An aav vector for gene targeting and expression and construction method and application thereof

CN116217658BActive Publication Date: 2026-06-26SHANGHAI OPHTHAL-BRIGHT BIOMEDICINE TECH
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI OPHTHAL-BRIGHT BIOMEDICINE TECH
Filing Date
2022-09-19
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

In existing AAV virus packaging systems, wild-type AAV capsid proteins exhibit poor infectivity and low targeting specific cells, leading to the need for higher doses to achieve the desired effect in clinical applications and increasing the risk of immune responses.

Method used

Using phage display technology, the peptide LANKVVDKWA was screened and inserted into a specific site of the AAV-8 serum capsid protein to construct a modified AAV vector, which enhanced its ability to infect cerebellar, motor cortex, striatum, retinal ganglion isolated cells, Neuro2A cells, MULLER cells, SH-SY-5Y cells, JURKAT cells, K562 cells, and THP1 cells.

Benefits of technology

The modified AAV vector showed a stronger infection effect when infecting the above-mentioned cells, significantly improving the infectivity of AAV-8 and advancing the application of gene therapy in the treatment of motor cortex-related diseases and leukemia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116217658B_ABST
    Figure CN116217658B_ABST
Patent Text Reader

Abstract

The application provides a polypeptide for targeting and an AAV vector for gene targeting and expression. The AAV vector comprises a nucleotide sequence encoding a modified capsid protein of an AAV-8 type serum, wherein the modified capsid protein is inserted with the polypeptide between the 590th amino acid and the 591st amino acid of the AAV-8 type serum capsid protein. The application also provides a recombinant adeno-associated virus particle comprising the modified capsid protein. In addition, the application also discloses a construction method and application of the polypeptide, the AAV vector and the recombinant adeno-associated virus particle. Compared with a vector expressing an AAV-8 type serum capsid protein, a cell and a tissue infected with the AAV vector can obtain a stronger fluorescence effect, and in the case of using the same virus amount, the AAV-8 type serum has a better expression effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and biotechnology, specifically relating to the screening, construction, and application of an AAV vector for gene targeting and expression. Background Technology

[0002] Adeno-associated virus (AAV) is a non-pathogenic parvovirus with DNA defects. Recombinant adeno-associated virus vectors (rAAV) are derived from non-pathogenic wild-type AAV. The natural tropism of the virus makes targeted delivery of therapy using AAV possible. As a small, non-enveloped cell virus, rAAV offers many advantages in delivery systems, such as efficient and sustained expression and ease of manipulation. After the therapeutic gene carried by the rAAV vector enters the cell, it can be transcribed and translated into functional proteins, thereby achieving the goal of treating a range of diseases. Currently, rAAV has become the main platform for in vivo gene therapy delivery, and rAAV gene therapy has made significant progress in the treatment of multiple diseases. In the treatment of hemophilia, the Biologics License Application (BLA) for the gene therapy drug Etranacogene dezaparvovec has received priority review designation from the U.S. Food and Drug Administration (FDA). In the treatment of eye diseases, there are Class 1 novel biological drugs such as KH631 ophthalmic injection, which uses rAAV to deliver target genes to treat neovascular (wet) age-related macular degeneration. In addition, many pharmaceutical companies are exploring the use of rAAV to deliver therapeutic genes in the treatment of central nervous system diseases, lysosomal storage diseases, muscle diseases, and heart diseases.

[0003] However, the AAV capsid proteins currently used in rAAV viral packaging systems are mostly traditional wild-type AAV-1, 2, 5, 8, and 9 capsid proteins. While these natural wild-type AAV capsids can effectively target rAAV to specific tissues for exogenous gene expression, they still face problems such as poor infectivity and weak targeting specificity in many tissues and specific cells. In clinical practice, when the targeting and transduction capabilities of the rAAV system are limited, it is necessary to increase the dosage to achieve the desired effect, which increases the risk of inducing an immune response. Therefore, to advance the application of gene therapy in clinical treatment, targeted modification and optimization of natural wild-type AAV capsid proteins has become an urgent task. Currently, there are many methods for modifying and optimizing AAV capsid proteins, including DNA shuffling technology, site-directed mutagenesis and artificial insertion / deletion of amino acid sequences to modify capsid proteins, etc. Among them, the phage display system technology, which screens for specifically targeted short peptides from random peptide libraries to insert into specific sites in wild-type AAV capsid proteins in recent years, is a highly efficient and feasible screening method. In our previously filed patent application, "Screening, Construction and Application of a Modified AAV-8 Serum Type for Gene Targeting and Expression" (Publication No.: CN115044614A), we used phage display system technology to screen for the peptide LARGDSTKSA and inserted it into the wild-type AAV-8 serum capsid protein to form a modified AAV-8 capsid protein. Compared with the wild-type AAV-8 serum capsid protein, the modified AAV-8 capsid protein showed stronger infectivity when infecting some cells, but it could not efficiently infect motor cortex and leukemia-associated cells (JURKAT cells, K562 cells and THP1 cells). Summary of the Invention

[0004] In view of the shortcomings of the above-mentioned rAAV system, one of the technical problems to be solved by the present invention is to provide a peptide for targeting.

[0005] The second technical problem to be solved by this invention is to provide an AAV vector for gene targeting and expression and a method for constructing the same.

[0006] The third technical problem to be solved by this invention is to provide a recombinant adeno-associated virus particle.

