EGFR Polymorphism Detection Probe Tm Analysis Automation
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
Current methods for detecting polymorphisms in the EGFR gene, such as PCR-RFLP and Tm analysis, face challenges in automation and accuracy, particularly in distinguishing between normal and mutant polymorphisms, which can lead to difficulties in determining drug resistance in cancer treatment.
Innovation Solution
A probe consisting of an oligonucleotide with a specific base sequence (tgagctgcatgatgaggtgcac) is used for Tm analysis to identify the T790M mutation in the EGFR gene, allowing for reliable detection of polymorphisms even in samples containing both wild-type and mutant types.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Reliability
If PCR-RFLP method is used for polymorphism detection, then detection capability is achieved, but procedure complexity increases and automation becomes difficult
Solution Approach 1:
The invention extracts and eliminates the cumbersome restriction enzyme treatment step from the PCR-RFLP method. By using a probe that directly hybridizes to the PCR amplification product and detecting polymorphism through Tm analysis, the method removes the intermediate steps of restriction enzyme digestion and fragment separation, thereby simplifying the overall procedure while maintaining detection capability.
Solution Approach 2:
The invention replaces the mechanical/chemical process of restriction enzyme digestion and fragment separation with a thermal analysis method. Instead of using restriction enzymes to cut DNA and then separating fragments through gel electrophoresis, the method uses temperature-dependent hybridization and Tm analysis to detect polymorphism, enabling automation through temperature control.
2Reliability
If PCR-RFLP method is used for polymorphism detection, then detection capability is achieved, but automation becomes difficult due to multiple manual steps
Solution Approach 1:
The invention extracts and eliminates the manual intervention steps from the PCR-RFLP method. By using a probe that directly hybridizes to the PCR amplification product and detecting polymorphism through Tm analysis, the method removes the intermediate steps of restriction enzyme digestion and fragment separation, thereby simplifying the overall procedure while maintaining detection capability.
Solution Approach 2:
The invention replaces the mechanical/chemical process of restriction enzyme digestion and fragment separation with a thermal analysis method. Instead of using restriction enzymes to cut DNA and then separating fragments through gel electrophoresis, the method uses temperature-dependent hybridization and Tm analysis to detect polymorphism, enabling automation through temperature control.
3Extent of automation
If Tm analysis is used for polymorphism detection, then automation becomes possible, but accuracy in distinguishing normal and mutant polymorphisms decreases
Solution Approach 1:
The invention applies local quality by designing a probe with specific sequence characteristics that enhance its ability to discriminate between wild-type and mutant sequences. The probe is designed to be perfectly complementary to the wild-type sequence, creating a significant Tm difference when mismatched with the mutant sequence. This localized optimization of probe sequence quality improves measurement precision while maintaining automation capability.
Solution Approach 2:
The invention utilizes parameter changes by optimizing the probe's melting temperature characteristics. By carefully designing the probe sequence and length, the method creates a sufficient Tm difference between perfectly matched and mismatched hybrids, enabling accurate discrimination of polymorphisms through thermal analysis while maintaining automation capability.
4Measurement precision
If a probe is designed to detect T790M mutation, then detection accuracy for mutant polymorphism improves, but the probe may not detect wild-type polymorphism
Solution Approach 1:
The invention applies the inversion principle by designing a probe that is perfectly complementary to the wild-type sequence rather than the mutant sequence. This allows the probe to serve as a reference: when it hybridizes perfectly to wild-type DNA, it indicates the absence of mutation; when it shows Tm reduction due to mismatch, it indicates the presence of mutation. This inverted approach enables detection of both wild-type and mutant polymorphisms with a single probe.
Applied Scientific Principles
This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.
Function Achieved in This Case
The probe enables efficient and accurate detection of EGFR gene polymorphisms, facilitating tailored cancer treatment by determining drug resistance, thus improving medical diagnostics and treatment outcomes.
Implementation Method 1
using a probe complementary to a region including a detection target polymorphism, a hybrid (double-stranded nucleic acid) of a nucleic acid to be examined (hereinafter simply referred to as a 'test nucleic acid') and the probe is formed
Implementation Method 2
the thus-obtained hybrid is heat-treated, and dissociation (melting) of the hybrid into single-stranded nucleic acids accompanying the temperature rise is detected by measuring a signal such as absorbance
Data Source
Figure 1A~1C
Figure 2A~2C
AI summary
The present invention provides a polymorphism detection probe that can identify a polymorphism in the EGFR gene easily and with high reliability and a polymorphism detection method using the probe. The probe of the present invention is a probe for detecting a polymorphism in the EGFR gene, including at least one of an oligonucleotide (P1) and an oligonucleotide (P2), wherein: (P1) is a 22- to 50-mer oligonucleotide composed of a base sequence complementary to a base sequence including the 334th to 355th bases in SEQ ID NO: 1 and having a base complementary to the 334th base in its 3' end region; and (P2) is an oligonucleotide composed of a base sequence complementary to the oligonucleotide (P1).