Antisense Oligonucleotide Sequences for Selective L1-MET Silencing

Resolve Bottlenecks,
Find Innovative SolutionsGenerate Solutions

Solution Overview

Problem

Existing cancer therapies cause significant side effects due to the non-specific targeting of both cancer and normal cells, and mutations in genes like KRAS and EGFR can render treatments ineffective, necessitating the development of therapies that selectively target cancer cells without affecting normal cells.

Innovation Solution

The use of antisense oligonucleotides that specifically target the L1-MET transcript, a non-coding RNA overexpressed in cancer cells, to induce selective death of tumor cells through silencing, utilizing chemically modified oligonucleotides for enhanced efficacy and stability.

Engineering Contradictions & Design Principles

VSEngineering Contradiction Analysis

1Reliability

If conventional chemotherapy is used to treat cancer, then cancer cells are killed, but normal cells are also damaged causing side effects

Engineering Contradiction:

Improvecancer cell killing efficacyVSAvoiddamage to normal cells

Core Design Contradiction:

ReliabilityVSObject-affected harmful factors

Solution Approach 1:

The invention targets a specific segmented molecular feature (L1-MET transcript) that is present in cancer cells but absent in normal cells. By designing antisense oligonucleotides that specifically bind to this unique transcript segment, the therapy achieves selective cancer cell killing without affecting normal cells, thus resolving the contradiction between efficacy and side effects.

Inventive Principle:

Principle #1Segmentation

Solution Approach 2:

The invention applies local quality by targeting a specific molecular characteristic (L1-MET transcript expression) that is locally present in cancer cells. The antisense oligonucleotides are designed to recognize and bind specifically to this local molecular feature, enabling selective destruction of cancer cells while preserving normal cells that lack this specific molecular signature.

Inventive Principle:

Principle #3Local quality

2Reliability

If existing targeted therapies are used, then specific molecular targets are blocked, but mutations in other genes can render the treatment ineffective

Engineering Contradiction:

Improvemolecular target blocking efficacyVSAvoidresistance to gene mutations

Core Design Contradiction:

ReliabilityVSAdaptability or versatility

Solution Approach 1:

The invention extracts and targets the L1-MET transcript, a non-coding RNA element that is specifically expressed in cancer cells due to promoter hypomethylation. By targeting this extracted molecular element rather than conventional protein-coding genes, the therapy avoids the problem of mutations in genes like KRAS or EGFR that can render traditional targeted therapies ineffective.

Inventive Principle:

Principle #2Taking out (Extraction)

Solution Approach 2:

Instead of targeting protein-coding genes that may have resistance mutations, the invention inverts the approach by targeting a non-coding RNA transcript (L1-MET) that arises from epigenetic activation of an interspersed element. This inverted strategy targets the regulatory/epigenetic layer rather than the protein-coding layer, potentially overcoming mutation-based resistance.

Inventive Principle:

Principle #13The other way round (Inversion)

3Reliability

If antisense oligonucleotides are designed to target L1-MET transcript, then cancer cell death is induced selectively, but the complexity of identifying and validating the target increases

Engineering Contradiction:

Improveselective cancer cell deathVSAvoidtarget identification and validation process

Core Design Contradiction:

ReliabilityVSDevice complexity

Solution Approach 1:

The invention performs preliminary action by identifying and characterizing the L1-MET transcript as a target before designing the antisense oligonucleotides. The transcript's unique features (originating from ORF-0 region, including MET neighbourhood sequence, specific splicing variants) were预先 identified and validated as cancer-specific markers, which simplified the subsequent drug design process and reduced the complexity of target validation.

Inventive Principle:

Principle #10Preliminary action

Applied Scientific Principles

This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.

Function Achieved in This Case

The antisense oligonucleotides effectively induce the death of cancer cells while sparing normal cells, demonstrating high selectivity and efficacy in treating tumors such as triple-negative breast cancer, lung adenocarcinoma, and colorectal cancer.

Implementation Method 1

antisense oligonucleotide... complementary to a sequence encoded by GCAGAAAATGTGCTAGATTGGAGGTGAAGACCCTGGAGCCAGAGAGCCTAGGCTTAGTCCTAGCCCTGCACTGAAG

Methodology Applied

Scientific EffectComplementary base pairing: Chemical Bonding

Data Source

PatentUS12454692B2Antisense oligonucleotide sequences for silencing the human L1-MET transcript in tumors

Publication Date: 2025.10.28 FOND DEL PIEMONTE PER LONCOLOGIA

AI summary

The present invention concerns the use of antisense oligonucleotides to induce the death of several types of human cancer cells by silencing human L1-MET, which is a non coding transcript specifically transcribed in tumour cells.