[0007] The fourth technical problem to be solved by the present invention is to provide the application of the polypeptide, the carrier and the recombinant adeno-associated virus particles based on the above two.

[0008] To address the first technical problem mentioned above, this invention provides a targeted polypeptide with the amino acid sequence shown in SEQ ID NO: 8, wherein the amino acids at positions 1, 2, and 10 are protective amino acids. The protective amino acid is represented by X, wherein the amino acid at position 1 is selected from L, I, and V; the amino acid at position 2 is selected from A, G, and S; and the amino acid at position 10 is selected from A, G, and S.

[0009] In some embodiments, the amino acid sequence of the targeted peptide is shown in SEQ ID NO: 3.

[0010] To address the second technical problem mentioned above, this invention provides an AAV vector for gene targeting and expression, comprising a nucleotide sequence encoding a modified capsid protein of the AAV-8 serotype; the modified capsid protein of the AAV-8 serotype is a polypeptide for targeting, as shown in SEQ ID NO: 8, inserted between amino acids 590 and 591 of the AAV-8 serotype capsid protein; the amino acid sequence of the AAV-8 serotype capsid protein is an amino acid sequence with 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO: 7; the nucleotide sequence of the AAV-8 serotype capsid protein is a nucleotide sequence with 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO: 2.

[0011] In some embodiments, the amino acid sequence of the targeted peptide is shown in SEQ ID NO: 3.

[0012] In some embodiments, the nucleotide sequence of the AAV vector is a nucleotide sequence that is 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homologous to SEQ ID NO: 1.

[0013] To address the second technical problem mentioned above, this invention also provides a method for constructing an AAV vector for gene targeting and expression, comprising the following steps: synthesizing a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 8 and inserting it into the nucleotide sequences corresponding to amino acids 590 and 591 of the AAV-8 type serotype capsid protein, thereby forming the AAV vector for gene targeting and expression. The AAV-8 type serotype capsid protein is an amino acid sequence with 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO: 7; the nucleotide sequence of the AAV-8 type serotype capsid protein is a nucleotide sequence with 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO: 2.

[0014] In some embodiments, the inserted nucleotide sequence is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 3.

[0015] To address the third technical problem mentioned above, this invention provides a recombinant adeno-associated virus particle comprising a modified capsid protein of the AAV-8 serotype; the modified capsid protein of the AAV-8 serotype is formed by inserting a targeting polypeptide, as shown in SEQ ID NO: 8, between amino acids 590 and 591 of the AAV-8 serotype capsid protein; the AAV-8 serotype capsid protein has an amino acid sequence with 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO: 7.

[0016] In some embodiments, the amino acid sequence of the targeted peptide is shown in SEQ ID NO: 3.

[0017] To address the third technical problem mentioned above, the present invention also provides the following four applications:

[0018] P1. Application in improving the capsid for AAV virus packaging.

[0019] P2. Applications in the linking and targeting of biological macromolecules, antibody drugs, peptides, and small chemical molecules.

[0020] P3. Applications in targeting the cerebellum, motor cortex, and / or striatum; or applications in the preparation of drugs targeting the cerebellum, motor cortex, and / or striatum.

[0021] P4. Applications in targeting retinal ganglion cells, Neuro2A cells, MULLER cells, SH-SY-5Y cells, JURKAT cells, K562 cells and / or THP1 cells; or applications in preparing retinal ganglion cells, Neuro2A cells, MULLER cells, SH-SY-5Y cells, JURKAT cells, K562 cells and / or THP1 cells.

[0022] The above four applications are optional. The targeted polypeptide can achieve the above four applications, and the AAV vector for gene targeting and expression and the recombinant adeno-associated virus particles can achieve the applications shown in P3 and P4.

[0023] Compared with existing technologies, the present invention has the following beneficial effects: The modified vector is effectively screened using phage display system technology and in vitro expression methods. As shown in experimental results, the modified capsid protein expressed by this vector has better infection efficacy in the following tissues and cells compared to wild-type AAV-8 serum capsid protein: the cerebellum of mouse brain (…). Figure 3 ), motor cortex ( Figure 4 ) and striatum ( Figure 5 ); retinal ganglion isolated cells ( Figure 6 Neuro2A cells Figure 7 ), MULLER cells ( Figure 8 ), SH-SY-5Y cells ( Figure 9 ), JURKAT cells ( Figure 10 K562 cells (Figure 11) and THP1 cells ( Figure 12 Compared to the aforementioned patent CN115044614A, the AAV vector for gene targeting and expression provided by this invention significantly enhances the ability to infect the motor cortex, JURKAT cells, K562 cells, and THP1 cells, as well as the wild-type AAV-8 serotype capsid, i.e., the AAV-8 serotype capsid protein. The modified vector in this invention improves the infection efficacy of AAV-8, powerfully promoting the application of gene therapy based on the rAAV system in clinical treatment, particularly in the treatment of motor cortex-related diseases and leukemia. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the structure of the vector (i.e., the AAV vector, hereinafter referred to as AAV8-590NKV) expressing the modified capsid protein of the AAV-8 serotype in Example 1.

[0025] Figure 2 This is a schematic diagram of the AAV8-590NKV nucleotide sequencing results in Example 3.

