the mRNA encoding a TEAD1 protein is at least 99% identical to SEQ ID NO: 5.
15. The RNA molecule of claim 1, wherein the RNA molecule is SEQ ID NO: 5.
16. The RNA molecule of claim 15, wherein the RNA molecule is at least 20% identical to SEQ ID NO:
517. The RNA molecule of claim 15, wherein the RNA molecule is at least 80% identical to SEQ ID NO: 5.
18. The RNA molecule of claim 15, wherein the RNA molecule is at least 85% identical to SEQ ID NO: 5.
19. The RNA molecule of claim 15, wherein the RNA molecule is at least 90% identical to SEQ ID NO: 5.
20. The RNA molecule of claim 15, wherein the RNA molecule is at least 95% identical to SEQ ID NO: 5.
21. The RNA molecule of claim 15, wherein the RNA molecule is at least 99% identical to SEQ ID NO: 5.
22. The RNA molecule of claim 1, further comprising a polyadenyl sequence.
23. The RNA molecule of claim 22, wherein the polyadenyl sequence is located at the 3’ end of the RNA molecule.
24. A method of making a complementary deoxyribonucleic acid (cDNA) molecule, the method comprising reverse transcribing the RNA molecule of claim 1 to produce the cDNA molecule.
25. The method of claim 24, wherein reverse transcription is carried out in vitro.
26. A cDNA molecule prepared from the RNA molecule of claim 1.
27. A deoxyribonucleic acid (DNA) molecule comprising in the 5’3’ direction of transcription relative to synthesis of a messenger RNA (mRNA) molecule comprising a 3’ UTR of an mRNA encoding a TEAD1 protein:(a) a promoter, operatively linked to(b) a nucleic acid sequence encoding a 3’ UTR of a TEAD1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
28. The DNA molecule of claim 27, wherein the TEAD1 gene is a TEAD1 oncogene.
29. The DNA molecule of claim 27, wherein the one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA comprises SEQ ID NO: 4.
30. The DNA molecule of claim 27 or claim 29, wherein at least two ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
31. The DNA molecule of claim 27 or claim 29, wherein at least three ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
32. The DNA molecule of claim 27 or claim 29, wherein at least four ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
33. The DNA molecule of claim 32, wherein the 3’ UTR of the mRNA is SEQ ID NO: 5.
34. The DNA molecule of claim 27 or claim 29, wherein every ARE poly(U) stabilizing motif of the 3’ UTR of the mRNA is substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:
335. The DNA molecule of claim 27, wherein the 3’ UTR of the mRNA is SEQ ID NO: 5.
36. The DNA molecule of claim 35, wherein the 3’ UTR of the mRNA is at least 20% identical to SEQ ID NO: 5.
37. The DNA molecule of claim 35, wherein the 3’ UTR of the mRNA is at least 80% identical to SEQ ID NO: 5.
38. The DNA molecule of claim 35, wherein the 3’ UTR of the mRNA is at least 85% identical to SEQ ID NO: 5.
39. The DNA molecule of claim 35, wherein the 3’ UTR of the mRNA is at least 90% identical to SEQ ID NO: 5.
40. The DNA molecule of claim 35, wherein the 3’ UTR of the mRNA is at least 95% identical to SEQ ID NO: 5.
41. The DNA molecule of claim 35, wherein the 3’ UTR of the mRNA is at least 99% identical to SEQ ID NO: 5.
42. The DNA molecule of claim 27, wherein the promoter sequence is selected from a DCP1 A promoter, a DCP2 promoter, and a ZFP36 promoter43. The DNA molecule of claim 27, wherein the promoter sequence is a DCP1A promoter.
44. The DNA molecule of claim 43, wherein the DCP1A promoter is SEQ ID NO: 6.
45. The DNA molecule of claim 27, wherein the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene comprises SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
46. The DNA molecule of claim 27, wherein the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is selected from SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.
