Antisense Oligonucleotides for Duchenne Muscular Dystrophy Exon Skipping
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
Current antisense oligonucleotides for treating Duchenne muscular dystrophy (DMD) are inefficient in causing exon skipping in the dystrophin gene, with many not producing effective results due to the need for extensive screening and varying biological effects between cell culture and muscle tissue in vivo.
Innovation Solution
Development of specific antisense oligonucleotide molecules with selected base sequences, such as GCTGGGAGAGAGCTTCCTGTAGCTTCAC, and the use of polymers like poloxamer and polyethylenimine (PEI) for enhanced cell delivery, to induce exon skipping in targeted exons of the dystrophin gene.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Reliability
If antisense oligonucleotides are used to target dystrophin exons for exon skipping, then the potential to restore reading frame and express functional dystrophin is achieved, but the efficiency of exon skipping is insufficient and extensive screening is required
Solution Approach 1:
The patent applies preliminary action by using computational algorithms to predict and identify effective antisense oligonucleotide sequences before experimental testing. The software analyzes dystrophin pre-mRNA sequences, predicts exon skipping efficacy, and ranks candidate sequences, allowing researchers to select the most promising candidates for in vitro and in vivo testing. This preliminary computational screening reduces the number of sequences that need experimental validation, saving time and resources.
2Ease of manufacture
If antisense oligonucleotides are screened in cell culture, then initial exon skipping effects can be identified, but the biological effect may significantly differ from the actual effect in muscle tissue in vivo
Solution Approach 1:
The patent adds another dimension to the screening process by integrating computational in silico prediction with traditional in vitro cell culture screening. The software provides a third dimension of prediction based on sequence analysis and algorithms that estimate in vivo efficacy. This multi-dimensional approach (in silico + in vitro + in vivo) allows researchers to correlate cell culture results with predicted in vivo performance, improving the reliability of predictive accuracy while maintaining the ease of initial cell culture screening.
3Adaptability or versatility
If many candidate antisense oligonucleotides are designed for each dystrophin exon, then the coverage of potential targets increases, but the complexity of selection and identification of effective sequences increases
Solution Approach 1:
The patent implements feedback through its computational algorithm that ranks and scores candidate antisense oligonucleotide sequences based on predicted exon skipping efficiency. The software provides feedback by identifying the top-ranked sequences that are most likely to be effective, allowing researchers to focus on a smaller subset of high-priority candidates. This feedback mechanism reduces selection complexity while maintaining comprehensive target coverage, as the system systematically evaluates all candidates and provides prioritized recommendations.
Applied Scientific Principles
This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.
Function Achieved in This Case
The antisense oligonucleotides demonstrate high efficiency in inducing exon skipping, with some sequences achieving skipping efficiencies of 20% to 80% or more in muscle tissue, effectively restoring dystrophin expression and potentially treating DMD.
Implementation Method 1
antisense oligonucleotides have been shown to induce specific exon skipping and thereby restore the reading frame and expression of functional dystrophin
Implementation Method 2
the use of polymers like poloxamer and polyethylenimine (PEI) for enhanced cell delivery
Data Source
AI summary
Embodiments of the present invention are directed generally to antisense compounds and compositions for the treatment of muscular dystrophy, and in particular, Duchenne muscular dystrophy (DMD). In one embodiment, the invention is directed to antisense oligonucleotide molecules, pharmaceutical compositions and formulations comprising antisense oligonucleotide molecules, and methods of treating muscular dystrophy related diseases and disorders wherein the antisense oligonucleotide molecules comprises a base sequence selected from the group consisting of SEQ ID NO: 5-8, 10, 12, 14, 16, 24, 27, 28, 34, 35, 37, 40, 42, 44-46, 79, 97, 100, 101, and 116, and combinations thereof.