[0026] Figure 3 This is a schematic diagram illustrating the infection of mouse cerebellum with the virus packaged in AAV8-590NKV and the virus packaged in a vector expressing AAV-8 serotype capsid protein (hereinafter referred to as AAV-8Cap) as described in Example 5; wherein, Figure 3 (A) represents the virus packaged in AAV-8Cap; Figure 3 (B) represents the virus packaged as AAV8-590NKV.

[0027] Figure 4 This is a schematic diagram illustrating the infection of the mouse motor cortex with the AAV8-590NKV-packaged virus and the AAV-8Cap-packaged virus, as shown in Example 5. Figure 4 (A) represents the virus packaged in AAV-8Cap; Figure 4 (B) represents the virus packaged as AAV8-590NKV.

[0028] Figure 5 This is a schematic diagram illustrating the infection of the mouse striatum with the AAV8-590NKV-packaged virus and the AAV-8Cap-packaged virus, as shown in Example 5. Figure 5 (A) represents the virus packaged in AAV-8Cap; Figure 5 (B) represents the virus packaged as AAV8-590NKV.

[0029] Figure 6 This is a schematic diagram illustrating the infection of isolated retinal ganglion cells with viruses packaged as AAV8-590NKV and AAV-8Cap, as shown in Example 4. Figure 6 (A) represents the virus packaged in AAV-8Cap; Figure 6 (B) represents the virus packaged as AAV8-590NKV.

[0030] Figure 7 This is a schematic diagram illustrating the infection of Neuro2A cells with viruses packaged in AAV8-590NKV and AAV-8Cap, as shown in Example 4. Figure 7 (A) represents the virus packaged in AAV-8Cap; Figure 7 (B) represents the virus packaged as AAV8-590NKV.

[0031] Figure 8 This is a schematic diagram illustrating the infection of Muller cells with the AAV8-590NKV-packaged virus and the AAV-8Cap-packaged virus, as shown in Example 4. Figure 8 (A) represents the virus packaged in AAV-8Cap; Figure 8 (B) represents the virus packaged as AAV8-590NKV.

[0032] Figure 9 This is a schematic diagram illustrating the infection of SH-SY-5Y cells with the AAV8-590NKV-packaged virus and the AAV-8Cap-packaged virus, as shown in Example 4. Figure 9 (A) represents the virus packaged in AAV-8Cap; Figure 9 (B) represents the virus packaged as AAV8-590NKV.

[0033] Figure 10 This is a schematic diagram illustrating the infection of JURKAT cells with the AAV8-590NKV-packaged virus and the AAV-8Cap-packaged virus, as shown in Example 4. Figure 10 (A) represents the virus packaged in AAV-8Cap; Figure 10 (B) represents the virus packaged as AAV8-590NKV.

[0034] Figure 11 This is a schematic diagram illustrating the infection of K562 cells with viruses packaged in AAV8-590NKV and AAV-8Cap, as shown in Example 4. Figure 11 (A) represents the virus packaged in AAV-8Cap; Figure 11 (B) represents the virus packaged as AAV8-590NKV.

[0035] Figure 12 This is a schematic diagram illustrating the infection of THP1 cells with viruses packaged in AAV8-590NKV and AAV-8Cap, as shown in Example 4. Figure 12 (A) represents the virus packaged in AAV-8Cap; Figure 12 (B) represents the virus packaged as AAV8-590NKV.

[0036] Figure 13 This is a schematic diagram of the structure of AAV-8Cap in Example 1. Detailed Implementation

[0037] The invention is further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments described herein are by way of example and are not intended to limit the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention.

[0038] This invention utilizes phage display system technology to screen for the targeted peptide. The specific steps are as follows: First, a random short peptide display library is constructed by synthesizing several random short peptides with different amino acid sequences, each consisting of 7 random amino acid fragments and 3 protective amino acids. Then, these random short peptides with different amino acid sequences are inserted between amino acids 590-591 of the AAV-8 serum capsid protein to obtain various AAV-8 modified capsid proteins with different random short peptides. Second, using in vitro expression, AAV-8 modified capsid proteins with good penetration, high infectivity, and low immunogenicity that can infect the retina via intravitreal injection are screened from the aforementioned various AAV-8 modified capsid proteins. Finally, sequencing confirms that the short peptide sequence inserted into the aforementioned AAV-8 modified capsid protein with good penetration, high infectivity, and low immunogenicity targeting the retina is the targeted peptide, which in Example 1 is the peptide shown in SEQ ID NO: 3.

[0039] Example 1: Vector Construction

[0040] The specific methods and steps for preparing sequence design and synthesis are as follows:

[0041] (1) Synthesize the nucleotide sequence of the amino acid sequence shown in SEQ ID NO: 3, and the nucleotide sequence is as shown in SEQ ID NO: 4;

[0042] (2) The double-stranded DNA molecules synthesized in step (1) were PCRed using the synthesized primers pAAV8-590-7aa-F and pAAV8-590-7aa-R respectively to obtain PCR products.

[0043] In step (2), the PCR system is as follows: 32.5 μL H2O, 10 μL 5× Buffer (containing Mg2+), 4 μL dNTPs (2.5 mM each), 1 μL forward primer Primer1(+), 1 μL reverse primer Primer2(-) (10 μM), 1 μL target gene template DNA, and 0.5 μL PrimeSTAR enzyme, which constitute the reaction system;

[0044] The PCR procedure is as follows: denaturation at 98°C for 3 minutes; annealing at 98°C for 10 seconds, 55°C for 15 seconds, and 72°C for 1 minute, repeated for 30 cycles; extension at 72°C for 10 minutes.

