Anti-s100a monoclonal antibody and preparation method and application thereof

By tandemly generating the S100A protein using genetic engineering methods and expressing it in HEK293 cells, a stable and highly specific anti-S100A monoclonal antibody was prepared, solving the problems of high cost and poor stability in traditional methods and achieving standardized production.

CN115819577BActive Publication Date: 2026-06-12HENAN CELNOVTE BIOTECHNOLOGY CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HENAN CELNOVTE BIOTECHNOLOGY CO LTD
Filing Date
2022-10-08
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Existing S100A monoclonal antibodies are expensive to produce, lack specificity and stability, exhibit large batch-to-batch variations, and pose risks in traditional production processes.

Method used

Anti-S100A monoclonal antibodies were prepared using genetic engineering methods. By tandem two full-length S100A proteins and adding a linker, immunogenicity was increased. The antibodies were expressed and purified using HEK293 cells, avoiding the risks of traditional methods.

🎯Benefits of technology

This approach achieves stable antibody properties, good specificity and affinity, and good reproducibility, avoiding the risks associated with traditional methods and providing a standardized production process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115819577B_ABST
    Figure CN115819577B_ABST
Patent Text Reader

Abstract

The application discloses an anti-S100A monoclonal antibody and a preparation method and application thereof. The anti-S100A monoclonal antibody provided by the application comprises VHCDR1, VHCDR2 and VHCDR3 with the amino acid sequences shown in SEQ ID NO:1-3, and VLCDR1 with the amino acid sequence shown in SEQ ID NO:4, VLCDR3 shown in SEQ ID NO:6 and VLCDR2 with the amino acid sequence DTS. The nucleotide sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody are also provided, and the recombinant antibody can be prepared by using a genetic engineering technology. The method is a standardized antibody production process, avoids risk factors in a traditional monoclonal antibody production and preservation process, and has the advantages of stable property, high experimental repeatability and the like. The recombinant antibody can specifically react with the S100A protein and has high sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to an anti-S100A monoclonal antibody, its preparation method, and its application, belonging to the field of immunology technology. Background Technology

[0002] S100 belongs to the polygenic calcium-binding protein family, composed of more than 20 known proteins, each encoded by a separate gene. At least 16 S100 protein genes map to human chromosome 1Q21 and are designated S100A1-A16. S100 proteins not included in this gene family are designated by single-letter names (S100B, S100G, S100P, S100Z). S100A1, also known as S100A, is an acidic protein encoding 94 amino acids and belongs to the calcium-binding protein family. 2+ Combined EF motif superfamily members.

[0003] S100A is highly expressed in skeletal muscle fibers, cardiomyocytes, and certain neuronal populations, and is a commonly used biomarker in immunohistochemistry (IHC) for pathological diagnosis. It is a neuron-specific protein. In pathological diagnosis, S100A is a marker for ovarian and endometrial cancers with poor prognosis, and also a specific and sensitive biomarker for differentiating renal adenocarcinoma from prostate cancer. In tumor cells, the vast majority of malignant melanomas and neurofibromas are S100A immunohistochemically positive.

[0004] Currently, most S100A monoclonal antibodies are prepared using full-length recombinant proteins or natural proteins extracted from tissues for immunization. These are expensive, and their specificity and stability need to be improved. Furthermore, there are issues such as significant batch-to-batch variability and poor stability. Summary of the Invention

[0005] To address the aforementioned problems, the first objective of this invention is to provide an anti-S100A monoclonal antibody that is stable and possesses good specificity and affinity.

[0006] A second objective of this invention is to provide the application of the above-mentioned monoclonal antibody in the preparation of S100A in vitro detection reagents or kits.

[0007] A third objective of this invention is to provide an immunohistochemical detection reagent or kit containing the above-mentioned monoclonal antibody.

[0008] A fourth objective of this invention is to provide a nucleic acid molecule comprising the gene encoding the monoclonal antibody described above.

[0009] A fifth objective of the present invention is to provide an expression cassette, expression vector, recombinant cell, or recombinant bacterium containing the aforementioned nucleic acid molecules.

[0010] The sixth object of the present invention is to provide the application of the above-mentioned nucleic acid molecules, expression cassettes, expression vectors, recombinant cells or recombinant bacteria in the preparation of anti-S100A monoclonal antibodies.

