Compound capable of inhibiting binding between cug repeat RNA and mbnl protein, and medicine

ZA202609209APending Publication Date: 2026-09-30NIPPON SHINYAKU CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
ZA202609209
Authority / Receiving Office
ZA · ZA
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-05
Filing Date
2026-09-18
Publication Date
2026-09-30

AI Technical Summary

Technical Problem

Current treatments for myotonic dystrophy type 1 (DM1) are limited to symptomatic relief, and no drug has demonstrated sufficient efficacy in clinical trials to address the underlying splicing abnormalities caused by the binding of CUG repeat RNA and MBNL protein.

Method used

Development of compounds that inhibit the binding between CUG repeat RNA and MBNL protein, represented by specific chemical structures or their pharmaceutically acceptable salts and solvates, which can potentially improve splicing abnormalities and treat DM1 symptoms.

Benefits of technology

These compounds offer a new therapeutic approach by inhibiting the binding of CUG repeat RNA and MBNL protein, potentially leading to improvements in splicing and myotonic symptoms, addressing the limitations of existing treatments.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

NOT VISIBLE DUE TO STATUS OF PATENT
Need to check novelty before this filing date? Find Prior Art

Description

Compounds and drugs that inhibit the binding of CUG repeat RNA to MBNL protein

[0001] The present invention relates to compounds and pharmaceuticals that have inhibitory activity against the binding between CUG repeat RNA and MBNL protein.

[0002] Myotonic dystrophy type 1 (hereinafter sometimes abbreviated as "DM1") is the muscular dystrophy most frequently occurring in adults. DM1 is an autosomal dominant disease that affects skeletal muscle, smooth muscle, eyes, heart, endocrine system, central nervous system, etc., and its main symptoms include muscle atrophy, muscle weakness, muscle rigidity (myotonia), cataracts, insulin resistance, cardiac conduction disorders, intellectual disability, etc. (Non-Patent Document 1). DM1 is caused by abnormal expansion of the CTG repeat sequence in the 3' untranslated region of the myotonin protein kinase (DMPK) gene. The abnormal DMPK mRNA contains a CUG repeat sequence, and the splicing regulator MBNL (Musclebind-like) protein binds to this CUG repeat sequence. As a result, there is a shortage of splicing regulators necessary for normal splicing, which causes abnormal splicing and leads to symptoms.

[0003] The CUG repeat RNA and MBNL protein contained in abnormal DMPK are said to be expressed in a wide range of tissues throughout the body, including skeletal muscle, smooth muscle, eyes, heart, endocrine system, and central nervous system, and abnormal gene splicing that occurs in each tissue is associated with symptoms. It has been reported that the chloride ion channel CLCN1 (chloride channel protein, skeletal muscle) is involved in myotonia, the calcium channels CACNA1S (voltage-gated calcium channel subunit alpha 1S) and DMD (dystrophin) are involved in muscle weakness, INSR (insulin-like growth factor receptor) is involved in insulin resistance, and NMDA (N-methyl-D-aspartate) and MAPT (microtubule-associated protein tau) are involved in cognitive function (Non-Patent Documents 2-4). Therefore, it is expected that improving splicing abnormalities will lead to the treatment of DM1.

[0004] Currently, most treatments for DM1 are limited to symptomatic treatment, making treatment extremely difficult. It has been shown that releasing CUG repeat RNA and MBNL protein using compounds that inhibit the binding of these proteins in DM1 pathology can lead to improvements in splicing and myotonic symptoms (Non-Patent Documents 5-6). However, no drug has yet demonstrated sufficient efficacy in clinical trials and been approved. Therefore, it is believed that compounds that inhibit the binding of CUG repeat RNA and MBNL protein could provide a new therapeutic approach.

[0005] Meola G and Cardani R. Biochim Biophys Acta. 2015 Apr; 1852(4):594-606. N Charlet-B et al. , Mol Cell. 2002 Jul;10(1):45-53. Nakamori et al. , Ann Neurol. 2013 Dec; 74(6):862-72. A Lopez-Martinez et al. , Genes (Basel). 2020 Sep 22;11(9):1109. AJ Angelbello et al. , Cell Chem Biol. 2021 Jan 21;28(1):34-45. Nakamori et al. , Ann Clin Transl Neurol. 2015 Dec 10;3(1):42-54. A. Mankodi et al. , Science, 2000, 289 (5485), 1769-73 Jenquin JR et al. , ACS Chem Biol. 2018 Sep 21;13(9):2708-2718.

[0006] An object of the present invention is to provide a compound or a pharmaceutically acceptable salt thereof, or a solvate thereof, which has binding inhibitory activity of inhibiting the binding between CUG repeat RNA and MBNL protein.

[0007] The present invention includes, for example, the following inventions: [1] A compound represented by general formula (1) or a pharmaceutically acceptable salt thereof, or a solvate thereof: [In the formula, X 1 , X 2 and X 3 is (a) X 1 , X 2 and X 3 is -CH=, (b) X 1 -N=, X 2 -CH=, X 3 is -CH=, or (c) X 1 -CH=, X 2 -CH=, X 3 A is any combination of -O-, -S-, -NR- (R is a hydrogen atom or C 1 ~C 3represents an alkyl group or a piperidinediyl group; B represents a single bond, a C optionally substituted with a hydroxyl group; 1 ~C 5 an alkylene group, or -Y 1 -NY 2 -Y 3 -(Y 1 and Y 3 are each independently C 1 ~C 3 represents an alkylene group, and Y 2 is a hydrogen atom or C 1 ~C 3 [2] The compound according to [1], wherein A is -O-, or a pharmaceutically acceptable salt thereof, or a solvate thereof. [3] B is a single bond or C 1 ~C 5

[0022] The compound according to [1] or [2], or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein C is an alkylene group. [4] The compound according to any one of [1] to [3], or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein C is a substituted or unsubstituted nitrogen-containing heterocyclic group. [5] The compound according to any one of [1] to [4], or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein C is a substituted or unsubstituted piperidinyl group, a substituted or unsubstituted piperazinyl group, or a substituted or unsubstituted pyrrolidinyl group. [6] The compound according to any one of [1] to [5], or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein C is a nitrogen-containing heterocyclic group substituted with an alkyl group, a benzyl group, or an acyl group, or an unsubstituted nitrogen-containing heterocyclic group. [7] X 1 , X 2 and X 3 is (a) X 1 , X 2 and X 3 is a combination of -CH=, A represents -O-, B represents a single bond or C 1 ~C 5[8] A compound selected from the group consisting of the following (1) to (104) and (107) to (119), or a pharmaceutically acceptable salt thereof, or a solvate thereof: (1) 3-{5-[(1-ethylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (2) 3-(5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (3) 3-(5-{[(3S)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (4) 3-{5-[(1-benzylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (5) 3-(5-{2-[benzyl(methyl)amino]ethoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (6) 3-{5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (7) 3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (8) 3-{5-[3-(pyrrolidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (9) 3-{5-[2-(pyrrolidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (10) 3-{5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (11) phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (12) 3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-Oxadiazol-5-one (13) 3-{5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (14) 3-{5-[(1-cyclopropanecarbonylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (15) 3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (16) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (17) 3-{5-[(1-propylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (18) 3-{5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (19) 3-{5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (20) Ethyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate (21) 3-(5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (22) 3-{5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (23) 3-{5-[3-(piperidin-1-yl)propoxy]pyrimidin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (24) 3-{6-[3-(piperidin-1-yl)propoxy]pyridazin-3-yl}-4,5-dihydro-1,2,4-Oxadiazol-5-one (25) 3-(5-{[3-(piperidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (26) 3-(5-{[3-(pyrrolidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (27) 3-(5-{[3-(azepan-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (28) phenyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate (29) ethyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate (30) 3-{5-[(1-ethylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (31) 3-{5-[(1-butylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (32) 3-{5-[(1-pentylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (33) 3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (34) 3-(5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (35) 3-{5-[(1-butylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (36) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (37) 3-{5-[(1-benzylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-Oxadiazol-5-one (38) 3-[5-({1-[(2-ethylphenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (39) 3-{5-[(1-{[2-(trifluoromethyl)phenyl]methyl}piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (40) 3-[5-({1-[(3-fluorophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (41) 3-[5-({1-[(3-bromophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (42) 3-{5-[(1-acetylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (43) 3-{5-[(1-propanoylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (44) Methyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate (45) Propan-2-yl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate (46) Methyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (47) Ethyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (48) Propyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (49) propan-2-yl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (50) benzyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (51) 3-{5-[3-(azepan-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (52) 3-{5-[2-(azepan-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (53) 3-{5-[2-(4-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (54) 3-{5-[2-(3-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (55) 3-[5-(2-{7-azaspiro[4.5]decan-7-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (56) 3-[5-(2-{9-oxa-2-azaspiro[5.5]undecan-2-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (57) tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (58) 3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (59) 3-{5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (60) 3-{5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (61) 3-{5-[3-(3-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-Oxadiazol-5-one (62) 3-{5-[3-(morpholin-4-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (63) 3-{5-[3-(1,2,3,6-tetrahydropyridin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (64) 3-[5-(3-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (65) 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperidin-4-one (66) 3-{5-[3-(3-fluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (67) 3-{5-[3-(4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (68) 3-{5-[3-(4-methoxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (69) 3-(5-{3-[(trans)3,4-dihydroxypiperidin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (70) 3-{5-[3-(4,4-difluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (71) 3-{5-[3-(4-fluoro-4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (72) 3-{5-[3-(4-acetylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (73) Methyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,(74) 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (75) 3-{5-[3-(4-benzylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (76) 3-[5-(3-{3-azabicyclo[3.1.0]hexan-3-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (77) 3-[5-(3-{octahydrocyclopenta[c]pyrrol-2-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (78) 3-[5-(3-{7-azaspiro[4.5]decan-7-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (79) 3-[5-(3-{2-oxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (80) 3-[5-(3-{9-oxa-2-azaspiro[5.5]undecan-2-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (81) 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)pyridin-1-ium 4-methylbenzene-1-sulfonate (82) 3-{5-[(5-methyl-1,3-oxazol-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (83) 3-{5-[(1,3-thiazol-2-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (84) 3-{5-[3-(pyridin-3-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (85) 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,(86) 3-{5-[2-methyl-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (87) 3-{5-[2-(dimethylamino)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (88) 3-{5-[3-(dimethylamino)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (89) 3-{5-[4-(dimethylamino)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (90) 3-{5-[4-(piperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (91) 3-{5-[4-(azepan-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (92) 3-{5-[4-(pyrrolidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (93) 3-{5-[4-(3-hydroxypiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (94) 3-{5-[4-(morpholin-4-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (95) 3-{5-[4-(4-fluoropiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (96) 3-{5-[4-(4,4-dimethylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (97) 3-{5-[4-(3-hydroxy-3-methylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (98) 3-[5-(4-{7-azaspiro[4.5]decan-7-yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-Oxadiazol-5-one (99) 3-[5-(4-{9-oxa-2-azaspiro[5.5]undecan-2-yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (100) Methyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate (101) 3-{5-[4-(4-acetylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (102) 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (103) 3-{5-[4-(4-benzylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (104) 3-(5-{[5-(piperidin-1-yl)pentyl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (107) 3-(5-{[2-(pyridin-4-yl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (108) 3-(5-{[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (109) 3-(5-{[(1-ethylpiperidin-4-yl)methyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (110) 3-(5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (111) 3-(5-{[2-(dimethylamino)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (112) 3-(5-{[3-(dimethylamino)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (113) 3-(5-{[4-(dimethylamino)butyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-Oxadiazol-5-one (114) 3-{5-[(1-ethylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (115) 3-{5-[(1-benzylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (116) 3-{5-[(1-ethylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (117) 3-{5-[(1-benzylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (118) 3-(5-{4-[2-(pyrrolidin-1-yl)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (119) 3-(5-{4-[2-(dimethylamino)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one [9] A compound selected from the group consisting of the following compounds (7), (11), (12), (15) and (16), or a pharmaceutically acceptable salt thereof, or a solvate thereof. (7) 3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (11) phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (12) 3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (15) 3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (16) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-Oxadiazol-5-one

[10] A pharmaceutical composition comprising the compound according to any one of [1] to [9] or a pharmaceutically acceptable salt thereof, or a solvate thereof as an active ingredient.

[11] A therapeutic agent for myotonic dystrophy type 1, comprising the compound according to any one of [1] to [9] or a pharmaceutically acceptable salt thereof, or a solvate thereof as an active ingredient.

[12] Use of the compound according to any one of [1] to [9] or a pharmaceutically acceptable salt thereof, or a solvate thereof for the manufacture of a therapeutic agent for myotonic dystrophy type 1.

[13] A binding inhibitor that inhibits the binding of CUG repeat RNA and MBNL protein, comprising the compound according to any one of [1] to [9] or a pharmaceutically acceptable salt thereof, or a solvate thereof as an active ingredient.

[0008] According to the present invention, it is possible to provide a compound having binding inhibitory activity of inhibiting the binding between CUG repeat RNA and MBNL protein, or a pharmaceutically acceptable salt or solvate thereof.

[0009] Hereinafter, embodiments of the present invention will be described in detail, but the present invention is not limited to the following embodiments.

[0010] In this specification, the term "alkyl group" refers to a monovalent group obtained by removing one hydrogen atom from a saturated hydrocarbon. The alkyl group may be linear or branched. The alkyl group may be any of C 1 ~C 6 may be an alkyl group, 1 ~C 4 may be an alkyl group, 1 ~C 3 In the present specification, the term "C a ~C b" means that the number of carbon atoms is a to b. Specific examples of the alkyl group include linear alkyl groups such as a methyl group, ethyl group, n-propyl group, n-butyl group, n-pentyl group, and n-hexyl group; and branched alkyl groups such as an isopropyl group (1-methylethyl group), a sec-butyl group, an isobutyl group (2-methylpropyl group), a tert-butyl group, a neopentyl group, an isopentyl group, a sec-pentyl group, a 3-pentyl group, a tert-pentyl group, a 1,1,2-trimethylpropyl group, a 1,2,2-trimethylpropyl group, a 1,1,2,2-tetramethylpropyl group, a 1,1-dimethylbutyl group, a 1,2-dimethylbutyl group, a 1,3-dimethylbutyl group, a 2,2-dimethylbutyl group, a 2,3-dimethylbutyl group, a 3,3-dimethylbutyl group, a 1-ethylbutyl group, and a 2-ethylbutyl group.

[0011] As used herein, the term "substituted alkyl group" refers to an alkyl group in which one or more hydrogen atoms have been substituted with a substituent. Examples of the substituent in the substituted alkyl group include a hydroxy group, a cyano group, a halogen atom, an amino group, a mono-substituted amino group, a di-substituted amino group, a nitro group, an alkyl group, a cycloalkyl group, an alkoxy group, an aryloxy group, a heteroaryloxy group, a heterocyclic group, an aryl group, an acyl group, and an oxo group. These substituents may be further substituted with other substituents, or may be bonded to each other to form a ring.

[0012] In this specification, the term "dialkylamino group" refers to a primary amino group (-NH 2 ) in which two hydrogen atoms are each independently substituted with an alkyl group. 2 ~C 12 may be a dialkylamino group, C 2 ~C 8 may be a dialkylamino group, C 2 Specific examples of the dialkylamino group include a dimethylamino group, a methylethylamino group, and a diethylamino group.

[0013] In the present specification, the term "cycloalkyl group" refers to a monovalent group obtained by removing one hydrogen atom from a cyclic saturated hydrocarbon. 3 ~C 8 may be a cycloalkyl group, C 3 ~C 6 may be a cycloalkyl group, C 3 ~C 5 It may be a cycloalkyl group. Specific examples of the cycloalkyl group include a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, and a cyclohexyl group.

[0014] In the present specification, the term "substituted cycloalkyl group" refers to a cycloalkyl group in which one or more hydrogen atoms are substituted with a substituent. Examples of the substituent in the substituted cycloalkyl group include the substituents described above.

[0015] In this specification, the term "alkylene group" refers to a divalent group obtained by removing two hydrogen atoms from a saturated hydrocarbon. The alkylene group may be linear, branched, or cyclic, and may be linear or branched. The alkylene group is a C 1 ~C 6 may be an alkylene group, 1 ~C 5 may be an alkylene group, 1 ~C 3 It may be an alkylene group. Specific examples of the alkylene group include a methylene group, an ethylene group, a propylene group, an isopropylene group, a butylene group, a pentylene group, and a hexylene group.

[0016] In this specification, the term "alkylene group which may be substituted with hydroxyl groups" refers to an alkylene group or an alkylene group in which one or more hydrogen atoms have been substituted with hydroxyl groups.

[0017] In this specification, the term "nitrogen-containing heterocyclic group" refers to a non-aromatic or aromatic cyclic monovalent group containing a nitrogen atom in the ring. The number of nitrogen atoms contained in the ring of the nitrogen-containing heterocyclic group may be, for example, 1 to 5, 1 to 3, or 1 to 2. The nitrogen-containing heterocyclic group may be a monocycle, a fused ring, or a spiro ring. The nitrogen-containing heterocyclic group may have an unsaturated bond in the ring (unsaturated nitrogen-containing heterocyclic group), or may not have an unsaturated bond (saturated nitrogen-containing heterocyclic group). Specific examples of the monocyclic nitrogen-containing heterocyclic group include non-aromatic nitrogen-containing heterocyclic groups such as an azetidinyl group (e.g., a 1-azetidinyl group, a 2-azetidinyl group, or a 3-azetidinyl group), a piperidinyl group (e.g., a 1-piperidinyl group, a 2-piperidinyl group, a 3-piperidinyl group, or a 4-piperidinyl group), a piperazinyl group (e.g., a 1-piperazinyl group, a 2-piperazinyl group, or a 3-piperazinyl group), a pyrrolidinyl group (e.g., a 1-pyrrolidinyl group, a 2-pyrrolidinyl group, or a 3-pyrrolidinyl group), an azepanyl group (e.g., an azepan-1-yl group, an azepan-2-yl group, or an azepan-3-yl group); a pyridyl group (e.g., a 2-pyridyl group, a 3-pyridyl group, or a 4-pyridyl group), a 1-pyridinium group, a pyrazyl group (e.g., a 2-pyridyl group), a pyrimidine ... Examples of the aromatic nitrogen-containing heterocyclic group include an aromatic nitrogen-containing heterocyclic group, such as a pyridyl group (e.g., a 2-pyrimidinyl group, a 4-pyrimidinyl group, a 5-pyrimidinyl group), a pyridazyl group (e.g., a 3-pyridazinyl group, a 4-pyridazinyl group), a triazinyl group (e.g., a 1,3,5-triazinyl group, a 1,2,4-triazinyl group, a 1,2,3-triazinyl group), a pyrrolyl group (e.g., a 1-pyrrolyl group, a 2-pyrrolyl group, a 3-pyrrolyl group), a triazolyl group (e.g., a 1,2,4-triazol-1-yl group, a 1,2,4-triazol-3-yl group, a 1,2,4-triazol-4-yl group), a pyrazolyl group (e.g., a 1-pyrazolyl group, a 3-pyrazolyl group, a 4-pyrazolyl group), and an imidazolyl group (e.g., a 1-imidazolyl group, a 2-imidazolyl group, a 4-imidazolyl group). The nitrogen-containing heterocyclic group may be a heterocyclic group containing other heteroatoms in addition to the nitrogen atom.Specific examples thereof include heterocyclic groups containing an oxygen atom, such as oxazolyl groups (e.g., 2-oxazolyl, 4-oxazolyl, and 5-oxazolyl groups), isoxazolyl groups (e.g., 3-isoxazolyl, 4-isoxazolyl, and 5-isoxazolyl groups), and morpholyl groups (e.g., 2-morpholinyl, 3-morpholinyl, and 4-morpholinyl groups), as well as sulfur-atom-containing thiazolyl groups (e.g., 2-thiazolyl, 4-thiazolyl, and 5-thiazolyl groups) and isothiazolyl groups (e.g., 3-isothiazolyl, 4-isothiazolyl, and 5-isothiazolyl groups). Specific examples of the nitrogen-containing heterocyclic group that is a fused ring include an isoquinolyl group (e.g., 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 6-isoquinolyl, 7-isoquinolyl, and 8-isoquinolyl group), a quinolidinyl group (e.g., 2-quinolidinyl group), a dihydroindolyl group (e.g., 1-dihydroindolyl, 2-dihydroindolyl, 3-dihydroindolyl, 4-dihydroindolyl, 5-dihydroindolyl, 6-dihydroindolyl, and 7-dihydroindolyl group), a dihydroisoindolyl group (e.g., 1-dihydroisoindolyl, 2-dihydroisoindolyl, 3-dihydroisoindolyl, 4-dihydroisoindolyl, 5-dihydroisoindolyl, 6-dihydroisoindolyl, and 7-dihydroindolyl group), and a quinolizinyl group (e.g., 1-dihydroisoindolyl, 2-dihydroisoindolyl, 3-dihydroisoindolyl, 4-dihydroisoindolyl, 5-dihydroisoindolyl, 6-dihydroisoindolyl, and 7-dihydroisoindolyl group). tetrahydroisoindolyl group), tetrahydroquinolyl groups (e.g., 1-tetrahydroquinolyl group, 2-tetrahydroquinolyl group, 3-tetrahydroquinolyl group, 4-tetrahydroquinolyl group, 5-tetrahydroquinolyl group, 6-tetrahydroquinolyl group, 7-tetrahydroquinolyl group, 8-tetrahydroquinolyl group), tetrahydroisoquinolyl groups (e.g., 1-tetrahydroisoquinolyl group, 2-tetrahydroisoquinolyl group, 3-tetrahydroisoquinolyl group, 4-tetrahydroisoquinolyl group, 5-tetrahydroisoquinolyl group, 6-tetrahydroisoquinolyl group, 7-tetrahydroisoquinolyl group, 8-tetrahydroisoquinolyl group), azabicyclo[3.1.0]hexan-3-yl group, octahydrocyclopenta[c]pyrrol-2-yl group, and the like. Specific examples of nitrogen-containing heterocyclic groups that are spiro rings include the groups shown below. [In the formula, * indicates the bonding position.]