[0045] The specific methods and steps for inserting the sequence at the insertion site are as follows:

[0046] 1) Digest the viral vector AAV-8Cap with the restriction endonuclease BsmBI. (The vector is described in the original text.) Figure 13As shown, its nucleotide sequence is shown in SEQ ID NO: 2, its amino acid sequence is shown in SEQ ID NO: 7, and the vector backbone is recovered;

[0047] 2) The PCR product from step (2) and the vector backbone from step 1) are recombined, transformed into Escherichia coli, positive bacteria are screened and their plasmids are extracted to obtain the recombinant vector.

[0048] In step 1), the enzyme digestion system is as follows: BsmBI(NEB,R0739L): 1 μL, buffer: 3 μL, AAV-8Cap plasmid: 1 μg, water added to 30 μL; digestion at 37℃ for 4 hours.

[0049] In step 2), the recombination system is as follows: recombinase (Suzhou Shenzhou Gene Co., Ltd., GB2002): 15 μL, recovered PCR product DNA: 40 ng, recovered plasmid: 20 ng; after incubating in a water bath at 42℃ for 30 min, it is transformed into E. coli.

[0050] pAAV8-590-7aa-F:AGGACCCTGTTACCGCCAAC,as shown in SEQ ID NO:5

[0051] pAAV8-590-7aa-R:GATGTTTCAGGCCAAAGCCG, as shown in SEQ ID NO:6

[0052] like Figure 1 As shown, the constructed pAAV8-590NKV vector structure contains the ampicillin resistance gene, the AAV replication gene, and the AAV-8 capsid protein gene, which contains the 10 amino acid sequence shown in SEQ ID NO:3: LANKVVDKWA.

[0053] Example 2: AAV virus packaging

[0054] (I) Cryopreservation of AAV-293 cells

[0055] As the number of passages increases, AAV-293 cells may exhibit decreased growth status and mutations. To prevent these phenomena, we need to cryopreserve large quantities of cells from the outset to ensure the stability and continuity of the experiment. Cryopreservation during the logarithmic growth phase increases the cell survival rate after recovery.

[0056] 1. Remove

[0057] Add PBS to the cell culture supernatant to wash away any residual culture medium;

[0058] 2. Add 0.25% trypsin and digest for 1-2 minutes. Observe under a microscope when the cells become round and the intercellular spaces increase. Remove the trypsin, add fresh culture medium, mix by pipetting, and transfer to a centrifuge tube.

[0059] 3. Cell Counting: Shake off all cells and add 3 mL of preheated 10% DMEM (37°C). Use a 10 mL pipette to vigorously pipette 6-8 times, ensuring no dead cells remain. Then, aspirate all cells and place them in a 15 mL centrifuge tube. Transfer 50 μL of the mixed cells to a 1.5 mL Eppendorf tube and add 450 μL of 10% DMEM (10-fold dilution). Mix well. Count 10 μL of cells in a counting chamber. The counting chamber has four large squares, each with 16 smaller squares. Count all cells in all four large squares. Divide the total count by 4 (to get the number of cells per large square), then multiply by 10 (for the 10-fold dilution) to obtain the actual cell concentration (n Thousands / mL).

[0060] 4. Centrifuge the cells at 1000 rpm for 5 minutes. Discard the supernatant.

[0061] 5. Based on the cell count, resuspend the cells in cryopreservation solution (70% complete culture medium + 20% FBS + 10% DMSO) at a density of 3 x 10⁻⁶ cells / mL. 6 per mL.

[0062] 6. Aliquot the cells into cryovials, place them in cryopreservation boxes, and store them in an ultra-low temperature freezer at -80°C.

[0063] 7. On the second day, place the cells in a liquid nitrogen tank for long-term preservation and record the results. During preservation, periodically revive the cells to check cell viability and observe cell condition.

[0064] (II) Passaging of AAV-293 cells

[0065] When cells reach a confluence of 80% to 90%, they need to be passaged to increase the number of cells and maintain good cell growth.

[0066] 1. Digest the cells, using the same method as for cell cryopreservation.

[0067] 2. After centrifugation, resuspend the cells in complete culture medium.

[0068] 3. Depending on the specific situation, divide the cells into 10cm culture dishes and add 10mL of culture medium to each dish.

[0069] (III) Resuscitation of AAV-293 cells

[0070] When cells have been passaged too many times, their condition deteriorates, or they are contaminated, they need to be discarded and the initially frozen cells need to be thawed.

[0071] 1. Set the water bath temperature to 37-42℃.

[0072] 2. Check the cell bank records and, according to the records, remove the frozen cells from the liquid nitrogen tank (wear cotton gloves to prevent frostbite), quickly place them in a water bath and shake rapidly, trying to completely dissolve the cells within 1-2 minutes.

[0073] Dissolve.

[0074] 3. Transfer the cell solution to a 15 mL centrifuge tube, add 1 mL of fresh complete culture medium, mix well, and centrifuge at 1000 rpm for 5 min.

[0075] 4. Remove the supernatant, add 5 mL of fresh complete culture medium, mix well, and transfer the precipitate to a 6 cm petri dish.

[0076] 5. Place the petri dish stably in an incubator at 37℃, 5% CO2 and 95% relative humidity for incubation.