47. The DNA molecule of claim 46, wherein the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 20% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
48. The DNA molecule of claim 46, wherein the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 80% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
49. The DNA molecule of claim 46, wherein the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 85% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
50. The DNA molecule of claim 46, wherein the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 90% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
51. The DNA molecule of claim 46, wherein the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 95% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
52. The DNA molecule of claim 46, wherein the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene is at least 99% identical to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
53. The DNA molecule of claim 27, wherein the DNA molecule is selected from SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.
54. The DNA molecule of claim 53, wherein the DNA molecule is at least 20% identical toSEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
55. The DNA molecule of claim 53, wherein the DNA molecule is at least 80% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
56. The DNA molecule of claim 53, wherein the DNA molecule is at least 85% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
57. The DNA molecule of claim 53, wherein the DNA molecule is at least 90% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
58. The DNA molecule of claim 53, wherein the DNA molecule is at least 95% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
59. The DNA molecule of claim 53, wherein the DNA molecule is at least 99% identical to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
60. The DNA molecule of claim 27, wherein the DNA molecule further comprises a first signal sequence encoding a first poly A sequence, wherein the first signal sequence is located at the 5’ end of the DNA molecule.
61. The DNA molecule of claim 60, wherein the first signal sequence is SEQ ID NO: 18.
62. The DNA molecule of claim 60, wherein the first polyA sequence is SEQ ID NO: 19.
63. The DNA molecule of claim 60, wherein the DNA molecule comprises, in the 5’3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, the first signal sequence, the promoter, and the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene.
64. The DNA molecule of claim 63, wherein the first restriction sequence is selected from a BstBl sequence, a PspOMl sequence, and an Apal sequence.
65. The DNA molecule of claim 63, wherein the first restriction sequence is a BstBl sequence.
66. The DNA molecule of claim 63, wherein the first restriction sequence is SEQ ID NO: 20.
67. The DNA molecule of claim 63, wherein the DNA molecule comprises, in the 5’3’ direction of transcription relative to synthesis of the mRNA molecule, the first restriction sequence, the first signal sequence, the promoter, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene, and a second signal sequence encoding a second polyA sequence.
68. The DNA molecule of claim 67, wherein the second signal sequence is SEQ ID NO: 21.
69. The DNA molecule of claim 67, wherein the second polyA sequence is SEQ ID NO: 22.
70. The DNA molecule of claim 67, wherein the DNA molecule comprises, in the 5’3’ direction of transcription relative to synthesis of the mRNA molecule, the first restriction sequence, the first signal sequence, the promoter, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene, the second signal sequence, and a second restriction sequence.
71. The DNA molecule of claim 70, wherein the first restriction sequence and the second restriction sequence are different.
72. The DNA molecule of claim 70, wherein the second restriction sequence is a BamHl sequence.
73. The DNA molecule of claim 70, wherein the second restriction sequence is SEQ ID NO: 23.
74. The DNA molecule of claim 70, wherein the first restriction sequence is a BstBl sequence and the second restriction sequence is a BamHl sequence.
75. The DNA molecule of claim 70, wherein the DNA molecule comprises, in the 5’3’ direction of transcription relative to synthesis of the mRNA molecule, a first digestion enhancing sequence, the first restriction sequence, the first signal sequence, the promoter, the nucleic acid sequence encoding the 3’ UTR of the TEAD1 gene, the second signal sequence, the second restriction sequence, and a second digestion enhancing sequence.
76. The DNA molecule of claim 75, wherein the DNA molecule is SEQ ID NO: 24, SEQ IDNO: 25, SEQ ID NO: 26, or SEQ ID NO: 27.
77. The DNA molecule of claim 70, wherein the DNA molecule consists of, in the 5’3’ direction of transcription relative to synthesis of the mRNA molecule, a first digestion enhancing sequence, the first restriction sequence, the first signal sequence, the promoter, the nucleic acid sequence of encoding the 3’ UTR of the TEAD1 gene (b), the second signal sequence, the second restriction sequence, and a second digestion enhancing sequence.
78. The DNA molecule of claim 60, wherein the DNA molecule comprises, in the 5’3’ direction of transcription relative to synthesis of the mRNA molecule, the first signal sequence, the promoter, the nucleic acid sequence of encoding the 3’ UTR of the TEAD1 gene (b), and a second signal sequence.