[0018] In the present specification, the term "substituted nitrogen-containing heterocycle" refers to a group in which one or more elements (elements not constituting the ring) of a nitrogen-containing heterocycle are substituted with a substituent. The substituent may be bonded to a nitrogen atom or a carbon atom in the ring of the nitrogen-containing heterocycle. Examples of the substituent in the substituted heterocyclic group include the substituents described above.

[0019] In this specification, the term "aryl group" refers to a monovalent cyclic aromatic hydrocarbon group. The aryl group may be a monocyclic ring or a fused ring. Specific examples of the aryl group include a phenyl group and a naphthyl group.

[0020] In this specification, the term "substituted aryl group" refers to an aryl group in which one or more elements (elements not constituting a ring) are substituted with a substituent. Examples of the substituent in the substituted aryl group include the substituents described above.

[0021] In this specification, the term "alkoxy group" refers to an oxy group having an alkyl group bonded thereto. Specific examples of the alkoxy group include a methoxy group, an ethoxy group, a 1-propoxy group, a 2-propoxy group, an n-butoxy group, an i-butoxy group, an s-butoxy group, a t-butoxy group, a pentyloxy group, and a 3-methylbutoxy group.

[0022] In the present specification, the term "substituted alkoxy group" refers to an alkoxy group in which one or more hydrogen atoms have been substituted with a substituent. Examples of the substituent in the substituted alkoxy group include the substituents described above.

[0023] In this specification, the term "aryloxy group" refers to an oxy group to which an aryl group is bonded. Specific examples of the aryloxy group include a phenoxy group and a naphthyloxy group.

[0024] In the present specification, the term "substituted aryloxy group" refers to an aryloxy group in which one or more elements (elements not constituting a ring) are substituted with a substituent. Examples of the substituent in the substituted aryloxy group include the substituents described above.

[0025] In the present specification, the term "heteroaryloxy group" refers to an oxy group having a heteroaryl group bonded thereto. Specific examples of the heteroaryloxy group include a furyloxy group, a thienyloxy group, a pyrrolyloxy group, an imidazolyloxy group, a pyrazolyloxy group, a thiazolyloxy group, and a piperazinyloxy group.

[0026] In the present specification, the term "substituted heteroaryloxy group" refers to a heteroaryloxy group in which one or more elements (elements not constituting the ring) are substituted with a substituent. Examples of the substituent in the substituted heteroaryloxy group include the substituents described above.

[0027] In this specification, the term "halogen" refers to a group consisting of a halogen atom (halogeno group). Examples of halogen include a fluoro group, a chloro group, a bromo group, and an iodo group.

[0028] In this specification, the term "acyl group" refers to a group consisting of an atomic group obtained by removing an OH group from the carboxyl group of a carboxylic acid. 1 ~C 10 may be an acyl group, C 2 ~C 8 may be an acyl group, C 2 ~C 3 It may be an acyl group. Specific examples of the acyl group include a formyl group (methanoyl group), an acetyl group (ethanoyl group), an n-propanoyl group, and a benzoyl group.

[0029] The compound of the present invention is a compound represented by general formula (1) or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0030] In general formula (1), X 1 , X 2 and X 3 is (a) X 1 , X 2 and X 3 is -CH=, (b) X 1 -N=, X 2 -CH=, X 3 is -CH=, or (c) X 1 -CH=, X 2 -CH=, X3 is any combination of -N=, (a) X 1 , X 2 and X 3 It is preferable that X is -CH=. 1 , X 2 and X 3 The ring containing (a) X 1 , X 2 and X 3 is -CH=, it is a pyridine ring, and (b) X 1 -N=, X 2 -CH=, X 3 is -CH=, it is a pyrimidine ring, and (c) X 1 -CH=, X 2 -CH=, X 3 When is -N=, it is a pyridazine ring.

[0031] In the general formula (1), A is —O—, —S—, —NR— or a piperidinediyl group, and is preferably —O—. In —NR—, R is a hydrogen atom or C 1 ~C 3 It is an alkyl group.

[0032] When A is a piperidinediyl group, the nitrogen atom in the piperidine ring is preferably bonded to a carbon atom in the second ring from the top in general formula (1). Specific examples of the piperidinediyl group include a 1,4-piperidinediyl group, a 1,3-piperidinediyl group, and a 1,2-piperidinediyl group.

[0033] In the general formula (1), B is a single bond, C 1 ~C 5 an alkylene group, or -Y 1 -NY 2 -Y 3 - and C 1 ~C 5 It is preferably an alkylene group, and C 1 ~C 3 An alkylene group is more preferred. 1 -NY 2 -Y 3 - In Y 1 and Y 3 are each independently C 1 ~C3 is an alkylene group, and Y 2 is a hydrogen atom or C 1 ~C 3 B is an alkyl group. 1 -NY 2 -Y 3 -, then Y 1 is bonded to A, and Y 3 binds to C.

[0034] In general formula (1), C is a substituted or unsubstituted aryl group or a substituted or unsubstituted nitrogen-containing heterocyclic group, preferably a substituted or unsubstituted nitrogen-containing heterocyclic group, more preferably a substituted or unsubstituted piperidinyl group, a substituted or unsubstituted piperazinyl group, or a substituted or unsubstituted pyrrolidinyl group. When C is a substituted or unsubstituted nitrogen-containing heterocyclic group, B may be bonded to a nitrogen atom in the ring of the nitrogen-containing heterocyclic ring, or may be bonded to a carbon atom.

[0035] Examples of the substituent in the substituted aryl group or substituted nitrogen-containing heterocyclic group of C include the substituents described above, and an alkyl group, a cycloalkyl group, a cycloalkylalkyl group, an aryl group, a substituted aryl group, a benzyl group, a substituted benzyl group, an aryloxy group, an acyl group, an alkyloxycarbonyl group, an aryloxycarbonyl group, a benzyloxycarbonyl group, a cycloalkylcarbonyl group, or a cycloalkyloxycarbonyl group is preferred.

[0036] Specific examples of the alkyl group, cycloalkyl group, aryl group, aryloxy group, and acyl group include the groups described above. Specific examples of the cycloalkylalkyl group include a cyclopropylmethyl group and a cyclobutylmethyl group. Specific examples of the substituted aryl group include a fluorophenyl group. Specific examples of the substituted benzyl group include a fluorobenzyl group, a bromobenzyl group, a trifluoromethylbenzyl group, and an ethylbenzyl group. Specific examples of the alkyloxycarbonyl group include methyloxycarbonyl, ethyloxycarbonyl, n-propyloxycarbonyl, isopropyloxycarbonyl, and isobutyloxycarbonyl. Specific examples of the aryloxycarbonyl group include phenyloxycarbonyl. Specific examples of the cycloalkylcarbonyl group include a cyclopropylcarbonyl group. Specific examples of the cycloalkyloxycarbonyl group include cyclopentyloxycarbonyl.

[0037] The above C is preferably a nitrogen-containing heterocyclic group substituted with an alkyl group, a benzyl group or an acyl group, or an unsubstituted nitrogen-containing heterocyclic group.

[0038] In general formula (1), at least one of B and C contains one or more nitrogen atoms. The total number of nitrogen atoms contained in A, B, and C may be 1 to 5, 1 to 3, or 1 to 2. The total number of nitrogen atoms contained in B and C may be 1 to 5, 1 to 3, or 1 to 2.

[0039] In the general formula (1), when C is a substituted or unsubstituted nitrogen-containing heterocyclic group, B is a single bond or C 1 ~C 5 Preferably, C is an alkylene group, and when C is a substituted or unsubstituted aryl group, B is -Y 1 -NY 2 -Y 3 - is preferable.

[0040] In general formula (1), X 1 , X 2 and X 3 is -CH=, A is -O-, B is a single bond or C1 ~C 5 More preferred is a combination in which C is an alkylene group, and C is a nitrogen-containing heterocyclic group substituted with an alkyl group, a benzyl group, or an acyl group, or an unsubstituted nitrogen-containing heterocyclic group, or a substituted or unsubstituted piperidinyl group, a substituted or unsubstituted piperazinyl group, or a substituted or unsubstituted pyrrolidinyl group.

[0041] Specific examples of the compound represented by general formula (1) include the above compounds (1) to (20) (compounds of Examples 1 to 20), and the above compounds (7), (11), (12), (15) and (16) (compounds of Examples 7, 11, 12, 15 and 16) are preferred.

[0042] The compound of the present invention can be produced using known compounds or intermediates that can be easily synthesized from known compounds, for example, according to the examples described below or known methods. In producing the compound of the present invention, if the raw material has a substituent that affects the reaction, the raw material is generally protected with an appropriate protecting group by a known method beforehand, and then the reaction is carried out. The protecting group can be deprotected by a known method after the reaction.

[0043] The meaning of each term used in this specification is explained below. Unless otherwise specified, each term has the same meaning whether used alone or in combination with other terms.

[0044] The abbreviations used in this specification have the following meanings: BSA: bovine albumin DBU: 1,8-diazabicyclo[5.4.0]-7-undecene DMSO: dimethyl sulfoxide CDI: 1,1'-carbonyldiimidazole KO t Bu: potassium tert-butoxide HATU: O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate HEPES: N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid MeOH: methanol MS: mass spectrometry LCMS: high-performance liquid chromatography mass spectrometry ESI: electrospray ionization M: molar concentration (mol / L)

[0045] The compound of the present invention can be used as a pharmaceutical directly, or can be used in the form of a pharmaceutically acceptable salt, solvate, or solvate of a salt by known methods. Examples of pharmaceutically acceptable salts include salts of mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid; salts of organic acids such as acetic acid, malic acid, lactic acid, citric acid, tartaric acid, maleic acid, succinic acid, fumaric acid, p-toluenesulfonic acid, benzenesulfonic acid, and methanesulfonic acid; salts of alkali metals such as lithium, potassium, and sodium; salts of alkaline earth metals such as magnesium and calcium; and salts of organic bases such as ammonium salts. These salts can be formed by commonly used methods.

[0046] For example, when the compound of the present invention is a hydrochloride, the free base of the compound of the present invention can be obtained by dissolving it in an alcohol solution of hydrogen chloride, an ethyl acetate solution of hydrogen chloride, a 1,4-dioxane solution of hydrogen chloride, a cyclopentyl methyl ether solution of hydrogen chloride, hydrochloric acid, or a diethyl ether solution of hydrogen chloride.

[0047] The compound of the present invention may take in solvent molecules to become a solvate when left in the air or when recrystallized, and such solvates are also included in the compound of the present invention. Examples of such solvates include solvates with solvent molecules such as methanol solvate, ethanol solvate, isopropyl alcohol solvate, butanol solvate, dimethyl sulfoxide solvate, and acetonitrile solvate, as well as monohydrates and dihydrates.

[0048] Some of the compounds of the present invention have asymmetric carbon atoms, and both optical isomers and mixtures thereof are included in the present invention. Stereoisomers can be produced, for example, by optical resolution of a racemate using an optically active acid (tartaric acid, dibenzoyltartaric acid, mandelic acid, 10-camphorsulfonic acid, etc.) by known methods, taking advantage of its basicity, or by using a pre-prepared optically active compound as a starting material. Alternatively, stereoisomers can also be produced by optical resolution using a chiral column or asymmetric synthesis.

[0049] The general formula (1) in the present invention is not limited to a specific isomer, but includes all possible isomers and racemates. For example, the compounds of the present invention also include the tautomers and stereoisomers shown below.

[0050] As shown in the test examples below, the compounds of the present invention have binding inhibitory activity that inhibits the binding between CUG repeat RNA and MBNL protein.

[0051] Therefore, one embodiment of the present invention provides a binding inhibitor that inhibits the binding between CUG repeat RNA and MBNL protein, which contains the compound of the present invention.

[0052] Furthermore, one embodiment of the present invention provides a method for inhibiting the binding between CUG repeat RNA and MBNL protein, which comprises administering the compound of the present invention to a subject in need thereof.

[0053] Furthermore, one embodiment of the present invention provides a compound of the present invention for use in inhibiting the binding between CUG repeat RNA and MBNL protein.

[0054] Furthermore, one embodiment of the present invention provides use of the compound of the present invention in the manufacture of a binding inhibitor that inhibits the binding between CUG repeat RNA and MBNL protein.

[0055] One embodiment of the present invention provides a therapeutic agent for myotonic dystrophy type 1, which comprises the compound of the present invention.

[0056] Furthermore, in one embodiment of the present invention, there is provided a method for treating myotonic dystrophy type 1, comprising administering a compound of the present invention to a subject in need thereof.

[0057] Furthermore, in one embodiment of the present invention there is provided a compound of the present invention for use in the treatment of myotonic dystrophy type 1.

[0058] Furthermore, one embodiment of the present invention provides use of a compound of the present invention in the manufacture of a medicament for treating myotonic dystrophy type 1.

[0059] Examples of diseases to which the compound of the present invention can be applied include myotonic dystrophy type 1, spinocerebellar ataxia type 8, and the like.

[0060] "Subject" refers to a human or non-human animal suffering from or suspected of suffering from a disease involving binding of CUG repeat RNA to MBNL protein or myotonic dystrophy type 1. In one embodiment of the invention, the subject is a mammal. In one embodiment of the invention, the subject is a human.

[0061] The compound of the present invention can be used as a therapeutic agent for the above-mentioned various diseases in mammals such as humans, mice, rats, rabbits, dogs, cats, cows, horses, pigs, and monkeys, either as such or in the form of a pharmaceutical composition containing, for example, 0.001% to 99.5%, preferably 0.1% to 90%, either as such or mixed with a pharmacologically acceptable carrier or the like.

[0062] The carrier may be one or more conventional pharmaceutically acceptable solid, semi-solid, or liquid diluents, fillers, and other formulation auxiliaries. The pharmaceutical composition of the present invention is preferably administered in a dosage unit form. The pharmaceutical composition may be administered intramuscularly, orally, intravenously, topically (transdermally, by eye drop, intraperitoneally, intrapleurally, etc.), or rectally. The pharmaceutical composition of the present invention is administered in a dosage form suitable for these administration methods.

[0063] The pharmaceutical dose is desirably adjusted taking into consideration the patient's condition, such as age, body weight, type and severity of disease, the route of administration, the type of compound of the present invention, whether or not it is a salt, and the type of salt, but typically, in the case of oral administration to an adult, the amount of the active ingredient of the compound of the present invention or a pharmaceutically acceptable salt thereof is within the range of 0.01 mg to 5 g per adult, preferably 1 mg to 2000 mg per adult, per day. In some cases, a lower dose may be sufficient, or conversely, a higher dose may be required. Typically, the compound is administered once a day or in divided doses, or in the case of intravenous administration, it can be administered as a bolus or continuously for up to 24 hours.

[0064] One or more hydrogen, carbon and / or other atoms of the compounds of the present invention may be replaced with an isotope of the hydrogen, carbon and / or other atom, respectively. Examples of such isotopes include, but are not limited to, 2 H. 3 H. 11 C. 13 C. 14 C. 15 N. 18 O. 17 O. 31 P. 32 P. 35 S. 18 F. 123 I and 36 The isotope-substituted compounds are useful as pharmaceuticals and include all radiolabeled compounds of the present invention.

[0065] The compounds of the present disclosure can be produced from known compounds or intermediates that can be easily synthesized from known compounds, for example, by the methods described herein or in accordance with known methods.

[0066] When the solvents, reagents, and raw materials used in each step in the following production methods are commercially available, the commercially available products can be used as they are. Furthermore, the compounds obtained in each step in the following production methods and the raw materials used may form salts, and can be converted into other types of salts or free forms by known methods. When the compounds obtained in each step in the following production methods and the raw materials used are in free forms, they can be converted into the desired salts by known methods. Examples of such salts include the same salts as those used for the compounds of the present disclosure described above.

[0067] In the production of the compounds of the present disclosure, when the raw materials have substituents that may affect the reaction, protecting groups may be introduced into these substituents in advance by known methods. When a protecting group is introduced into the substituent of the raw material, the target compound can be obtained by removing the protecting group as necessary after the reaction. Examples of such protecting groups include those described in "Greene's Protective Groups in Organic Synthesis" by Wuts and Greene, 4th Edition; John Wiley & Sons Inc., 2006; or "Protecting Groups" by P.J. Kocienski, 3rd Edition; Thieme, 2005. Protecting groups can be appropriately selected and used depending on the properties of the raw materials and the reaction conditions.

[0068] The compounds obtained in each step of the following production methods can be isolated or purified in accordance with conventional methods, such as solvent extraction, concentration, distillation, sublimation, recrystallization, reprecipitation, and chromatography, or can be used in the next step in the form of a reaction mixture or a crude product.

[0069] Unless otherwise specified, the reactions in each step in the following production methods are carried out according to known methods, for example, those described in "Comprehensive Organic Transformations: A Guide to Functional Group Preparations 2nd Edition" by R.C. Larock, John Wiley & Sons Inc. The present invention can be carried out by appropriately modifying or combining the methods described in, for example, "Experimental Chemistry Lectures" edited by the Chemical Society of Japan, 4th edition, Maruzen, 1992; "Organic Synthesis Strategies Learned from Named Reactions" by L. Kuerti and B. Czako, translated and supervised by Kiyoshi Tomioka, Kagaku Dojin, 2006; "Latest Organic Synthesis Methods: Design and Strategy" by G. S. Zweifel and M. H. Nantz, translated by Tamejiro Hiyama, Kagaku Dojin, 2009, or the methods described herein. More specific methods for producing the compounds of the present disclosure are described below.

[0070] Compound (1) can be produced by the following method. (X 1 , X 2 , X 3 , A, B, and C have the same meanings as above. 1 represents a leaving group, and examples thereof include halogens such as fluorine and chlorine, mesylate esters, tosylate esters, and trifluoromethanesulfonate esters. 2 represents a leaving group, such as chlorine, imidazole, etc.)

[0071] Route 1 Step 1 This step is a step of obtaining compound A-2 by reacting compound A-1, which is commercially available or synthesized by a known method, with hydroxylamine hydrochloride or hydroxylamine in a solvent such as ethanol, methanol, water, tetrahydrofuran, dimethyl sulfoxide, etc., in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, sodium hydroxide, potassium hydroxide, potassium carbonate, sodium bicarbonate, diisopropylethylamine, triethylamine, etc., at 0°C to 100°C, preferably 10°C to 80°C, more preferably 20°C to 40°C, for 5 minutes to 48 hours, preferably 10 minutes to 24 hours, more preferably 30 minutes to 6 hours. Compound A-2 can sometimes be obtained as a salt of an inorganic acid.

[0072] Step 2 This reaction is a step to obtain compound A-4 by reacting compound A-2 with compound A-3, which is commercially available or synthesized by a known method, in a solvent such as acetonitrile, tetrahydrofuran, or dioxane in the presence of a base such as diisopropylethylamine, triethylamine, or DBU at 0°C to 50°C, preferably 10°C to 40°C, and more preferably 20°C to 30°C, for 5 minutes to 24 hours, preferably 10 minutes to 12 hours, and more preferably 30 minutes to 6 hours.

[0073] Step 3 In this reaction, compound A-4 is reacted with compound A-5, which is commercially available or synthesized by a known method, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, tetrahydrofuran, or the like, in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, potassium carbonate, sodium hydride, diisopropylethylamine, triethylamine, DBU, or the like, at 0°C to 120°C, preferably 30°C to 80°C, and more preferably 50°C to 70°C, for 5 minutes to 48 hours, preferably 10 minutes to 12 hours, and more preferably 30 minutes to 4 hours, to obtain compound (1).

[0074] Compound (1) can also be produced by the following method: after introducing a substituent corresponding to ABC, the cyano group (—CN) is converted to 4,5-dihydro-1,2,4-oxadiazol-5-one. (X 1 , X 2 , X 3 , A, B, C, E 1 , E 2 has the same meaning as above.)

[0075] Route 2 Step 1 This step is a step of obtaining compound B-1 by reacting compound A-1, which is commercially available or synthesized by a known method, with compound A-5, which is commercially available or synthesized by a known method, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, tetrahydrofuran, or the like, in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, sodium hydride, potassium carbonate, diisopropylethylamine, triethylamine, or DBU at 0°C to 120°C, preferably 10°C to 100°C, and more preferably 20°C to 30°C, for 5 minutes to 48 hours, preferably 10 minutes to 12 hours, and more preferably 30 minutes to 6 hours.

[0076] Step 2 This reaction is a step for obtaining Compound B-2 from Compound B-1, and can be produced by the same method as in Step 1 of Route 1 above.