[0077] 6. Observe cell viability on the second day. Change the culture medium. Observe cell growth daily thereafter.

[0078] (iv) AAV Packaging and Concentration

[0079] 1. Plasmid amplification

[0080] The constructed AAV vector, packaging plasmid, and helper plasmid need to undergo extensive extraction to a concentration greater than 1 μg / μL, with A260 / 280 between 1.7 and 1.8, before they can be used for viral encapsulation. It is recommended to use the Qiagen Large Extraction Kit for large-scale endotoxin-free extraction of the plasmid.

[0081] 2. Passing AAV-293 cells

[0082] Aspirate the culture medium from the T75 flask containing AAV-293 cells. Add 2 mL of 0.25% trypsin (taken from a 4°C freezer) to evenly cover the bottom of the flask. Incubate at 37°C for 3-5 minutes. Remove the flask and shake; the cells will detach from the bottom. Shake off all the cells. Add 3 mL of 10% DMEM preheated to 37°C. Use a 10 mL pipette to gently pipette the medium 6-8 times, ensuring no dead spots. If the area near the flask opening is difficult to pipette from, aim the pipette at the opening and gently pipette to cover the cells close to the opening. Aspirate all cells and transfer them to a 15 mL centrifuge tube. Transfer 50 μL of the mixed cells to a 1.5 mL Eppendorf tube and add 450 μL of 10% DMEM (a 10-fold dilution). Mix well. Count 10 μL of the cells using a counting chamber with 4 large divisions and 16 small divisions per large division. For cell counting, count cells in all four large cells. Divide the total number of cells by 4 (to get the number of cells per large cell), then multiply by 10 (for a 10-fold dilution) to obtain the actual cell concentration (n Thousands / mL). The day of passage is designated as day one. If transfection is performed on day two, seed with 9-10 million cells / T75 culture medium; if transfection is performed on day three, seed with 3.5-4 million cells / T75 culture medium. Add 10 mL of 10% DMEM medium to each T75 culture flask. Observe cell density on the day of transfection; transfection can proceed when the cell density reaches 80-90% confluency. No change of medium is required before transfection.

[0083] 3. Perform lipid-to-complex surgery

[0084] Reagent Name Reagent Quantity

[0085] 5 μL of vector plasmid (1.0 μg / μL)

[0086] Packaging plasmid 5 μL (1.0 μg / μL)

[0087] 5 μL of helper plasmid (1.0 μg / μL)

[0088] Note: Lipofiter™ transfection reagent is a product of Hanheng Biotechnology. Please refer to the Lipofiter™ instruction manual for usage instructions.

[0089] 4. AAV virus receiving:

[0090] Viral particles are present in both packaging cells and culture supernatant. Collecting both cells and culture supernatant will yield the best results.

[0091] 1) Prepare a dry ice ethanol bath (simply pour ethanol into a foam box containing dry ice, or liquid nitrogen can be used instead of a dry ice ethanol bath) and a 37°C water bath;

[0092] 2) Collect the toxin-producing cells along with the culture medium into a 15 mL centrifuge tube. When collecting the cells, tilt the culture dish at a certain angle to scrape the cells into the culture medium;

[0093] 3) Centrifuge at 1000 rpm / min for 3 minutes to separate the cells and supernatant. Store the supernatant separately and resuspend the cells in 1 mL of PBS.

[0094] 4) Repeatedly transfer the cell suspension between a dry ice ethanol bath and a 37°C water bath, performing four freeze-thaw cycles. Gently shake after each thaw. Note: Each freezing and thawing process takes approximately ten minutes.

[0095] 5. AAV virus concentration:

[0096] 1) Centrifuge at 10,000g to remove cell debris, and transfer the supernatant to a new centrifuge tube.

[0097] 2) Combine the supernatants collected from both collections and filter them through a 0.45μm filter to remove impurities.

[0098] 3) Add 1 / 2 volume of 1M NaCl and 10% PEG8000 solution, mix well, and incubate overnight at 4°C.

[0099] 4) Centrifuge at 12,000 rpm for 2 hours, discard the supernatant, dissolve the virus precipitate with an appropriate amount of PBS solution, and filter it through a 0.22 μm filter to remove bacteria after complete dissolution.

[0100] 5) Add Benzonase nuclease to digest and remove residual plasmid DNA (final concentration 50 U / mL). Close the tube cap and invert several times to mix thoroughly. Incubate at 37°C for 30 minutes;

[0101] 6) Filter with a 0.45μm filter head and collect the filtrate, which is the concentrated AAV virus.

[0102] 6. Purification of AAV

[0103] 1) Add solid CsCl to the virus concentrate until the density is 1.41 g / mL (refractive index 1.372);

[0104] 2) Add the sample to the ultracentrifuge tube and fill the remaining space of the tube with the pre-prepared 1.41 g / mL CsCl solution;

[0105] 3) Centrifuge at 175,000g for 24 hours to establish a density gradient. Collect samples of different densities sequentially and perform titer determination. Collect the fraction enriched with AAV particles;

[0106] 4) Repeat the above process once.

[0107] 5) Place the virus into a 100kDa dialysis bag and dialyze overnight at 4°C to remove salt. This is the purified AAV virus.

[0108] AAV virus packaging titer determination (using Q-PCR method)

[0109] 1) Take 20 μL of concentrated virus solution, add 1 μL of RNAse-free DNAse, mix well, and react in a water bath at 37°C for 30 min.

