Anti-human TRPS1 monoclonal antibody as well as preparation method and application thereof

Abstract

The invention discloses an anti-human TRPS1 monoclonal antibody as well as a preparation method and application thereof, and belongs to the technical field of immunology. The anti-human TRPS1 monoclonal antibody provided by the invention comprises a VHCDR1, a VHCDR2 and a VHCDR3 of which the amino acid sequences are shown as SEQ ID NO.1-3, and a VLCDR1, a VLCDR2 and a VLCDR3 of which the amino acid sequences are shown as SEQ ID NO.4-6. The anti-human TRPS1 monoclonal antibody provided by the invention can be used for preparing the anti-human TRPS1 monoclonal antibody. The invention also provides nucleotide sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody, an expression cassette containing the nucleotide sequences, an expression vector, a recombinant cell and a recombinant bacterium. Therefore, the monoclonal antibody can be prepared by using a genetic engineering technology, and risk factors occurring in the traditional monoclonal antibody production and storage process are avoided. The monoclonal antibody prepared by the invention is stable in property, high in experimental repeatability and high in titer, and has good specificity and affinity to TRPS1 protein.

Description

Technical Field

[0001] The invention relates to an anti-human TRPS1 monoclonal antibody and a preparation method and application thereof, belonging to the technical field of immunology. Background Art

[0002] TRPS1, also known as the transcriptional repressor GATA binding 1 gene, is a member of the atypical GATA transcription factor family (containing only one GATA zinc finger domain). The protein encoded by this gene plays a key role in a variety of biological processes, including bone development, skin and hair morphological characteristics, and has attracted much attention in many physiological and pathological processes, mainly because TRPS1 gene mutations lead to loss of TRPS1 protein function, thereby causing clinical features such as sparse hair, protruding nose, and abnormal bone development.

[0003] Studies in recent years have shown that TRPS1 is considered a marker for cancer and is specifically expressed in a variety of tissues. Its expression pattern is significantly different from other related biomarkers. The specific expression of TRPS1 makes it an important marker for distinguishing TRPS1-related diseases from other types of diseases. Studies have shown that the expression level of TRPS1 in prostate cancer cells often changes. The expression of TRPS1 protein in normal prostate tissue is usually low, but the expression level of TRPS1 in prostate cancer tissue can be significantly increased. This change may be closely related to the occurrence and development of prostate cancer; the same is true for the expression of TRPS1 in ovarian cancer tissue; and in breast cancer tissue, the expression level of TRPS1 protein can show heterogeneity. Although TRPS1 protein may be highly expressed in some breast cancer cases, its expression level may be low or undetectable in other cases. These results indicate that the expression level of TRPS1 protein may be associated with the progression and prognosis of cancer.

[0004] Lennartz M et al. N, D,Dwertmann Rico S,vonBargen C,Kind S,Reiswich V,Viehweger F,Lutz F,Bertram V,Fraune C,Gorbokon N,Weidemann S,Blessin NC,Hube-Magg C,Menz A,Schlichter R,Krech T,Hinsch A,Burandt E,Sauter G,Simon R,Kluth M,Marx AH,Lebok P,Dum D,Minner S,Jacobsen F,Clauditz TS,Bernreuther C,Steurer S.TRPS1 is a Highly Sensitive Marker forBreast Cancer:A Tissue Microarray Study Evaluating More Than19,000Tumors From152Different Tumor Entities.Am J Surg Pathol.2024Jun 1;48(6):637-651.doi:10.1097 / PAS.0000000000002213.Epub 2024Apr 18.PMID:38647255;PMCID:PMC11093513.) To determine the diagnostic and prognostic value of TRPS1 IHC, tissue microarrays of 19,201 samples of 152 different tumor types and subtypes were analyzed, and the data showed that TRPS1 staining was seen in 86 of the 152 tumor categories, and 36 of them had at least one strongly positive case. TRPS1 staining was predominant in multiple types of breast cancer (51%-100%), soft tissue tumors (up to 100%), salivary gland tumors (up to 46%), squamous cell carcinomas (up to 35%), and gynecological cancers (up to 40%). Low TRPS1 expression is associated with high tumor grade, high pT stage, lymph node metastasis, hormone receptor loss, and triple-negative breast cancer characteristics. Therefore, the development of anti-TRPS1 monoclonal antibodies can provide a powerful tool for early diagnosis of tumors, and also help evaluate the biological characteristics of tumors and patient prognosis.

[0005] Currently, there are challenges in the research on TRPS1 protein, such as: TRPS1 protein is large and contains zinc finger domains and phosphorylation sites, so the protein expression and purification process is relatively complicated, resulting in difficulty in obtaining high-quality TRPS1 protein. Although some anti-TRPS1 antibodies have been developed and used in research, existing antibodies often lack sufficient specificity and affinity, which limits their effectiveness in basic research and clinical applications. Moreover, the preparation of most TRPS1 polyclonal antibodies on the market currently relies on immunization with TRPS1 recombinant protein fragments or synthetic peptides, and these methods often face problems such as difficult expression and poor specificity. Summary of the invention

[0006] The first object of the present invention is to provide an anti-human TRPS1 monoclonal antibody, and to provide an anti-human TRPS1 monoclonal antibody with good specificity and reliability.

[0007] The second object of the present invention is to provide the use of anti-human TRPS1 monoclonal antibodies in the preparation of TRPS1 detection reagents or kits, and to provide a method with good specificity and reliability for preparing detection reagents or kits for detecting TRPS1 protein.

