Hydatidiform Mole Genotyping Detection System, Kit and Application

CN117265101BActive Publication Date: 2025-08-05SUZHOU MICROREAD GENETICS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311386157.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-25
Publication Date
2025-08-05
Estimated Expiration
2043-10-25

AI Technical Summary

Technical Problem

The existing hydatidiform molar diagnosis and typing methods have problems such as low sensitivity, high cost and difficulty in accurately distinguishing partial and complete hydatidiform molars, especially in FFPE specimens that are prone to misdiagnosis.

Method used

A composite amplification system, including 20 pairs of primers, is able to amplify 19 STR sites and one gender site simultaneously, combined with six-color fluorescent labeling and UDG enzymes, and is detected by PCR reaction and capillary electrophoresis. Using a special reaction buffer and enzyme mix, the amplification procedure is optimized to improve sensitivity and accuracy.

Benefits of technology

It realizes that the genotyping map can be accurately obtained when the DNA template is low, with high sensitivity, simple operation, low cost and effective distinction between fetal hydatidiform status. It is suitable for a variety of sample types, including FFPE specimens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117265101B_ABST
    Figure CN117265101B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biotechnology and relates to a hydatidiform mole genetic typing detection system, kit, and application. The composite amplification system includes 20 pairs of primers capable of simultaneously amplifying 20 genomic loci, and the primer sequences for each of the 20 loci are disclosed. The kit incorporates a UDG enzyme anti-contamination system to digest any amplification products containing uracil prior to PCR amplification, thereby preventing product contamination. These loci possess high individual recognition power and high polymorphic information content, enabling effective and accurate detection of STR polymorphisms, detection of maternal and fetal loci typing, and, through comparison, determination of fetal hydatidiform mole status.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and relates to a molar pregnancy gene typing detection system, a kit, and applications, specifically a composite amplification system for 19 short tandem repeat sequences and a sex locus on human autosomes. The system specifically relates to a fluorescent detection kit that utilizes genetic markers with polymorphisms on chromosomes and performs composite amplification through polymerase chain reaction. The system can determine the STR typing of the human genome and, by comparing the test results with those of the parents, can indicate the status of fetal molar pregnancy. Background Art

[0002] Hydatidiform mole is a common placental proliferative disease that endangers female reproductive health and is characterized by abnormal fertilization and subsequent trophoblast proliferation.

[0003] A normal embryo's DNA comes half from the mother and half from the father. With the exception of identical twins, each person's DNA sequence is unique. Molar pregnancies, genetically characterized by abnormal paternal chromosomes, are classified into two main categories: complete hydatidiform mole and partial hydatidiform mole. Molar pregnancies carry the risk of progression to persistent trophoblastic disease, with complete hydatidiform mole being more likely to develop this disease than partial hydatidiform mole. Clinically, compared to partial hydatidiform mole and hydropic miscarriage, complete hydatidiform mole requires appropriate preventive chemotherapy in addition to uterine evacuation and regular follow-up. Therefore, accurate classification of hydatidiform mole is crucial.

[0004] Currently, the diagnosis and classification of hydatidiform moles (HMs) in pathology are primarily based on clinical symptoms, histological observations, and immunohistochemical staining for p57 protein. While these methods allow for accurate diagnosis and classification of most hydatidiform moles, a small number of cases remain challenging due to the expression of p57 protein in CHM, PHM, and HA from both parents. Previously, flow cytometry DNA ploidy analysis, demonstrating triploidy, was used to distinguish triploid partial hydatidiform moles from diploid complete hydatidiform moles and diploid non-hydatidiform moles with villous edema. However, the latter two types of diploid non-hydatidiform moles are indistinguishable from complete hydatidiform moles because they are all diploid. Furthermore, among triploid miscarriages, while two-thirds are dizygotic and monozygotic incomplete hydatidiform moles, approximately one-third are dizygotic and monozygotic non-hydatidiform moles with villous edema. Therefore, flow cytometry triploidy analysis serves only as a guideline and cannot confirm a partial hydatidiform mole. In addition, cell breakage often occurs in FFPE specimens, and tissue fixatives and fixation methods have a significant impact on the results, which can easily lead to deviations in the results and misdiagnosis of hydatidiform mole.

[0005] Therefore, given the unique genetic background of hydatidiform mole, genetic typing is considered the "gold standard" for the definitive diagnosis of hydatidiform mole. In recent years, STR polymorphism analysis has been demonstrated to be the most accurate and practical diagnostic and typing tool for hydatidiform mole. STR markers are abundant throughout the genome, many with very high heterozygosity, reflecting variations in allele frequencies within a population. Human genomic STRs (short tandem repeats) are relatively stable sequences in DNA, consisting of tandem repeats of a few base pairs as core units. Different ethnic groups, populations, and even individuals are distinguished by differences in the core unit sequence and repeat number, which also constitutes STR genetic polymorphism. On average, one STR locus is found every 15-20 kb of the genome, accounting for 10% of the genome. They are primarily found in noncoding regions and introns. Repeat units are 2-6 bp, repeated 10-60 times, and fragment sizes range from 70-500 bp. Inheritance follows Mendelian codominant patterns. However, existing methods for detecting STR polymorphisms in glucose suffer from low sensitivity and high cost. Summary of the Invention

[0006] The present invention provides a hydatidiform mole genotyping detection system, kit, and application. These systems utilize six-color fluorescent markers, offer extremely high sensitivity, and can detect and obtain a complete genotyping profile even with low-concentration DNA templates. The loci employed in this invention exhibit extremely high individual recognition rates and polymorphisms, and by comparing results with those of the parent, the fetal hydatidiform mole status can be indicated.

