Ligated Multimeric DNA for Immune Activation and Lower Toxicity
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
Current immunostimulatory DNA molecules, such as CpG ODNs and their modified versions, face challenges in effectively modulating the human or animal immune system, including toxicity issues and non-specific protein binding, and struggle to consistently trigger a desired immune response.
Innovation Solution
A multimeric non-coding nucleic acid molecule is developed through a method involving 5'-phosphorylated oligodeoxyribonucleic acid sequences, lyophilization, and T4 DNA ligase treatment, forming higher molecular weight structures that effectively stimulate immune cells like thymocytes, B cells, and dendritic cells, with specific sequences like GTTCCTGGAGACGTTCCTTAGGAACGTTCTCCTTGACGTTGAGAGAAC and ACCTTCCTTGTACTAACGTTGCCTCAAGGAAGGTGATCTTCATAACGTTGCCTAGATCA promoting immune activation.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Reliability
If CpG ODNs with phosphorothioate backbone are used to stabilize CpG DNA, then the immune stimulation activity is enhanced, but toxicity and non-specific binding to proteins increase
Solution Approach 1:
The patent changes the chemical structure parameters of the DNA backbone from phosphorothioate to phosphodiester bonds, and modifies the sugar moieties to 2'-deoxyribose, creating a DNA structure that maintains immunostimulatory activity while reducing toxicity and non-specific protein binding. This structural parameter change resolves the contradiction between immune stimulation and toxicity.
Solution Approach 2:
The patent employs short-lived, naturally occurring DNA structures (standard phosphodiester backbone) instead of more stable but toxic phosphorothioate backbones, allowing the molecule to function temporarily for immune stimulation then be degraded by normal cellular processes, avoiding accumulation toxicity.
2Reliability
If CpG ODNs with phosphorothioate backbone are used, then the immune response is activated, but non-specific binding to proteins occurs
Solution Approach 1:
The patent changes the chemical parameters of the DNA backbone from phosphorothioate to phosphodiester bonds, which fundamentally alters the interaction profile with proteins. This parameter change maintains specific immune receptor binding while reducing non-specific protein binding, resolving the contradiction.
3Reliability
If immunostimulatory DNA molecules are used to trigger immune response, then the immune activity is enhanced, but the ability to modulate at desired level is insufficient
Solution Approach 1:
The patent segments the immunostimulatory function into modular components: specific CpG motifs for TLR9 activation, variable length and sequence for dose control, and configurable loop/stem structures for pharmacokinetic modulation. This segmentation allows independent optimization of each function, resolving the contradiction between strong immune activation and precise level control.
Solution Approach 2:
The patent introduces dynamic control mechanisms through variable molecular parameters (length, sequence composition, secondary structure) that can be adjusted to achieve different levels and durations of immune stimulation, enabling precise modulation at desired levels while maintaining strong activity.
Applied Scientific Principles
This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.
Function Achieved in This Case
The multimeric molecules demonstrate enhanced immune stimulation, with improved safety profiles and prolonged activity in target organisms, capable of triggering a robust immune response when used alone or in combination with chemotherapeutic agents, particularly effective in tumor treatment.
Implementation Method 1
adding a T4 DNA ligase, thereby forming a reaction mixture, and incubating the reaction mixture at 37° C. for at least 30 minutes
Implementation Method 2
lyophilizing until a dry residue is obtained
Data Source
AI summary
The invention relates to a multimeric non-coding nucleic acid molecule for modulating the activity of the human or animal immune system, and to a preparation process therefore and a vaccine which comprises the multimeric non-coding nucleic acid molecule.