[0011] The seventh objective of this invention is to provide a method for preparing anti-S100A monoclonal antibodies, which is a standardized antibody production process that avoids the risk factors that occur during the traditional monoclonal antibody production and preservation process.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0013] An anti-S100A monoclonal antibody comprising VHCDR1, VHCDR2 and VHCDR3 with amino acid sequences as shown in SEQ ID NO: 1-3, VLCDR1 with amino acid sequences as shown in SEQ ID NO: 4, VLCDR3 with amino acid sequences as shown in SEQ ID NO: 6 and VLCDR2 with an amino acid sequence of DTS.

[0014] The anti-S100A monoclonal antibody provided by this invention is prepared by using two full-length S100A proteins tandemly as antigens, while also increasing immunogenicity. The two full-length S100A proteins are tandemly linked by a linker. The addition of the linker maintains the independence of the tandem units, ensuring that the structures of the two tandem sequences do not affect each other, while simultaneously increasing immunogenicity. The anti-S100A monoclonal antibody of this invention is stable and exhibits good specificity and affinity.

[0015] Preferably, the heavy chain variable region of the monoclonal antibody has an amino acid sequence as shown in SEQ ID NO: 7, and the light chain variable region has an amino acid sequence as shown in SEQ ID NO: 8.

[0016] Application of anti-S100A monoclonal antibody in the preparation of S100A in vitro detection reagents or kits.

[0017] This monoclonal antibody can be used to prepare in vitro detection reagents or kits for S100A to detect the expression of S100A in tissue cells.

[0018] Immunohistochemical detection reagents or kits, including S100A monoclonal antibody.

[0019] This reagent or a kit containing this reagent can be used for in vitro immunoassay of S100A expression in tissue cells.

[0020] A nucleic acid molecule containing a gene sequence encoding an anti-S100A monoclonal antibody.

[0021] This nucleic acid molecule can be obtained through genetic engineering recombination technology or chemical synthesis methods. Those skilled in the art will readily understand that the variant sequences of the heavy chain variable region nucleotide sequence and / or light chain variable region nucleotide sequence obtained by mutating the above-mentioned nucleic acid molecule provided in this invention through one or more nucleotide additions, deletions, substitutions, modifications, etc., will still retain the ability to specifically bind to the S100A protein when the encoded amino acid sequences form single-chain antibodies, chimeric monoclonal antibodies, modified monoclonal antibodies, or other forms of monoclonal antibodies or antibody fragments.

[0022] Preferably, the nucleotide sequence of the heavy chain variable region gene of the anti-S100A monoclonal antibody is shown in SEQ ID NO: 9; and the nucleotide sequence of the light chain variable region gene of the anti-S100A monoclonal antibody is shown in SEQ ID NO: 10.

[0023] An expression cassette, expression vector, recombinant cell, and recombinant bacteria comprising the aforementioned nucleic acid molecules.

[0024] Preferably, the recombinant expression vector is selected from prokaryotic or eukaryotic expression vectors; more specifically, the recombinant expression vector is selected from bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors.

[0025] Preferably, the expression system is a bacterial, yeast, filamentous fungus, mammalian cell, insect cell, plant cell, or cell-free expression system.

[0026] The application of the above-mentioned nucleic acid molecules, expression cassettes, expression vectors, recombinant cells, and recombinant bacteria in the preparation of anti-S100A antibodies.

[0027] This invention provides nucleic acid molecules, expression cassettes, expression vectors, recombinant cells, and recombinant bacteria containing the variable region amino acid sequences of the heavy and light chains of an anti-S100A monoclonal antibody. Based on this, the anti-S100A monoclonal antibody of this invention can be obtained using conventional genetic engineering methods.

[0028] A method for preparing an anti-S100A monoclonal antibody involves introducing the aforementioned nucleic acid molecules into host cells, collecting the cell supernatant, and purifying and ultrafiltration the supernatant.

[0029] This invention provides a method for preparing anti-S100A monoclonal antibodies. Compared with traditional monoclonal antibody preparation methods, it has advantages such as known recombinant antibody sequences, long-term preservation of antibody genes, stable antibody properties, and good experimental reproducibility. It is a standardized antibody production process that avoids the risk factors that occur in the traditional monoclonal antibody production and preservation process.