79. The DNA molecule of claim 77, wherein the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, the first signal sequence, the promoter, the nucleic acid sequence of encoding the 3’ UTR of the TEAD1 gene (b), the second signal sequence, and a second restriction sequence.
80. The DNA molecule of claim 27, wherein the DNA molecule further comprises a second signal sequence encoding a second poly A sequence, wherein the second signal sequence is located at the 3’ end of the DNA molecule.
81. The DNA molecule of claim 80, wherein the DNA molecule comprises, in the 5’3’ direction of transcription relative to synthesis of the mRNA molecule, the promoter, the nucleic acid sequence of encoding the 3’ UTR of the TEAD1 gene (b), the second signal sequence, and a second restriction sequence.
82. The DNA molecule of claim 81, wherein the second restriction sequence is a BamHl sequence.
83. A plasmid vector comprising the DNA molecule of any one of claims 27 to 82.
84. A method of reducing TEAD1 expression in a cell expressing TEAD1, the method comprising transfecting the cell with an amount of the vector of claim 83 to cause a reduction of TEAD1 expression.
85. The method of claim 84, wherein the cell is mammalian.
86. The method of claim 84, wherein the cell is human.
87. The method of claim 84, wherein the cell has been isolated from a mammal prior to the transfecting step.
88. The method of claim 84, wherein the cell is a cancer cell.
89. The method of claim 88, wherein the cancer cell is a breast cancer cell, an ovarian cancer cell, a pancreatic cancer cell, or a prostate cancer cell.
90. The method of claim 88, wherein the cancer cell is resistant to a chemotherapeutic drug.
91. The method of claim 90, wherein the chemotherapeutic drug is selected from paclitaxel, cisplatin, olaparib, doxorubicin, bevacizumab, trastuzumab, and trastuzumab dexrutecan.
92. The method of claim 88, wherein the cancer cell is resistant to an immunotherapy.
93. The method of claim 92, wherein the immunotherapy is an anti-PD-1 monoclonal antibody, an anti-PD-Ll monoclonal antibody, or a checkpoint inhibitor.
94. The method of claim 84, wherein transfecting is ex vivo.
95. The method of claim 84, wherein transfecting is in vitro.
96. The method of claim 84, wherein transfecting is in vivo.
97. The method of claim 84, wherein transfecting is via administration to a mammal.
98. A method of reducing TEAD1 expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the vector of claim 83.
99. The method of claim 98, wherein the subject is a mammal.
100. The method of claim 98, wherein the subject is a human.
101. The method of claim 98, wherein administering is via oral, intraveneous, intraperitoneal, subcutaneous, or intramuscular administration.
102. The method of claim 98, wherein the subject has been diagnosed with a need for inhibition of TEAD1 expression prior to the administering step.
103. The method of claim 98, further comprising identifying a subject in need of inhibition of TEAD1 expression.
104. A pharmaceutical composition comprising the plasmid vector of claim 83 and a pharmaceutically acceptable carrier.
105. A method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of claim 104, wherein the disease or disorder is selected from cancer, obesity, a liver disease, and a cardiac disease.
106. The method of claim 105, wherein the subject is a mammal.
107. The method of claim 105, wherein the subject is a human.
108. The method of claim 105, wherein the disease or disorder is cancer.
109. The method of claim 108, wherein the cancer is selected from a sarcoma (e.g., a cholangiosarcoma), a carcinoma (e. , a hepatocellular carcinoma), a blastoma (e.g., a hepatoblastoma), a gastric adenoma, a hematological cancer, a solid tumor, breast cancer, cervical cancer, gastrointestinal cancer, colorectal cancer, brain cancer, skin cancer, prostate cancer (e.g., neuroendocrine prostate cancer), ovarian cancer, non-small cell lung carcinoma, thyroid cancer, testicular cancer, pancreatic cancer, liver cancer, endometrial cancer, melanoma, a glioma (e.g., astrocytoma, oligodendroglioma, oligoastrocytoma, glioblastoma), leukemia, lymphoma, chronic myeloproliferative disorder, myelodysplastic syndrome, myeloproliferative neoplasm, and plasma cell neoplasm (myeloma).
