Aptamer Stabilizing Vitamin C for Cognitive Decline

Resolve Bottlenecks,
Find Innovative Solutions
Generate Solutions

Solution Overview

Problem

There is a need for effective substances that can improve cognitive decline caused by natural aging, as the global population ages rapidly, leading to decreased cognitive function and quality of life in the elderly, with existing treatments mainly focusing on specific senile diseases like Alzheimer's.

Innovation Solution

A novel aptamer with the nucleotide sequence SEQ ID NO: 1, which delays the oxidation of vitamin C, is used in combination with vitamin C as active ingredients in pharmaceutical and food compositions to improve cognitive function and provide anti-aging effects, potentially treating dementia.

Engineering Contradictions & Design Principles

VSEngineering Contradiction Analysis

1Reliability

If existing drugs and health foods are used to improve cognitive decline, then treatment for specific senile diseases like Alzheimer's is available, but effective substances for cognitive decline caused by natural aging are insufficient

Engineering Contradiction:
Improveeffectiveness for natural aging cognitive declineVSAvoidcoverage of different aging-related cognitive conditions
Core Design Contradiction:
ReliabilityVSAdaptability or versatility

Solution Approach 1:

The aptamer is designed to bind to and stabilize vitamin C, providing antioxidant protection that addresses cognitive decline from natural aging. This universal mechanism protects against multiple aging-related conditions without being limited to specific diseases like Alzheimer's, making it applicable across different cognitive decline scenarios.

Inventive Principle:
Principle #6Universality (Multi-functionality)

2Reliability

If vitamin C is used as an antioxidant, then cognitive function can be improved, but vitamin C oxidizes rapidly reducing its effectiveness

Engineering Contradiction:
Improveantioxidant effectivenessVSAvoidstability of vitamin C
Core Design Contradiction:
ReliabilityVSDuration of action of stationary object

Solution Approach 1:

The aptamer acts as an intermediary molecule that binds to vitamin C, protecting it from oxidation. This mediator stabilizes vitamin C in vivo, extending its duration of action and maintaining its antioxidant effectiveness throughout the body without rapid degradation.

Inventive Principle:
Principle #24Intermediary (Mediator)

3Reliability

If the aptamer sequence is optimized for vitamin C binding, then antioxidant protection is enhanced, but synthesis complexity increases

Engineering Contradiction:
Improvebinding affinity to vitamin CVSAvoidaptamer synthesis simplicity
Core Design Contradiction:
ReliabilityVSEase of manufacture

Solution Approach 1:

The aptamer sequence was optimized by adjusting nucleotide parameters to achieve high binding affinity for vitamin C. Specific sequence modifications (e.g., GCCAGTCTCGCGGTGGCGGC) were made to enhance stability and binding characteristics while maintaining synthetic feasibility through standard oligonucleotide synthesis methods.

Inventive Principle:
Principle #35Parameter changes

Applied Scientific Principles

This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.

Function Achieved in This Case

The aptamer and vitamin C complex effectively delays vitamin C oxidation, maintaining its antioxidant function, thereby improving cognitive function and reducing aging-related cognitive decline, as demonstrated in animal models, with potential applications in health foods, pharmaceuticals, and cosmetics.

Implementation Method 1

an aptamer which delays the oxidation of vitamin C

Methodology Applied
Scientific EffectOxidation: Oxidation

Data Source

PatentEP4435106A1Novel aptamer, and composition for cognitive function improvement and Anti-aging comprising aptamer as active ingredient
Publication Date: 2024.09.25 NEXMOS CO LTD
  • EP4435106A1 patent drawingFigure 1
  • EP4435106A1 patent drawingFigure 2
  • EP4435106A1 patent drawingFigure 3~3B

AI summary

The present invention relates to an aptamer set forth in SEQ ID NO: 1, and a composition for improving cognitive function and anti-aging comprising vitamin C the aptamer as active ingredients, wherein the aptamer of the present invention has a superior oxidative delay effect on vitamin C compared to other known aptamers, and the aptamer and/or vitamin C complex has improved cognitive function and anti-aging effects in aging animal models, and thus may be used in pharmaceutical, food, and/or cosmetic fields.