[0030] Preferably, the host cell is a HEK293 cell.

[0031] HEK293 is a cold-resistant, semi-adherent, well-maintained cell line that is easy to transfect and can produce large amounts of recombinant proteins. Attached Figure Description

[0032] Figure 1 The results of Western blot analysis of the S100A mouse monoclonal antibody prepared in Example 4 of this invention (M is the marker).

[0033] Figure 2 This is an immunohistochemical image (200X) of the tonsils in Example 4 of the present invention.

[0034] Figure 3 Immunohistochemical image of kidney tissue in Example 4 of this invention (200X);

[0035] Figure 4 This is an immunohistochemical image (200X) of a schwannoma in Example 4 of the present invention.

[0036] Figure 5 The Western blot results of the S100A recombinant antibody prepared in Example 6 of this invention (M is the marker).

[0037] Figure 6 This is an immunohistochemical image (200X) of the tonsils in Example 6 of the present invention.

[0038] Figure 7 This is an immunohistochemical image (200X) of a schwannoma in Example 6 of the present invention. Detailed Implementation

[0039] The present invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments, experimental examples and comparative examples are all commercially available.

[0040] Example 1 Antigen Design

[0041] According to the S100A amino acid sequence published by Uniprot (accession number P23297), S100A is an acidic protein encoding 94 amino acids. To increase the immunogenicity of the antigen, two S100A proteins were tandemly linked, with GSG added as a linker in between. The tandem nucleotide sequence of S100A is shown in SEQ ID NO: 11, and the amino acid sequence is shown in SEQ ID NO: 12.

[0042] The purpose of adding a linker is to prevent the formation of tandem epitopes. Homology modeling and structural prediction of the tandem whole protein sequence show that the structures of the two tandem sequences do not affect each other, while also increasing immunogenicity.

[0043] Example 2: Expression and purification of antigen

[0044] 1. Construction of recombinant vectors

[0045] The S100A tandem gene was artificially synthesized, and gene fragments were introduced at both ends of the sequence. NdeI and XhoI The enzyme restriction sites were synthesized and cloned into the pET-28a expression vector to construct the pET-28a-S100A recombinant vector.

[0046] 2. Pre-expression of recombinant proteins:

[0047] The successfully constructed recombinant plasmid was transformed into BL21(DE3) Escherichia coli competent cells, and single colonies were picked and cultured in 4 mL of LB broth containing kanamycin resistance (50 μg / mL) until OD600. 600 Once the concentration reaches 0.6-0.8, add 1 mM IPTG for expression analysis and preserve the strain capable of expressing the target protein.

[0048] 3. Expression of recombinant proteins

[0049] The strains capable of expressing the target protein were inoculated into 350 mL of LB liquid medium containing kanamycin (50 μg / mL) resistance and cultured at 37°C until OD500. 600 Once the concentration reaches 0.6-0.8, add IPTG to a final concentration of 0.4 mM and induce expression at 37°C for 4 h.

[0050] 4. Collection and disruption of bacterial cells

[0051] The induced bacterial cells were collected by centrifugation, resuspended in 10mM PBS (cold in an ice bath), and sonicated (350W, 20min, 3s working, 3s intermittent). The cells were then centrifuged at 12000g for 10min, and the supernatant was collected for further purification.

[0052] 5. Protein purification and identification

[0053] The supernatant solution was filtered through a 0.45 μm filter membrane, and the filtrate was purified by nickel agarose gel electrophoresis. When loading the filtrate onto the equilibrated gel, the flow rate was controlled at 1 mL / min. Unadsorbed protein was removed by washing with 10 mM PBS, followed by gradient elution with PBS and PBS containing 0.5 M imidazole. Different elution peaks were collected for SDS-PAGE protein identification. Samples with a purity greater than 90% were ultrafiltered and stored in 10 mM PBS.

[0054] Example 3: Screening of S100A hybridoma cell lines and preparation of monoclonal antibodies

[0055] 1. Animal immunization

[0056] The purified S100A protein was mixed with an equal volume of Freund's complete adjuvant and administered subcutaneously to 6-8 week old BalB / c mice at a dose of 100 μg per mouse. A second immunization was performed two weeks later using Freund's incomplete adjuvant emulsified at the same dose via intraperitoneal injection. After the second immunization, tail blood was collected and serum titers were determined using a serially diluted indirect ELISA method. Mice with the highest antibody titers were selected for tail vein pulse immunization at a dose of 50 μg per mouse.