110. The method of claim 108, wherein the cancer is selected from breast cancer, prostate cancer, and ovarian cancer.
111. The method of claim 108, wherein the cancer is resistant to at least one chemotherapeutic drug.
112. The method of claim 111, wherein the chemotherapeutic drug is selected from paclitaxel, cisplatin, olaparib, doxorubicin, bevacizumab , trastuzumab, and trastuzumab dexrutecan.
113. The method of claim 105, wherein the disease or disorder is obesity.
114. The method of claim 105, wherein the disease or disorder is the liver disease.
115. The method of claim 114, wherein the liver disease is selected from fatty liver disease, steatosis, non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, non-alcoholic steatohepatitis (NASH), and alcohol steatohepatitis.
116. The method of claim 105, wherein the disease or disorder is the cardiac disease.
117. The method of claim 116, wherein the cardiac disease is cardiomegaly.
118. A ribonucleic acid (RNA) molecule comprising a 3 ’-untranslated region (3’ UTR) of an mRNA encoding a yes-associated protein 1 (YAP1) protein, in which one or more adenylateuridine rich element (ARE) poly(uridylic acid) (poly(U)) stabilizing motifs of the 3’ UTR are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
119. The RNA molecule of claim 118, wherein the one or more ARE poly(U) stabilizing motifs of the 3’ UTR comprise SEQ ID NO: 4.
120. The RNA molecule of claim 118 or claim 119, wherein the RNA molecule is destabilized in at least two ARE poly(U) stabilizing motifs of the 3’ UTR.
121. The RNA molecule of claim 118 or claim 119, wherein the RNA molecule is destabilized in at least three ARE poly(U) stabilizing motifs of the 3’ UTR.
122. The RNA molecule of claim 118 or claim 119, wherein the RNA molecule is destabilized in at least four ARE poly(U) stabilizing motifs of the 3’ UTR.
123. The RNA molecule of claim 122, wherein the 3’ UTR is SEQ ID NO: 28.
124. The RNA molecule of claim 118 or claim 119, wherein every ARE stabilizing motif of the 3’ UTR is destabilized.
125. The RNA molecule of claim 118, wherein the 3’ UTR of the mRNA is SEQ ID NO: 28.
126. The RNA molecule of claim 125, wherein the 3’ UTR of the mRNA is at least 20% identical to SEQ ID NO: 28.
127. The RNA molecule of claim 125, wherein the 3’ UTR of the mRNA is at least 80% identical to SEQ ID NO: 28.
128. The RNA molecule of claim 125, wherein the 3’ UTR of the mRNA is at least 85% identical to SEQ ID NO: 28.
129. The RNA molecule of claim 125, wherein the 3’ UTR of the mRNA is at least 90% identical to SEQ ID NO: 28.
130. The RNA molecule of claim 125, wherein the 3’ UTR of the mRNA is at least 95% identical to SEQ ID NO: 28.
131. The RNA molecule of claim 125, wherein the 3’ UTR i of the mRNA s at least 99% identical to SEQ ID NO: 28.
132. The RNA molecule of claim 118, wherein the RNA molecule is SEQ ID NO: SEQ ID NO: 28.
133. The RNA molecule of claim 133, wherein the RNA molecule is at least 20% identical to SEQ ID NO: 28.
134. The RNA molecule of claim 133, wherein the RNA molecule is at least 80% identical to SEQ ID NO: 28.
135. The RNA molecule of claim 133, wherein the RNA molecule is at least 85% identical to SEQ ID NO: 28.
136. The RNA molecule of claim 133, wherein the RNA molecule is at least 90% identical to SEQ ID NO: 28.
137. The RNA molecule of claim 133, wherein the RNA molecule is at least 95% identical to SEQ ID NO: 28.
138. The RNA molecule of claim 133, wherein the RNA molecule is at least 99% identical to SEQ ID NO: 28.
139. The RNA molecule of claim 118, further comprising a polyadenyl sequence.
140. The RNA molecule of claim 139, wherein the polyadenyl sequence is located at the 3’ end of the RNA molecule.
141. A method of making a complementary deoxyribonucleic acid (cDNA) molecule, the method comprising reverse transcribing the RNA molecule of claim 118 to produce the cDNA molecule.