[0008] The third object of the present invention is to provide a detection reagent or a kit, to provide a detection reagent or a kit for detecting TRPS1 protein with good specificity and reliability.

[0009] The fourth object of the present invention is to provide a nucleic acid molecule, which can stably express an anti-human TRPS1 monoclonal antibody.

[0010] The fifth object of the present invention is to provide an expression cassette, an expression vector, a recombinant cell or a recombinant bacterium comprising the above nucleic acid molecule, and to provide a molecular biology tool capable of stably expressing anti-human TRPS1 monoclonal antibodies.

[0011] The sixth object of the present invention is to provide the use of the above-mentioned nucleic acid molecules, expression cassettes, recombinant vectors, recombinant cells or recombinant bacteria in the preparation of anti-human TRPS1 monoclonal antibodies, and to provide a simple and stable method for producing anti-human TRPS1 monoclonal antibodies.

[0012] The seventh objective of the present invention is to provide a method for preparing an anti-human TRPS1 monoclonal antibody to solve the problem in the prior art that the anti-human TRPS1 monoclonal antibody is obtained by traditional immunization of animals, resulting in batch differences, low yield, and poor antibody stability, or the problem that the antibody gene is lost by the hybridoma method.

[0013] In order to achieve the above object, the technical solution adopted by an anti-human TRPS1 monoclonal antibody in the present invention is:

[0014] An anti-human TRPS1 monoclonal antibody comprises VHCDR1, VHCDR2 and VHCDR3 whose amino acid sequences are shown in SEQ ID NOs. 1 to 3, and VLCDR1, VLCDR2 and VLCDR3 whose amino acid sequences are shown in SEQ ID NOs. 4 to 6.

[0015] The beneficial effect of the above technical solution is that: the anti-human TRPS1 monoclonal antibody of the present invention is a pioneering invention. The present invention selects 1-200aa of the TRPS1 head and 945-1050aa of the tail, uses the recombinant protein connected by Linker as the antigen of the TRPS1 protein, immunizes animals to obtain hybridoma cells, and screens out a hybridoma cell line that can secrete anti-TRPS1 specific antibodies. The secreted anti-human TRPS1 monoclonal antibody comprises VHCDR1, VHCDR2 and VHCDR3 as shown in SEQ ID NO.1-3, and VLCDR1, VLCDR2 and VLCDR3 as shown in SEQ ID NO.4-6. It has been verified by experiments that it has the advantages of stable properties, good specificity and affinity.

[0016] Specifically, the TRPS1 antigen prepared by the present invention can achieve the expected immune effect, can effectively stimulate the immune response, achieve the expected immune effect, avoid the problem that the TRPS1 protein is too large and difficult to express, and avoid the low specific immune effect that is easily produced when the TRPS1 full-length recombinant protein is used as an immunogen, thereby improving the immune hit rate of TRPS1. By expressing the head and tail domains of TRPS1 in series, the non-specific immune response that may be caused by the full-length protein can be reduced, thereby improving the specificity of immunity and the hit rate of the antibody, and then obtaining an anti-human TRPS1 monoclonal antibody comprising VHCDR1, VHCDR2 and VHCDR3 as shown in amino acid sequences such as SEQ ID NO.1 to 3, and VLCDR1, VLCDR2 and VLCDR3 as shown in amino acid sequences such as SEQ ID NO.4 to 6.

[0017] As a further improvement, the heavy chain variable region of the anti-human TRPS1 monoclonal antibody has an amino acid sequence as shown in SEQ ID NO.7, and the light chain variable region has an amino acid sequence as shown in SEQ ID NO.8.

[0018] In order to achieve the above-mentioned purpose, the technical scheme adopted by the application of anti-human TRPS1 monoclonal antibody in the preparation of TRPS1 detection reagent or kit in the present invention is:

[0019] The invention discloses an application of an anti-human TRPS1 monoclonal antibody in preparing a TRPS1 detection reagent or a kit.

[0020] The beneficial effect of the above technical solution is that: the present invention has been verified by experiments that the anti-human TRPS1 monoclonal antibody has good specificity and affinity, and can be used to prepare TRPS1 detection reagents or kits to detect the expression of TRPS1 in tissues and cells.

[0021] Specifically, the anti-human TRPS1 monoclonal antibody can be used to prepare detection reagents or kits that require the anti-human TRPS1 monoclonal antibody, such as immunohistochemistry, Western blot or ELISA.

[0022] In order to achieve the above-mentioned purpose, the technical solution adopted by the detection reagent or kit in the present invention is:

[0023] A detection reagent or a detection kit, comprising the anti-human TRPS1 monoclonal antibody.

[0024] The beneficial effect of the above technical solution is that: the present invention has been verified by experiments that the anti-human TRPS1 monoclonal antibody has good specificity and affinity, and the detection reagent and detection kit containing the anti-human TRPS1 monoclonal antibody can effectively and specifically detect TRPS1 in tissues and cells, providing means and tools for in-depth research on the function of TRPS1.

[0025] Furthermore, the anti-human TRPS1 monoclonal antibody with good specificity and affinity of the present invention can be prepared into immunohistochemical staining, immune cell staining, Western blot or ELISA and other detection reagents or kits for detecting TRPS1 in tissues or cells according to the needs of users, which helps to meet diverse market needs.

[0026] In order to achieve the above-mentioned purpose, the technical solution adopted by the nucleic acid molecule in the present invention is:

[0027] A nucleic acid molecule, wherein the nucleic acid molecule encodes the anti-human TRPS1 monoclonal antibody.