[0057] 2. Cell fusion

[0058] Myeloma cells were sp2 / 0 derived from BalB / c, and were in the logarithmic growth phase at fusion. Spleens were aseptically harvested from mice after pulse immunization, and single-cell suspensions of spleen cells were prepared. Mouse spleen cells and myeloma cells were mixed at a 1:5 ratio, and 1 mL of 50% PEG (pH 8.0) at 37°C was added. Incomplete culture medium was added, and after centrifugation and discarding the supernatant, HAT medium was added to resuspend and mix well. The volume was adjusted to 50 mL, and the mixture was added to 96-well cell culture plates and incubated at 37°C in a 5% CO2 incubator.

[0059] 3. Screening and cloning

[0060] Cell clones were selected within 7-10 days after fusion for screening and testing (ELISA, IHC, WB, and other methods). Positive wells were subjected to limiting dilutions, with ELISA values ​​measured 5-6 days after each dilution. OD values ​​were then collected. 450 Limiting dilutions were performed on wells with high positive values ​​for single clones until the entire 96-well plate was positive for ELISA. Single clones with high positive values ​​were then selected to confirm the cell line.

[0061] 4. Preparation and purification of ascites monoclonal antibodies

[0062] Eight- to ten-week-old BalB / c mice were intraperitoneally injected with 0.5 ml of liquid paraffin. One week later, each mouse was intraperitoneally injected with a 1 ml syringe containing a suspension of monoclonal cells washed and resuspended in PBS, at a volume of 5 × 10⁶ cells. 6 / mouse, 3 mice per cell line. After ascites fluid accumulates in the mice, the ascites fluid is collected, centrifuged, and the supernatant is obtained. The ascites fluid is purified by Protein G column chromatography. The concentration of the purified monoclonal antibody is determined, aliquoted, and stored at -20℃.

[0063] Example 4: Specificity detection of S100A monoclonal antibody

[0064] 1. Western blotting for the specificity of S100A monoclonal antibody.

[0065] 1) Sample preparation

[0066] Prepare mouse liver lysate, lyse it with RAPI containing 1 mM PMSF, and then add 5×SDS-PAGE Loading Buffer for sample preparation.

[0067] 2) Electrophoresis and membrane transfer

[0068] Load 20 μg of each sample and electrophoresis at 80V for 20 min, then electrophoresis at 120V until bromophenol blue reaches the bottom of the gel. Then start the transfer process. Soak the NC membrane and filter paper in transfer buffer beforehand, and place them in a sandwich configuration in the wet transfer apparatus in the following order: electrode (-) - sponge - filter paper - gel - NC membrane - filter paper - sponge - electrode (+), constant voltage 90V, 60 min.

[0069] 3) Closed

[0070] Immerse the NC membrane in the blocking solution (TBST containing 5% skim milk) and incubate at 37°C for 2 hours.

[0071] 4) Primary antibody incubation

[0072] The NC membrane was placed in the anti-S100A monoclonal antibody prepared in Example 3 (the antibody was diluted 1:3000 with blocking buffer), incubated at 37°C for 1 hour, and then washed 4 times with TBST for 5 minutes each time.

[0073] 5) Secondary antibody incubation

[0074] The NC membrane was placed in HRP-labeled goat anti-mouse IgG secondary antibody (antibody diluted 1:5000 with blocking buffer), incubated on a shaker at 37°C for 1 hour, and then washed 4 times with TBST for 5 minutes each time.

[0075] 6) Color development

[0076] Components A and B in the ECL luminescent solution were mixed in a 1:1 ratio and then added to the NC film, followed by exposure in an exposure apparatus. The results are as follows: Figure 1 As shown, the S100A mouse monoclonal antibody exhibits a target band of approximately 10 kDa in mouse liver lysate tissue, with a dilution ratio of 1:3000.