[0110] 2) Centrifuge at 4℃, 12000rpm / min for 10min, and transfer 10μL of supernatant to another sterile 1.5mL EP tube.

[0111] 3) Add 90 μL of Dilution Buffer (1 mM Tris-HCl, pH 8.0, 0.1 mM EDTA, 150 mM NaCl), mix well, and react in a metal bath at 37 °C for 30 min.

[0112] 4) Cool naturally to room temperature, add 1 μL of proteinase K, and react in a 65°C water bath for 1 hour.

[0113] 5) React in a metal bath at 100℃ for 10 minutes, then allow to cool naturally to room temperature.

[0114] 6) Perform Q-PCR to detect the titer.

[0115] Storage and dilution of AAV virus

[0116] 1. Virus storage:

[0117] Upon receiving the viral fluid, experiments can be conducted using adeno-associated virus within a very short time. The virus can be temporarily stored at 4°C; for long-term storage, please store at -80°C (the virus should be placed in a cryovial and sealed with sealing film).

[0118] 1) The virus can be stored at -80℃ for more than 6 months; however, if the virus has been stored for more than 6 months, it is recommended to re-measure the virus titer before use.

[0119] 2) Repeated freeze-thaw cycles will reduce the virus titer: Each freeze-thaw cycle will reduce the virus titer by 10%; therefore, repeated freeze-thaw cycles should be avoided as much as possible during virus use. To avoid repeated freeze-thaw cycles, it is recommended to aliquot the virus according to the amount to be used each time after receiving it.

[0120] 2. Virus dilution:

[0121] If virus dilution is required, remove the virus and thaw it in an ice bath before using PBS buffer or serum-free culture medium (containing serum or antibiotics will not affect viral infection). After mixing and aliquoting, store at 4°C (use within three days if possible).

[0122] Safety Precautions for AAV Use

[0123] 1. A biosafety cabinet is recommended for handling viruses. If using a regular clean bench, do not turn on the exhaust fan.

[0124] 2. When handling viruses, please wear a lab coat, mask, and gloves.

[0125] 3. Exercise extreme caution when handling viruses to avoid generating aerosols or splashes. If the clean bench becomes contaminated with viruses during operation, wipe it clean immediately with a solution of 70% ethanol and 1% SDS. Dispose of pipette tips, centrifuge tubes, culture plates, culture media, etc., that have come into contact with viruses after soaking them overnight in 84 disinfectant or 1% SDS.

[0126] 4. When observing cell infection under a microscope, follow these steps: Tighten the culture flask or cap the culture plate. Clean the outer wall of the culture flask with 70% ethanol before observing and photographing it under the microscope. Before leaving the microscope stage, clean the microscope stage with 70% ethanol.

[0127] 5. If centrifugation is required, use well-sealed centrifuge tubes, or seal them with sealing film before centrifugation, and try to use a centrifuge in a tissue culture room.

[0128] 6. After removing the gloves, wash your hands with soap and water.

[0129] Example 3: Intravitreal injection and retinal extraction of recombinant adeno-associated virus particles containing AAV8-590NKV capsid protein in mice.

[0130] 1. Anesthesia: 4.3% chloral hydrate 0.01 mL / g;

[0131] 2. Mydriatic solution dilates the pupils, while methylcellulose keeps the ocular surface moist;

[0132] 3. Adjust the mouse's head position and inject at a location approximately 1 mm behind the limbus;

[0133] 4. Make an incision using a 33G syringe, insert the needle vertically, then tilt it to slowly inject the recombinant adeno-associated virus particles into the vitreous cavity of the mouse. After injection, leave the needle in place for 0.5-1 minutes and then quickly withdraw it.

[0134] 5. About a week later, the mice were anesthetized and euthanized. The retina and retinal pigment epithelium of the target tissue were taken, and their genomes were extracted. The AAV capsid sequence that had infiltrated into the target tissue was sequenced and analyzed.

[0135] Analysis of AAV sequences contained in the genome based on sequencing results (see...) Figure 2The box indicates the inserted nucleotide sequence obtained from sequencing. Reading and analysis yielded the nucleotide sequence shown in SEQ ID NO: 4.

[0136] Example 4: Comparison of cell infection and fluorescence of viruses packaged in AAV-8Cap and AAV8-590NKV capsids respectively.

[0137] 1. Locate the desired cells in the cell bank table;

[0138] 2. Remove the cells from the liquid nitrogen tank and quickly place them in a 37-degree water bath, shaking them gently and continuously.

[0139] 3. Place the cryovial, whose internal liquid has been completely thawed, in a centrifuge and centrifuge at 800 RPM for 5 minutes;

[0140] 4. After centrifugation, discard the supernatant in the centrifuge tube;

[0141] 5. Add 1 mL of the corresponding culture medium to the cryovial, gently pipette to mix evenly, and make a single-cell suspension;

[0142] 6. Take a suitable-sized dish (usually a 10cm or 6cm dish) and add the culture medium;

[0143] 7. Add the cell suspension that has been pipetted and mixed evenly from the cryovial to the dish;

[0144] 8. Shake the cell culture dish in a rice-grain-shaped motion to mix it evenly;

[0145] 9. Place the shaken cell culture dish in a 37-degree incubator;

[0146] 10. On the second day, remove the dish and observe it under a microscope, then perform subsequent operations such as changing the solution;

[0147] 11. Remove the cells, which have reached a density of 80%, from the incubator;

[0148] 12. Remove the existing culture medium from the dish;

[0149] 13. Add 3 mL of PBS buffer, shake the dish well to ensure the PBS reaches every corner of the dish;

[0150] 14. Wash away the PBS buffer used for cleaning;

[0151] 15. Add 1 mL of trypsin and shake the dish evenly to ensure that the trypsin is evenly distributed to every corner of the dish;

[0152] 16. Place the dish containing the added trypsin and shaken well back into the 37°C incubator;

[0153] 17. After digestion for a certain period of time (generally between 1 and 2 minutes), remove the cell culture dish;

[0154] 18. Hold the dish in your left hand and gently tap along the side of the dish with your right hand. If you see cells slip off, the digestion is complete.