[0028] The beneficial effect of the above technical solution is that: the present invention provides a nucleic acid molecule encoding an anti-human TRPS1 monoclonal antibody, which can be used to quickly, stably and large-scale produce anti-human TRPS1 monoclonal antibodies through genetic engineering.

[0029] Specifically, the nucleic acid molecule can be obtained by genetic engineering recombination technology or chemical synthesis method. It is obvious to those skilled in the art that the variant sequence of the heavy chain variable region nucleotide sequence and / or the light chain variable region nucleotide sequence obtained after one or more nucleotide addition, deletion, substitution, modification or other mutation of the above-mentioned nucleic acid molecule provided by the present invention, the single-chain antibody or chimeric monoclonal antibody or modified monoclonal antibody or other forms of monoclonal antibody or antibody fragment composed of the amino acid sequence encoded by it still retains the ability to specifically bind to TRPS1 protein.

[0030] As a further improvement, the nucleotide sequence of the heavy chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown as SEQ ID NO.9; the nucleotide sequence of the light chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown as SEQ ID NO.10.

[0031] In order to achieve the above-mentioned object, the technical scheme adopted by the expression cassette, expression vector, recombinant cell or recombinant bacteria containing nucleic acid molecules of the present invention is:

[0032] An expression cassette, expression vector, recombinant cell or recombinant bacterium comprising a nucleic acid molecule.

[0033] The beneficial effect of the above technical solution is that: the present invention provides a nucleic acid molecule encoding an anti-human TRPS1 monoclonal antibody, an expression cassette, an expression vector, a recombinant cell and a recombinant bacterium comprising the above nucleic acid molecule, and the anti-human TRPS1 monoclonal antibody is stored in the form of DNA, which is convenient for the later exogenous expression and large-scale industrial production of the anti-human TRPS1 monoclonal antibody.

[0034] Specifically, the expression vector is selected from a prokaryotic or eukaryotic expression vector; further, the expression vector is selected from a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, a mammalian cell virus such as an adenovirus, a retrovirus or other vectors.

[0035] Specifically, the recombinant bacteria are selected from bacteria, yeast, filamentous fungi and other commonly used carrier bacteria in the field of genetic engineering.

[0036] Specifically, the recombinant cells are selected from host cells commonly used in the field of genetic engineering, such as mammalian cells, insect cells, and plant cells.

[0037] In order to achieve the above-mentioned purpose, the technical scheme adopted by the application of nucleic acid molecules or expression cassettes, expression vectors, recombinant cells or recombinant bacteria in the preparation of anti-human TRPS1 monoclonal antibodies in the present invention is:

[0038] The invention discloses an application of a nucleic acid molecule or an expression box, an expression vector, a recombinant cell or a recombinant bacterium in preparing an anti-human TRPS1 monoclonal antibody.

[0039] The beneficial effect of the above technical solution is that: the present invention provides a nucleic acid molecule, an expression cassette, an expression vector, a recombinant cell and a recombinant bacterium comprising the variable region amino acid sequence of the heavy chain and the light chain of the anti-human TRPS1 monoclonal antibody. On this basis, the anti-human TRPS1 monoclonal antibody of the present invention can be obtained by conventional genetic engineering methods, which can effectively avoid the problems of large batch differences and poor stability of the anti-human TRPS1 monoclonal antibody caused by fluctuations in animal and hybridoma cell batches.

[0040] In order to achieve the above-mentioned purpose, the technical scheme adopted in the method for preparing anti-human TRPS1 monoclonal antibody of the present invention is:

[0041] A method for preparing an anti-human TRPS1 monoclonal antibody comprises introducing a nucleic acid molecule into a host cell, collecting the cell supernatant, and purifying and ultrafiltrating the antibody to obtain the antibody.

[0042] The beneficial effect of the above technical scheme is that: the preparation method of the anti-human TRPS1 monoclonal antibody provided by the present invention, compared with traditional monoclonal antibodies, has the advantages of known sequence, long-term storage of antibody genes, stable antibody properties, good experimental repeatability, etc., and is a standardized antibody production process, which avoids the risk factors that occur in the production and storage process of traditional monoclonal antibodies: by using recombinant technology to prepare TRPS1 antibodies, the controllability and traceability of the antibody sequence are ensured, the batch differences and storage problems that may occur in traditional antibody production are solved, and a more stable and reliable antibody tool is provided, which is suitable for long-term and standardized research and application.

[0043] As a further improvement, the host cells include HEK293 cells and CHO cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The Western blot test results of the anti-human TRPS1 mouse monoclonal antibody prepared in Example 5 of the present invention;

[0045] Figure 2 This is a diagram of the immunohistochemistry effect of breast cancer in Example 5 of the present invention (wherein the magnification of the left diagram is 100×, and the magnification of the right diagram is 200×);

[0046] Figure 3 The immunohistochemical effect diagram of lung cancer in Example 5 of the present invention (wherein the magnification of the left diagram is 100×, and the magnification of the right diagram is 200×);

[0047] Figure 4 The results of Western blot detection of the recombinant anti-human TRPS1 mouse monoclonal antibody prepared in Example 5 of the present invention;

[0048] Figure 5The ICH detection result of the recombinant anti-human TRPS1 mouse monoclonal antibody prepared in Example 5 of the present invention in breast cancer tissue (magnification is 100×);

[0049] Figure 6 This is a comparison chart of the effects of the anti-human TRPS1 mouse monoclonal antibody prepared by the present invention and the anti-human TRPS1 rabbit monoclonal antibody of Abcam in ICH detection in breast cancer tissue in Experimental Example 1 of the present invention (wherein the left picture is the anti-human TRPS1 rabbit monoclonal antibody of Abcam [EPR16171], and the right picture is the anti-human TRPS1 mouse monoclonal antibody prepared by the present invention, and the magnification is 100× for both). DETAILED DESCRIPTION