[0077] Step 3 This reaction is a step for obtaining compound (1) from compound B-2, and can be produced by the same method as in Step 2 of Route 1 above.

[0078] Compound B-1 can also be produced by the following method. (X 1 , X 2 , X 3 , A, B, C, E 1 has the same meaning as above. 3 represents a leaving group, and examples thereof include halogens such as chlorine, bromine, and iodine, mesylates, tosylates, and trifluoromethanesulfonates.

[0079] Route 3 Step 1 This step is a step of obtaining compound C-2 by reacting compound A-1, which is commercially available or synthesized by a known method, with compound C-1, which is commercially available or synthesized by a known method, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, tetrahydrofuran, etc., in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, sodium hydride, potassium carbonate, diisopropylethylamine, triethylamine, DBU, etc., at 0°C to 120°C, preferably 10°C to 100°C, more preferably 20°C to 30°C, for 5 minutes to 48 hours, preferably 10 minutes to 12 hours, more preferably 30 minutes to 6 hours. Note that the hydroxyl group of compound C-1 may be protected with a known protecting group, and the hydroxyl group can be deprotected by a known method after the addition reaction.

[0080] Step 2 This step is a step of obtaining compound C-3 from compound C-2, and can be carried out in accordance with a known method. For example, compound C-3 can be obtained by reacting compound C-2 with a sulfonate esterifying agent such as tosylate chloride, mesylate chloride, or p-toluenesulfonic anhydride in a solvent such as dichloromethane or tetrahydrofuran in the presence of a base such as pyridine, diisopropylethylamine, triethylamine, or DBU at 0° C. to 50° C., preferably 10 to 30° C., for 1 hour to 48 hours, preferably 2 hours to 6 hours.

[0081] Step 3 This step is a step of introducing C into Compound C-3 to obtain Compound B-1, and can be carried out in accordance with a known method. For example, Compound B-1 can be obtained by reacting Compound C-2 with a secondary amine such as piperidine or pyrrolidine in the presence of a base such as sodium hydride, potassium carbonate, diisopropylethylamine, triethylamine, or DBU in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, or tetrahydrofuran at 40° C. to 120° C., preferably 80° C. to 100° C., for 1 hour to 48 hours, preferably 3 hours to 12 hours.

[0082] Compound (1) can also be produced by the following method: adding B having a hydroxyl group and then carrying out a chemical reaction. (X 1 , X 2 , X 3 , A, B, C, E 1 , E 3 has the same meaning as above.)

[0083] Route 4 Step 1 This step is a process for obtaining compound D-1 by reacting compound A-4 with compound C-1, which is commercially available or synthesized by a known method, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, or tetrahydrofuran in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, sodium hydride, potassium carbonate, diisopropylethylamine, triethylamine, or DBU at 0°C to 120°C, preferably 20°C to 80°C, and more preferably 50°C to 70°C, for 5 minutes to 48 hours, preferably 10 minutes to 12 hours, and more preferably 30 minutes to 6 hours. Note that the hydroxyl group of compound C-1 may be protected with a known protecting group, and the hydroxyl group can be deprotected by a known method after the addition reaction.

[0084] Step 2 This step is a step in which the hydroxyl group of compound D-1 is converted to introduce a leaving group to obtain compound D-2. D-2 can be obtained by carrying out the reaction under the same conditions as in the synthesis of compound (C-3) above.

[0085] Step 3 This step is a step in which the leaving group of compound D-2 is converted to introduce C to obtain compound (1), which can be produced by the same method as in Step 3 of Route 3 above.

[0086] The present invention will be explained in more detail below with reference to examples and test examples, but the present invention is not limited to these examples alone.

[0087] MS was measured by LCMS. ESI was used as the ionization method. The observed mass spectrometry values ​​are expressed as m / z.

[0088] The LCMS measurement conditions are as follows: Analytical instrument: ACQUITY UPLC MS / PDA system (Waters Corporation) Mass spectrometer: ACQUITY QDa detector or Waters 3100 MS detector Photodiode array detector: ACQUITY PDA detector (UV detection wavelength: 210 to 400 nm) Column: Acquity BEH C18, 1.7 μm, 2.1 × 50 mm Flow rate: 0.5 mL / min Column temperature: 40°C Solvent: Solution A: 0.1% formic acid / H 2 Solution B: 0.1% formic acid / acetonitrile (v / v; the same applies below)

[0089] Nuclear magnetic resonance (NMR) spectra were measured using a JNM-ECS400 nuclear magnetic resonance spectrometer (manufactured by JEOL RESONANCE Co., Ltd.) or a JNM-ECZL400S nuclear magnetic resonance spectrometer (manufactured by JEOL Ltd.). The observed peaks are expressed as chemical shift values ​​δ (ppm) (s = singlet, d = doublet, t = triplet, q = quartet, br = broad singlet, m = multiplet, dd = double doublet, ddd = double double doublet, dt = double triplet).

[0090] In the microwave experiments, Initiator (Biotage) or Initiator+ (Biotage) was used.

[0091] The compound names in this specification are determined using naming software conforming to IUPAC rules, ACD / NAME (registered trademark, Advanced Chemistry Development Inc.), or ChemBioDraw (version 19.1, manufactured by Cambridge Soft), or are determined according to the IUPAC nomenclature.

[0092] Example 1 3-{5-[(1-ethylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile To a mixture of (1-ethylpiperidin-4-yl)methanol (528 mg) and N,N-dimethylformamide (2.46 mL), sodium hydride (60%, dispersed in liquid paraffin, 147 mg) was added and stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (300 mg) was added and stirred overnight. Water was added to the reaction mixture under ice-cooling, and the mixture was diluted with ethyl acetate. The mixture was washed with water and saturated brine and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel chromatography to give the title compound (500 mg). MS (m / z): 246.3 [M+H] +

[0093] [Step 2] Preparation of 5-[(1-ethylpiperidin-4-yl)methoxy]-N'-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (425 mg) and dimethyl sulfoxide (2.04 mL), KO t Bu (686 mg) was added sequentially at room temperature and stirred for 10 minutes. 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile (500 mg) was added and stirred overnight. Water was added to the reaction solution, and the precipitate was collected by filtration and dried to obtain the title compound (396 mg). MS (m / z): 279.3 [M+H] +

[0094] [Step 3] Preparation of 3-{5-[(1-ethylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 5-[(1-ethylpiperidin-4-yl)methoxy]-N'-hydroxypyridine-2-carboximidamide (396 mg), tetrahydrofuran (4.74 mL), and DBU (0.255 mL), CDI (277 mg) was added and stirred at room temperature overnight. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make it acidic. The title compound (98 mg) was obtained by purification by silica gel chromatography. MS (m / z): 305.0 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.39 (d, 1H), 7.89 (d, 1H), 7.57 (dd, 1H), 4.05 (d, 2H), 3.50-3.12 (m , 2H), 2.92-2.82 (m, 2H), 2.74-2.60 (m, 2H), 2.10-1.88 (m, 3H), 1.60-1.42 (m, 2H), 1.17 (t, 3H)

[0095] Example 2 3-(5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of tert-butyl (3R)-3-{[(6-cyanopyridin-3-yl)oxy]methyl}piperidine-1-carboxylate Sodium hydride (60%, dispersed in liquid paraffin, 76 mg) was added to a mixture of tert-butyl (3R)-3-(hydroxymethyl)piperidine-1-carboxylate (410 mg) and N,N-dimethylformamide (1.27 mL), and the mixture was stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (155 mg) was added, and the mixture was stirred overnight. Water was added to the reaction mixture under ice-cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel chromatography to give the title compound (310 mg). MS (m / z): 318.1 [M+H] +

[0096] [Step 2] Preparation of 5-{[(3R)-piperidin-3-yl]methoxy}pyridine-2-carbonitrile hydrochloride To tert-butyl (3R)-3-{[(6-cyanopyridin-3-yl)oxy]methyl}piperidine-1-carboxylate (310 mg), 4M hydrogen chloride in dioxane (3.0 mL) was added at room temperature, and the mixture was stirred for 1 hour. The solvent was evaporated under reduced pressure to give the title compound (310 mg). MS (m / z): 218.0 [M+H] +

[0097] [Step 3] Preparation of 5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridine-2-carbonitrile Iodoethane (217 mg) was added to a mixture of 5-{[(3R)-piperidin-3-yl]methoxy}pyridine-2-carbonitrile hydrochloride (310 mg), N,N-dimethylformamide (3 mL), and diisopropylethylamine (0.92 mL), and the mixture was heated and stirred at 70° C. overnight. The reaction mixture was purified by silica gel column chromatography to give the title compound (66 mg). MS (m / z): 246.1 [M+H] +

[0098] [Step 4] Preparation of 3-(5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride A procedure similar to Steps 2 and 3 of Example 1 was carried out using 5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridine-2-carbonitrile (66 mg) obtained in Step 3 of Example 2 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile to obtain the title compound (48 mg). MS (m / z): 305.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.45 (d, 1H), 7.79 (d, 1H), 7.46 (dd, 1H), 4.06 (d, 2H), 3.93 (t , 2H), 2.85 (d, 2H), 3.55-3.20 (m, 3H), 2.22-2.08 (m, 1H), 1.85-1.60 (m, 3H), 1.15 (t, 3H) Elemental analysis value (C 15 H 20 N4 O 3 HCl) Calculated values ​​(%) C: 52.86, H: 6.21, N: 16.44 Found values ​​(%) C: 53.30, H: 6.61, N: 16.43

[0099] Example 3 3-(5-{[(3S)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride

[0111] The title compound (24 mg) was obtained by a method similar to that of Example 2, except that tert-butyl (3S)-3-(hydroxymethyl)piperidine-1-carboxylate (410 mg) was used instead of tert-butyl (3R)-3-(hydroxymethyl)piperidine-1-carboxylate in Step 1 of Example 2. MS (m / z): 305.1 [M+H] +

[0100] Example 4 3-{5-[(1-benzylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[(1-benzylpiperidin-4-yl)oxy]pyridine-2-carbonitrile The title compound (400 mg) was obtained by a method similar to Step 1 of Example 1, using 1-benzylpiperidin-4-ol (470 mg) instead of (1-ethylpiperidin-4-yl)methanol. MS (m / z): 294.1 [M+H] +

[0101] [Step 2] Preparation of 3-{5-[(1-benzylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that 5-[(1-benzylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (400 mg) obtained in Step 1 of Example 4 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (390 mg) was obtained. MS (m / z): 353.1 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 10.75 (br, 1H), 8.48 (d, 1H), 7.95 (d, 1H), 7.70 (dd, 1H), 7.66-7.58 (m, 2H), 7. 50-7.44 (m, 3H), 5.10-4.70 (m, 1H), 4.34 (s, 2H), 3.30-3.00 (m, 4H), 2.30-2.18 (m, 2H), 2.14-1.98 (m, 2H)

[0102] Example 5 3-(5-{2-[benzyl(methyl)amino]ethoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Preparation of 5-{2-[benzyl(methyl)amino]ethoxy}pyridine-2-carbonitrile The title compound (430 mg) was obtained by a method similar to Step 1 of Example 1, except that 2-[benzyl(methyl)amino]ethan-1-ol (406 mg) was used instead of (1-ethylpiperidin-4-yl)methanol. MS (m / z): 268.2 [M+H] +

[0103] [Step 2] 3-(5-{2-[benzyl(methyl)amino]ethoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one

[0123] The title compound (300 mg) was obtained by a method similar to Steps 2 and 3 of Example 1, except that 5-{2-[benzyl(methyl)amino]ethoxy}pyridine-2-carbonitrile (430 mg) obtained in Step 1 of Example 5 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile. MS (m / z): 327.0 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.43 (d, 1H), 7.92 (d, 1H), 7.61 (dd, 1H), 7 .33-7.22 (m, 5H), 4.29 (t, 2H), 3.60 (s, 2H), 2.80 (t, 2H), 2.26 (s, 3H) Elemental analysis value (C 17 H 18 N 4 O 3 ・0.1H 2Calculated values ​​(%): C: 62.22, H: 5.59, N: 17.07 Measured values ​​(%): C: 62.06, H: 5.59, N: 16.96

[0104] Example 6 3-{5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of tert-butyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate To a mixture of tert-butyl 4-(2-hydroxyethyl)piperazine-1-carboxylate (1.42 g) and N,N-dimethylformamide (4.10 mL), sodium hydride (60%, dispersed in liquid paraffin, 246 mg) was added and stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (500 mg) was added and the mixture was stirred overnight. Water was added to the reaction mixture under ice-cooling, and the mixture was purified by silica gel column chromatography to obtain the title compound (1.97 g). MS (m / z): 333.3 [M+H] +

[0105] [Step 2] Preparation of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride To a mixture of tert-butyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate (1.97 g) and methanol (2.85 mL), 4M hydrogen chloride in dioxane (4.44 mL) was added and stirred at room temperature for 30 minutes. Methanol (2.85 mL) and 4M hydrogen chloride in dioxane (4.44 mL) were added and stirred overnight. The resulting precipitate was collected by filtration and dried to give the title compound (0.97 g). MS (m / z): 233.2 [M+H] +

[0106] [Step 3] Preparation of 5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile. To a mixture of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride (300 mg), dichloromethane (3.28 mL), and diisopropylethylamine (0.85 mL), acetyl chloride (0.084 mL) was added sequentially under ice cooling, and the mixture was stirred at room temperature for 5 hours. A few drops of saturated aqueous sodium bicarbonate were added to the reaction mixture, and the mixture was concentrated under reduced pressure. The title compound (242 mg) was obtained by purification using silica gel column chromatography. MS (m / z): 275.2 [M+H] +

[0107] [Step 4] Preparation of 3-{5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride

[0111] The title compound (207 mg) was obtained by a method similar to Steps 2 and 3 of Example 1, except that 5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile (242 mg) obtained in Step 3 of Example 6 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile. MS (m / z): 334.0 [M+H] + 1 H-NMR (400MHz, D 2 O) δ: 8.24 (d, 1H), 7.72 (d, 1H), 7.42 (dd, 1H), 4.39 (t, 2H), 3.80-3.67 (m, 4H), 3.42 (t, 2H), 3.25-3.11 (m, 4H), 2.09 (s, 3H)

[0108] Example 7 3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile To a mixture of 3-(piperidin-1-yl)propan-1-ol (387 mg) and N,N-dimethylformamide (3.0 mL), sodium hydride (60%, dispersed in liquid paraffin, 108 mg) was added and stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (220 mg) was added and stirred overnight at room temperature. Water was added to the reaction mixture under ice-cooling, and the mixture was diluted with ethyl acetate. The mixture was washed with water and saturated brine and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography to give the title compound (336 mg). MS (m / z): 246.2 [M+H] +

[0109] [Step 2] Preparation of N'-hydroxy-5-[3-(piperidin-1-yl)propoxy]pyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (530 mg) and ethanol (3.0 mL), 2M aqueous sodium hydroxide solution (3.42 mL) was added and stirred at room temperature for 10 minutes. 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile (336 mg) was added to the reaction solution, and the mixture was stirred for 4 hours. Water was added to the reaction solution, and the precipitate was collected by filtration and dried to give the title compound (236 mg). MS (m / z): 279.3 [M+H] +

[0110] [Step 3] Preparation of 3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride. To a mixture of N'-hydroxy-5-[3-(piperidin-1-yl)propoxy]pyridine-2-carboximidamide (236 mg), tetrahydrofuran (5.0 mL), and DBU (0.19 mL), CDI (206 mg) was added at room temperature and stirred for 5 hours. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make it acidic. Purification by silica gel column chromatography gave the title compound (190 mg). MS (m / z): 305.2 [M+H] + 1 H-NMR (400MHz, D 2 O) δ: 8.23 ​​(d, 1H), 7.62 (d, 1H), 7.41 (dd, 1H), 4.24 (t, 2H), 3.69 (br, 2H), 3.43-3.39 (m, 2H) , 3.08 (ddd, 2H), 2.39-2.32 (m, 2H), 2.08-2.05 (m, 2H), 1.95-1.79 (m, 3H), 1.65-1.55 (m, 1H) Elemental analysis value (C 15 H 20 N 4 O 3 HCl) Calculated values ​​(%) C: 52.86, H: 6.21, N: 16.44 Found values ​​(%) C: 52.71, H: 6.31, N: 16.52

[0111] Example 8 3-{5-[3-(pyrrolidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[3-(pyrrolidin-1-yl)propoxy]pyridine-2-carbonitrile The title compound (296 mg) was obtained by a method similar to Step 1 of Example 1, except that 3-(pyrrolidin-1-yl)propan-1-ol (349 mg) was used instead of (1-ethylpiperidin-4-yl)methanol. MS (m / z): 232.2 [M+H] +

[0112] [Step 2] Preparation of 3-{5-[3-(pyrrolidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that 5-[3-(pyrrolidin-1-yl)propoxy]pyridine-2-carbonitrile (296 mg) obtained in Step 1 of Example 8 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (250 mg) was obtained. MS (m / z): 291.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.28 (br, 1H), 7.74 (d, 1H), 7.36 (d, 1H), 4.16 (t, 2H), 3.30-3.15 (m, 6H), 2.15-2.06 (m, 2H), 1.94-1.87 (m, 4H)

[0113] Example 9 3-{5-[2-(pyrrolidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[2-(pyrrolidin-1-yl)ethoxy]pyridine-2-carbonitrile The title compound (350 mg) was obtained by a method similar to Step 1 of Example 1, using 2-(pyrrolidin-1-yl)ethan-1-ol (325 mg) instead of (1-ethylpiperidin-4-yl)methanol. MS (m / z): 218.0 [M+H] +

[0114] [Step 2] Preparation of 3-{5-[2-(pyrrolidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride

[0111] The title compound (330 mg) was obtained by a method similar to Steps 2 and 3 of Example 1, except that 5-[2-(pyrrolidin-1-yl)ethoxy]pyridine-2-carbonitrile (350 mg) obtained in Step 1 of Example 9 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile. MS (m / z): 277.0 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.37 (d, 1H), 7.80 (d, 1H), 7.43 (dd, 1H), 4.34 (t, 2H), 3.35 (t, 2H), 3.18-3.12 (m, 4H), 1.92-1.86 (m, 4H)

[0115] Example 10 3-{5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Preparation of 5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile To a mixture of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride (228 mg) obtained in Step 2 of Example 6, N,N-dimethylformamide (3 mL), and diisopropylethylamine (0.65 mL), bromomethylbenzene (0.11 mL) was added at room temperature and stirred overnight. Saturated aqueous sodium bicarbonate was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to obtain the title compound (235 mg). MS (m / z): 323.3 [M+H] +

[0116] [Step 2] Preparation of 3-{5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one In a similar manner to Steps 2 and 3 of Example 1, except that 5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile (235 mg) obtained in Step 1 of Example 10 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (105 mg) was obtained. MS (m / z): 382.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.42 (d, 1H), 7.91 (d, 1H), 7.61 (dd, 1H), 7.40-7.20 (m , 5H), 4.25 (t, 2H), 3.50 (s, 2H), 3.40-3.20 (m, 4H), 2.76 (t, 2H), 2.45-2.30 (m, 4H) Elemental analysis value (C 20 H 23 N 5 O 3・0.1H 2 Calculated values ​​(%) C: 62.68, H: 6.10, N: 18.28 Measured values ​​(%) C: 62.42, H: 6.09, N: 18.26

[0117] Example 11 Phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate hydrochloride [Step 1] Preparation of phenyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate To a mixture of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride (220 mg) obtained in Step 2 of Example 6, dichloromethane (2.40 mL), and diisopropylethylamine (0.62 mL), phenylcarbonochloridate (0.11 mL) was added under ice cooling, and the mixture was stirred at room temperature. A few drops of saturated aqueous sodium bicarbonate were added to the reaction solution, and the mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give the title compound (254 mg). MS (m / z): 353.2 [M+H] +

[0118] [Step 2] Preparation of phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that phenyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate (254 mg) obtained in Step 1 of Example 11 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (208 mg) was obtained. MS (m / z): 412.3 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 11.2 (br, 1H), 8.52 (d, 1H), 8.01 (d, 1H), 7.70 (dd, 1H), 7.43-7.38 (m, 2H), 7.2 7-7.20 (m, 1H), 7.18-7.12 (m, 2H), 4.63 (br, 2H), 4.40-4.00 (m, 2H), 3.75-3.55 (m, 4H), 3.35-3.20 (m, 4H) Elemental analysis value (C 20 H 21 N 5 O 5 (as HCl) Calculated values ​​(%) C: 53.63, H: 4.95, N: 15.64 Measured values ​​(%) C: 53.19, H: 5.03, N: 15.46

[0119] Example 12 3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[2-(piperidin-1-yl)ethoxy]pyridine-2-carbonitrile The title compound (758 mg) was obtained by a method similar to Step 1 of Example 1, using 2-(piperidin-1-yl)ethan-1-ol (794 mg) instead of (1-ethylpiperidin-4-yl)methanol. MS (m / z): 232.2 [M+H] +

[0120] [Step 2] Preparation of 3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride

[0111] The title compound (480 mg) was obtained by a method similar to Steps 2 and 3 of Example 1, except that 5-[2-(piperidin-1-yl)ethoxy]pyridine-2-carbonitrile (758 mg) obtained in Step 1 of Example 12 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile. MS (m / z): 291.2 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.40 (d, 1H), 7.88 (d, 1H), 7.56 (dd, 1H), 4.29 (t , 2H), 2.91 (t, 2H), 2.70-2.64 (m, 4H), 1.61-4.54 (m, 4H), 1.46-1.38 (m, 2H)