[0155] 19. The previous step can also be replaced by observing the cells become rounded under a microscope;

[0156] 20. Add 2 mL of the appropriate culture medium to a 10 cm dish to terminate digestion;

[0157] 21. Shake the cell culture dish containing the stop solution evenly;

[0158] 22. Using a 1 mL pipette, pipette the cells to form a single-cell suspension;

[0159] 23. After the pipetting is complete, transfer all the liquid into a 5mL centrifuge tube;

[0160] 24. After labeling the centrifuge tubes, place them in a centrifuge and centrifuge at 800 RPM for 5 minutes;

[0161] 25. After centrifugation, discard the supernatant in the centrifuge tube;

[0162] 26. Add 2 mL of the appropriate culture medium to resuspend the cells to make a single-cell suspension;

[0163] 27. Distribute cells into wells in a specified quantity;

[0164] 28. Mix the cells and culture medium in the well plate thoroughly;

[0165] 29. Place the well plate in a 37°C incubator for incubation;

[0166] 30. The day before infection, seed the cells into well plates (see steps above);

[0167] 31. Infection can occur 12 hours after cell plating;

[0168] 32. After 12 hours of cell plating, prepare the corresponding virus / sodium butyrate;

[0169] 33. According to the MOI value corresponding to the cells, take an appropriate amount of virus and mix it with 2% serum culture medium;

[0170] 34. Add sodium butyrate at a ratio of 1:1000;

[0171] 35. Replace the medium in the well plate with 2% serum culture medium.

[0172] 36. Add the virus-sodium butyrate mixture to the well plate and shake well;

[0173] 37. Place the well plate in an incubator at 37 degrees Celsius for incubation;

[0174] 38. After culturing for 6 hours, remove the plate and aspirate all the liquid inside.

[0175] 39. Add a certain amount of fresh culture medium and continue to incubate in a 37°C incubator;

[0176] 40. After a certain period of time, take (fluorescence) photos and send the samples.

[0177] Figures 6-12 Viruses packaged in AAV-8Cap(A) and AAV8-590NKV(B) capsids, representing the same viral load, were used to infect isolated retinal ganglion cells. Figure 6 Neuro2A cells Figure 7 ), Muller cells ( Figure 8 ), SH-SY-5Y cells ( Figure 9 ), JURKAT cells ( Figure 10 K562 cells (Figure 11), THP1 cells ( Figure 12 The fluorescence of AAV8-590NKV-capsulated virus-infected retinal ganglion isolated cells. Figure 6 Neuro2A cells Figure 7 ), Muller cells ( Figure 8 ), SH-SY-5Y cells ( Figure 9 ), JURKAT cells ( Figure 10 ), K562 cells ( Figure 11 ), THP1 cells ( Figure 12 It has better infection efficiency than viruses encapsulated in AAV-8.

[0178] Example 5: Comparison of infection areas of viruses packaged in AAV-8Cap and AAV8-590NKV capsids in mice via intravitreal injection and localized brain injection.

[0179] (a) Intravitreal injection (see Example 3)

[0180] (II) The stereotactic injection procedure for mouse brain is as follows:

[0181] 1. Anesthesia

[0182] 1) Anesthetize mice with anesthetics such as sodium pentobarbital, chloral hydrate, or isoflurane / oxygen mixture, with a moderate degree of anesthesia;

[0183] 2. Fixed

[0184] 1) Turn on the cold light source to provide illumination, and fix the anesthetized mouse on the stereotactic injection device;

[0185] 2) Fixing the head: First, gently insert one ear rod into the external auditory canal. After touching the bottom of the bony external auditory canal, fix the ear rod. Then, insert and fix the other ear rod in the same way. Check whether the mouse's head is stable and tilted, and whether the scales on both ear rods are symmetrical. Gently move the ear rods to make the scales on both sides consistent and the head position completely centered. Fix the ear rods again.

[0186] 3) Fix the maxilla: Insert the mouse's upper incisors into the slots of the upper tooth fixing plate and tighten the screws. Push the animal's head from all directions; there should be no movement. Adjust the anterior and posterior fontanelles to be on the same sagittal line using the positioning pin, and try to keep the anterior fontanelle (Bregma) and posterior fontanelle (Lambda) on the same horizontal plane.

[0187] 3. Drilling

[0188] 1) Shave the hair off the mouse's head with a pet razor, then disinfect the head with medical alcohol and iodine to prevent infection;

[0189] 2) Apply eye ointment to the animal's eyes to keep them moist and prevent blindness caused by prolonged dryness;

[0190] 3) Use medical scissors to cut open the scalp from between the eyes to the base of the ears;

[0191] 4) Use hemostatic forceps to widen the opening, and use a cotton swab soaked in hydrogen peroxide to wipe and remove the dura mater on the surface of the skull.

