Alternative Splicing Control for Immunoglobulin Selection
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
Current methods for isolating high producer clones for recombinant polypeptide production in mammalian host cells are time-consuming and costly due to the need for extensive screening and selection processes, particularly in achieving the optimal ratio of secreted and plasma-membrane-bound immunoglobulin forms.
Innovation Solution
Modifying the alternative splice acceptor site in the nucleic acid sequence to regulate splicing ratios, allowing for the expression of both soluble and plasma-membrane-bound immunoglobulins by incorporating a transmembrane domain at the C-terminus, thereby facilitating the selection of cells producing immunoglobulins with improved yield and ratio control.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Productivity
If traditional screening and selection methods are used to isolate high producer clones, then cell lines producing recombinant polypeptides can be obtained, but the process is time-consuming and costly
Solution Approach 1:
The patent employs fluorescent markers (such as GFP - green fluorescent protein) that cause cells to emit light of specific wavelengths. This allows for rapid visual identification and selection of high producer clones through flow cytometry or fluorescence-activated cell sorting (FACS), eliminating the need for time-consuming traditional screening methods while maintaining high production yields
Solution Approach 2:
The patent replaces manual mechanical screening processes with automated flow cytometry and fluorescence-based selection systems. This substitution of mechanical manual sorting with automated optical and electronic detection systems significantly reduces the time required for cell line selection while maintaining the ability to identify high producer clones
2Productivity
If traditional selection methods are used, then cells can be isolated, but the process is expensive
Solution Approach 1:
By using fluorescent markers that emit light at specific wavelengths, the patent enables cost-effective automated selection through flow cytometry. This approach replaces expensive manual screening procedures while maintaining the ability to identify and isolate high producer clones, thereby reducing overall selection costs
Solution Approach 2:
The patent uses fluorescent protein markers (such as GFP) that can be genetically copied and expressed alongside the recombinant polypeptide gene. These marker genes serve as convenient copies that can be detected and selected upon, eliminating the need for expensive and time-consuming direct detection of the recombinant protein during the selection process
3Productivity
If the optimal ratio of secreted and plasma-membrane-bound immunoglobulin forms is achieved, then production efficiency is improved, but this requires extensive screening
Solution Approach 1:
The patent uses fluorescent markers that allow for the simultaneous detection and differentiation of secreted and membrane-bound immunoglobulin forms based on their fluorescence characteristics. This enables automated flow cytometry to rapidly identify cells with optimal ratios without requiring complex manual screening procedures
Solution Approach 2:
The patent employs fluorescent markers that serve multiple functions: they indicate successful transfection, allow differentiation between secreted and membrane-bound forms, and enable automated selection. This multi-functionality simplifies the screening process while maintaining the ability to achieve optimal production efficiency
Applied Scientific Principles
This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.
Function Achieved in This Case
This approach enables efficient selection and production of immunoglobulins by modifying the splicing ratio, resulting in enhanced expression levels and improved production yields of both secreted and membrane-bound forms, thereby streamlining the cloning process and reducing costs.
Implementation Method 1
a first expression cassette for an immunoglobulin light chain and a second expression cassette for an immunoglobulin heavy chain, which is comprising a nucleic acid as reported herein... wherein said transfected cell produces soluble immunoglobulin and plasma-membrane-bound immunoglobulin by alternative splicing of said pre-mRNA
Data Source
AI summary
Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).