[0077] 2. Immunohistochemical (IHC) detection of the specificity of S100A monoclonal antibody

[0078] 1) Slice

[0079] Paraffin blocks of tonsil, kidney tissue, and schwannoma tissue were taken and sectioned using a Leica tissue microtome. The tissue thickness was 3 μm, and the sections were dry-baked at 65°C for 2 hours.

[0080] 2) The antibodies of this invention were subjected to immunohistochemical staining using a manual immunohistochemical method. The specific steps are as follows:

[0081] A. High-temperature repair was performed using DAKO HIGH pH repair solution for 20 min. After cooling, the solution was incubated at room temperature for 5 min using 100 μL of endogenous peroxidase blocking solution. The solution was then used to soak the sample twice, for 5 min each time.

[0082] B. The primary antibody used was the anti-S100A monoclonal antibody prepared in Example 3, diluted 1:1000 using antibody dilution buffer.

[0083] Add 100 μL of diluted antibody, incubate at 37°C for 30 min, and soak twice with washing buffer, 5 min each time;

[0084] C. Use 100 μL of enzyme-labeled polymer for the secondary antibody, incubate at room temperature for 20 min, and soak twice in washing solution for 5 min each time.

[0085] D. Use 100 μL of DAB colorimetric solution, incubate at room temperature for 5 min, and soak in purified water twice, 5 min each time;

[0086] E. Add 100 μL of hematoxylin for counterstaining, incubate at room temperature for 5 min, and rinse with tap water to return to blue.

[0087] 3. Dehydration, clearing and sealing

[0088] Wash with deionized water for 3 min; rinse with 85% ethanol for 1 min; rinse with 95% ethanol for 1 min; rinse with 100% ethanol for 1 min, twice; rinse with xylene for 1 min, twice; mount with neutral resin.

[0089] 4. Observe the slide under a microscope

[0090] The results are as follows Figure 2 , Figure 3 , Figure 4 As shown, the S100A protein was correctly located (in the nucleus or cytoplasm) in the tonsils, kidney tissue, and schwannoma tissue, showing a clear positive result.

[0091] Example 5: S100A Antibody Gene Extraction

[0092] 1. Total RNA extraction

[0093] Resuscitate the hybridoma cells successfully constructed in Example 3, then test the cell line titer and collect the cells; add 1 mL Trizol, mix well, and incubate at room temperature for 5-10 min until the cells are completely lysed, centrifuge at 12000 rpm for 5 min, discard the precipitate, then add 200 μL chloroform, invert vigorously, let stand for 15 min, centrifuge at 12000 rpm at 4℃ for 15 min and collect the upper aqueous phase; add an equal volume of isopropanol, mix gently, and let stand for 10 min; then centrifuge at 12000 rpm at 4℃ for 10 min and discard the supernatant; add 1 mL pre-chilled 75% ethanol, gently tap the bottom of the tube, centrifuge at 12000 rpm at 4℃ for 5 min, discard the supernatant, air dry at room temperature for several minutes, then add 30-50 μL pre-chilled DEPC water until dissolved to obtain the RNA product, and store at -80℃ for long-term use; the entire extraction process must be carried out while wearing a mask and gloves to prevent RNase contamination.

[0094] 2. Obtaining the NKX3.1 antibody gene via 5' RACE

[0095] This patent primarily utilizes the SMARTer RACE 5' / 3' Kit (Clontech, Cat. No. 634859) to isolate the 5' sequence of the S100A antibody. Using 1 μg of total RNA as a template, first-strand cDNA synthesis was performed using the 5'-CDS primer A, SMART IIA oligo, and 3'-CDS primer A provided in the kit, following the instructions to obtain 5'-RACE-Ready cDNA. PCR, or Rapid Amplification of cDNA Ends, was then performed using these cDNAs as templates. 5'-RACE PCR used UPM (Universal Primer) primers, and GSP (gene-specific primer) primers designed based on the gene-specific sequence. The first-round PCR reaction volume was 50 μl, and the components are shown in Table 1.

[0096] Table 1 PCR reaction system

[0097]

[0098] The PCR reaction procedure is shown in Table 2.

[0099] Table 2 PCR reaction procedure

[0100]

[0101] PCR products were stored at 4°C. 5 μl of the PCR product was analyzed by 1.0% agarose gel electrophoresis. If the bands were uniform, the gel was excised and recovered, constructed onto pRACE, and positive clones were selected for sequencing. If the bands were not uniform, nested PCR was performed for further amplification before constructing the product onto pRACE and selecting positive clones for sequencing to obtain the antibody gene.