[0121] Example 13 3-{5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridine-2-carbonitrile The title compound (192 mg) was obtained by a method similar to Step 1 of Example 1, using 2-(4-phenoxypiperidin-1-yl)ethan-1-ol (213 mg) instead of (1-ethylpiperidin-4-yl)methanol. MS (m / z): 324.2 [M+H] +

[0122] [Step 2] Preparation of 3-{5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that 5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridine-2-carbonitrile (192 mg) obtained in Step 1 of Example 13 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (39 mg) was obtained. MS (m / z): 383.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.44 (d, 1H), 7.92 (d, 1H), 7.63 (dd, 1H), 7.30-7.20 (m, 2H), 6.98-6.88 (m, 3H), 4.43-4.33 (m, 1H), 4.29 (t, 2H), 2.90-2.80 (m, 4H), 2.48-2.38 (m, 2H), 2.00-1.90 (m, 2H), 1.70-1.60 (m, 2H)

[0123] Example 14 3-{5-[(1-cyclopropanecarbonylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Preparation of tert-butyl 4-{[(6-cyanopyridin-3-yl)oxy]methyl}piperidine-1-carboxylate Sodium hydride (60%, dispersed in liquid paraffin, 1.47 g) was added to a mixture of tert-butyl 4-(hydroxymethyl)piperidine-1-carboxylate (7.94 g) and N,N-dimethylformamide (35 mL), and the mixture was stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (3.0 g) was added to the reaction mixture, and the mixture was stirred for 2 hours. Water was added to the reaction mixture under ice-cooling, and the mixture was diluted with ethyl acetate. The mixture was washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title compound (7.8 g). MS (m / z): 262.2 [M- t Bu + H] +

[0124] [Step 2] Preparation of tert-butyl 4-[({6-[N'-hydroxycarbamimidoyl]pyridin-3-yl}oxy)methyl]piperidine-1-carboxylate To a mixture of hydroxylamine hydrochloride (8.5 g) and dimethyl sulfoxide (49 mL), t Bu (14 g) was added under ice-cooling, and the mixture was stirred for 15 minutes. tert-Butyl 4-{[(6-cyanopyridin-3-yl)oxy]methyl}piperidine-1-carboxylate (7.8 g) was added to the reaction mixture, and the mixture was stirred overnight. Water was added to the reaction mixture, and the precipitate was collected by filtration and dried to obtain the title compound (7.72 g). MS (m / z): 351.3 [M+H] +

[0125] [Step 3] Preparation of tert-butyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate To a mixture of tert-butyl 4-[({6-[N'-hydroxycarbamimidoyl]pyridin-3-yl}oxy)methyl]piperidine-1-carboxylate (7.72 g), tetrahydrofuran (44 mL), and DBU (3.95 mL), CDI (5.36 g) was added and stirred at room temperature for 2 hours. Water was added to the reaction mixture, and 2M hydrochloric acid was added dropwise to adjust the pH to 5. After 1 hour, the precipitate was collected by filtration and dried to give the title compound (7.5 g). MS (m / z): 375.2 [M-H] -

[0126] [Step 4] Preparation of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of tert-butyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate (7.5 g) and tetrahydrofuran (30 mL), 4M hydrogen chloride in dioxane (24.9 mL) was added at room temperature, and the mixture was stirred overnight. The solvent was evaporated under reduced pressure, and the resulting precipitate was collected by filtration with diethyl ether and dried to give the title compound (7.24 g). MS (m / z): 277.2 [M+H] +

[0127] [Step 5] Preparation of 3-{5-[(1-cyclopropanecarbonylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one. HATU (219 mg) was added to a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg), cyclopropanecarboxylic acid (53.7 mg), diisopropylethylamine (0.4 mL), and N,N-dimethylformamide (1 mL) at room temperature, and the mixture was stirred overnight. The reaction mixture was purified by silica gel column chromatography to give the title compound (110 mg). MS (m / z): 345.1 [M+H]+

[0128] Example 15 3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of tert-butyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate Sodium hydride (60%, dispersed in liquid paraffin, 1.47 g) was added to a mixture of tert-butyl 4-hydroxypiperidine-1-carboxylate (7.42 g) and N,N-dimethylformamide (50 mL) under ice-cooling, and the mixture was stirred for 10 minutes. 5-Fluoropyridine-2-carbonitrile (3.0 g) was added, and the mixture was stirred for 1 hour. Water was added to the reaction mixture under ice-cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the resulting precipitate was collected by filtration and dried to give the title compound (6.0 g). MS (m / z): 248.2 [M- t Bu + H] +

[0129] [Step 2] Preparation of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride To a mixture of tert-butyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate (6.0 g) and methanol (20 mL), 4 M hydrogen chloride in ethyl acetate (50 mL) was added at room temperature and stirred overnight. The solvent was evaporated under reduced pressure, and the resulting precipitate was collected by filtration, washed with ethyl acetate, and then dried to obtain the title compound (4.5 g). MS (m / z): 204.2 [M+H] +

[0130] [Step 3] Preparation of 5-[(1-propylpiperidin-4-yl)oxy]pyridine-2-carbonitrile 1-Bromopropane (385 mg) was added to a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg), N,N-dimethylformamide (1 mL), and diisopropylethylamine (1.08 mL), and the mixture was heated and stirred at 80°C for 3 hours. Purification by silica gel column chromatography gave the title compound (300 mg). MS (m / z): 246.2 [M+H] +

[0131] [Step 4] Preparation of 3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that 5-[(1-propylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (300 mg) obtained in Step 3 of Example 15 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (260 mg) was obtained. MS (m / z): 305.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.50 (br, 1H), 7.96 (d, 1H), 7.71 (dd, 1H), 5.05-4.7 7 (m, 1H), 3.63-2.95 (m, 6H), 2.33-1.95 (m, 4H), 1.79-1.67 (m, 2H), 0.92 (t, 3H)

[0132] Example 16 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridine-2-carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (1 mL), and diisopropylethylamine (1.08 mL), (bromomethyl)cyclopropane (422 mg) was added and the mixture was heated and stirred at 80° C. for 3 hours. Purification by silica gel column chromatography afforded the title compound (300 mg). MS (m / z): 258.2 [M+H] +

[0133] [Step 2] Preparation of 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that 5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridine-2-carbonitrile (300 mg) obtained in Step 1 of Example 16 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (310 mg) was obtained. MS (m / z): 317.0 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.43 (d, 1H), 7.89 (d, 1H), 7.64 (dd, 1H), 4.80-4.70 (m, 1H), 3.20-3.05 (m, 2H), 2.94-2.80 (m , 2H), 2.70-2.60 (m, 2H), 2.20-2.05 (m, 2H), 1.94-1.80 (m, 2H), 1.04-0.92 (m, 1H), 0.60-0.48 (m, 2H), 0.28-0.15 (m, 2H)

[0134] Example 17 3-{5-[(1-propylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), and diisopropylethylamine (0.37 mL), 1-bromopropane (0.12 mL) was added sequentially at room temperature, and the mixture was stirred at 80° C. for 4 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (42 mg). MS (m / z): 319.1 [M+H] +

[0135] Example 18 3-{5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridine-2-carbonitrile By a method similar to Step 1 of Example 1, except that 2-(2,3-dihydro-1H-isoindol-2-yl)ethan-1-ol (122 mg) was used instead of (1-ethylpiperidin-4-yl)methanol, the title compound (112 mg) was obtained. MS (m / z): 266.2 [M+H] +

[0136] [Step 2] Preparation of 3-{5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Steps 2 and 3 of Example 1, except that 5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridine-2-carbonitrile (112 mg) obtained in Step 1 of Example 18 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (76 mg) was obtained. MS (m / z): 325.1 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.52 (d, 1H), 8.03 (d, 1H), 7.65 (dd, 1H), 7.45-7.38 (m, 4H), 4.60 (t, 2H), 3.99 (t, 2H), 3.29 (s, 4H) Elemental analysis value (C 17 H 16 N 4 O 3 HCl 0.2H 2 Calculated values ​​(%) C: 56.03, H: 4.81, N: 15.38 Measured values ​​(%) C: 56.01, H: 4.64, N: 15.44

[0137] Example 19 3-{5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridine-2-carbonitrile By a method similar to Step 1 of Example 1, except that 2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethan-1-ol (174 mg) was used instead of (1-ethylpiperidin-4-yl)methanol, the title compound (164 mg) was obtained. MS (m / z): 280.2 [M+H] +

[0138] [Step 2] Preparation of 3-{5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride

[0111] The title compound (30 mg) was obtained by a method similar to Steps 2 and 3 of Example 1, except that 5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridine-2-carbonitrile (162 mg) obtained in Step 1 of Example 19 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile. MS (m / z): 339.1 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.42 (d, 1H), 7.95 (d, 1H), 7.56 (dd, 1H), 7.18-7.05 (m , 4H), 4.42 (t, 2H), 3.94 (s, 2H), 3.18 (t, 2H), 3.10-3.04 (m, 2H), 3.04-2.96 (m, 2H)

[0139] Example 20 Ethyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (0.57 mL), and diisopropylethylamine (0.24 mL), ethyl carbonochloridate (0.027 mL) was added successively at room temperature and stirred for 15 minutes. The mixture was diluted with water, and 2M hydrochloric acid was added. The precipitate was collected by filtration and dried to give the title compound (83 mg). MS (m / z): 349.2 [M+H] + Elemental analysis value (C 16 H 20 N 4 O 5 Calculated values ​​(%) C: 55.17, H: 5.79, N: 16.08 Measured values ​​(%) C: 55.07, H: 5.82, N: 16.07

[0140] Example 21 3-(5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}pyridine-2-carbonitrile To a mixture of 3-[4-(2-fluorophenyl)piperazin-1-yl]propan-1-ol (351 mg) and N,N-dimethylformamide (3 mL), sodium hydride (60%, dispersed in liquid paraffin, 59 mg) was added sequentially at room temperature, and the mixture was stirred for 15 minutes. 5-Fluoropyridine-2-carbonitrile (120 mg) was added and the mixture was stirred overnight. Water was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to obtain the title compound (270 mg). MS (m / z): 341.1 [M+H] +

[0141] [Step 2] Preparation of 5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}-N'-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (480 mg) and dimethyl sulfoxide (5 mL), KO t Bu (712 mg) was added sequentially at room temperature, and the mixture was stirred for 10 minutes. 5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}pyridine-2-carbonitrile (270 mg) was added, and the mixture was stirred at room temperature for 4 hours. Water was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to obtain the title compound (160 mg). MS (m / z): 374.2 [M+H] +

[0142] [Step 3] Preparation of 3-(5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}-N'-hydroxypyridine-2-carboximidamide (160 mg), tetrahydrofuran (5 mL), and DBU (0.096 mL), CDI (104 mg) was added at room temperature, and the mixture was stirred for 5 hours. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make it acidic. The title compound (75 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 400.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.39 (d, 1H), 7.88 (d, 1H), 7.57 (dd, 1H), 7.15-6.92 (m, 4H), 4.20 (t, 2H), 3.05-2.98 (m, 4H), 2.60-2.56 (m, 4H), 2.55-2.48 (m, 2H), 1.99-1.92 (m, 2H)

[0143] Example 22 3-{5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile By a method similar to that of Step 1 of Example 1, except that 2-(4-phenylpiperazin-1-yl)ethan-1-ol (50 mg) was used instead of (1-ethylpiperidin-4-yl)methanol, the title compound (62 mg) was obtained. MS (m / z): 309.2 [M+H] +

[0144] [Step 2] Preparation of 3-{5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride In a similar manner to Steps 2 and 3 of Example 1, except that 5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile (62 mg) obtained in Step 1 of Example 22 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (45 mg) was obtained. MS (m / z): 368.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.43 (d, 1H), 7.91 (d, 1H), 7.61 (dd, 1H), 7.23-7.16 (m, 2H), 6.96-6.91 (m, 2H ), 6.78-6.74 (m, 1H), 4.31 (t, 2H), 4.20-4.00 (br, 1H), 3.16-3.12 (m, 4H), 2.80 (t, 2H), 2.68-2.92 (m, 4H)

[0145] Example 23 3-{5-[3-(piperidin-1-yl)propoxy]pyrimidin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step 1] Preparation of 5-[3-(piperidin-1-yl)propoxy]pyrimidine-2-carbonitrile To a mixture of 3-(piperidin-1-yl)propan-1-ol (175 mg) and N,N-dimethylformamide (1.6 mL), sodium hydride (60%, dispersed in liquid paraffin, 49 mg) was added under ice-cooling and the mixture was stirred for 15 minutes. 5-Fluoropyrimidine-2-carbonitrile (100 mg) was added and the mixture was stirred under ice-cooling for 2 hours. Water was added to the reaction mixture under ice-cooling, and the mixture was diluted with ethyl acetate. The mixture was washed with water and saturated brine and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography to give the title compound (69 mg). MS (m / z): 247.1 [M+H] +

[0146] [Step 2] Preparation of N-hydroxy-5-[3-(piperidin-1-yl)propoxy]pyrimidine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (97 mg) and ethanol (1.4 mL), 2M aqueous sodium hydroxide solution (0.7 mL) was added and stirred at room temperature for 10 minutes. 5-[3-(piperidin-1-yl)propoxy]pyrimidine-2-carbonitrile (69 mg) was added to the reaction solution, and the mixture was stirred for 4 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (58 mg). MS (m / z): 280.1 [M+H] +

[0147] [Step 3] Preparation of 3-{5-[3-(piperidin-1-yl)propoxy]pyrimidin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate. To a mixture of N-hydroxy-5-[3-(piperidin-1-yl)propoxy]pyrimidine-2-carboximidamide (58 mg), tetrahydrofuran (1 mL), and DBU (0.046 mL), CDI (51 mg) was added at room temperature and stirred for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (316 mg) was added dropwise to the reaction mixture to make it acidic. Purification by silica gel column chromatography afforded the title compound (39 mg). MS (m / z): 306.1 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.64 (s, 2H), 7.69 (d, 2H), 7.22 (d, 2H), 4.35 (t, 2H), 3.80-3 .50 (m, 2H), 3.40-3.26 (m, 2H), 3.10-2.80 (m, 2H), 2.42-2.26 (m, 5H), 2.10-1.40 (m, 6H)

[0148] Example 24 3-{6-[3-(piperidin-1-yl)propoxy]pyridazin-3-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 6-[3-(piperidin-1-yl)propoxy]pyridazine-3-carbonitrile To a mixture of 3-(piperidin-1-yl)propan-1-ol (770 mg) and N,N-dimethylformamide (5 mL), sodium hydride (60%, dispersed in liquid paraffin, 215 mg) was added and stirred at room temperature for 30 minutes. 6-Chloropyridazine-3-carbonitrile (500 mg) was added and stirred at room temperature overnight. Water was added to the reaction mixture under ice-cooling, and the mixture was purified by silica gel column chromatography to obtain the title compound (300 mg). MS (m / z): 247.2 [M+H] +

[0149] [Step 2] Preparation of N-hydroxy-6-[3-(piperidin-1-yl)propoxy]pyridazine-3-carboximidamide To a mixture of hydroxylamine hydrochloride (510 mg) and ethanol (5 mL), 2M aqueous sodium hydroxide solution (3.04 mL) was added and stirred at room temperature for 30 minutes. 6-[3-(piperidin-1-yl)propoxy]pyridazine-3-carbonitrile (300 mg) was added to the reaction solution, and the mixture was stirred overnight. Water was added to the reaction solution, and the precipitate was collected by filtration and dried to give the title compound (227 mg). MS (m / z): 280.2 [M+H] +

[0150] [Step 3] Preparation of 3-{6-[3-(piperidin-1-yl)propoxy]pyridazin-3-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of N-hydroxy-6-[3-(piperidin-1-yl)propoxy]pyridazine-3-carboximidamide (227 mg), tetrahydrofuran (5 mL), and DBU (0.182 mL), CDI (198 mg) was added at room temperature and stirred overnight. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make it acidic. Purification by silica gel column chromatography gave the title compound (125 mg). MS (m / z): 306.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.13 (d, 1H), 7.43 (d, 1H), 4.62 (t, 2H), 3.58-3.25 (m, 4H), 3.20 (t, 2H), 2.32-2.22 (m, 2H), 1.86-1.25 (m, 6H) Elemental analysis value (C 14 H 19 N 5 O 3 HCl 0.1H 2 Calculated values ​​(%): C: 48.94, H: 5.93, N: 20.38 Measured values ​​(%): C: 48.84, H: 6.08, N: 20.39

[0151] Example 25 3-(5-{[3-(piperidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step 1] Preparation of 5-({3-[(tert-butyldimethylsilyl)oxy]propyl}sulfanyl)pyridine-2-carbonitrile 5-Fluoropyridine-2-carbonitrile (1.5 g) was added to a mixture of 3-sulfanylpropan-1-ol (1 g), N,N-dimethylformamide (5 mL), and sodium carbonate (2.3 g), and the mixture was heated and stirred at 50° C. for 3 hours. The reaction mixture was returned to room temperature, and imidazole (2.24 g) and tert-butyl(chloro)dimethylsilane (2.13 g) were added, followed by stirring overnight. The mixture was purified by silica gel column chromatography to obtain the title compound (800 mg). MS (m / z): 309.2 [M+H] +

[0152] [Step 2] Preparation of 3-[5-({3-[(tert-butyldimethylsilyl)oxy]propyl}sulfanyl)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one. By a method similar to Step 2 and Step 3 of Example 7, using 5-({3-[(tert-butyldimethylsilyl)oxy]propyl}sulfanyl)pyridine-2-carbonitrile (800 mg) obtained in Step 1 of Example 25 instead of 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile, the title compound (950 mg) was obtained. MS (m / z): 368.1 [M+H] +

[0153] [Step 3] Preparation of 3-{5-[(3-hydroxypropyl)sulfanyl]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4M hydrogen chloride in ethyl acetate (6.46 mL) was added to 3-[5-({3-[(tert-butyldimethylsilyl)oxy]propyl}sulfanyl)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (950 mg), and the mixture was stirred at room temperature for 1 hour. The resulting precipitate was collected by filtration and dried to give the title compound (700 mg). MS (m / z): 252.1 [M+H]+

[0154] [Step 4] Preparation of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]sulfanyl}propyl 4-methylbenzene-1-sulfonate. To a mixture of 3-{5-[(3-hydroxypropyl)sulfanyl]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (200 mg) and pyridine (3 mL), 4-methylbenzene-1-sulfonyl chloride (256 mg) was added and stirred for 1 hour. Hexane was added to the reaction mixture, and the precipitate was collected by filtration and dried to give the title compound (280 mg). MS (m / z): 408.2 [M+H] +

[0155] [Step 5] Preparation of 3-(5-{[3-(piperidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]sulfanyl}propyl 4-methylbenzene-1-sulfonate (80 mg), N,N-dimethylformamide (0.5 mL), and sodium iodide (88 mg), piperidine (50 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. Hydrochloric acid was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to give the title compound (35 mg). MS (m / z): 321.0 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.61 (s, 1H), 7.94-7.82 (m, 2H), 7.47 (d, 2H), 7.11 (d, 2H), 3.20-2.92 (m, 6H), 2.28 (s, 3H), 2.00-1.88 (m, 4H), 1.72-1.42 (m, 6H)

[0156] Example 26 3-(5-{[3-(pyrrolidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt Pyrrolidine (42 mg) was added to a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]sulfanyl}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 4 of Example 25, sodium iodide (88 mg), diisopropylethylamine (0.1 mL), and N,N-dimethylformamide (0.5 mL), and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (187 mg) was added dropwise to the reaction mixture to acidify it. The mixture was purified by silica gel column chromatography to give the title compound (15 mg). MS (m / z): 307.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.66 (d, 1H), 7.98 (dd, 1H), 7.89 (d, 1H), 7.4 7 (d, 2H), 7.11 (d, 2H), 3.40-3.15 (m, 8H), 2.28 (s, 3H), 1.99-1.84 (m, 6H)

[0157] Example 27 3-(5-{[3-(azepan-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride The title compound (73 mg) was obtained by the same method as in Example 26, except that azepane (58 mg) was used instead of pyrrolidine. MS (m / z): 335.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.47 (s, 1H), 7.72-7.64 (m, 2H), 3.15-2.95 (m, 8H), 1.95-1.85 (m, 2H), 1.75-1.45 (m, 8H)

[0158] Example 28 Phenyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate [Step 1] Preparation of phenyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate Phenyl carbonochloridate (380 mg) was added to a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (5 mL), and diisopropylethylamine (1.08 mL), and the mixture was stirred at room temperature for 1 hour. Purification by silica gel column chromatography afforded the title compound (400 mg). MS (m / z): 324.0 [M+H] +

[0159] [Step 2] Preparation of phenyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate By a method similar to Step 2 and Step 3 of Example 1, except that phenyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate (400 mg) obtained in Step 1 of Example 28 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (370 mg) was obtained. MS (m / z): 383.0 [M+H] + Elemental analysis value (C 19 H 18 N 4 O 5 Calculated values ​​(%) C: 59.68, H: 4.75, N: 14.65 Measured values ​​(%) C: 59.64, H: 4.58, N: 14.70