142. The method of claim 141, wherein reverse transcription is carried out in vitro.
143. A cDNA molecule prepared from the RNA molecule of claim 118.
144. A deoxyribonucleic acid (DNA) molecule comprising in the 5’3’ direction of transcription relative to synthesis of a messenger RNA (mRNA) molecule comprising a 3’ UTR of an mRNA encoding a YAP1 protein:(a) a promoter, operatively linked to(b) a nucleic acid sequence encoding a 3’ UTR of a YAP1 gene in the mRNA molecule in which one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
145. The DNA molecule of claim 144, wherein the YAP1 gene is a YAP1 oncogene.
146. The DNA molecule of claim 144, wherein the one or more ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA comprises SEQ ID NO: 4.
147. The DNA molecule of claim 144 or claim 146, wherein at least two ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
148. The DNA molecule of claim 144 or claim 146, wherein at least three ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
149. The DNA molecule of claim 144 or claim 146, wherein at least four ARE poly(U) stabilizing motifs of the 3’ UTR of the mRNA are substituted with a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
150. The DNA molecule of claim 149, wherein the 3’ UTR of the mRNA is SEQ ID NO: 28.
151. The DNA molecule of claim 144 or claim 146, wherein every ARE poly(U) stabilizing motif of the 3’ UTR of the mRNA is substituted with a nucleic acid sequence selected from SEQ ID NO: 1 , SEQ ID NO: 2, and SEQ ID NO: 3.
152. The DNA molecule of claim 144, wherein the 3’ UTR of the mRNA of of (b) is SEQ ID NO: 28.
153. The DNA molecule of claim 152, wherein the 3’ UTR of the mRNA of of (b) is at least 20% identical to SEQ ID NO: 28.
154. The DNA molecule of claim 152, wherein the 3’ UTR of the mRNA of of (b) is at least 80% identical to SEQ ID NO: 28.
155. The DNA molecule of claim 152, wherein the 3’ UTR of the mRNA of of (b) is at least 85% identical to SEQ ID NO: 28.
156. The DNA molecule of claim 152, wherein the 3’ UTR of the mRNA of of (b) is at least 90% identical to SEQ ID NO: 28.
157. The DNA molecule of claim 152, wherein the 3’ UTR of the mRNA of of (b) is at least 95% identical to SEQ ID NO: 28.
158. The DNA molecule of claim 152, wherein the 3’ UTR of the mRNA is at least 99% identical to SEQ ID NO: 28.
159. The DNA molecule of claim 144, wherein the promoter sequence is selected from a DCP1A promoter, a DCP2 promoter, and a ZFP36 promoter.
160. The DNA molecule of claim 144, wherein the promoter sequence is a DCP1A promoter.
161. The DNA molecule of claim 160, wherein the DCP1 A promoter comprises a nucleic acid sequence selected from SEQ ID NO: 6.
162. The DNA molecule of claim 144, wherein the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene comprises one or more selected from SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.
163. The DNA molecule of claim 144, wherein the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is selected from SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ, and ID NO: 34.
164. The DNA molecule of claim 163, wherein the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 20% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 34.
165. The DNA molecule of claim 163, wherein the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 80% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 34.
166. The DNA molecule of claim 163, wherein the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 85% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 34.
167. The DNA molecule of claim 163, wherein the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 90% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 34.
168. The DNA molecule of claim 163, wherein the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 95% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 34.
169. The DNA molecule of claim 163, wherein the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene is at least 99% identical to SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 34.
170. The DNA molecule of claim 144, wherein the DNA molecule is selected from SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, and SEQ ID NO: 40.
171. The DNA molecule of claim 170, wherein the DNA molecule is at least 20% identical to SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40.
172. The DNA molecule of claim 170, wherein the DNA molecule is at least 80% identical to SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40.
173. The DNA molecule of claim 170, wherein the DNA molecule is at least 85% identical to SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40.