[0192] 5) Use a positioning device to ensure that the anterior fontanelle (Bregma, X=0, Y=0, Z=0) and posterior fontanelle (Lambda) are on the same horizontal plane (the difference between X and Z values ​​is less than 0.1);

[0193] 6) Determine the location parameters of the brain region to be injected based on the brain atlas;

[0194] 7) Use a positioning device to locate the site where the virus needs to be injected, and mark it on the skull with a marker;

[0195] 8) Use a skull scraper to gently grind the skull at the injection site to slowly thin the skull. When a crack appears in the skull, carefully puncture it with the needle of a medical syringe to prevent damage.

[0196] 4. Virus injection

[0197] 1) Rinse the microsyringe (5μL) 3-5 times with PBS;

[0198] 2) First, draw about 1 μL of air, then draw about 1 μL of diluted virus, and test the syringe for patency in the air;

[0199] 3) Assemble the microinjection pump and microinjector, place them above the drilled hole, with the needle tip parallel to the skull (Z=0), and fine-tune the position of the syringe to be the same as when the hole was drilled.

[0200] 4) Slowly lower the injection needle to the predetermined depth;

[0201] 5) Inject the virus at a rate of 0.05 μL / min, and stop injecting when 0.5 μL remains;

[0202] 6) After the injection is completed, leave the injection needle at the injection site for 10 minutes to allow the virus to spread, and then slowly withdraw the needle;

[0203] 7) Rinse the microsyringe 5 times with PBS for later use;

[0204] 8) If bleeding occurs during the injection, immediately absorb it with a cotton swab to avoid introducing the virus;

[0205] 5. Suturing

[0206] 1) After the injection needle is completely removed, suture the scalp.

[0207] 2) After the experiment, place the mice in a place with a suitable temperature (around 25℃) (such as a constant temperature heating plate) to recover. Once the mice are awake, they can be put back into the cage for rearing.

[0208] 6. Testing

[0209] 1) Mice injected with the virus were fed for 3-4 weeks, then euthanized by cervical dislocation, and their brains were removed. The brains were fixed in 4% paraformaldehyde for about 1 day and dehydrated in 20% and 30% sucrose solutions.

[0210] 2) Frozen sections, 10 μm thick. Observe fluorescence under a fluorescence microscope;

[0211] Figure 3 , Figure 4 , Figure 5 Viruses packaged in AAV-8(A) and AAV8-590NKV(B) capsids, representing the same viral load, were used to infect the cerebellum of mice via brain-targeted injection. Figure 3 ), motor cortex ( Figure 4 ) and striatum ( Figure 5 The fluorescence of AAV8-590NKV-capsulated virus was observed. Experimental results indicate that the AAV8-590NKV-capsulated virus infected the cerebellum of mice (…). Figure 3 ), motor cortex ( Figure 4 ) and striatum ( Figure 5 It has better infection efficiency than viruses encapsulated in AAV-8.

[0212] It should be noted that the structures, proportions, sizes, etc., illustrated in the accompanying drawings of this specification are only used to complement the content disclosed in the specification for those skilled in the art to understand and read, and are not intended to limit the conditions under which the present invention can be implemented. Therefore, they have no substantial technical significance. Any modifications to the structure, changes in the proportions, or adjustments to the size, without affecting the effects and objectives that the present invention can produce, should still fall within the scope of the technical content disclosed in the present invention.

[0213] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A targeted polypeptide, characterized in that, Its amino acid sequence is shown in SEQ ID NO:

3.

2. An AAV vector for gene targeting and expression, characterized in that, A vector formed by replacing the AAV-8 serotype capsid protein of the AAV8-Cap vector with a modified AAV-8 serotype capsid protein; wherein the modified AAV-8 serotype capsid protein is formed by inserting an amino acid between amino acids 590 and 591 of the AAV-8 serotype capsid protein. The protein formed after targeting with the polypeptide as described in claim 1; the amino acid sequence of the AAV-8 type serum capsid protein is shown in SEQ ID NO:7; the nucleotide sequence of the AAV8-Cap vector is shown in SEQ ID NO:

2.

3. An AAV vector for gene targeting and expression, characterized in that, The nucleotide sequence of the AAV vector used for gene targeting and expression is shown in SEQ ID NO:

1.

4. The method for constructing an AAV vector for gene targeting and expression according to claim 2, characterized in that, The method includes the following steps: synthesizing a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 3 and inserting it into the nucleotide sequences corresponding to amino acids 590 and 591 of the AAV-8 type serum capsid protein to form the AAV vector for gene targeting and expression; the amino acid sequence of the AAV-8 type serum capsid protein is shown in SEQ ID NO:

7.

5. A recombinant adeno-associated virus particle, characterized in that, The modified capsid protein comprising the AAV-8 serotype; wherein the modified capsid protein of the AAV-8 serotype is formed by inserting an amino acid between amino acids 590 and 591 of the AAV-8 serotype capsid protein. The protein formed after targeting with the polypeptide as described in claim 1; the amino acid sequence of the AAV-8 type serum capsid protein is shown in SEQ ID NO:7.

Citation Information

Patent Citations

  • CN115044614A

  • CN118373878A

  • CN119306807A

  • CN119529111A

  • CN119751600A