Penta E Locus Primers for Allelic Dropout Reduction
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
Current DNA-based human identification technologies face challenges due to allelic dropout issues in STR assays, which can lead to inconclusive results, especially when new mutations or polymorphisms occur, affecting the accuracy of DNA profile matching within and between databases.
Innovation Solution
A method involving hybridization of primers flanking the Penta E locus, specifically amplifying sequences such as AAGAAAATTGTGGACAGGTGCG, AAGAAAATTGTGGCCAGGTGTG, or AAGAAAATTGTGGACAGGTGTG, to enhance DNA profiling by ensuring detection of all potential amplification products, thereby improving the accuracy of human identification.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Measurement precision
If new STR assays are developed to improve DNA profiling, then detection capability is enhanced, but allelic dropout occurs due to unknown mutations or polymorphisms
Solution Approach 1:
The patent modifies the primer sequences to account for known polymorphisms in the Penta E locus. By changing the primer parameters (sequence composition) to match the three known variants, the assay reliably amplifies all alleles without dropout, resolving the contradiction between enhanced detection and reliability.
2Ease of manufacture
If STR assays are designed without accounting for all polymorphisms, then assay development is simplified, but DNA profile matching accuracy decreases
Solution Approach 1:
The patent performs preliminary research to identify all three polymorphic variants at the Penta E locus before designing the assay. By conducting this preliminary characterization, the primers can be designed upfront to accommodate all variants, ensuring both ease of manufacture and high matching accuracy without needing complex iterative development.
3Adaptability or versatility
If existing primer sequences are used for Penta E amplification, then conventional assays can be maintained, but allelic dropout occurs for certain polymorphic variants
Solution Approach 1:
The patent designs universal primers that can amplify all three known polymorphic variants at the Penta E locus. By making the primers universal rather than variant-specific, the assay maintains broad adaptability while eliminating allelic dropout across all known polymorphisms, achieving both compatibility and reliability.
Applied Scientific Principles
This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.
Function Achieved in This Case
This approach enhances the reliability of human identification by reducing allelic dropout and improving the continuity and comparability of DNA profiles, ensuring more precise matching and investigative leads.
Implementation Method 1
hybridizing a first and second primer flanking the Penta E locus
Implementation Method 2
amplifying the Penta E locus, wherein the amplifying yields at least an amplified product encompassing the sequence
Data Source
AI summary
Methods for human identification using polymorphisms in the Penta E short tandem repeat locus are significant in preventing allelic drop out. An exemplary method encompasses (a) contacting a first primer to a nucleic acid sample to be analyzed, (b) contacting a second primer to the nucleic acid sample, and (c) subjecting the nucleic acid sample, the first primer, and the second primer to an amplification reaction, and thereby forming an amplification product. The first primer, the second primer, or both the first and second primers can be labeled with a non-nucleic-acid label. Additionally, or alternatively, the amplification product can include an adenosine at position 14 from the 5′ end of SEQ ID NO:1, a thymidine at position 21 from the 5′ end of SEQ ID NO:2, or both an adenine at position 14 and a thymidine at position 21 from the 5′ end of SEQ ID NO:3.