[0050] Although anti-human TRPS1 antibodies have been developed for research in the prior art, there is a problem of lack of anti-scale specificity and affinity, which limits the effectiveness of anti-human TRPS1 antibodies in basic research and clinical applications. Monoclonal antibodies have become an important tool in biomedical research due to their high specificity and consistency. In order to facilitate the preparation of anti-human TRPS1 monoclonal antibodies, the present invention selects two key regions of TRPS1 and connects the key regions, and a connecting element Linker is used at the connection. The addition of Linker can maintain the independence of the two key regions and prevent the appearance of tandem epitopes at the connection, and prepares anti-human TRPS1 monoclonal antibodies containing VHCDR1, VHCDR2 and VHCDR3 as shown in amino acid sequences such as SEQ ID NO.1 to 3, and VLCDR1, VLCDR2 and VLCDR3 as shown in amino acid sequences such as SEQ ID NO.4 to 6.

[0051] Furthermore, the anti-human TRPS1 monoclonal antibody provided by the present invention was tested by Western blot (WB) and immunohistochemistry (IHC). Compared with the polyclonal antibodies prepared with recombinant proteins or synthetic polypeptides commonly used on the market, the TRPS1 monoclonal antibody prepared by the present invention performed excellently in terms of specificity and stability, and also had good specificity and reliability in the study of TRPS1-related diseases.

[0052] The present invention is further described in detail below in conjunction with specific examples. Unless otherwise specified, the equipment and reagents used in each embodiment, experimental example and comparative example can be obtained from commercial sources.

[0053] 1. Specific embodiments of an anti-human TRPS1 monoclonal antibody of the present invention:

[0054] Example 1 Anti-human TRPS1 monoclonal antibody

[0055] The anti-human TRPS1 monoclonal antibody of this embodiment comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO. 7 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO. 8. The heavy chain variable region comprises VHCDR1, VHCDR2 and VHCDR3 as shown in SEQ ID NOs. 1 to 3, and the light chain variable region comprises VLCDR1, VLCDR2 and VLCDR3 as shown in SEQ ID NOs. 4 to 6.

[0056] 2. Specific embodiment of a detection reagent of the present invention:

[0057] Example 2 A detection reagent

[0058] The detection reagent of this embodiment is an immunohistochemistry detection reagent, which is the anti-human TRPS1 monoclonal antibody working solution of Example 1, the concentration of the monoclonal antibody is 0.1 μg / mL, the solvent is TBS buffer, which contains BSA (bovine serum albumin) with a concentration of 10 mg / mL and preservatives Proclin-300 and Proclin-950, and the preservatives are added at a ratio of 1:1000 (V / V).

[0059] 3. Specific embodiments of a nucleic acid molecule of the present invention:

[0060] Example 3 A nucleic acid molecule

[0061] The nucleic acid molecule of this example encodes the anti-human TRPS1 monoclonal antibody in Example 1, wherein the nucleotide sequence of the heavy chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO.9; the nucleotide sequence of the light chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO.10.

[0062] IV. A specific embodiment of a recombinant cell comprising the nucleic acid molecule of the present invention:

[0063] Example 4 A recombinant cell comprising the nucleic acid molecule

[0064] The recombinant cells of this example are CHO-K1 cells as starting cells, and are transfected with a recombinant expression vector that exogenously expresses the nucleic acid molecule in Example 3.

[0065] V. Specific examples of a method for preparing an anti-human TRPS1 monoclonal antibody of the present invention:

[0066] Example 5 A method for preparing an anti-human TRPS1 monoclonal antibody

[0067] The preparation method of the anti-human TRPS1 monoclonal antibody of this embodiment selects the TRPS1 head 1-200aa and the tail 945-1050aa, uses the recombinant protein composed of Linker connection as the immunogen, immunizes mice, isolates hybridoma cells, and specifically detects the anti-human TRPS1 monoclonal antibody secreted by the hybridoma cells. Then, the gene of the anti-human TRPS1 monoclonal antibody is retrieved, the antibody heavy chain and light chain gene information is determined, the heavy chain and light chain genes are amplified and connected to the expression vector, the cells are transfected, and the cell supernatant is purified and concentrated to obtain the anti-human TRPS1 monoclonal antibody. The specific implementation operation is as follows:

[0068] 1. Selection of TRPS1 head and tail

[0069] The head and tail sequences were selected according to the TRPS1 sequence and structure published by Uniprot, and the head and tail sequences were selected by bioinformatics analysis for the preparation of TRPS1 immunogens. The Uniprot accession number of human TRPS1 is Q9UHF7, which contains 1281 amino acids, of which 1-200aa is its head and 945-1050aa is its tail. The amino acid sequence of TRPS1 head-linker-tail protein is shown in SEQ ID NO.11, and the nucleic acid sequence is shown in SEQ ID NO.12.

[0070] 2. Fusion expression and purification of antigens

[0071] (1) Synthesis of TRPS1 head and tail nucleic acid sequences and vector construction

[0072] According to the selected TRPS1 head 1-200aa and tail 945-1050aa nucleic acid sequences, linker was inserted to artificially synthesize TRPS1(1-200aa)-linker-TRPS1(945-1050aa), and restriction sites NdeI and XhoI were introduced at both ends of the sequence. The synthesized tandem nucleic acid sequence was cloned into the pET-28a expression vector to construct the recombinant plasmid pET-28a-TRPS1(1-200aa)-linker-TRPS1(945-1050aa).