174. The DNA molecule of claim 170, wherein the DNA molecule is at least 90% identical to SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40.
175. The DNA molecule of claim 170, wherein the DNA molecule is at least 95% identical to SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40.
176. The DNA molecule of claim 170, wherein the DNA molecule is at least 99% identical to SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40177. The DNA molecule of claim 144, wherein the DNA molecule is selected from SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, and SEQ ID NO: 46.
178. The DNA molecule of claim 144, wherein the DNA molecule further comprises a first signal sequence encoding a first polyA sequence, wherein the first signal sequence is located at the 5’ end of the DNA molecule.
179. The DNA molecule of claim 178, wherein the first signal sequence is SEQ ID NO: 18.
180. The DNA molecule of claim 178, wherein the first polyA sequence is SEQ ID NO: 19.
181. The DNA molecule of claim 178, wherein the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first restriction sequence, the first signal sequence, the promoter, and the nucleic acid sequence encoding the 3’ UTR of the YAP 1 gene.
182. The DNA molecule of claim 181, wherein the first restriction sequence is selected from a BstBl sequence, a PspOMl sequence, an Apal sequence.
183. The DNA molecule of claim 181, wherein the first restriction sequence is BstB 1 sequence.
184. The DNA molecule of claim 181, wherein the first restriction sequence is SEQ ID NO: 20.
185. The DNA molecule of claim 181, wherein the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, the first restriction sequence, the first signal sequence, the promoter, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene, and a second signal sequence encoding a second polyA sequence.
186. The DNA molecule of claim 185, wherein the second signal sequence is SEQ ID NO: 21.
187. The DNA molecule of claim 185, wherein the second polyA sequence is SEQ ID NO: 22.
188. The DNA molecule of claim 185, wherein the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, the first restriction sequence, the first signal sequence, the promoter, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene, the second signal sequence, and a second restriction sequence.
189. The DNA molecule of claim 188, wherein the first restriction sequence and the second restriction sequence are different.
190. The DNA molecule of claim 188, wherein the second restriction sequence is a BamHl sequence.
191. The DNA molecule of claim 188, wherein the second restriction sequence is SEQ ID NO: 23.
192. The DNA molecule of claim 188, wherein the first restriction sequence is a BstBl sequence and the second restriction sequence is a BamHl sequence.
193. The DNA molecule of claim 188, wherein the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, a first digestion enhancing sequence, the first restriction sequence, the first signal sequence, the promoter, the nucleic acid sequence encoding the 3’ UTR of the YAP 1 gene, the second signal sequence, the second restriction sequence, and a second digestion enhancing sequence.
194. The DNA molecule of claim 193, wherein the DNA molecule is selected from SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, and SEQ ID NO: 46.
195. The DNA molecule of claim 188, wherein the DNA molecule consists of, in the 5’3’ direction of transcription relative to synthesis of the mRNA molecule, a first digestion enhancing sequence, the first restriction sequence, the first signal sequence, the promoter, the nucleic acidsequence encoding the 3’ UTR of the YAP1 gene, the second signal sequence, the second restriction sequence, and a second digestion enhancing sequence.
196. The DNA molecule of claim 178, wherein the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, the first signal sequence, the promoter, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene, and a second signal sequence.
197. The DNA molecule of claim 196, wherein the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, the first signal sequence, the promoter, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene, the second signal sequence, and a second restriction sequence.
198. The DNA molecule of claim 144, wherein the DNA molecule further comprises a second signal sequence encoding a second poly A sequence, wherein the second signal sequence is located at the 3’ end of the DNA molecule.
199. The DNA molecule of claim 198, wherein the DNA molecule comprises, in the 5’ -> 3’ direction of transcription relative to synthesis of the mRNA molecule, the promoter, the nucleic acid sequence encoding the 3’ UTR of the YAP1 gene, the second signal sequence, and a second restriction sequence.
200. The DNA molecule of claim 199, wherein the second restriction sequence is a BamHl sequence.
201. A plasmid vector comprising the DNA molecule of any one of claim 144 to 193.
202. A method of reducing YAP1 expression in a cell expressing YAP1, the method comprising transfecting the cell with an amount of the vector of claim 201 to cause a reduction of YAP 1 expression.