[0160] Example 29 Ethyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate [Step 1] Preparation of ethyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate Ethyl carbonochloridate (340 mg) was added to a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (5 mL), and diisopropylethylamine (1.08 mL), and the mixture was stirred at room temperature for 1 hour. Purification by silica gel column chromatography afforded the title compound (400 mg). MS (m / z): 276.0 [M+H] +

[0161] [Step 2] Preparation of ethyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate By a method similar to Step 2 and Step 3 of Example 1, except that ethyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate (400 mg) obtained in Step 1 of Example 29 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (180 mg) was obtained. MS (m / z): 335.0 [M+H] + Elemental analysis value (C 15 H 18 N 4 O 5 Calculated values ​​(%) C: 53.89, H: 5.43, N: 16.76 Measured values ​​(%) C: 53.81, H: 5.37, N: 16.71

[0162] Example 30 3-{5-[(1-ethylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[(1-ethylpiperidin-4-yl)oxy]pyridine-2-carbonitrile To a mixture of 1-ethylpiperidin-4-ol (206 mg) and N,N-dimethylformamide (3 mL), sodium hydride (60%, dispersed in liquid paraffin, 64 mg) was added sequentially at room temperature, and the mixture was stirred for 15 minutes. 5-Fluoropyridine-2-carbonitrile (130 mg) was added and the mixture was stirred overnight. Water was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to obtain the title compound (240 mg). MS (m / z): 232.2 [M+H] +

[0163] [Step 2] Preparation of 5-[(1-ethylpiperidin-4-yl)oxy]-N'-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (577 mg) and dimethyl sulfoxide (5 mL), KO t Bu (931 mg) was added thereto at room temperature, and the mixture was stirred for 10 minutes. 5-[(1-ethylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (240 mg) was added thereto, and the mixture was stirred at room temperature for 4 hours. Water was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to obtain the title compound (260 mg). MS (m / z): 265.1 [M+H] +

[0164] [Step 3] Preparation of 3-{5-[(1-ethylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 5-[(1-ethylpiperidin-4-yl)oxy]-N'-hydroxypyridine-2-carboximidamide (260 mg), tetrahydrofuran (5 mL), and DBU (0.22 mL), CDI (239 mg) was added at room temperature and stirred overnight. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make it acidic. The title compound (160 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 291.1 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.44 (d, 1H), 7.91 (d, 1H), 7.65 (dd, 1H), 4.80-4.74 (m, 1H), 4.25-3.8 5 (m, 2H), 3.60-3.00 (m, 2H), 2.88-2.74 (m, 3H), 2.16-2.07 (m, 2H), 1.92-1.82 (m, 2H), 1.15 (t, 3H) Elemental analysis value (C 14 H 18 N 4 O 3 HCl) Calculated values ​​(%) C: 51.46, H: 5.86, N: 17.15 Measured values ​​(%) C: 51.45, H: 6.19, N: 17.21

[0165] Example 31 3-{5-[(1-butylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[(1-butylpiperidin-4-yl)oxy]pyridine-2-carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (1 mL), and diisopropylethylamine (1.08 mL), 1-bromobutane (429 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. Purification by silica gel column chromatography afforded the title compound (190 mg). MS (m / z): 260.1 [M+H] +

[0166] [Step 2] Preparation of 3-{5-[(1-butylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that 5-[(1-butylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (190 mg) obtained in Step 1 of Example 31 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (220 mg) was obtained. MS (m / z): 319.1 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.49 (d, 1H), 7.96 (d, 1H), 7.72 (dd, 1H), 5.10-4.70 (br, 1H), 3.65-3.20 (m , 4H), 3.05 (t, 2H), 2.30-2.18 (m, 2H), 2.14-1.95 (m, 2H), 1.74-1.65 (m, 2H), 1.31 (dt, 2H), 0.92 (t, 3H) Elemental analysis value (C 16 H 22 N 4 O 3 HCl 1H 2 Calculated values ​​(%): C: 51.54, H: 6.76, N: 15.03 Measured values ​​(%): C: 51.24, H: 7.00, N: 14.97

[0167] Example 32 3-{5-[(1-pentylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[(1-pentylpiperidin-4-yl)oxy]pyridine-2-carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (400 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.86 mL), 1-bromopentane (504 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. Purification by silica gel column chromatography afforded the title compound (300 mg). MS (m / z): 274.2 [M+H] +

[0168] [Step 2] Preparation of 3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that 5-[(1-pentylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (300 mg) obtained in Step 1 of Example 32 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (280 mg) was obtained. MS (m / z): 333.1 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 10.50 (br, 1H), 8.50 (d, 1H), 7.96 (d, 1H), 7.72 (dd, 1H), 5.02-4.98 (br, 1H), 4.85-4.73 (m, 1H), 3.60-3.32 (m, 4H), 3.18-2.97 (m, 4H), 2.34-1.92 (m, 2H), 1.76-1.65 (m, 2H), 1.38-1.24 (m, 4H), 0.89 (t, 3H) Elemental analysis value (C 17 H 24 N 4 O 3 HCl 0.3H 2 Calculated values ​​(%) C: 54.56, H: 6.89, N: 14.97 Measured values ​​(%) C: 54.51, H: 6.97, N: 15.02

[0169] Example 33 3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridine-2-carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (1 mL), and diisopropylethylamine (1.08 mL), (bromomethyl)cyclobutane (466 mg) was added and heated with stirring at 80° C. for 3 hours. Purification by silica gel column chromatography gave the title compound (113 mg). MS (m / z): 272.1 [M+H] +

[0170] [Step 2] Preparation of 3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Step 2 and Step 3 of Example 1, except that 5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridine-2-carbonitrile (113 mg) obtained in Step 1 of Example 33 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (90 mg) was obtained. MS (m / z): 331.0 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.49 (d, 1H), 7.96 (d, 1H), 7.71 (dd, 1H), 5.10-4.70 (br, 1H), 3.62-3.20 (m, 4H), 3.14 (d, 2H), 2.86-2.72 (m, 1H), 2.30-1.55 (m, 11H) Elemental analysis value (C 17 H 22 N 4 O 3 HCl 0.5H 2 Calculated values ​​(%): C: 54.33, H: 6.44, N: 14.91 Measured values ​​(%): C: 53.99, H: 6.45, N: 14.90

[0171] Example 34 3-(5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Preparation of 5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridine-2-carbonitrile To a mixture of [1-(propan-2-yl)piperidin-4-yl]methanol (386 mg) and N,N-dimethylformamide (3 mL), sodium hydride (60%, dispersed in liquid paraffin, 98 mg) was added sequentially at room temperature, and the mixture was stirred for 15 minutes. 5-Fluoropyridine-2-carbonitrile (200 mg) was added and the mixture was stirred overnight. Water was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to obtain the title compound (300 mg). MS (m / z): 260.1 [M+H] +

[0172] [Step 2] Preparation of N'-hydroxy-5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (460 mg) and dimethyl sulfoxide (5 mL), KO t Bu (649 mg) was added thereto at room temperature, and the mixture was stirred for 10 minutes. 5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridine-2-carbonitrile (300 mg) was added thereto, and the mixture was stirred at room temperature for 4 hours. Water was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to obtain the title compound (280 mg). MS (m / z): 293.2 [M+H] +

[0173] [Step 3] Preparation of 3-(5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of N'-hydroxy-5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridine-2-carboximidamide (280 mg), tetrahydrofuran (5 mL), and DBU (0.172 mL), CDI (202 mg) was added at room temperature, and the mixture was stirred overnight. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make it acidic. The title compound (250 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 319.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.33 (d, 1H), 7.82 (d, 1H), 7.49 (dd, 1H), 4.15-4.00 (br, 1H), 4.00 ( d, 2H), 3.30-3.00 (m, 4H), 2.70-2.55 (m, 2H), 2.00-1.85 (m, 3H), 1.51-1.41 (m, 2H), 1.12 (d, 6H) Elemental analysis value (C 16 H 22 N 4 O 3 ・0.3H 2 Calculated values ​​(%) C: 59.35, H: 7.04, N: 17.30 Measured values ​​(%) C: 59.11, H: 7.10, N: 17.27

[0174] Example 35 3-{5-[(1-butylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), water (2.15 mL), and diisopropylethylamine (0.37 mL), 1-bromobutane (0.138 mL) was added sequentially at room temperature, and the mixture was heated and stirred at 80°C for 4 hours. The reaction solution was purified by silica gel column chromatography to give the title compound (13 mg). MS (m / z): 333.1 [M+H] +

[0175] Example 36 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14 and N,N-dimethylformamide (1 mL), (bromomethyl)cyclopropane (290 mg), tetrabutylammonium iodide (232 mg), and 10 M aqueous sodium hydroxide solution (0.13 mL) were added, and the mixture was heated and stirred at 80° C. for 3 hours. Hydrochloric acid was added dropwise to acidify the mixture. The title compound (30 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 331.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.40 (d, 1H), 7.89 (d, 1H), 7.57 (dd, 1H), 4.04 (d, 2H), 3.45 (d, 1H), 2.85-2.75 (m, 3H), 2.10-1.85 (m, 3H), 1.65 (dd, 2H), 1.25 (dd, 2H), 1.10-1.00 (m, 1H), 0.64-0.55 (m, 2H), 0.35-0.27 (m, 2H)

[0176] Example 37 3-{5-[(1-benzylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (30 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (0.43 mL), water (0.43 mL), and diisopropylethylamine (0.074 mL), bromomethylbenzene (15 mg) was added and stirred at room temperature for 2 hours. Purification by silica gel column chromatography afforded the title compound (7 mg). MS (m / z): 367.3 [M+H] +

[0177] Example 38 3-[5-({1-[(2-ethylphenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), water (2.15 mL), and diisopropylethylamine (0.372 mL), 1-(bromomethyl)-2-ethylbenzene (90 mg) was added and stirred at room temperature overnight. Purification by silica gel column chromatography afforded the title compound (67 mg). MS (m / z): 395.1 [M+H] +

[0178] Example 39 3-{5-[(1-{[2-(trifluoromethyl)phenyl]methyl}piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), water (2.15 mL), and diisopropylethylamine (0.372 mL), 1-(bromomethyl)-2-(trifluoromethyl)benzene (108 mg) was added and stirred at room temperature overnight. Purification by silica gel column chromatography gave the title compound (102 mg). MS (m / z): 435.0 [M+H] +

[0179] Example 40 3-[5-({1-[(3-fluorophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), water (2.15 mL), and diisopropylethylamine (0.37 mL), 1-(bromomethyl)-3-fluorobenzene (85 mg) was added and stirred at room temperature for 2 hours. Purification by silica gel column chromatography afforded the title compound (22 mg). MS (m / z): 385.0 [M+H] +

[0180] Example 41 3-[5-({1-[(3-bromophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (120 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (1.72 mL), water (1.72 mL), and diisopropylethylamine (0.30 mL), 1-bromo-3-(bromomethyl)benzene (90 mg) was added and stirred at room temperature for 2 hours. Purification by silica gel column chromatography gave the title compound (24 mg). MS (m / z): 445.2 [M+H] +

[0181] Example 42 3-{5-[(1-acetylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (1 mL), acetic acid (25 mg), and diisopropylethylamine (0.27 mL), HATU (146 mg) was added and stirred at room temperature for 45 minutes. Purification by silica gel column chromatography afforded the title compound (59 mg). MS (m / z): 319.2 [M+H] +

[0182] Example 43 3-{5-[(1-propanoylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (1 mL), propionic acid (46 mg), and diisopropylethylamine (0.40 mL), HATU (219 mg) was added and stirred at room temperature for 45 minutes. Purification by silica gel column chromatography afforded the title compound (99 mg). MS (m / z): 333.2 [M+H] +

[0183] Example 44 Methyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (0.57 mL), and diisopropylethylamine (0.24 mL), methyl carbonochloridate (0.022 mL) was added and the mixture was stirred at room temperature for 1 hour. Hydrochloric acid was added, and the precipitate was collected by filtration and dried to obtain the title compound (61 mg). MS (m / z): 335.2 [M+H] + Elemental analysis value (C 15 H 18 N 4 O 5 Calculated values ​​(%) C: 53.89, H: 5.43, N: 16.76 Measured values ​​(%) C: 53.88, H: 5.38, N: 16.82

[0184] Example 45 Propan-2-yl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (0.57 mL), and diisopropylethylamine (0.24 mL), propan-2-yl carbonochloridate (0.039 mL) was added successively at room temperature, and the mixture was stirred for 15 minutes. 2M hydrochloric acid was added, and the mixture was diluted with water. The precipitate was collected by filtration and dried to obtain the title compound (69 mg). MS (m / z): 363.3 [M+H] + Elemental analysis value (C 17 H 22 N 4 O 5 Calculated values ​​(%) C: 56.35, H: 6.12, N: 15.46 Measured values ​​(%) C: 56.13, H: 6.28, N: 15.31

[0185] Example 46 Methyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate [Step 1] Preparation of methyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate To a mixture of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride (220 mg) obtained in Step 2 of Example 6, dichloromethane (2.4 mL), and diisopropylethylamine (0.62 mL), methyl carbonochloridate (0.067 mL) was added and stirred for 2 hours. Saturated aqueous sodium bicarbonate was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to give the title compound (194 mg). MS (m / z): 291.2 [M+H] +

[0186] [Step 2] Preparation of methyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate By a method similar to Step 2 and Step 3 of Example 1, except that methyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate (194 mg) obtained in Step 1 of Example 46 was used instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (128 mg) was obtained. MS (m / z): 350.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.45 (d, 1H), 7.93 (d, 1H), 7.63 (dd, 1H), 4.28 (t, 2H), 3.58 (s, 3H), 3.40-3.25 (m, 8H), 2.79 (t, 2H) Elemental analysis value (C 15 H 19 N 5 O 5 ・1H 2 Calculated values ​​(%): C: 49.04, H: 5.76, N: 19.06 Measured values ​​(%): C: 49.45, H: 5.64, N: 19.30

[0187] Example 47 Ethyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate [Step 1] Preparation of tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate By a method similar to Steps 2 and 3 of Example 1, using tert-butyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate (3.73 g) obtained in Step 1 of Example 6 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (3.3 g) was obtained. MS (m / z): 392.1 [M+H] +

[0188] [Step 2] Preparation of 3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride Methanol (40 mL), THF (11 mL), and 4M hydrogen chloride in dioxane (22 mL) were added sequentially to tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (3.3 g) at room temperature, and the mixture was stirred overnight. The solvent was evaporated under reduced pressure to give the title compound (2.95 g). MS (m / z): 292.2 [M+H] +

[0189] [Step 3] Preparation of ethyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate. To a mixture of 3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride (100 mg), N,N-dimethylformamide (0.55 mL), and diisopropylethylamine (0.24 mL) was added dropwise ethyl carbonochloridate (0.026 mL) under ice-cooling, followed by stirring at room temperature for 1 hour. Hydrochloric acid was added dropwise to acidify the mixture. The mixture was purified by silica gel column chromatography to give the title compound (64 mg). MS (m / z): 364.1 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.40 (d, 1H), 7.95 (d, 1H), 7.53 (dd, 1H), 4.30 (t, 2H) ), 4.12 (q, 2H), 3.58-3.45 (m, 4H), 2.90 (t, 2H), 2.65-2.55 (m, 4H), 1.25 (t, 3H) Elemental analysis value (C 16 H 21 N 5 O 5 Calculated values ​​(%) C: 52.89, H: 5.83, N: 19.27 Measured values ​​(%) C: 52.85, H: 5.89, N: 19.30

[0190] Example 48 Propyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate The title compound (84 mg) was obtained by a method similar to that of Step 3 of Example 47, except that propyl carbonochloridate (0.031 mL) was used instead of ethyl carbonochloridate. MS (m / z): 378.2 [M+H] +

[0191] Example 49 Propan-2-yl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate The title compound (61 mg) was obtained by a method similar to that of Step 3 of Example 47, except that propan-2-yl carbonochloridate (0.038 mL) was used instead of ethyl carbonochloridate. MS (m / z): 378.2 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.40 (d, 1H), 7.95 (d, 1H), 7.53 (dd, 1H), 4.90-4.80 (m, 1H), 4.3 0 (t, 2H), 3.55-3.45 (m, 4H), 3.35-3.26 (m, 1H), 2.90 (t, 2H), 2.65-2.55 (m, 4H), 1.24 (d, 6H) Elemental analysis value (C 17 H 23 N 5 O 5 Calculated values ​​(%) C: 54.10, H: 6.14, N: 18.56 Measured values ​​(%) C: 53.70, H: 6.13, N: 18.47

[0192] Example 50 Benzyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate The title compound (44 mg) was obtained by a method similar to Step 3 of Example 47, except that benzyl carbonochloridate (0.039 mL) was used instead of ethyl carbonochloridate. MS (m / z): 426.2 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.44 (d, 1H), 7.92 (d, 1H), 7.62 (dd, 1H), 7.40-7.28 (m , 5H), 5.07 (s, 2H), 4.27 (t, 2H), 3.45-3.33 (m, 4H), 2.78 (t, 2H), 2.55-2.45 (m, 4H) Elemental analysis value (C 21 H 23 N 5 O 5 ・0.5H 2 Calculated values ​​(%): C: 58.06, H: 5.57, N: 16.12 Measured values ​​(%): C: 57.88, H: 5.49, N: 15.86

[0193] Example 51 3-{5-[3-(azepan-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of hydroxylamine hydrochloride (4.43 g) and ethanol (50 mL), 2M aqueous sodium hydroxide solution (28.4 mL) was added and the mixture was stirred at room temperature for 10 minutes. 5-Fluoropyridine-2-carbonitrile (4.95 g) was added to the reaction mixture, and the mixture was stirred at room temperature overnight. Water was added to the reaction mixture, and the resulting precipitate was collected by filtration and dried to obtain a crude product (6.2 g). Tetrahydrofuran (50 mL), DBU (8.9 mL), and CDI (9.7 g) were added to the crude product at room temperature, and the mixture was stirred for 5 hours. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make the mixture acidic. The precipitate was collected by filtration and dried to give the title compound (6.3 g). MS (m / z): 182.1 [M+H] +

[0194] [Step 2] Preparation of 3-[5-(3-hydroxypropoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one A mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (7 g), propane-1,3-diol (8.82 g), and 1-methylpyrrolidin-2-one (70 mL) was added to KO tBu (8.67 g) was added, and the mixture was heated and stirred at 60° C. for 3 hours. The reaction mixture was neutralized with hydrochloric acid under ice cooling, and purified by silica gel column chromatography to obtain the title compound (3.5 g). MS (m / z): 238.1 [M+H] +

[0195] [Step 3] Preparation of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate. 4-Methylbenzenesulfonyl 4-methylbenzene-1-sulfonate (6.19 g) was added to a mixture of 3-[5-(3-hydroxypropoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (3.0 g), pyridine (3.07 mL), and dichloromethane (100 mL) under ice-cooling, and the mixture was stirred at room temperature for 3 hours. A saturated aqueous solution of ammonium chloride was added to the reaction mixture under ice-cooling, diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography to obtain the title compound (1.9 g). MS (m / z): 392.1 [M+H] +

[0196] [Step 4] Preparation of 3-{5-[4-(azepan-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride. Azepane (61 mg) was added to a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) and N,N-dimethylformamide (1 mL), and the mixture was heated and stirred at 80°C for 3 hours. Hydrochloric acid was added dropwise to the reaction mixture to make it acidic. The title compound (35 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 319.3 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.32 (d, 1H), 7.79 (d, 1H), 7.46 (dd, 1H), 4 .15 (t, 2H), 3.00-2.88 (m, 4H), 2.04-1.94 (m, 2H), 1.75-1.52 (m, 10H)

[0197] Example 52 3-{5-[2-(azepan-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step 1] Preparation of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate According to a method similar to Steps 1, 2, and 3 of Example 51, except that ethane-1,2-diol (3.4 g) was used instead of propane-1,3-diol, the title compound (1.02 g) was obtained. MS (m / z): 378.3 [M+H] +

[0198] [Step 2] Preparation of 3-{5-[2-(azepan-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate. Azepane (16 mg) was added to a mixture of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (30 mg), N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.041 mL), and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (121 mg) was added dropwise to the reaction mixture to acidify it. The mixture was purified by silica gel column chromatography to give the title compound (27 mg). MS (m / z): 305.1 [M+H] + 1H-NMR (400MHz, MeOH-d4) δ: 8.44 (br, 1H), 7.92 (br, 1H), 7.68 (d, 2H), 7.54 (d, 1H), 7.21 (d, 2H), 4.51 (t, 2H), 3.68 (t, 2H), 3.50-3.45 (m, 4H), 2.35 (s, 3H), 1.98-1.91 (m, 4H), 1.77-1.72 (m, 4H)

[0199] Example 53 3-{5-[2-(4-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (45 mg) obtained in Step 1 of Example 52. To a mixture of diisopropylethylamine (0.062 mL), and N,N-dimethylformamide (0.5 mL), 4-methoxypiperidine (41 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (181 mg) was added dropwise to neutralize the mixture. The mixture was purified by silica gel column chromatography to obtain the title compound (10 mg). MS (m / z): 321.1 [M+H] +

