Nucleic Acid Aptamer Annexin 2 Binding Specificity

Resolve Bottlenecks,
Find Innovative Solutions
Generate Solutions

Solution Overview

Problem

Current annexin 2 ligands face limitations such as high cost of synthesis, immunogenicity, and affinity issues, making them ineffective for therapeutic and diagnostic applications, particularly in targeting pathological functions and detecting annexin 2 in biological samples.

Innovation Solution

Development of an aptamer with a nucleic acid sequence specifically recognizing annexin 2 on the cell surface, featuring a dissociation constant in the nanomolar range, which can be used as a medicine or diagnostic agent to detect and quantify annexin 2 in biological samples.

Engineering Contradictions & Design Principles

VSEngineering Contradiction Analysis

1Reliability

If protein ligands or monoclonal antibodies are used to target annexin 2, then therapeutic action is achieved, but cost of synthesis and immunogenicity increase

Engineering Contradiction:
Improvetherapeutic actionVSAvoidcost of synthesis
Core Design Contradiction:
ReliabilityVSEase of manufacture

Solution Approach 1:

The patent uses aptamers as simplified copies of protein ligands and monoclonal antibodies. These nucleic acid-based molecules replicate the binding function of protein-based therapeutics but with advantages in synthesis cost and reduced immunogenicity, directly resolving the contradiction between therapeutic efficacy and manufacturing ease

Inventive Principle:
Principle #26Copying

Solution Approach 2:

The invention replaces the complex protein-based binding mechanism with a nucleic acid-based aptamer system. This substitution maintains the therapeutic binding function while eliminating the drawbacks of protein synthesis complexity and immunogenicity associated with monoclonal antibodies

Inventive Principle:
Principle #28Mechanics substitution (Replace mechanical system)

2Reliability

If protein ligands or monoclonal antibodies are used to target annexin 2, then therapeutic action is achieved, but immunogenicity increases

Engineering Contradiction:
Improvetherapeutic actionVSAvoidimmunogenicity
Core Design Contradiction:
ReliabilityVSObject-affected harmful factors

Solution Approach 1:

The aptamer serves as a non-protein copy that replicates the therapeutic binding function of monoclonal antibodies without triggering immune responses. This resolves the contradiction by maintaining efficacy while eliminating the harmful immunogenicity of protein-based ligands

Inventive Principle:
Principle #26Copying

Solution Approach 2:

The invention changes the chemical nature of the ligand from protein-based to nucleic acid-based. This parameter change fundamentally alters the immunogenicity profile while preserving the therapeutic binding capability, directly addressing the contradiction

Inventive Principle:
Principle #35Parameter changes

3Difficulty of detecting and measuring

If existing ligands are used to detect annexin 2, then detection is possible, but affinity for target is insufficient

Engineering Contradiction:
Improvedetection capabilityVSAvoidaffinity for target
Core Design Contradiction:
Difficulty of detecting and measuringVSReliability

Solution Approach 1:

The patent optimizes the nucleic acid sequence and structural parameters of the aptamer to achieve nanomolar affinity for annexin 2. This parameter optimization resolves the contradiction by enhancing target binding affinity while maintaining the detection function

Inventive Principle:
Principle #35Parameter changes

Applied Scientific Principles

This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.

Function Achieved in This Case

The aptamer effectively binds to annexin 2 with high specificity and affinity, enabling accurate detection and potential therapeutic intervention in cancers and other annexin 2-related conditions, while overcoming the limitations of existing ligands.

Implementation Method 1

an aptamer comprising a nucleic acid capable of specifically recognizing annexin 2 on the surface of a cell

Methodology Applied
Scientific EffectMolecular recognition:

Data Source

PatentEP2638164B1Specific ligand for annexin 2
Publication Date: 2018.04.25 COMMISSARIAT A LENERGIE ATOMIQUE ET AUX ENERGIES ALTERNATIVES
  • EP2638164B1 patent drawingFigure 1~3
  • EP2638164B1 patent drawingFigure 4
  • EP2638164B1 patent drawingFigure 5~6

AI summary

The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.