[0102] Example 6: Preparation of Recombinant Monoclonal Antibodies

[0103] 1. Identification of antibody heavy chain and light chain gene information and analysis of the IMGT database.

[0104] Sequencing analysis revealed that the nucleotide sequence of the heavy chain variable region gene of the anti-S100A monoclonal antibody of this invention is shown in SEQ ID NO: 9, and the amino acid sequence is shown in SEQ ID NO: 7; the nucleotide sequence of the light chain variable region gene of the anti-S100A monoclonal antibody is shown in SEQ ID NO: 10, and the amino acid sequence is shown in SEQ ID NO: 8. Further analysis revealed the amino acid sequences of the heavy chain variable regions VHCDR1-3 of the monoclonal antibody as shown in SEQ ID NO: 1-3, respectively; the amino acid sequence of the light chain variable region VLCDR1 of the monoclonal antibody is shown in SEQ ID NO: 4; the amino acid sequence of VLCDR2 is DTS; and the amino acid sequence of VLCDR3 is shown in SEQ ID NO: 6.

[0105] 2. Primer design and vector construction

[0106] Light chain primers and heavy chain primers were designed based on the sequencing results. The primer sequences are shown below:

[0107] LF: TAAACGGATCTCTAGCGAATTCATGGATTTACAGGTGCAGAT (as shown in SEQ ID NO: 13)

[0108] LR: CGAGCGGCCGCTAGCAAGCTTTCAACACTCATTCCTGTTGAAG (as shown in SEQ ID NO: 14)

[0109] HF: TAAACGGATCTCTAGCGAATTCATGAAATGCAGCTGGGTCATC (as shown in SEQ ID NO: 15)

[0110] HR: CGAGCGGCCGCTAGCAAGCTTtcaTTTACCAGGAGAGTGGGAG (as shown in SEQ ID NO: 16)

[0111] Using cDNA as a template, PrimeSTAR Max DNA Polymerase (TAKARA Code No. R045Q) was used for amplification. The PCR reaction conditions are shown in Table 3.

[0112] Table 3 PCR reaction procedure

[0113]

[0114] PCR amplification fragments and pTT5 vector were EcoRI / HindIII Three hours after double enzyme digestion, the antibody expression vector was recovered by agarose gel electrophoresis and then constructed by recombination. The positive clones with correct sequencing were then subjected to plasmid extraction for transfection.

[0115] 2. Expression and purification of recombinant anti-S100A antibody

[0116] 1) Cell culture before transfection

[0117] HEK293 cells were placed in a 5% CO2 constant temperature shaker and cultured at 37°C and 120 rpm. Before passage, cell counts were performed to confirm the density. After confirming the density, there was no need to centrifuge the cells. The cell suspension could be directly added to the culture medium in the required proportion. If too many dead cells were found during the culture process, the cells should be discarded and new cells should be used.

[0118] 2) Cell preparation and chronotransfection

[0119] Before transient transfection, cell density and viability need to be determined; cells do not need to be centrifuged, but can be directly added to HEK293 culture medium to dilute the cell density to 3 × 10⁻⁶. 6 Cells / mL; place the shake flask in a 5% CO2 constant temperature shaker and incubate at 37℃ and 120 rpm for 10 min before transfection. For transient transfection, prepare two 15 mL sterile centrifuge tubes. Add 5 mL of KPM and sterile plasmid DNA to one tube at a heavy chain:light chain ratio of 1:1, and gently pipette to mix. Take the other centrifuge tube and add 5 mL of KPM and 500 μl of TA-293 transfection reagent, and gently pipette to mix. Transfer all liquid from the centrifuge tube containing the transfection reagent to the centrifuge tube containing the plasmid, and gently pipette to mix. Incubate at room temperature for 10 min to prepare the plasmid-vector complex. Remove the cells from the constant temperature shaker, add the prepared plasmid-vector complex while shaking, and return to the CO2 constant temperature shaker for incubation. After 3 hours, add an appropriate amount of antibiotic as needed.

