ApoE Modulation Oligonucleotides Crossing Blood-Brain Barrier
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
Current treatments for neurodegenerative diseases such as Alzheimer's and Amyotrophic Lateral Sclerosis (ALS) are limited, and abnormalities in cholesterol transport, mediated by Apolipoprotein E (ApoE), offer a potential therapeutic pathway but require effective modulation of ApoE expression in the central nervous system.
Innovation Solution
Development of RNA molecules, specifically double-stranded RNA (dsRNA) sequences complementary to ApoE mRNA, which are administered to inhibit ApoE gene expression by at least 50% in the brain, using various chemical modifications and delivery methods to cross the blood-brain barrier.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Quantity of substance
If dsRNA sequences are administered to inhibit ApoE gene expression in the brain, then ApoE expression is reduced by at least 50%, but the blood-brain barrier prevents effective delivery of the RNA molecules
Solution Approach 1:
The patent uses chemical modifications (2'-O-methyl, phosphorothioate) and conjugation with cell-penetrating peptides or transfection reagents as intermediary agents to facilitate the passage of dsRNA sequences through the blood-brain barrier, enabling effective delivery while maintaining the therapeutic function of ApoE inhibition
Solution Approach 2:
The patent alters the physical and chemical parameters of the RNA molecules by introducing modified nucleotides (2'-O-methyl ribonucleotides, phosphorothioate linkages) and adjusting structural characteristics (double-stranded configuration, specific length ranges), which enhance blood-brain barrier penetration capability while preserving gene silencing activity
2Reliability
If global ApoE modulation is implemented to achieve measurable effect on neurodegeneration, then neurodegeneration progression is slowed, but non-selective modulation affects both CNS and systemic ApoE levels causing unwanted side effects
Solution Approach 1:
The patent creates locally targeted ApoE inhibition in the CNS by using blood-brain barrier-penetrating delivery systems that release dsRNA sequences specifically in the central nervous system, while leaving systemic ApoE levels unaffected, thus achieving neurodegeneration treatment without systemic side effects
Solution Approach 2:
The patent segments the ApoE modulation effect to be confined to the CNS compartment by using targeted delivery mechanisms, separating the therapeutic action in the brain from systemic circulation, allowing independent control of CNS ApoE levels without affecting liver or other peripheral tissues
Applied Scientific Principles
This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.
Function Achieved in This Case
The dsRNA sequences effectively reduce ApoE gene expression in the brain, potentially slowing neurodegeneration and alleviating symptoms of neurodegenerative diseases by modulating cholesterol transport pathways.
Implementation Method 1
double-stranded RNA (dsRNA) sequences complementary to ApoE mRNA, which are administered to inhibit ApoE gene expression
Implementation Method 2
comprising a region of complementarity which is substantially complementary to 5′ GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3′ or 5′ UGGACCCUAGUUUAAUAAAGAUUCACCAAG 3′
Data Source
AI summary
This disclosure relates to novel ApoE targeting sequences. Novel oligonucleotides for the treatment of neurodegenerative and amyloid-related diseases are also provided.