SCN2A Oligomeric Gapmer Therapy for Seizure Frequency Reduction
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
There is a lack of effective treatments for SCN2A-related disorders such as Developmental and Epileptic Encephalopathies (DEEs), including Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, and Benign Familial Neonatal-Infantile Seizures (BFNIS), as well as intellectual disability (ID) and autism spectrum disorder (ASD), which are associated with symptoms like seizures, motor and cognitive dysfunctions, and gastrointestinal disorders.
Innovation Solution
Administration of an oligomeric compound comprising a 6-10-4 MOE gapmer with a specific sequence (CCACGACATATTTTTCTACA) to subjects with SCN2A-related disorders caused by a gain-of-function mutation, where the compound is administered at varying doses and intervals to reduce seizure frequency and severity.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Reliability
If conventional treatments are used for SCN2A-related disorders, then current standard therapies are administered, but they lack effectiveness in managing seizures and associated symptoms
Solution Approach 1:
The patent applies parameter changes by modifying the chemical structure of oligonucleotide compounds to create MOE gapmers with specific sequences and modifications (2'-O-methoxyethyl groups, phosphorothioate linkages) that enhance their ability to bind and silence mutant SCN2A mRNA, thereby improving treatment effectiveness for gain-of-function mutations
Solution Approach 2:
The patent segments the treatment approach by developing specific oligomeric compounds tailored for gain-of-function mutations versus other mutation types, allowing differentiated therapy strategies that improve overall treatment versatility and effectiveness across different SCN2A-related disorder subtypes
2Object-affected harmful factors
If oligomeric compound is administered to reduce seizure frequency, then seizure occurrence decreases by 10% to 95%, but the compound requires specific structural modifications and precise dosing protocols
Solution Approach 1:
The patent applies local quality by introducing specific modifications at particular positions within the oligomeric compound structure (2'-MOE modifications at nucleosides 1-6 and 17-20, phosphorothioate linkages at specific internucleoside positions) to optimize both seizure reduction efficacy and pharmacokinetic properties while managing structural complexity
3Reliability
If current treatments are used for intellectual disability and autism spectrum disorder associated with SCN2A mutations, then standard care is provided, but effective management options are unavailable
Solution Approach 1:
The patent uses RNA interference technology as an intermediary mechanism, where oligomeric compounds serve as mediators to selectively silence mutant SCN2A mRNA transcripts, thereby treating the underlying genetic cause of intellectual disability and autism spectrum disorder symptoms rather than merely managing symptoms
Data Source
AI summary
Provided are methods of treating a subject with a SCN2A-related disorder, e.g., Developmental and Epileptic Encephalopathies (DEE), comprising administering to the subject an oligomeric compound. Also provided are methods of reducing frequency of seizures experienced by a subject with a SCN2A-related disorder, comprising administering to the subject an oligomeric compound.