[0073] (2) Transformation and expression analysis of recombinant plasmids

[0074] The pET-28a-TRPS1(1-200aa)-linker-TRPS1(945-1050aa) recombinant plasmid constructed above was transformed into BL21(DE3) E. coli competent cells, and a single colony was picked and inoculated into 4 mL of LB liquid medium containing kanamycin (50 μg / mL) for culture. Subsequently, IPTG with a final concentration of 1 mM was added to induce expression analysis, and the strain that can express the TRPS1 target protein was preserved.

[0075] (3) Large-scale expression of recombinant proteins

[0076] The strain capable of expressing the TRPS1 target protein in step (2) was inoculated into 350 mL of LB liquid culture medium containing kanamycin (50 μg / mL) and cultured at 37°C until OD 600 When the p value reached 0.8, IPTG was added to a final concentration of 0.4 mM and the expression was induced at 37°C for 4 hours.

[0077] (4) Collection and ultrasonic disruption of bacteria

[0078] The cells induced by expression in step (3) were collected by centrifugation and resuspended in 10 mM PBS in an ice bath. Subsequently, the cells were disrupted by ultrasound (350 W, for 20 minutes, 3 seconds on, 3 seconds off). After disruption, the cells were centrifuged at 12000 g for 10 minutes, and the supernatant solution was collected for the next step of purification.

[0079] (5) Nickel agarose gel purification

[0080] The supernatant collected in step (4) was filtered through a 0.45 μm filter, and the obtained filtrate was purified by nickel agarose gel. The filtrate was loaded onto a balanced nickel agarose gel column at a flow rate of 1 mL / min, and washed with 10 mM PBS to remove unbound impurity proteins. Afterwards, linear elution was performed with PBS containing 0.5 M imidazole, and different elution peaks were collected for SDS-PAGE to identify the purity of the protein. Samples with a purity greater than 90% were ultrafiltered and the solution was exchanged into 10 mM PBS for subsequent experiments.

[0081] 3. TRPS1 hybridoma cell line screening and monoclonal antibody preparation

[0082] (1) Immunization and antibody screening

[0083] The TRPS1 protein purified in step 2 was mixed with an equal volume of Freund's complete adjuvant and immunized 6-8 week old BalB / c mice by subcutaneous injection. The immunization dose for each mouse was 100 μg. Two weeks later, the second immunization was performed, the antigen was emulsified with Freund's incomplete adjuvant, the immunization dose was the same as the first, and the intraperitoneal injection method was used. After the second immunization, the tail blood was taken and the serum titer was determined by gradient dilution using the indirect ELISA method. The mice with the highest antibody titer were selected for tail vein shock immunization, and the shock dose was 50 μg / mouse.

[0084] (2) Cell fusion

[0085] Use sp2 / 0 myeloma cells derived from BalB / c mice, and the cells should be in the logarithmic growth phase. Aseptically remove the spleen of the mouse after shock immunization and prepare a single cell suspension of spleen cells. Mix the mouse spleen cells and myeloma cells in a ratio of 1:5, add 1mL of 50% PEG (pH8.0) at 37°C, mix well, and add HT selective culture medium. After centrifugation, discard the supernatant, add HAT culture medium, mix well, make up to 50mL, and add dropwise to a 96-well cell culture plate. Place the culture plate at 37°C and 5% CO 2 Culture in a constant temperature incubator.

[0086] (3) Screening and cloning

[0087] Within 7-10 days after fusion, cell clones were selected and screened (ELISA method). The positive well cells were subjected to limiting dilution, and the ELISA value was measured 5-6 days after each limiting dilution. 450 The monoclonal wells with higher positive values ​​were further diluted until the results of the entire 96-well plate were positive by ELISA, and finally the monoclonal cell lines with higher positive values ​​were selected for confirmation.

[0088] (4) Preparation and purification of ascites monoclonal antibodies

[0089] BalB / c mice aged 8-10 weeks were intraperitoneally injected with 0.5 mL of liquid paraffin. One week later, each mouse was intraperitoneally injected with a 1 mL syringe with a monoclonal cell suspension washed with PBS and resuspended. Each cell line was injected with 5 × 10 6 cells / mouse, 3 mice in total. After the ascites of the mice accumulated, the ascites was collected and the supernatant was obtained by centrifugation. The ascites was purified by Protein A column chromatography, the concentration of the purified monoclonal antibody was determined, and the purified monoclonal antibody was aliquoted and frozen at -20°C.

[0090] 4. Western-Blot detection of the specificity of TRPS1 monoclonal antibodies

[0091] (1) Sample preparation

[0092] The prior art records that TRPS1 is expressed in 293T cells and HeLa cell lines, but not in Jurket cell lines. Therefore, in order to verify the specificity of TRPS1 monoclonal antibodies, human HeLa cells, 293T cells, and Jurket cells were prepared and lysed using RAPI lysis buffer containing 1mM PMSF. After lysis, the sample was mixed with 5×SDS-PAGE Loading buffer in a volume ratio of 1:1 for sample preparation.

[0093] (2) Electrophoresis and membrane transfer

[0094] 30 μg of each sample was loaded and subjected to SDS-PAGE electrophoresis with an initial voltage of 80 V for 20 min, then the voltage was adjusted to 120 V and electrophoresis was continued until the bromophenol blue dye ran to the bottom of the gel.

