FixR Peptide Inhibits Late Na Current via Intracellular Targeting
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
Current strategies for inhibiting late sodium current (INa,L) in cardiac cells are limited by suboptimal potency, non-selectivity, and potential side effects, highlighting the need for more effective and targeted approaches.
Innovation Solution
The use of a minimal effector domain engineered from fibroblast growth factor homologous factor (FHF), referred to as FixR, as a peptide inhibitor of late Na current, which can be delivered intracellularly via cell-penetrating peptides or viral vectors.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Reliability
If small molecule inhibitors (e.g., ranolazine, GS-458967) are used to block late Na current, then efficacy in reducing INa,L is improved, but selectivity and safety are worsened due to off-target effects on other ionic currents and CNS penetration
Solution Approach 1:
The invention segments the sodium channel into functional domains by using a peptide inhibitor that targets specifically the intracellular S6 segment of domain III, rather than blocking the transmembrane pore. This domain-specific targeting provides high selectivity for late Na current while avoiding off-target effects on other ionic currents.
Solution Approach 2:
The invention uses an endogenous peptide intermediary (FHF-derived FixR) that naturally interacts with the sodium channel intracellular domain. This peptide mediator provides selective inhibition of late Na current through a physiologically relevant mechanism, avoiding the non-selective pore blocking mechanism of small molecules.
2Object-affected harmful factors
If intracellular peptides are used to target intracellular channel domains, then selectivity for late Na current is improved, but delivery to the intracellular target is worsened by the need for cell penetration mechanisms
Solution Approach 1:
The FixR peptide is designed to be self-sufficient for intracellular delivery by incorporating cell-penetrating properties. The peptide can enter cells autonomously without requiring complex external delivery systems, while maintaining its selective inhibition mechanism at the intracellular target site.
3Ease of operation
If existing small molecule inhibitors are used, then ease of administration is improved, but therapeutic effectiveness is worsened due to suboptimal potency and non-selectivity
Solution Approach 1:
The invention changes the fundamental parameter of inhibitor type from small molecules to peptides, enabling high potency and selectivity through specific intracellular domain targeting. The peptide mechanism achieves superior therapeutic effectiveness by acting on the intracellular S6 domain, which controls late current inactivation.
Data Source
AI summary
Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5′-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3′ (SEQ ID NO: 1). As pathophysiological impact of late Na current extends beyond cardiac myocytes to other physiological settings, including neurons of the central and peripheral nervous system and skeletal muscle, these treatments and methods provide potential therapeutic avenues for a range of human ailments, including cardiac conditions, neurological/neuropsychiatric disorders, and skeletal muscle conditions. Neurological/neuropsychiatric disorders include, for example, epilepsy and autism spectrum disorders, pain-related diseases, and myotonia.