203. The method of claim 202, wherein the cell is mammalian.
204. The method of claim 202, wherein the cell is human.
205. The method of claim 202, wherein the cell has been isolated from a mammal prior to the transfecting step.
206. The method of claim 202, wherein the cell is a cancer cell.
207. The method of claim 206, wherein the cancer cell is a breast cancer cell, an ovarian cancer cell, a pancreatic cancer cell, or a prostate cancer cell.
208. The method of claim 206, wherein the cancer cell is resistant to a chemotherapeutic drug.
209. The method of claim 208, wherein the chemotherapeutic drug is paclitaxel, cisplatin, olaparib, doxorubicin, bevacizumab, trastuzumab, and trastuzumab dexrutecan.
210. The method of claim 206, wherein the cancer cell is resistant to an immunotherapy.
211. The method of claim 210, wherein the immunotherapy is an anti-PD-1 monoclonal antibody, an anti-PD-Ll monoclonal antibody, or a checkpoint inhibitor.
212. The method of claim 202, wherein transfecting is ex vivo.
213. The method of claim 202, wherein transfecting is in vitro.
214. The method of claim 202, wherein transfecting is in vivo.
215. The method of claim 202, wherein transfecting is via administration to a mammal.
216. A method of reducing YAP1 expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the vector of claim 201.
217. The method of claim 216, wherein the subject is a mammal.
218. The method of claim 216, wherein the subject is a human.
219. The method of claim 216, wherein administering is via oral, intraveneous, intraperitoneal, subcutaneous, or intramuscular administration.
220. The method of claim 216, wherein the subject has been diagnosed with a need for inhibition of YAP 1 expression prior to the administering step.
221. The method of claim 216, further comprising identifying a subject in need of inhibition of YAP1 expression.
222. A pharmaceutical composition comprising the vector of claim 201 and a pharmaceutically acceptable carrier.
223. A method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of claim 222, wherein the disease or disorder is selected from cancer, obesity, a liver disease, and a cardiac disease.
224. The method of claim 223, wherein the subject is a mammal.
225. The method of claim 223, wherein the subject is a human.
226. The method of claim 223, wherein the disease or disorder is cancer.
227. The method of claim 226, wherein the cancer is selected from a sarcoma (e.g., a cholangiosarcoma), a carcinoma (e. , a hepatocellular carcinoma), a blastoma (e.g., a hepatoblastoma), a gastric adenoma, a hematological cancer, a solid tumor, breast cancer, cervical cancer, gastrointestinal cancer, colorectal cancer, brain cancer, skin cancer, prostate cancer (e.g., neuroendocrine prostate cancer), ovarian cancer, non-small cell lung carcinoma, thyroid cancer, testicular cancer, pancreatic cancer, liver cancer, endometrial cancer, melanoma, a glioma (e.g., astrocytoma, oligodendroglioma, oligoastrocytoma, glioblastoma), leukemia, lymphoma, chronic myeloproliferative disorder, myelodysplastic syndrome, myeloproliferative neoplasm, and plasma cell neoplasm (myeloma).
228. The method of claim 226, wherein the cancer is selected from breast cancer, prostate cancer, and ovarian cancer.
229. The method of claim 226, wherein the cancer is resistant to at least one chemotherapeutic drug.
230. The method of claim 229, wherein the chemotherapeutic drug is selected from paclitaxel, cisplatin, olaparib, doxorubicin, bevacizumab , trastuzumab, and trastuzumab dexrutecan.
231. The method of claim 223, wherein the disease or disorder is obesity.
232. The method of claim 223, wherein the disease or disorder is the liver disease.
233. The method of claim 232, wherein the liver disease is selected from fatty liver disease, steatosis, non-alcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, non-alcoholic steatohepatitis (NASH), and alcohol steatohepatitis.
234. The method of claim 223, wherein the disease or disorder is the cardiac disease.
235. The method of claim 234, wherein the cardiac disease is cardiomegaly.