[0095] After electrophoresis, transfer to membrane: soak NC membrane and filter paper with transfer buffer in advance. Place the sample and membrane in a sandwich form in a wet transfer instrument in the following order: electrode (-)-sponge-filter paper-gel-NC membrane-filter paper-sponge-electrode (+), and transfer at a constant voltage of 90V for 90 minutes.

[0096] (3) Closed

[0097] The NC membrane was immersed in blocking solution (TBST containing 5% skim milk) and incubated at 37°C for 2 hours for blocking treatment to reduce nonspecific binding.

[0098] (4) Primary antibody incubation

[0099] The NC membrane was placed in a blocking solution containing anti-human TRPS1 monoclonal antibody (2.5 mg / mL antibody was diluted 1:2000) and incubated in a 37°C incubator for 1 hour. After incubation, the membrane was washed 3 times with TBST for 5 minutes each time to remove unbound primary antibody.

[0100] (5) Secondary antibody incubation

[0101] The NC membrane was placed in HRP-labeled goat anti-mouse IgG secondary antibody (diluted at 1:5000) and incubated in a shaker at 37°C for 30 minutes. After incubation, the membrane was washed 3 times with TBST for 5 minutes each time to remove unbound secondary antibody.

[0102] (6) Color rendering

[0103] After mixing component A and component B in the ECL luminescent solution at a ratio of 1:1, add them to the NC membrane for color development. Use an exposure device to expose the NC membrane to observe and record the protein bands of TRPS1.

[0104] WB results are as follows Figure 1As shown, the TRPS1 target band appeared in 293T and HeLa cell lysate samples, but not in Jurket cell lysate, indicating that the anti-human TRPS1 monoclonal antibody has good specificity.

[0105] 5. Specificity of TRPS1 monoclonal antibody detected by immunohistochemistry (IHC)

[0106] (1) Preparation of tissue sections

[0107] Paraffin-embedded blocks of human breast cancer and lung cancer tissue were taken and sliced ​​using a Leica tissue slicer with a slice thickness set to 3 μm. After slicing, the slices were dry-baked at 65°C for 2 hours to remove excess paraffin and perform preliminary fixation.

[0108] (2) Immunohistochemical staining

[0109] The manual immunohistochemistry method was used to perform immunohistochemical staining test on anti-human TRPS1 monoclonal antibody. The specific steps are as follows

[0110] ①Use DAKO HIGH pH repair solution for high temperature antigen repair, and the repair time is 20 minutes.

[0111] ② After the slices have cooled, add 100 μL of endogenous peroxidase blocking solution and incubate at room temperature for 5 minutes to block endogenous peroxidase activity. Then, soak the slices in cleaning solution (PBS or TBS) twice, each time for 5 minutes.

[0112] ③ Primary antibody incubation: Use TRPS1 monoclonal antibody, dilute at a ratio of 1:1000, take 100 μL of the diluted antibody and drop it on the slice, and incubate at 37°C for 30 minutes. After incubation, soak the slice in cleaning solution twice, 5 minutes each time, to remove unbound primary antibody.

[0113] ④ Add 100 μL of enzyme-labeled polymer and incubate at room temperature for 20 minutes. After incubation, soak the sections in the cleaning solution twice, each time for 5 minutes.

[0114] ⑤ Use DAB color developing solution for color development: add 100 μL DAB color developing solution and incubate at room temperature for 5 minutes. After color development is completed, soak the sections in purified water twice, 5 minutes each time.

[0115] ⑥Re-staining: Add 100 μL of hematoxylin to re-stain the sections and incubate at room temperature for 5 minutes. After re-staining, rinse the sections with tap water to perform blueing.

[0116] (3) Dehydration, transparency and sealing

[0117] ① Wash the slices with deionized water for 3 minutes.

[0118] ② Dehydration treatment was performed in sequence: 85% ethanol for 1 minute; 95% ethanol for 1 minute; 100% ethanol for 1 minute, and repeated twice.

[0119] ③ Treat the sections with xylene for 1 minute and repeat twice to achieve a transparent effect.

[0120] ④Finally, use neutral gum to seal the slide and cover it with a coverslip.

[0121] (4) Microscope observation

[0122] Observe the staining results under a microscope. Figure 2 and Figure 3 As shown, TRPS1 protein is localized in the cell nucleus and shows specific expression in breast cancer tissue and lung cancer tissue. The staining results are expected to show specific intranuclear positive signals.

[0123] 6. TRPS1 antibody gene retrieval

[0124] (1) Total RNA extraction

[0125] Resuscitate TRPS1 hybridoma cell line, collect cells after testing cell titer. Add 1mL Trizol to the cell suspension, mix thoroughly by blowing, and let stand at room temperature for 5-10 minutes until the cells are completely lysed. Then centrifuge at 12000rpm for 5 minutes and discard the precipitate. Add 200μL chloroform to the supernatant, mix vigorously by inversion, let stand for 15 minutes, and then centrifuge at 12000rpm at 4℃ for 15 minutes, and take the upper aqueous phase. Add an equal volume of isopropanol, mix gently, let stand for 10 minutes, centrifuge at 12000rpm at 4℃ for 10 minutes, and discard the supernatant. Add 1mL pre-cooled 75% ethanol to the precipitate, flick the bottom of the tube to mix, centrifuge again at 12000rpm at 4℃ for 5 minutes, discard the supernatant, dry at room temperature for several minutes, and add 30-50μL pre-cooled DEPC water to dissolve to obtain RNA product. RNA product can be stored at -80℃ for a long time. Masks and gloves should be worn during the entire RNA extraction process to prevent RNase contamination.