[0200] Example 54 3-{5-[2-(3-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 52, N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.069 mL) were mixed with 3-methoxypiperidine (31 mg) and heated with stirring at 80°C for 3 hours. Hydrochloric acid was added to the reaction mixture to neutralize it. Purification by silica gel column chromatography afforded the title compound (6 mg). MS (m / z): 321.1 [M+H] +

[0201] Example 55 3-[5-(2-{7-azaspiro[4.5]decan-7-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 52, diisopropylethylamine (0.069 mL), and N,N-dimethylformamide (0.2 mL) were mixed with 7-azaspiro[4.5]decane (37 mg) and heated with stirring at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (101 mg) was added dropwise to the mixture to neutralize it. The mixture was purified by silica gel column chromatography to obtain the title compound (23 mg). MS (m / z): 345.1 [M+H] +

[0202] Example 56 3-[5-(2-{9-oxa-2-azaspiro[5.5]undecan-2-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (45 mg) obtained in Step 1 of Example 52, diisopropylethylamine (0.062 mL), and N,N-dimethylformamide (0.5 mL) were mixed with 9-oxa-2-azaspiro[5.5]undecane (56 mg) and heated with stirring at 80° C. for 3 hours. The mixture was neutralized by dropwise addition of an aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (181 mg). The product was purified by silica gel column chromatography to give the title compound (12 mg). MS (m / z): 361.2 [M+H] +

[0203] Example 57 tert-Butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate To a mixture of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (200 mg) obtained in Step 1 of Example 52, diisopropylethylamine (0.275 mL), and N,N-dimethylformamide (5.3 mL), tert-butyl piperazine-1-carboxylate (197 mg) was added, and the mixture was heated and stirred at 80° C. for 3 hours. The mixture was allowed to cool to room temperature, and acetic acid (0.46 mL) was added dropwise to neutralize. The mixture was purified by silica gel column chromatography to give the title compound (25 mg). MS (m / z): 390.2 [MH] -

[0204] Example 58 3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride To a mixture of tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (19 mg) obtained in Example 57 and tetrahydrofuran (0.5 mL) was added 4 M hydrochloric acid in dioxane (0.24 mL) and stirred overnight. After concentration, 4 M hydrochloric acid (1.15 mL) was added dropwise to the reaction solution and stirred overnight. 12 M hydrochloric acid (0.15 mL) was added dropwise to the reaction solution and stirred for 8 hours. The reaction solution was concentrated, and the resulting residue was washed with diethyl ether and then dried to give the title compound (4 mg). MS (m / z): 292.1 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.52 (d, 1H), 8.01 (d, 1H), 7.64 (dd, 1H), 4.62 (t, 2H), 3.86-3.60 (m, 10H)

[0205] Example 59 3-{5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile To a mixture of 5-hydroxypyridine-2-carbonitrile (100 mg), 2-(chloromethyl)oxirane (154 mg), and acetonitrile (1.5 mL), potassium carbonate (345 mg) was added sequentially at room temperature, and the mixture was heated and stirred at 70°C for 5 hours. Insoluble matter was filtered off and the mixture was concentrated. Water (1 mL) and piperidine (212 mg) were added, and the mixture was stirred at room temperature for 3 hours. Purification by silica gel column chromatography afforded the title compound (90 mg). MS (m / z): 262.3 [M+H] +

[0206] [Step 2] Preparation of 3-{5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method similar to Steps 2 and 3 of Example 7, using 5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile (74 mg) obtained in Step 1 of Example 59 instead of 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile, the title compound (25 mg) was obtained. MS (m / z): 321.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.35 (d, 1H), 7.83 (d, 1H), 7.52 (dd, 1H), 4.16-3.97 (m, 3H), 2.60-2.40 (m, 6H), 1.70-1.35 (m, 6H)

[0207] Example 60 3-{5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of 5-(3-hydroxypropoxy)pyridine-2-carbonitrile Sodium hydride (60%, dispersed in liquid paraffin, 983 mg) was added to a mixture of propane-1,3-diol (5.6 g) and N,N-dimethylformamide (5 mL), and the mixture was stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (3 g) was added, and the mixture was stirred overnight. Water was added to the reaction mixture under ice-cooling, and the mixture was purified by silica gel column chromatography to obtain the title compound (1.8 g). MS (m / z): 179.2 [M+H] +

[0208] [Step 2] Preparation of 3-[(6-cyanopyridin-3-yl)oxy]propyl 4-methylbenzene-1-sulfonate 4-Methylbenzene-1-sulfonyl chloride (642 mg) was added to a mixture of 5-(3-hydroxypropoxy)pyridine-2-carbonitrile (400 mg) and pyridine (1 mL), and the mixture was stirred at room temperature for 1 hour. Hexane was added to the reaction mixture, and the precipitate was collected by filtration and dried to give the title compound (690 mg). MS (m / z): 333.2 [M+H] +

[0209] [Step 3] Preparation of 5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridine-2-carbonitrile Piperidin-4-ol (170 mg) was added to a mixture of 3-[(6-cyanopyridin-3-yl)oxy]propyl 4-methylbenzene-1-sulfonate (186 mg), N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.291 mL), and the mixture was heated and stirred at 80°C for 2 hours. Purification by silica gel column chromatography afforded the title compound (98 mg). MS (m / z): 262.3 (M+H) +

[0210] [Step 4] Preparation of 3-{5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride

[0111] By a method similar to Steps 2 and 3 of Example 7, using 5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridine-2-carbonitrile (98 mg) obtained in Step 3 of Example 60 instead of 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile, the title compound (25 mg) was obtained. MS (m / z): 321.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.34 (d, 1H), 7.84 (d, 1H), 7.50 (dd, 1H), 4.69 (br, 1H), 4.17 (t, 2H), 3.60-3.45 (m, 1H) , 2.98-2.86 (m, 2H), 2.72-2.62 (m, 2H), 2.35-2.45 (m, 2H), 2.20-1.85 (m, 2H), 1.84-1.54 (m, 2H), 1.54-1.50 (m, 2H)

[0211] Example 61 3-{5-[3-(3-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride The procedure of Example 60 was repeated except that piperidin-3-ol (170 mg) was used instead of piperidin-4-ol to obtain the title compound (15 mg). MS (m / z): 321.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 9.59 (br, 1H), 8.38 (d, 1H), 7.88 (d, 1H), 7.55 (dd, 1H), 4.76 (br, 1H), 4.17 (t, 2H), 3 .60-3.40 (m, 2H), 2.95-2.88 (m, 1H), 2.80-2.72 (m, 1H), 2.70-2.55 (m, 2H) 2.00-1.88 (m, 2H), 1.80-1.38 (m, 4H)

[0212] Example 62 3-{5-[3-(morpholin-4-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride The title compound (35 mg) was obtained by the same method as in Example 60, except that morpholine (380 mg) was used instead of piperidin-4-ol. MS (m / z): 307.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.42 (d, 1H), 7.92 (d, 1H), 7.59 (dd, 1H), 4.19 (t, 2H), 3.62-3.56 (m, 4H), 2.47 (t, 2H), 2.43-2.36 (m, 4H), 1.93 (dt, 2H) Elemental analysis value (C 14 H 18 N 4 O 4 HCl) Calculated values ​​(%) C: 49.06, H: 5.59, N: 16.35 Measured values ​​(%) C: 49.38, H: 5.76, N: 16.55

[0213] Example 63 3-{5-[3-(1,2,3,6-tetrahydropyridin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride According to the method similar to Example 60, except that 1,2,3,6-tetrahydropyridine (140 mg) was used instead of piperidin-4-ol, the title compound (55 mg) was obtained. MS (m / z): 303.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.39 (d, 1H), 7.88 (d, 1H), 7.56 (dd, 1H), 5.77-5.64 (m, 2H), 4.19 (t, 2H), 3.07-3.02 (m, 2H), 2.69-2.58 (m, 4H), 2.16-2.09 (m, 2H), 2.03-1.93 (m, 2H)

[0214] Example 64 3-[5-(3-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride According to the method similar to Example 60, except that 1,4-dioxa-8-azaspiro[4.5]decane (600 mg) was used instead of piperidin-4-ol, the title compound (13 mg) was obtained. MS (m / z): 363.3 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.33 (br, 1H), 7.85 (br, 1H), 7.45 (br, 1H), 4.25-4.14 ( m, 2H), 4.00-3.94 (m, 4H), 3.25-2.85 (m, 6H), 2.30-2.08 (m, 2H), 1.90-1.80 (m, 4H)

[0215] Example 65 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperidin-4-one 4-methylbenzene-1-sulfonate To a mixture of 3-[5-(3-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Example 64 and water (5 mL), 4-methylbenzene-1-sulfonic acid hydrate (95 mg) was added and stirred overnight at room temperature. The residue obtained after concentration was purified by silica gel column chromatography to give the title compound (70 mg). MS (m / z): 319.0 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.39 (br, 1H), 7.93 (d, 1H), 7.69 (d, 2H), 7.51 (d, 1H), 7.23 (d, 2H), 4.9 5-4.85 (m, 2H), 4.24 (t, 2H), 3.44-3.20 (m, 6H), 2.36 (s, 3H), 2.34-2.22 (m, 2H), 2.10-1.92 (m, 2H)

[0216] Example 66 3-{5-[3-(3-fluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (100 mg) obtained in Step 3 of Example 51. To a mixture of potassium carbonate (177 mg) and N,N-dimethylformamide (1 mL), 3-fluoropiperidine hydrochloride (107 mg) was added and heated with stirring at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (243 mg) was added dropwise to the reaction mixture to neutralize it. Purification by silica gel column chromatography afforded the title compound (29 mg). MS (m / z): 323.0 [M+H] +

[0217] Example 67 3-{5-[3-(4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and sodium iodide (92 mg), 4-methylpiperidine (61 mg) was added and heated with stirring at 80°C overnight. 2M hydrochloric acid was added dropwise to the reaction mixture to make it acidic. Purification by silica gel column chromatography gave the title compound (12 mg). MS (m / z): 319.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.34 (d, 1H), 7.84 (d, 1H), 7.51 (dd, 2H), 7.19-7.02 (m, 3H), 4.16 (t, 2H), 3.03 (d, 2H) ), 2.66 (t, 2H), 2.21 (t, 2H), 2.02-1.92 (m, 2H), 1.64 (d, 2H), 1.48-1.34 (m, 1H), 1.27-1.13 (m, 2H), 0.89 (d, 3H)

[0218] Example 68 3-{5-[3-(4-methoxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and sodium iodide (92 mg), 4-methoxypiperidine (71 mg) was added and heated with stirring at 80°C overnight. 2M hydrochloric acid was added dropwise to the reaction mixture to make it acidic. Purification by silica gel column chromatography gave the title compound (12 mg). MS (m / z): 335.0 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.35 (d, 1H), 7.85 (d, 1H), 7.52 (dd, 1H), 4.16 (t, 2H), 3.22 (s , 3H), 2.85-2.75 (m, 2H), 2.58 (t, 2H), 2.29 (t, 2H), 1.98-1.80 (m, 5H), 1.54-1.44 (m, 2H)

[0219] Example 69 3-(5-{3-[(trans)3,4-dihydroxypiperidin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (15 mg) obtained in Step 3 of Example 51, sodium iodide (11 mg), and N,N-dimethylformamide (0.3 mL), trans-piperidine-3,4-diol (9 mg) was added, and the mixture was heated and stirred at 100°C for 1 hour. Hydrochloric acid was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to give the title compound (10 mg). MS (m / z): 337.2 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.34 (br, 1H), 7.85 (d, 1H), 7.52 (dd, 1H), 4.85-4.65 (m, 2H), 4.15 (t, 2H), 2.50-2.40 (m, 1H), 2.90-2.75 (m, 2H), 2.08-1.70 (m, 6H), 1.44-1.32 (m, 1H)

[0220] Example 70 3-{5-[3-(4,4-difluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51 and N,N-dimethylformamide (1 mL), 4,4-difluoropiperidine (74 mg) was added and heated with stirring at 80°C for 3 hours. Hydrochloric acid was added dropwise to the reaction mixture to make it acidic. Purification by silica gel column chromatography gave the title compound (25 mg). MS (m / z): 341.0 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.32 (d, 1H), 7.82 (d, 1H), 7.49 (dd, 1H), 4.14 (t, 2H), 2.50-2.42 (m, 6H), 2.00-1.84 (m, 6H)

[0221] Example 71 3-{5-[3-(4-fluoro-4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (47 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and potassium carbonate (50 mg), 4-fluoro-4-methylpiperidine hydrochloride (56 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (180 mg) was added dropwise to the reaction mixture to acidify it. Purification by silica gel column chromatography afforded the title compound (14 mg). MS (m / z): 337.3 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.44 (s, 1H), 7.97 (d, 1H), 7.62 (d, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.24 (t, 2H), 3.25-2.94 (m, 6H), 2.29 (s, 3H), 2.20-1.75 (m, 6H), 1.40 (d, 3H)

[0222] Example 72 3-{5-[3-(4-acetylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1.3 mL), and diisopropylethylamine (0.066 mL), 1-(piperazin-1-yl)ethan-1-one (33 mg) was added and heated with stirring at 80° C. for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (194 mg) was added dropwise to the reaction solution at room temperature to make it acidic. The residue was purified by silica gel column chromatography to give the title compound (9 mg). MS (m / z): 348.1 [M+H] +1 H-NMR (400MHz, MeOH-d4) δ: 8.40 (d, 1H), 7.97 (d, 1H), 7.70 (d, 2H), 7.53 (dd, 1H), 7.23 (d, 2H), 4.27 (t, 2H), 4.00-3.65 (m, 2H), 3.42-3.18 (m, 8H), 2.36 (s, 3H), 2.34-2.23 (m, 2H), 2.15 (s, 3H)

[0223] Example 73 Methyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate [Step 1] Preparation of tert-butyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1.3 mL), and diisopropylethylamine (0.066 mL) was added tert-butyl Piperazine-1-carboxylate (48 mg) was added and the mixture was heated and stirred at 80° C. for 3 hours. 2M hydrochloric acid was added dropwise to the reaction mixture at room temperature to make it acidic. The mixture was purified by silica gel column chromatography to give the title compound (10 mg). MS (m / z): 406.2 [M+H] +

[0224] [Step 2] Preparation of 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride To a mixture of tert-butyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate (10 mg) and tetrahydrofuran (1 mL), 4M hydrogen chloride in dioxane (0.031 mL) was added at room temperature and stirred for 15 hours. 4M hydrogen chloride in dioxane (0.031 mL) and methanol (0.5 mL) were added, and the mixture was heated and stirred at 50°C for 3 hours. 4M hydrogen chloride in dioxane (0.031 mL) was added, and the mixture was heated and stirred at 50°C for 2 hours. The solvent was evaporated under reduced pressure, and the resulting precipitate was washed with diethyl ether and dried to give the title compound (10 mg). MS (m / z): 306.1 [M+H] +

[0225] [Step 3] Preparation of methyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate To a mixture of 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride (9 mg), N,N-dimethylformamide (0.48 mL), and diisopropylethylamine (0.02 mL) was added methyl carbonochloridate (0.0018 mL) successively at room temperature, followed by stirring for 1 hour. To the reaction mixture was added dropwise an aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (36 mg) to acidify it. The mixture was purified by silica gel column chromatography to obtain the title compound (3 mg). MS (m / z): 364.3 [M+H] +

[0226] Example 74 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (300 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (7.7 mL), and diisopropylethylamine (0.40 mL), tert-butyl piperazine-1-carboxylate (286 mg) was added and heated with stirring at 80°C for 3 hours. Acetic acid (0.66 mL) was added dropwise to the reaction solution to neutralize it. The crude product was obtained by purification by silica gel column chromatography. This crude product was dissolved in tetrahydrofuran (0.94 mL), and 4M hydrochloric acid in dioxane (0.59 mL) was added, followed by stirring overnight at room temperature. The reaction mixture was concentrated, and the resulting residue was washed with diethyl ether. Purification by silica gel column chromatography afforded the title compound (29 mg). MS (m / z): 306.2 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.38 (d, 1H), 7.95 (d, 1H), 7.70 (d, 2H), 7.51 (dd, 1H), 7.23 (d , 2H), 4.22 (t, 2H), 3.25-3.18 (m, 4H), 2.85-2.60 (m, 6H), 2.36 (s, 3H), 2.10-2.00 (m, 2H)

[0227] Example 75: 3-{5-[3-(4-benzylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate. To a mixture of 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate (24 mg) obtained in Example 74, N,N-dimethylformamide (0.25 mL), water (0.25 mL), and diisopropylethylamine (0.043 mL), bromomethylbenzene (9 mg) was added and stirred at room temperature for 3 hours. Purification was performed by silica gel column chromatography. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (1.6 mg) was added and the mixture was concentrated to give the title compound (9 mg). MS (m / z): 396.2 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.37 (d, 1H), 7.93 (d, 1H), 7.69 (d, 2H), 7.49 (dd, 1H), 7.45-7.32 (m, 5H), 7.21 (d, 2H), 4.22 (t, 2H), 3.86 (s, 2H), 3.25-2.75 (m, 10H), 2.35 (s, 3H), 2.23-2.14 (m, 2H)

[0228] Example 76 3-[5-(3-{3-azabicyclo[3.1.0]hexan-3-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.177 mL), 3-azabicyclo[3.1.0]hexane hydrochloride (73 mg) was added, and the mixture was heated and stirred at 80°C for 5 hours. 2M hydrochloric acid was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to give the title compound (30 mg). MS (m / z): 303.2 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.37 (d, 1H), 7.88 (d, 1H), 7.54 (dd, 1H), 4.15 (t, 2H), 3.05 (d, 2H), 2.6 7 (t, 2H), 2.52-2.38 (m, 2H), 1.90 (dt, 2H), 1.42-1.36 (m, 2H), 0.60-0.55 (m, 1H), 0.39-0.32 (m, 1H)

[0229] Example 77 3-[5-(3-{octahydrocyclopenta[c]pyrrol-2-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride Octahydrocyclopenta[c]pyrrole (68 mg) was added to a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and sodium iodide (92 mg), and the mixture was heated and stirred at 80°C overnight. 2M hydrochloric acid was added dropwise to the reaction mixture to acidify it. The mixture was purified by silica gel column chromatography to give the title compound (12 mg). MS (m / z): 331.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.30 (d, 1H), 7.80 (d, 1H), 7.45 (dd, 1H), 4.16 (t, 2H), 3.0-2.86 (m, 2H) ), 2.78-2.67 (m, 2H), 2.64-2.54 (m, 2H), 2.40-2.30 (m, 2H), 1.98-1.92 (m, 2H), 1.65-1.34 (m, 6H)

[0230] Example 78 3-[5-(3-{7-azaspiro[4.5]decan-7-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (100 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (0.2 mL), and diisopropylethylamine (0.13 mL), 7-azaspiro[4.5]decane (53 mg) was added and heated with stirring at 80° C. for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (243 mg) was added dropwise to the reaction mixture to make it acidic. The product was purified by silica gel column chromatography to give the title compound (35 mg). MS (m / z): 359.2 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.34 (d, 1H), 7.86 (d, 1H), 7.69 (d, 2H), 7.44 (dd, 1H), 7.22 (d, 2H), 4.2 1 (t, 2H), 3.50-2.29 (m, 6H), 2.35 (s, 3H), 2.35-2.24 (m, 2H), 1.94-1.84 (m, 2H), 1.75-1.45 (m, 10H)

[0231] Example 79 3-[5-(3-{2-oxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt 2-Oxa-8-azaspiro[4.5]decane (87 mg) was added to a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, sodium iodide (92 mg), diisopropylethylamine (0.11 mL), and N,N-dimethylformamide (0.5 mL), and the mixture was heated and stirred at 80° C. for 3 hours. The reaction mixture was acidified with an aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (194 mg). The mixture was purified by silica gel column chromatography to give the title compound (8 mg). MS (m / z): 361.3 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.35 (d, 1H), 7.86 (d, 1H), 7.68 (dd, 2H), 7.44 (dd, 1H), 7.22 (d, 2H), 4.22 ( t, 2H), 3.88 (t, 2H), 3.59 (s, 2H), 3.38-3.25 (m, 6H), 2.35 (s, 3H), 2.35-2.25 (m, 2H), 1.92-1.82 (m, 6H)

[0232] Example 80 3-[5-(3-{9-oxa-2-azaspiro[5.5]undecan-2-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (47 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.062 mL), 9-oxa-2-azaspiro[5.5]undecane (56 mg) was added and heated with stirring at 80° C. for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (180 mg) was added dropwise to the reaction mixture to make it acidic. The product was purified by silica gel column chromatography to give the title compound (22 mg). MS (m / z): 375.4 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.43 (s, 1H), 7.95 (d, 1H), 7.60 (dd, 1H), 7.49 (d, 2H), 7.09 (d, 2H), 4.2 5 (t, 2H), 3.35-3.15 (m, 2H), 3.65-3.48 (m, 6H), 2.28 (s, 3H), 2.25-2.13 (m, 2H), 1.82-1.30 (m, 10H)