[0120] 3) Product expression

[0121] 600 μl of HEK293 cell protein expression enhancer (KE-293) can be added 24 hours after transfection, and KT-Feed can be added at the same time to increase the product expression level. Collect cell supernatant 6-8 days after transfection.

[0122] 4) Antibody purification

[0123] The cell culture supernatant was purified using a Protein G column, and the antibody was collected and concentrated in PBS (pH 7.4) by ultrafiltration.

[0124] 3. Recombinant antibody verification

[0125] The recombinant monoclonal antibody was validated using Western blotting and IHC, with the specific implementation steps described in Example 4.

[0126] WB results are available Figure 5 As shown in the figure, the recombinant S100A antibody exhibits a target band of approximately 10 kDa in mouse liver lysate tissue, with a dilution ratio of 1:3000. This indicates that the recombinant monoclonal antibody can specifically react with S100A.

[0127] IHC results are available in [link to IHC results]. Figure 6 , Figure 7 As shown in the figure, the S100A recombinant antibody is correctly located and positively expressed in the tonsil and schwannoma tissues.

[0128] This invention provides the variable region amino acid sequences of the heavy and light chains of an anti-S100A monoclonal antibody. Based on these sequences, the monoclonal antibody of this invention can be obtained using conventional antibody engineering methods, as detailed in this embodiment. Western blotting and IHC specificity verification experiments demonstrate that the obtained anti-S100A recombinant antibody can specifically recognize human S100A protein and can be used for IHC immunohistochemical detection. Compared with traditional monoclonal antibody preparation methods, the anti-S100A recombinant antibody prepared by the genetic engineering method of this invention has advantages such as known sequence, stable antibody properties, and good reproducibility. The standardized antibody production process avoids the risk factors that occur during the production and storage of traditional monoclonal antibodies. Furthermore, based on the antibody amino acid sequence provided by this invention, modifications such as the addition, deletion, or substitution of one or more amino acids can be used to obtain its active fragment or conserved variant, laying the foundation for further improving the specificity and affinity of the antibody.

[0129] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An anti-S100A monoclonal antibody, characterized by: It contains VHCDR1, VHCDR2 and VHCDR3 with amino acid sequences as shown in SEQ ID NO: 1~3, VLCDR1 with amino acid sequences as shown in SEQ ID NO: 4, VLCDR3 with amino acid sequences as shown in SEQ ID NO: 6 and VLCDR2 with amino acid sequence DTS.

2. The anti-S100A monoclonal antibody according to claim 1, characterized by: The monoclonal antibody heavy chain variable region has the amino acid sequence shown in SEQ ID NO: 7, and the light chain variable region has the amino acid sequence shown in SEQ ID NO:

8.

3. The use of a monoclonal antibody as described in any one of claims 1 to 2 in the preparation of an S100A in vitro detection reagent or kit.

4. An immunohistochemical detection reagent or kit comprising the monoclonal antibody as described in any one of claims 1 to 2.

5. A nucleic acid molecule encoding the anti-S100A monoclonal antibody as described in claim 1 or 2.

6. The nucleic acid molecule according to claim 5, characterized in that: The nucleotide sequence of the heavy chain variable region gene of the anti-S100A monoclonal antibody is shown in SEQ ID NO: 9; the nucleotide sequence of the light chain variable region gene of the anti-S100A monoclonal antibody is shown in SEQ ID NO:

10.

7. An expression cassette, expression vector, recombinant cell, or recombinant bacterium comprising the nucleic acid molecule as described in claim 6.

8. The use of a nucleic acid molecule as described in claim 5 or 6, or an expression cassette, expression vector, recombinant cell, or recombinant bacterium as described in claim 7, in the preparation of an anti-S100A monoclonal antibody.

9. A method for preparing an anti-S100A monoclonal antibody, characterized in that: The nucleic acid molecule described in claim 5 or 6 is introduced into a host cell, the cell supernatant is collected, and purified by ultrafiltration.

10. The method for preparing the anti-S100A monoclonal antibody according to claim 9, characterized in that: The host cell is HEK293 cell.

Citation Information

Patent Citations

  • Detection kit for S100B protein and using method of detection kit

    CN111487407A

  • Antibodies against the s100p protein for the treatment and diagnosis of cancer

    WO2012098124A1