[0126] (2) 5' RACE to obtain the TRPS1 antibody gene

[0127] Use SMARTer RACE 5' / 3'Kit (Clontech, Cat. No. 634859) to isolate the 5' sequence of the antibody of TRPS1. Take 1 μg of total RNA as a template, use the 5'-CDS primer A, SMART II A oligo and 3'-CDSprimer A provided by the kit, and perform first-strand cDNA synthesis according to the instructions to prepare 5'-RACE-Ready cDNA. Then use these cDNAs as templates for PCR amplification, i.e., rapid amplification of cDNA ends (RACE). In the 5'-RACE PCR reaction, UPM (Universal Primer) and GSP (gene specific primer) primers designed according to the specific sequence of the TRPS1 gene are used.

[0128] The reaction system of the first round of PCR was 50 μL, the components were shown in Table 1, and the PCR reaction procedure was shown in Table 2.

[0129] Table 1 PCR reaction system

[0130] Components Dosage 5'-RACE-Ready cDNA cDNA 2.5μL 10×UPM 5μL 10 μM GSP 1μL 2×SeqAmp buffer 25μL SeqAmp DNA polymerase 1μL <![CDATA[ddH 2 The]]> 15.5μL

[0131] Table 2 PCR reaction program

[0132]

[0133] The PCR product was stored at 4°C. Take 5 μL of the PCR product and perform electrophoresis on a 1.0% agarose gel. If the electrophoresis results show a single band, cut the gel to recover the remaining product and clone it into the pRACE vector, then select the positive clone for sequencing. If the electrophoresis results show that the band is not single, nested PCR is required for further amplification, and then the product is cloned into the pRACE vector, and the positive clone is selected for sequencing to finally obtain the TRPS1 antibody gene.

[0134] 7. Preparation of recombinant monoclonal antibodies

[0135] (1) Determination of antibody heavy chain and light chain gene information and IMGT database analysis

[0136] After sequencing analysis, the nucleotide sequence of the heavy chain variable region gene of the anti-human TRPS1 monoclonal antibody of the present invention is shown as SEQ ID NO.9, and the amino acid sequence is shown as SEQ ID NO.7; the nucleotide sequence of the light chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown as SEQ ID NO.10, and the amino acid sequence is shown as SEQ ID NO.8. Further analysis revealed that the amino acid sequences of the heavy chain variable region VHCDR1-3 of the monoclonal antibody are shown as SEQ ID NO.1-3, respectively; and the amino acid sequences of the light chain variable region VLCDR1-3 of the monoclonal antibody are shown as SEQ ID NO.4-6, respectively.

[0137] (2) Primer design and vector construction

[0138] Light chain primers and heavy chain primers were designed according to the sequencing results. The primer sequences are as follows:

[0139] Light chain forward primer (LF): TAAACGGATCTCTAGCGAATTCATGGAGTCAGACACACTCCTG (as shown in SEQ ID NO.13);

[0140] Light chain reverse primer (LR): CGAGCGGCCGCTAGCAAGCTTTCAACACTCATTCCTGTTGAAG (as shown in SEQ ID NO.14);

[0141] Heavy chain forward primer (HF): TAAACGGATCTCTAGCGAATTCATGGGCTTGGGTGTGGACCTG (as shown in SEQ ID NO. 15);

[0142] Heavy chain reverse primer (HR): CGAGCGGCCGCTAGCAAGCTTTTATTTACCAGGAGAGTGGGAGAG (as shown in SEQ ID NO. 16).

[0143] Using the cDNA obtained in step 6 as a template, amplification was performed using PrimeSTAR Max DNA Polymerase (TAKARA Code No. R045Q). The PCR reaction conditions are shown in Table 3.

[0144] Table 3 PCR reaction conditions

[0145]

[0146] After 3 hours of EcoR I / Hind III double digestion of the PCR amplified fragment and the pTT5 vector, the gel was cut and recovered by agarose gel electrophoresis, and the gel-cut fragments were recovered. Then, the antibody expression vector was constructed by recombination, and the positive clones with correct sequencing were subjected to plasmid extraction for standby use.

[0147] (3) Expression and purification of anti-human TRPS1 recombinant antibodies

[0148] 1) Cell culture before transfection

[0149] CHO-K1 cells were placed in 5% CO 2 In a constant temperature shaker, perform constant temperature shaking culture at 37°C and 120rpm. Before subculturing, count the cells and confirm the density. After centrifugation, add the cell suspension directly to the culture medium in proportion. If there are too many dead cells, discard the batch of cells and use new cells.

[0150] 2) Preparation of transfected cells

[0151] Before transient transfection, determine the cell density and viability; dilute the cells to a density of 3 × 10 cells / mL without centrifugation. 6 / ml, and incubate at 37°C, 120 rpm for 10 minutes before transfection.

[0152] 3) Time-dependent transfection

[0153] Use a 15 mL sterile centrifuge tube to mix 5 mL of KPM and sterile plasmid DNA in a heavy chain: light chain ratio of 1:1, and gently pipette to mix; take another 15 mL sterile centrifuge tube, add 5 mL of KPM and 500 μL of TA-CHO transfection reagent, and gently pipette to mix; mix the contents of the two centrifuge tubes and let stand for 10 minutes to prepare the plasmid-vector complex; then, add the complex to the cell suspension and return to 37 °C CO 2 Incubate the culture in a constant temperature shaker. Add appropriate amount of antibiotics as needed after 3 hours.

[0154] 4) Product expression

[0155] 600 μL CHO cell protein expression enhancer can be added 24 hours after transfection; transient transfection nutrient additives can be added 24 hours after transfection; cell supernatant can be collected 6-8 days after transfection.