[0233] Example 81 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)pyridin-1-ium 4-methylbenzene-1-sulfonate Pyridine (0.3 mL) was added to a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (170 mg) obtained in Step 3 of Example 51, sodium iodide (130 mg), and N,N-dimethylformamide (0.3 mL), and the mixture was heated and stirred at 100°C for 1 hour. Hydrochloric acid was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to give the title compound (40 mg). MS (m / z): 299.2 [M] +1 H-NMR (400MHz, DMSO-d6) δ: 9.15 (d, 2H), 8.63 (t, 1H), 8.17 (t, 2H), 8.06 (d, 1H), 7.74 (d, 1H), 7 .48 (d, 2H), 7.32 (d, 1H), 7.11 (d, 2H), 4.82 (t, 2H), 4.21 (t, 2H), 2.48-2.42 (m, 2H), 2.29 (s, 3H)

[0234] Example 82 3-{5-[(5-methyl-1,3-oxazol-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one obtained in Step 1 of Example 51 (50 mg), (5-methyl-1,3-oxazol-4-yl)methanol (62 mg), and 1-methylpyrrolidin-2-one (0.9 mL) was added KO. t Bu (62 mg) was added, and the mixture was heated and stirred at 60°C for 2 hours and then at 80°C for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (420 mg) was added dropwise to the reaction mixture at room temperature to make it acidic. The mixture was purified by silica gel column chromatography to obtain the title compound (2 mg). MS (m / z): 275.1 [M+H] +

[0235] Example 83 3-{5-[(1,3-thiazol-2-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one A mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one obtained in Step 1 of Example 51 (50 mg), (1,3-thiazol-2-yl)methanol (79 mg), and 1-methylpyrrolidin-2-one (0.9 mL) was added to KO. t Bu (77 mg) was added, and the mixture was heated and stirred at 60°C for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (420 mg) was added dropwise to the reaction mixture at room temperature to make it acidic. The mixture was purified by silica gel column chromatography to give the title compound (6 mg). MS (m / z): 277.0 [M+H] +

[0236] Example 84 3-{5-[3-(pyridin-3-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one The procedure of Example 83 was repeated, except that 3-(pyridin-3-yl)propan-1-ol (57 mg) was used instead of (1,3-thiazol-2-yl)methanol, to obtain the title compound (7 mg). MS (m / z): 299.0 [M+H] +

[0237] Example 85 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperidin-2-one A mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (50 mg) obtained in Step 1 of Example 51, 1-(3-hydroxypropyl)piperidin-2-one (87 mg), and 1-methylpyrrolidin-2-one (0.1 mL) was diluted with KO. t Bu (62 mg) was added, and the mixture was heated and stirred at 60° C. for 3 hours. Hydrochloric acid was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to obtain the title compound (45 mg). MS (m / z): 319.1 [M+H] +

[0238] Example 86 3-{5-[2-methyl-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to the method similar to Example 83, using 2-methyl-3-(piperidin-1-yl)propan-1-ol (87 mg) instead of (1,3-thiazol-2-yl)methanol, the title compound (83 mg) was obtained. MS (m / z): 319.1 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.44 (d, 1H), 7.98 (d, 1H), 7.61 (dd, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.14-4.06 (m , 2H), 3.50-3.26 (m, 2H), 3.24-3.16 (m, 2H), 3.08-3.00 (m, 2H), 2.29 (s, 3H), 1.95-1.22 (m, 7H), 1.11 (d, 3H)

[0239] Example 87 3-{5-[2-(dimethylamino)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to the method similar to Example 83, except that 2-(dimethylamino)ethan-1-ol (37 mg) was used instead of (1,3-thiazol-2-yl)methanol, the title compound (63 mg) was obtained. MS (m / z): 251.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.48 (d, 1H), 8.00 (d, 1H), 7.67 (dd, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.51 (t, 2H), 3.55 (t, 2H), 2.87 (s, 6H), 2.29 (s, 3H)

[0240] Example 88 3-{5-[3-(dimethylamino)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to the method similar to Example 83, except that 3-(dimethylamino)propan-1-ol (43 mg) was used instead of (1,3-thiazol-2-yl)methanol, the title compound (64 mg) was obtained. MS (m / z): 265.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.44 (d, 1H), 7.97 (d, 1H), 7.61 (dd, 1H), 7.47 (d, 2H), 7 .11 (d, 2H), 4.24 (t, 2H), 3.23 (t, 2H), 2.82 (s, 6H), 2.29 (s, 3H), 2.18-2.10 (m, 2H)

[0241] Example 89 3-{5-[4-(dimethylamino)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to the method similar to Example 83, except that 4-(dimethylamino)butan-1-ol (49 mg) was used instead of (1,3-thiazol-2-yl)methanol, the title compound (53 mg) was obtained. MS (m / z): 279.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 9.21 (br, 1H), 8.44 (d, 1H), 7.96 (d, 1H), 7.61 (dd, 1H), 7.47 (d, 2 H), 7.11 (d, 2H), 4.19 (t, 2H), 3.17-3.18 (m, 2H), 2.79 (s, 6H), 2.29 (s, 3H), 1.83-1.73 (m, 4H)

[0242] Example 90 3-{5-[4-(piperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride

[0112] The title compound (112 mg) was obtained by a method similar to steps 1, 2, and 3 of Example 7, except that 4-(piperidin-1-yl)butan-1-ol (232 mg) was used instead of 3-(piperidin-1-yl)propan-1-ol. MS (m / z): 319.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.31 (d, 1H), 7.79 (d, 1H), 7.40 (dd, 1H), 4.09 (br, 2H), 2.90-2.65 (m, 6H), 1.85-1.34 (m, 10H)

[0243] Example 91 3-{5-[4-(azepan-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step 1] Preparation of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate According to a method similar to Steps 1, 2, and 3 of Example 51, except that butane-1,4-diol (12 g) was used instead of propane-1,3-diol, the title compound (4.89 g) was obtained. MS (m / z): 406.1 [M+H] +

[0244] [Step 2] Preparation of 3-{5-[4-(azepan-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate. Azepane (22 mg) was added to a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (30 mg), N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.038 mL), and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (113 mg) was added dropwise to the reaction mixture to acidify it. The mixture was purified by silica gel column chromatography to give the title compound (26 mg). MS (m / z): 333.2 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.43 (d, 1H), 7.95 (d, 1H), 7.61 (dd, 1H), 7.47 (d, 2H), 7.11 (d, 2 H), 4.22-4.16 (m, 2H), 3.30-3.12 (m, 6H), 2.29 (s, 3H), 1.85-1.72 (m, 8H), 1.66-1.56 (m, 4H)

[0245] Example 92 3-{5-[4-(pyrrolidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91 and N,N-dimethylformamide (0.5 mL), pyrrolidine (26 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (164 mg) was added dropwise to the reaction mixture to acidify it. Purification by silica gel column chromatography afforded the title compound (35 mg). MS (m / z): 305.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.36 (br, 1H), 7.86 (d, 1H), 7.50-7.42 (m, 3H), 7 .12 (d, 2H), 4.11 (br, 2H), 3.30-3.05 (m, 6H), 2.29 (s, 3H), 1.98-1.72 (m, 8H)

[0246] Example 93 3-{5-[4-(3-hydroxypiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.062 mL), piperidin-3-ol (37 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. The reaction mixture was acidified by adding an aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (180 mg). The mixture was purified by silica gel column chromatography to obtain the title compound (1 mg). MS (m / z): 335.1 [M+H] +

[0247] Example 94 3-{5-[4-(morpholin-4-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt Morpholine (37 mg) was added to a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.062 mL), and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (180 mg) was added dropwise to acidify the mixture. The title compound (25 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 321.1 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.38 (d, 1H), 7.95 (d, 1H), 7.70 (d, 2H), 7.51 (dd, 1H), 7.22 (d , 2H), 4.19 (t, 2H), 3.95-3.82 (m, 4H), 3.35-3.17 (m, 6H), 2.36 (s, 3H), 2.00-1.86 (m, 4H)

[0248] Example 95 3-{5-[4-(4-fluoropiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.5 mL), and potassium carbonate (50 mg), 4-fluoropiperidine hydrochloride (51 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (184 mg) was added dropwise to acidify the mixture. Purification by silica gel column chromatography afforded the title compound (23 mg). MS (m / z): 337.2 [M+H] + 1H-NMR (400MHz, MeOH-d4) δ: 8.38 (d, 1H), 7.96 (d, 1H), 7.70 (d, 2H), 7.52 (dd, 1H) ), 7.23 (d, 2H), 4.21 (t, 2H), 3.50-3.16 (m, 7H), 2.36 (s, 3H), 2.30-1.86 (m, 8H)

[0249] Example 96 3-{5-[4-(4,4-dimethylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.5 mL), and potassium carbonate (50 mg), 4,4-dimethylpiperidine hydrochloride (54 mg) was added and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (184 mg) was added dropwise to acidify the mixture. Purification by silica gel column chromatography afforded the title compound (16 mg). MS (m / z): 347.2 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.36 (d, 1H), 7.93 (d, 1H), 7.70 (d, 2H), 7.49 (dd, 1H), 7.22 (d, 2H), 4.18 (t, 2 H), 3.54-3.00 (m, 6H), 3.40-2.90 (m, 6H), 2.36 (s, 3H), 2.04-1.85 (m, 4H), 1.74-1.58 (m, 4H), 1.06 (s.6H)

[0250] Example 97 3-{5-[4-(3-hydroxy-3-methylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 3-Methylpiperidin-3-ol (43 mg) was added to a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.064 mL), and the mixture was heated and stirred at 80°C for 3 hours. Hydrochloric acid was added to the reaction mixture to neutralize it. The title compound (23 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 349.2 [M+H] +

[0251] Example 98 3-[5-(4-{7-azaspiro[4.5]decan-7-yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 7-Azaspiro[4.5]decane (34 mg) was added to a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.2 mL), and diisopropylethylamine (0.064 mL), and the mixture was heated and stirred at 80°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (94 mg) was added dropwise to the mixture to neutralize it. The title compound (23 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 373.2 [M+H] +

[0252] Example 99 3-[5-(4-{9-oxa-2-azaspiro[5.5]undecan-2-yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate salt To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.063 mL), 9-oxa-2-azaspiro[5.5]undecane (56 mg) was added and heated with stirring at 80° C. for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (184 mg) was added dropwise to acidify the mixture. The product was purified by silica gel column chromatography to give the title compound (5 mg). MS (m / z): 389.2 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.36 (br, 1H), 7.91 (br, 1H), 7.70 (d, 2H), 7.46 (dd, 1H), 7.22 ( d, 2H), 4.16 (t, 2H), 3.78-3.59 (m, 4H), 3.40-2.90 (m, 6H) 2.36 (s, 3H), 2.50-1.45 (m, 12H)

[0253] Example 100 Methyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate 4-methylbenzene-1-sulfonate [Step 1] Preparation of tert-butyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91, dimethyl sulfoxide (1 mL), and diisopropylethylamine (0.064 mL), tert-butyl Piperazine-1-carboxylate (46 mg) was added, and the mixture was heated and stirred at 80°C for 3 hours. 2M hydrochloric acid was added dropwise to the reaction mixture at room temperature to make it acidic. The mixture was purified by silica gel column chromatography to give the title compound (13 mg). MS (m / z): 418.3 [M-H] -

[0254] [Step 2] Preparation of 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride To a mixture of tert-butyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate (13 mg) and tetrahydrofuran (1 mL), 4M hydrogen chloride in dioxane (0.039 mL) was added at room temperature and stirred for 15 hours. 4M hydrogen chloride in dioxane (0.039 mL) and methanol (0.5 mL) were added, and the mixture was heated and stirred at 50°C for 3 hours. 4M hydrogen chloride in dioxane (0.039 mL) was added, and the mixture was heated and stirred at 50°C for 2 hours. The solvent was evaporated under reduced pressure, and the resulting precipitate was collected by filtration with diethyl ether and dried to give the title compound (14 mg). MS (m / z): 320.1 [M+H] +

[0255] [Step 3] Preparation of methyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate 4-methylbenzene-1-sulfonate To a mixture of 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride (11 mg), N,N-dimethylformamide (0.31 mL), and diisopropylethylamine (0.026 mL), methyl carbonochloridate (0.0024 mL) was added successively at room temperature, and the mixture was stirred for 1 hour. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (47 mg) was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to obtain the title compound (2 mg). MS (m / z): 378.1 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.38 (d, 1H), 7.95 (d, 1H), 7.70 (d, 2H), 7.51 (dd, 1H), 7.23 (d , 2H), 4.19 (t, 2H), 3.78-3.70 (m, 5H), 3.35-3.23 (m, 8H), 2.36 (s, 3H), 2.02-1.89 (m, 4H)

[0256] Example 101 3-{5-[4-(4-acetylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (1.2 mL), and diisopropylethylamine (0.064 mL), 1-(piperazin-1-yl)ethan-1-one (32 mg) was added and heated with stirring at 80° C. for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (188 mg) was added dropwise to the reaction solution at room temperature to make it acidic. The residue was purified by silica gel column chromatography to give the title compound (22 mg). MS (m / z): 362.2 [M+H] +1 H-NMR (400MHz, MeOH-d4) δ: 8.38 (d, 1H), 7.95 (d, 1H), 7.70 (d, 2H), 7.51 (dd, 1H), 7.23 (d, 2H), 4.21 (t, 2H), 4.00-3.62 (m, 2H), 3.50-3.18 (m, 8H), 2.36 (s, 3H), 2.15 (s, 3H), 2.06-1.86 (m, 4H)

[0257] Example 102 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (200 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (4.9 mL), and diisopropylethylamine (0.26 mL), tert-butyl piperazine-1-carboxylate (184 mg) was added, and the mixture was heated and stirred at 80°C for 3 hours. Acetic acid (0.42 mL) was added dropwise to neutralize the mixture. The crude product was obtained by purification by silica gel column chromatography. This crude product was dissolved in THF (0.46 mL), and 4M hydrochloric acid in dioxane (0.29 mL) was added, followed by stirring at room temperature overnight. The reaction mixture was concentrated, and the resulting residue was washed with diethyl ether. The title compound (28 mg) was obtained by purification using silica gel column chromatography. MS (m / z): 320.2 [M+H] + 1 H-NMR (400MHz, MeOH-d4) δ: 8.36 (d, 1H), 7.94 (d, 1H), 7.50 (dd, 1H), 4.70-4.50 (m, 2H), 4.17 (t , 2H), 3.20-3.12 (m, 4H), 2.80-2.65 (m, 4H), 2.53 (t, 2H), 1.95-1.82 (m, 2H), 1.75-1.68 (m, 2H)

[0258] Example 103 3-{5-[4-(4-benzylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride (21 mg) obtained in Example 102, N,N-dimethylformamide (0.27 mL), water (0.27 mL), and diisopropylethylamine (0.046 mL), bromomethylbenzene (10 mg) was added and stirred at room temperature for 3 hours. Purification by silica gel column chromatography afforded the title compound (4 mg). MS (m / z): 410.3 [M+H] +

[0259] Example 104 3-(5-{[5-(piperidin-1-yl)pentyl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one A mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one obtained in Step 1 of Example 51 (50 mg), 5-(piperidin-1-yl)pentan-1-ol (118 mg), and 1-methylpyrrolidin-2-one (0.3 mL) was added to KO. t Bu (77 mg) was added, and the mixture was heated and stirred at 60°C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (105 mg) was added dropwise to the reaction mixture to neutralize it. The mixture was purified by silica gel column chromatography to obtain the title compound (28 mg). MS (m / z): 333.1 [M+H] +

[0260] Example 105 3-(5-{[2-(3-methoxyphenyl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Preparation of 5-{[2-(3-methoxyphenyl)ethyl]amino}pyridine-2-carbonitrile Potassium carbonate (85 mg) was added to a mixture of 5-fluoropyridine-2-carbonitrile (50 mg), 2-(3-methoxyphenyl)ethan-1-amine (62 mg), and N,N-dimethylformamide (1.4 mL), and the mixture was heated and stirred at 80°C for 15 hours. The reaction solution was purified by silica gel column chromatography to give the title compound (89 mg). MS (m / z): 254.1 [M+H] +

[0261] [Step 2] Preparation of N-hydroxy-5-{[2-(3-methoxyphenyl)ethyl]amino}pyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (122 mg) and ethanol (1.8 mL), 2M aqueous sodium hydroxide solution (0.88 mL) was added and stirred at room temperature for 10 minutes. 5-{[2-(3-methoxyphenyl)ethyl]amino}pyridine-2-carbonitrile (89 mg) was added to the reaction solution, and the mixture was stirred at room temperature for 15 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (82 mg). MS (m / z): 287.1 [M+H] +

[0262] [Step 3] Preparation of 3-(5-{[2-(3-methoxyphenyl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one. To a mixture of N-hydroxy-5-{[2-(3-methoxyphenyl)ethyl]amino}pyridine-2-carboximidamide (82 mg), tetrahydrofuran (1.4 mL), and DBU (0.064 mL), CDI (70 mg) was added at room temperature, and the mixture was stirred for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (436 mg) was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to obtain the title compound (81 mg). MS (m / z): 313.0 [M+H] +

[0263] Example 106 3-(5-{[2-(3-fluorophenyl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one By a method similar to Step 1, Step 2, and Step 3 of Example 105, except that 2-(3-fluorophenyl)ethan-1-amine (57 mg) was used instead of 2-(3-methoxyphenyl)ethan-1-amine, the title compound (82 mg) was obtained. MS (m / z): 301.0 [M+H] +

[0264] Example 107 3-(5-{[2-(pyridin-4-yl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one By a method similar to Step 1, Step 2, and Step 3 of Example 105, except that 2-(pyridin-4-yl)ethan-1-amine (50 mg) was used instead of 2-(3-methoxyphenyl)ethan-1-amine, the title compound (10 mg) was obtained. MS (m / z): 284.1 [M+H] +

[0265] Example 108 3-(5-{[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step 1] Preparation of N-hydroxy-5-{[3-(piperidin-1-yl)propyl]amino}pyridine-2-carboximidamide By a method similar to Steps 1 and 2 of Example 105, using 3-(piperidin-1-yl)propan-1-amine (58 mg) instead of 2-(3-methoxyphenyl)ethan-1-amine, the title compound (55 mg) was obtained. MS (m / z): 278.1 [M+H] +

[0266] [Step 2] Preparation of 3-(5-{[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of N-hydroxy-5-{[3-(piperidin-1-yl)propyl]amino}pyridine-2-carboximidamide (55 mg), tetrahydrofuran (0.99 mL), and DBU (0.044 mL), CDI (48 mg) was added at room temperature, and the mixture was stirred for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (302 mg) was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to obtain the title compound (40 mg). MS (m / z): 304.1 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.07 (d, 1H), 7.70 (d, 1H), 7.47 (d, 2H), 7.13-7.06 (m, 3H), 6.81 (t, 1H), 3 .50-3.28 (m, 2H), 3.21 (dd, 2H), 3.13-3.07 (m, 2H), 3.00-2.70 (m, 2H), 2.29 (s, 3H), 1.94-1.18 (m, 8H)

[0267] Example 109 3-(5-{[(1-ethylpiperidin-4-yl)methyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Preparation of 5-{[(1-ethylpiperidin-4-yl)methyl]amino}pyridine-2-carbonitrile To a mixture of (1-ethylpiperidin-4-yl)methanamine (140 mg), 5-fluoropyridine-2-carbonitrile (100 mg), and dimethyl sulfoxide (1 mL), potassium carbonate (170 mg) was added sequentially at room temperature, and the mixture was heated and stirred at 120°C for 3 hours. Water was added to the reaction mixture, and the mixture was purified by silica gel column chromatography to give the title compound (205 mg). MS (m / z): 245.3 [M+H] +

[0268] [Step 2] Preparation of 5-{[(1-ethylpiperidin-4-yl)methyl]amino}-N-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (350 mg) and dimethyl sulfoxide (1 mL), KO t Bu (565 mg) was added thereto at room temperature and stirred for 10 minutes. 5-{[(1-ethylpiperidin-4-yl)methyl]amino}pyridine-2-carbonitrile (205 mg) was added thereto and stirred overnight. Water was added to the reaction mixture, and the precipitate was collected by filtration and dried to give the title compound (152 mg). MS (m / z): 278.3 [M+H] +

[0269] [Step 3] Preparation of 3-(5-{[(1-ethylpiperidin-4-yl)methyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 5-{[(1-ethylpiperidin-4-yl)methyl]amino}-N-hydroxypyridine-2-carboximidamide (152 mg), tetrahydrofuran (1 mL), and DBU (0.098 mL), CDI (133 mg) was added at room temperature, and the mixture was stirred overnight. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make it acidic. The mixture was purified by silica gel column chromatography. The fractions containing the target product were neutralized with an aqueous solution of potassium carbonate and purified by silica gel column chromatography to give the title compound (112 mg). MS (m / z): 304.2 [M+H] +

[0270] Example 110 3-(5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Preparation of N-hydroxy-5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridine-2-carboximidamide According to a method similar to Steps 1 and 2 of Example 105, using methyl[3-(piperidin-1-yl)propyl]amine (77 mg) instead of 2-(3-methoxyphenyl)ethan-1-amine, the title compound (99 mg) was obtained. MS (m / z): 259.4 [M+H] +

[0271] [Step 2] Preparation of 3-(5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of N-hydroxy-5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridine-2-carboximidamide (99 mg), tetrahydrofuran (3 mL), and DBU (0.076 mL), CDI (83 mg) was added at room temperature, and the mixture was stirred overnight. Water was added to the reaction mixture, and hydrochloric acid was added dropwise to make it acidic. The title compound (80 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 318.4 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.10 (d, 1H), 7.67 (d, 1H), 7.18 (dd, 1H), 3.45 (t , 2H), 2.98 (s, 3H), 2.55-2.35 (m, 6H), 1.78-1.66 (m, 2H), 1.62-1.32 (m, 6H)

[0272] Example 111 3-(5-{[2-(dimethylamino)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step 1] Preparation of 5-{[2-(dimethylamino)ethyl]amino}pyridine-2-carbonitrile A mixture of 5-fluoropyridine-2-carbonitrile (50 mg), (2-aminoethyl)dimethylamine (40 mg), 1-methylpyrrolidin-2-one (2.0 mL), and potassium carbonate (85 mg) was heated and stirred at 80°C for 3 hours. The reaction solution was purified by silica gel column chromatography to give the title compound (66 mg). MS (m / z): 191.3 [M+H] +

[0273] [Step 2] Preparation of 5-{[2-(dimethylamino)ethyl]amino}-N-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (121 mg) and ethanol (1.7 mL), 2M aqueous sodium hydroxide solution (0.87 mL) was added sequentially at room temperature and stirred for 10 minutes. 5-{[2-(dimethylamino)ethyl]amino}pyridine-2-carbonitrile (66 mg) was added and stirred for 5 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (83 mg). MS (m / z): 224.3 [M+H] +

[0274] [Step 3] Preparation of 3-(5-{[2-(dimethylamino)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 5-{[2-(dimethylamino)ethyl]amino}-N-hydroxypyridine-2-carboximidamide (83 mg), tetrahydrofuran (1.9 mL), and DBU (0.083 mL), CDI (90 mg) was added at room temperature, and the mixture was stirred for 14 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (566 mg) was added dropwise to the reaction mixture to make it acidic. The mixture was purified by silica gel column chromatography to obtain the title compound (97 mg). MS (m / z): 250.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.11 (d, 1H), 7.73 (d, 1H), 7.48 (d, 2H), 7.16 (dd, 1H) , 7.12 (d, 2H), 6.84 (t, 1H), 3.53 (dt, 2H), 3.25 (t, 2H), 2.83 (s, 6H), 2.29 (s, 3H)

[0275] Example 112 3-(5-{[3-(dimethylamino)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to a method similar to Steps 1, 2, and 3 of Example 111, except that (3-aminopropyl)dimethylamine (46 mg) was used instead of (2-aminoethyl)dimethylamine, the title compound (113 mg) was obtained. MS (m / z): 264.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 9.25 (br, 1H), 8.06 (d, 1H), 7.71 (d, 1H), 7.47 (d, 2H), 7.21-7.01 (m, 3H), 6.80 (t, 1H), 3.25-3.17 (m, 2H), 3.13 (t, 2H), 2.79 (s, 6H), 2.29 (s, 3H), 1.90 (tt, 2H)

[0276] Example 113 3-(5-{[4-(dimethylamino)butyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to a method similar to Steps 1, 2, and 3 of Example 111, except that (4-aminobutyl)dimethylamine (52 mg) was used instead of (2-aminoethyl)dimethylamine, the title compound (148 mg) was obtained. MS (m / z): 278.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 9.22 (br, 1H), 8.06 (d, 1H), 7.69 (d, 1H), 7.47 (d, 2H), 7.11 (d, 1H), 7.05 (dd, 1H), 6.78 (t, 1H), 3.20-3.13 (m, 2H), 3.07 (t, 2H), 2.77 (s, 6H), 2.29 (s, 3H), 1.74-1.65 (m, 2H), 1.61-1.53 ​​(m, 2H)

[0277] Example 114 3-{5-[(1-ethylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to a method similar to Steps 1, 2, and 3 of Example 111, except that 1-ethylpiperidin-4-amine (58 mg) was used instead of (2-aminoethyl)dimethylamine, the title compound (79 mg) was obtained. MS (m / z): 290.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.11 (br, 1H), 7.70 (d, 1H), 7.48 (d, 2H), 7.20-7.02 (m, 3H), 6.83 (d, 1H), 3.6 6 (br, 1H), 3.51 (br, 2H), 3.20-2.92 (m, 4H), 2.29 (s, 3H), 2.13 (br, 2H), 1.65 (br, 2H), 1.29-1.13 (m, 3H)

[0278] Example 115 3-{5-[(1-benzylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to a method similar to Steps 1, 2, and 3 of Example 111, using 1-benzylpiperidin-4-amine (86 mg) instead of (2-aminoethyl)dimethylamine, the title compound (109 mg) was obtained. MS (m / z): 352.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.13-8.02 (m, 1H), 7.68 (d, 1H), 7.58-7.38 (m, 7H), 7.18-7.06 (m, 3H), 6. 80-6.72 (m, 1H), 4.23 (br, 1H), 3.55 (br, 2H), 2.99 (br, 2H), 2.29 (s, 3H), 2.10 (br, 2H), 1.60 (br, 2H)

[0279] Example 116 3-{5-[(1-ethylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to a method similar to Steps 1, 2, and 3 of Example 111, using 1-ethyl-N-methylpiperidin-4-amine (64 mg) instead of (2-aminoethyl)dimethylamine, the title compound (13 mg) was obtained. MS (m / z): 304.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.29 (d, 1H), 7.75 (d, 1H), 7.46 (d, 2H), 7.35 (dd, 1H), 7.10 (d, 2H), 4.16 (br, 1H), 3.60-3.40 (m, 2H), 3.02 (br, 2H), 2.85 (s, 3H), 2.28 (s, 3H), 2.02-1.89 (m, 2H), 1.88-1.79 (m, 2H), 1.20 (t, 3H)

[0280] Example 117 3-{5-[(1-benzylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to a method similar to Steps 1, 2, and 3 of Example 111, using 1-benzyl-N-methylpiperidin-4-amine (92 mg) instead of (2-aminoethyl)dimethylamine, the title compound (55 mg) was obtained. MS (m / z): 366.4 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 8.31-8.26 (m, 1H), 7.74 (d, 1H), 7.58-7.38 (m, 7H), 7.38-7.33 (m, 1H), 7.11 (d, 2H), 4.15 (br, 1H), 3.58-3.45 (m, 2H), 3.02 (br, 2H), 2.84 (s, 3H), 2.29 (s, 3H), 1.96 (br, 2H), 1.83 (br, 2H)

[0281] Example 118 3-(5-{4-[2-(pyrrolidin-1-yl)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate A mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (30 mg) obtained in Step 1 of Example 51, 4-[2-(pyrrolidin-1-yl)ethyl]piperidine (75 mg), 1-methylpyrrolidin-2-one (1 mL), and diisopropylethylamine (0.072 mL) was stirred at 150°C for 2 hours under microwave irradiation. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (252 mg) was added dropwise to the reaction solution to make it acidic. The mixture was purified by silica gel column chromatography to obtain the title compound (50 mg). MS (m / z): 344.3 [M+H] + 1 H-NMR (400MHz, DMSO-d6) δ: 9.37 (br, 1H), 8.39 (d, 1H), 7.75 (d, 1H), 7.47 (d, 2H), 7.44 (d, 1H), 7.11 (d, 2H), 3.99 (d, 2H), 3.52 ( br, 2H), 3.18 (t, 2H), 3.01 (br, 2H), 2.87 (t, 2H), 2.29 (s, 3H), 1.92 (br, 4H), 1.76 (d, 2H), 1.65-1.53 ​​(m, 3H), 1.29-1.15 (m, 2H)

[0282] Example 119 3-(5-{4-[2-(dimethylamino)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate According to the method similar to Example 118, except that dimethyl[2-(piperidin-4-yl)ethyl]amine (65 mg) was used instead of 4-[2-(pyrrolidin-1-yl)ethyl]piperidine, the title compound (60 mg) was obtained. MS (m / z): 318.3 [M+H] + 1H-NMR (400MHz, DMSO-d6) δ: 8.39 (d, 1H), 7.75 (d, 1H), 7.47 (d, 2H), 7.44 (d, 1H), 7.11 (d, 2H), 3.98 (d, 2H) ), 3.10 (t, 2H), 2.87 (t, 2H), 2.77 (s, 6H), 2.29 (s, 3H), 1.75 (d, 2H), 1.62-1.49 (m, 3H), 1.31-1.15 (m, 2H)

[0283] The structural formulae of the compounds obtained in Examples 1 to 119 are shown in Table 1.

[0284] The following are examples of biological tests of the compounds (test substances) obtained in the examples.

[0285] Test Example 1: Evaluation of inhibitory effect on binding between CUG repeat RNA and MBNL protein 1. Preparation of test substance solution The test substance was prepared in dimethyl sulfoxide (DMSO, Nacalai Tesque, 13445-74) to a concentration of 10 mM and diluted with DMSO to six concentrations: 10,000, 3,000, 1,000, 300, 100, and 10 μM. The test substance was further diluted 10-fold with RNA Nuclease-Free Water (not DEPC-Treated) (ThermoFisher SCIENTIFIC, AM9937) to concentrations of 1,000, 300, 100, 30, 10, and 1 μM, respectively, to prepare test substance solutions.

[0286] 2. Measurement of the binding inhibitory effect between CUG repeat RNA and MBNL protein. The prepared test substance solutions at six concentrations were added to a 384-well plate (PerkinElmer, 6008350) at 2 μL / well to final concentrations of 100,000, 30,000, 10,000, 3,000, 1,000, and 100 nM. Furthermore, 40 mM HEPES (Nacalai Tesque, 17547-24), 220 mM KCl (Nacalai Tesque, 28514-75), 20 mM sodium chloride (Nacalai Tesque, 31319-45), 2 mM magnesium chloride hexahydrate (Nacalai Tesque, 20908-65), 4 mM calcium chloride dihydrate (Fujifilm Wako Pure Chemical Industries, 036-19731), 0.2% B A buffer containing SA (Nacalai Tesque, 08587-26), 0.1% Tween (Tokyo Chemical Industry Co., Ltd., T0543-25G), and 10 mM dithiothreitol (Nacalai Tesque, 14112-52) was mixed with synthetic RNA (Sigma) containing 12 CUG repeats to a final concentration of 5 nM and MBNL protein to a final concentration of 150 nM, and the mixture was added at 14 μL / well. After 30 minutes of incubation at room temperature, donor and acceptor beads from the AlphaScreen Histidine Detection Kit (PerkinElmer, 6760619M) were added at 4 μL / well to a final concentration of 5 μg / mL. After incubation at room temperature for 1.5 hours, the fluorescence intensity was measured using Envision (PerkinElmer) at an excitation wavelength of 680 nm and an absorption wavelength of 520-620 nm. The test was performed in duplicate.

[0287] 3. Analysis of measurement results The maximum inhibition rate of each test substance was set to 100% and the minimum inhibition rate was set to 0%, and the inhibition rate of the test substance was calculated. 50 The values ​​(50% inhibitory concentration) were calculated by logistic regression analysis. The measurement results for the compounds obtained in each example are shown in Tables 2 to 4 below.

[0288]

[0289]

[0290]

[0291] Test Example 2: Examination of in vivo drug efficacy using a myotonic dystrophy type 1 model 1. Preparation of test substance administration solution The test substance was weighed and suspended in 0.5% methylcellulose (Shin-Etsu Chemical Co., Ltd.) + 99.5% Otsuka distilled water (Otsuka Pharmaceutical Factory), to prepare a test substance administration solution at a concentration of 10 mg / mL.

[0292] 2. Preparation of Animal Model The myotonic dystrophy model animal FVB / N-Tg(HSA*LR)20bCath / J (6-week-old male) was used. LR The mice were transgenic animals with 220 CTG repeats downstream of the hACTA gene, and DM1-like symptoms were manifested by the expression of mRNA containing the CUG repeats in skeletal muscles (Non-Patent Document 7). FVB / Njcl (6-week-old male) mice were used as healthy animals.

[0293] 3. Study of splicing improvement effect The test substance solution was orally administered twice daily for four days. On the fifth day after the start of administration, the animals were euthanized and the quadriceps muscles were collected. Total RNA was extracted using Qiazol Reagent (Qiagen, 79306) and Maxwell® RSC simply RNA Tissue Kit (Promega, A1340), and cDNA was then prepared using the SuperScript IV First Strand Synthesis System (Invitrogen, 18091050). RT-PCR was performed using the cDNA and the following Clcn1 exon 7a or CACNA1S exon 29 RT primers. The RT-PCR products were electrophoresed using a MultiNA (Shimadzu Corporation), normal and abnormal PCR products were quantified, and the proportion of normal PCR products in the RT-PCR products was calculated. <Clcn1 exon 7a RT primer> Fw: TGAAGGAATACCTCACACTCAAGG Rv: CACGGAACACAAAGGCACTG <CACNA1S exon 29 RT primer> Fw: GAGATCCTTGGAATGTGTTTGACTTCCT Rv: GGTTCAGCAGCTTGACCAGTCTCAT

[0294] 4. Analysis of Measurement Results The splicing improvement rate was calculated from the splicing ratios of the FVB / N-Tg(HSA*LR)20bCath / J vehicle-administered group and the FVB / Njcl group (Non-Patent Document 8). The experimental results are shown in Table 5.

[0295]

Claims

1. A compound represented by general formula (1) or a pharmaceutically acceptable salt thereof, or a solvate thereof: [In the formula, X 1 , X 2 and X 3 is (a) X 1 , X 2 and X 3 is -CH=, (b) X 1 -N=, X 2 -CH=, X 3 is -CH=, or (c) X 1 -CH=, X 2 -CH=, X 3 is any combination of -N=, A is -O-, -S-, -NR- (R is a hydrogen atom or C 1 ~C 3 represents an alkyl group or a piperidinediyl group; B represents a single bond, a C optionally substituted with a hydroxyl group; 1 ~C 5 an alkylene group, or -Y 1 -NY 2 -Y 3 -(Y 1 and Y 3 are each independently C 1 ~C 3 represents an alkylene group, and Y 2 is a hydrogen atom or C 1 ~C 3 C represents a substituted or unsubstituted aryl group, a substituted or unsubstituted nitrogen-containing heterocyclic group, or a dialkylamino group, with the proviso that at least one of B and C contains one or more nitrogen atoms.

2. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein A is -O-.

3. B is a single bond or C 1 ~C 5 The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, or a solvate thereof, which is an alkylene group.

4. The compound according to any one of claims 1 to 3, or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein C is a substituted or unsubstituted nitrogen-containing heterocyclic group.

5. The compound according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein C is a substituted or unsubstituted piperidinyl group, a substituted or unsubstituted piperazinyl group, or a substituted or unsubstituted pyrrolidinyl group.

6. The compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein C is a nitrogen-containing heterocyclic group substituted with an alkyl group, a benzyl group, or an acyl group, or an unsubstituted nitrogen-containing heterocyclic group.

7. X 1 , X 2 and X 3 is (a) X 1 , X 2 and X 3 is a combination of -CH=, A represents -O-, B represents a single bond or C 1 ~C 5 The compound according to claim 1 , or a pharmaceutically acceptable salt thereof, or a solvate thereof, wherein: C represents an alkylene group; and C represents a substituted or unsubstituted nitrogen-containing heterocyclic group.

8. A compound selected from the group consisting of the following compounds (1) to (104) and (107) to (119), or a pharmaceutically acceptable salt thereof, or a solvate thereof: (1) 3-{5-[(1-ethylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (2) 3-(5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (3) 3-(5-{[(3S)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (4) 3-{5-[(1-benzylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (5) 3-(5-{2-[benzyl(methyl)amino]ethoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (6) 3-{5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (7) 3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (8) 3-{5-[3-(pyrrolidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (9) 3-{5-[2-(pyrrolidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (10) 3-{5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (11) phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (12) 3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (13) 3-{5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-Dihydro-1,2,4-oxadiazol-5-one (14) 3-{5-[(1-cyclopropanecarbonylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (15) 3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (16) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (17) 3-{5-[(1-propylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (18) 3-{5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (19) 3-{5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (20) Ethyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate (21) 3-(5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (22) 3-{5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (23) 3-{5-[3-(piperidin-1-yl)propoxy]pyrimidin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (24) 3-{6-[3-(piperidin-1-yl)propoxy]pyridazin-3-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (25) 3-(5-{[3-(piperidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-Oxadiazol-5-one (26) 3-(5-{[3-(pyrrolidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (27) 3-(5-{[3-(azepan-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (28) Phenyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate (29) Ethyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate (30) 3-{5-[(1-ethylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (31) 3-{5-[(1-butylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (32) 3-{5-[(1-pentylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (33) 3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (34) 3-(5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (35) 3-{5-[(1-butylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (36) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (37) 3-{5-[(1-benzylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (38) 3-[5-({1-[(2-ethylphenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-Oxadiazol-5-one (39) 3-{5-[(1-{[2-(trifluoromethyl)phenyl]methyl}piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (40) 3-[5-({1-[(3-fluorophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (41) 3-[5-({1-[(3-bromophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (42) 3-{5-[(1-acetylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (43) 3-{5-[(1-propanoylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (44) methyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate (45) propan-2-yl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate (46) methyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (47) Ethyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (48) Propyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (49) Propan-2-yl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (50) Benzyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-Oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (51) 3-{5-[3-(azepan-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (52) 3-{5-[2-(azepan-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (53) 3-{5-[2-(4-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (54) 3-{5-[2-(3-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (55) 3-[5-(2-{7-azaspiro[4.5]decan-7-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (56) 3-[5-(2-{9-oxa-2-azaspiro[5.5]undecan-2-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (57) tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (58) 3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (59) 3-{5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (60) 3-{5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (61) 3-{5-[3-(3-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (62) 3-{5-[3-(morpholin-4-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (63) 3-{5-[3-(1,2,3,(64) 3-[5-(3-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (65) 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperidin-4-one (66) 3-{5-[3-(3-fluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (67) 3-{5-[3-(4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (68) 3-{5-[3-(4-methoxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (69) 3-(5-{3-[(trans)3,4-dihydroxypiperidin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (70) 3-{5-[3-(4,4-difluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (71) 3-{5-[3-(4-fluoro-4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (72) 3-{5-[3-(4-acetylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (73) Methyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate (74) 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (75) 3-{5-[3-(4-benzylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-Oxadiazol-5-one (76) 3-[5-(3-{3-azabicyclo[3.1.0]hexan-3-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (77) 3-[5-(3-{octahydrocyclopenta[c]pyrrol-2-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (78) 3-[5-(3-{7-azaspiro[4.5]decan-7-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (79) 3-[5-(3-{2-oxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (80) 3-[5-(3-{9-oxa-2-azaspiro[5.5]undecan-2-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (81) 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)pyridin-1-ium 4-methylbenzene-1-sulfonate (82) 3-{5-[(5-methyl-1,3-oxazol-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (83) 3-{5-[(1,3-thiazol-2-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (84) 3-{5-[3-(pyridin-3-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (85) 1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperidin-2-one (86) 3-{5-[2-methyl-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (87) 3-{5-[2-(dimethylamino)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-Oxadiazol-5-one (88) 3-{5-[3-(dimethylamino)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (89) 3-{5-[4-(dimethylamino)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (90) 3-{5-[4-(piperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (91) 3-{5-[4-(azepan-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (92) 3-{5-[4-(pyrrolidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (93) 3-{5-[4-(3-hydroxypiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (94) 3-{5-[4-(morpholin-4-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (95) 3-{5-[4-(4-fluoropiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (96) 3-{5-[4-(4,4-dimethylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (97) 3-{5-[4-(3-hydroxy-3-methylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (98) 3-[5-(4-{7-azaspiro[4.5]decan-7-yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (99) 3-[5-(4-{9-oxa-2-azaspiro[5.5]undecan-2-yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (100) Methyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate (101) 3-{5-[4-(4-acetylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (102) 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (103) 3-{5-[4-(4-benzylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (104) 3-(5-{[5-(piperidin-1-yl)pentyl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (107) 3-(5-{[2-(pyridin-4-yl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (108) 3-(5-{[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (109) 3-(5-{[(1-ethylpiperidin-4-yl)methyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (110) 3-(5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (111) 3-(5-{[2-(dimethylamino)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (112) 3-(5-{[3-(dimethylamino)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (113) 3-(5-{[4-(dimethylamino)butyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (114) 3-{5-[(1-ethylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (115) 3-{5-[(1-benzylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-Oxadiazol-5-one (116) 3-{5-[(1-ethylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (117) 3-{5-[(1-benzylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (118) 3-(5-{4-[2-(pyrrolidin-1-yl)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (119) 3-(5-{4-[2-(dimethylamino)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, 9. A compound selected from the group consisting of the following compounds (7), (11), (12), (15) and (16), or a pharmaceutically acceptable salt thereof, or a solvate thereof: (7) 3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (11) phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (12) 3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (15) 3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (16) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 10. A pharmaceutical composition comprising, as an active ingredient, the compound according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

11. A therapeutic agent for myotonic dystrophy type 1, comprising as an active ingredient the compound according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

12. Use of the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof, or a solvate thereof, for the manufacture of a therapeutic agent for myotonic dystrophy type 1.

13. A binding inhibitor that inhibits the binding between CUG repeat RNA and MBNL protein, comprising the compound according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof, or a solvate thereof, as an active ingredient.