[0156] 5) Antibody purification

[0157] The cell culture supernatant was purified using a Protein G column, and the antibodies were collected and concentrated in PBS (pH 7.4) by ultrafiltration.

[0158] 6) Validation of anti-human TRPS1 monoclonal antibody

[0159] The effect of the purified anti-human TRPS1 monoclonal antibody was verified by WB. The specific operation steps were as described in step 4. The results were as follows: Figure 4 As shown in the figure, the TRPS1 target band appeared in the 293T and HeLa cell lysate samples.

[0160] The specific implementation steps for verification using IHC on breast cancer tissue are as described in step 5, and the results are as follows Figure 5 As shown in the figure, TRPS1 protein is localized in the cell nucleus and shows specific expression in breast cancer tissue. The staining results are expected to show specific intranuclear positive signals.

[0161] Experimental Example 1

[0162] Currently, there are few TRPS1 monoclonal antibody products on the market, and rabbit monoclonal antibodies are the main ones. Among them, abcam's rabbit monoclonal antibody TRPS1 (EPR16171) is widely used. In this experimental example, abcam's rabbit monoclonal antibody TRPS1 (EPR16171) is used to perform ICH detection on human breast cancer tissue. The specific operation steps are as described in step 5 in Example 5.

[0163] Specific test results such as Figure 6 As shown, it can be seen from the figure that the rabbit monoclonal antibody TRPS1 (EPR16171) of abcam on the market and the anti-human TRPS1 monoclonal antibody provided in Example 5 of the present invention show specific expression in breast cancer tissue, and the staining results are expected to show specific intranuclear positive signals. Moreover, under the conditions of the same concentration and dilution multiple, when the anti-human TRPS1 monoclonal antibody provided by the present invention is used for immunohistochemical staining, the positive signal is stronger and the effect is better, which is more suitable for detecting tissues and cells with low expression of TRPS1.

[0164] The above results show that the anti-human TRPS1 monoclonal antibody provided by the present invention has comparable specificity and sensitivity to the rabbit monoclonal antibody TRPS1 (EPR16171) of abcam commonly used on the market; and the anti-human TRPS1 monoclonal antibody provided by the present invention is a unique mouse monoclonal antibody engineered antibody on the market, which can meet the different needs of consumers.

[0165] In summary, the present invention provides the variable region amino acid sequences of the heavy chain and light chain of the anti-human TRPS1 monoclonal antibody. On this basis, the monoclonal antibody of the present invention can be obtained by conventional antibody engineering methods. The specific method is described in the embodiments of the present invention. WB and IHC specificity verification tests have proved that the obtained anti-human TRPS1 recombinant antibody can specifically recognize human TRPS1 protein and can be used for WB and IHC immunohistochemistry detection. Compared with the traditional monoclonal antibody preparation method, the anti-human TRPS1 monoclonal antibody prepared by the genetic engineering method of the present invention has the advantages of known sequence, stable antibody properties, good repeatability, etc., and the standardized antibody production process avoids the risk factors that occur during the production and storage of traditional monoclonal antibodies. Furthermore, on the basis of the antibody amino acid sequence provided by the invention, one or more amino acids can also be added, deleted, replaced, etc. to obtain its active fragment or conservative variant, which lays the foundation for further improving the specificity and affinity of the antibody.

[0166] Finally, it is noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An anti-human TRPS1 monoclonal antibody, characterized in that: The anti-human TRPS1 monoclonal antibody comprises VHCDR1, VHCDR2 and VHCDR3 whose amino acid sequences are shown in SEQ ID NOs. 1 to 3, and VLCDR1, VLCDR2 and VLCDR3 whose amino acid sequences are shown in SEQ ID NOs. 4 to 6.

2. The anti-human TRPS1 monoclonal antibody according to claim 1, characterized in that: The heavy chain variable region of the anti-human TRPS1 monoclonal antibody has an amino acid sequence as shown in SEQ ID NO.7, and the light chain variable region has an amino acid sequence as shown in SEQ ID NO.

8.

3. Use of the anti-human TRPS1 monoclonal antibody according to claim 1 or 2 in the preparation of a TRPS1 detection reagent or kit.

4. A detection reagent or kit, characterized in that: The detection reagent or detection kit comprises the anti-human TRPS1 monoclonal antibody according to claim 1 or 2.

5. A nucleic acid molecule, characterized in that: The nucleic acid molecule encodes the anti-human TRPS1 monoclonal antibody according to claim 1 or 2.

6. The nucleic acid molecule according to claim 5, characterized in that: The nucleotide sequence of the heavy chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO.9; the nucleotide sequence of the light chain variable region gene of the anti-human TRPS1 monoclonal antibody is shown in SEQ ID NO.

10.

7. An expression cassette, expression vector, recombinant cell or recombinant bacterium comprising the nucleic acid molecule according to claim 5 or 6.

8. Use of the nucleic acid molecule according to claim 5 or 6 or the expression cassette, expression vector, recombinant cell or recombinant bacterium according to claim 7 in the preparation of anti-human TRPS1 monoclonal antibodies.

9. A method for preparing an anti-human TRPS1 monoclonal antibody according to claim 1 or 2, characterized in that: The nucleic acid molecule according to claim 5 or 6 is introduced into a host cell, the cell supernatant is collected, and purified by ultrafiltration.

10. The method for preparing an anti-human TRPS1 monoclonal antibody according to claim 9, characterized in that: The host cells include HEK293 cells and CHO cells.

Images