[0007] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is as follows:

[0008] The hydatidiform mole genotyping detection system includes 20 pairs of primers that can simultaneously amplify 19 STR loci and one gender locus: TPOX, D5S818, D18S51, D7S820, AMEL, D3S1358, D13S317, D21S11, D16S539, D2S441, vWA, D8S1179, D6S1043, TH01, D12S391, D2S1338, CSF1PO, D19S433, D10S1248, and FGA.

[0009] The primers and corresponding primer concentrations are (Table 1):

[0010] Table 1: Primer sequences and concentration ratios for each locus in the multiplex amplification system

[0011]

[0012] manual

[0013]

[0014] The amplified sites in the hydatidiform mole genotyping detection system are respectively marked with five colors of fluorescent markers, and the same fluorescent markers are considered to be the same group. The five groups are:

[0015] FAM: TPOX, D5S818, D18S51, D7S820;

[0016] HEX: AMEL, D3S1358, D13S317, D21S11, D16S539;

[0017] TAMRA: D2S441, vWA, D8S1179, D6S1043;

[0018] ROX: TH01, D12S391, D2S1338, CSF1PO;

[0019] PURP: D19S433, D10S1248, FGA.

[0020] The six groups of fluorescent markers are FAM, HEX, TAMRA, ROX, PURP and ORG.

[0021] The first group is labeled with FAM, the second group is labeled with HEX, the third group is labeled with TAMRA, the fourth group is labeled with ROX, and the fifth group is labeled with PURP. The internal standard used in the hydatidiform mole genotyping detection system is labeled with orange fluorescent marker ORG, which is the sixth group of fluorescent markers.

[0022] The hydatidiform mole gene typing detection system further comprises a PCR reaction solution, an enzyme mixture, and a DNA template.

[0023] The PCR reaction solution includes: 10mM ammonium sulfate, 10mM potassium chloride, 60mM Tris-HCl (pH 8.5), 2.5mM magnesium ion, 0.8ug / ul BSA, 5% DMSO, 8% ethylene glycol, 1mM Na4P2O7, and 0.25mM Dntp. It can be stored at -20°C without freezing, preventing repeated freezing and thawing during use.

[0024] The enzyme mixture includes: 8U of Taq enzyme and 0.4U of UDG enzyme.

[0025] The amplification procedure for the hydatidiform mole genotyping detection system is as follows: Step 1: digestion at 50°C for 10 minutes, Step 2: pre-denaturation at 95°C for 2 minutes, Step 3: denaturation at 94°C for 10 seconds, Step 4: annealing at 59°C for 30 seconds, Step 5: extension at 72°C for 30 seconds, repeating Steps 3 to 5 30 times, Step 6: extension at 72°C for 10 minutes; Step 7: incubation at 4°C. The amplified products of the present invention are subjected to capillary electrophoresis for fragment analysis.

[0026] The above-mentioned hydatidiform mole gene typing detection system or kit can be used to indicate the hydatidiform mole status of the fetus.

[0027] The reaction buffer (PCR reaction solution) used in the hydatidiform mole genotyping detection system of the present invention has a special formula (Table 2)

[0028] Table 2: Reaction buffer (PCR reaction solution) formula

[0029] Element unit Concentration in buffer KCl M 0.01 <![CDATA[MgCl2]]> M 0.0025 Tris-HCl (pH 8.5) M 0.06 BSA mg / ml 0.8 dNTP mM 0.25 <![CDATA[(NH4)2SO4]]> mM 0.01 DMSO % 5 Ethylene glycol % 8 <![CDATA[Na4P2O7]]> mM 1

[0030] The enzyme mixture used in the hydatidiform mole genotyping detection system of the present invention has a special formula (Table 3)

[0031] Table 3: Enzyme mixture formula

[0032] Element unit Concentration in buffer Taq enzyme U 8 UDG enzyme U 0.4

[0033] The PCR amplification program used in the hydatidiform mole genotyping detection system of the present invention is (Table 4).

[0034] Table 4: Amplification procedures of the composite amplification system of the present invention

[0035]

[0036] The DNA sample involved in the present invention can be derived from human blood, oral swabs, paraffin-embedded tissues, etc. The DNA sample can be extracted using a kit method or an automatic nucleic acid extraction instrument.

[0037] The amplified products of the present invention can be detected using an ABI series genetic analyzer. The detection results can be analyzed using data analysis software such as Genemapper to obtain corresponding STR typing patterns and data.

[0038] The present invention aims to improve the poor integrity of hydatidiform mole FFPE samples and the loss of large fragments due to excessive amplification. Using 5-color channels, the maximum amplified product fragment is 328bp, and the site product range is as follows:

[0039] Table 5 Site product range

[0040]

[0041]

[0042] Beneficial effects

[0043] This method effectively and accurately detects genomic STR polymorphisms by typing 19 short tandem repeats and a sex locus. Comparing the results with those of the parents can indicate the status of the fetal hydatidiform mole. Furthermore, the test is simple to operate, has high specificity, high sensitivity, high throughput, strong reliability, and low cost.

[0044] The reaction buffer (PCR reaction solution) and enzyme mixture used in the hydatidiform mole genotyping detection system of the present invention have a special formula that is freeze-resistant at -20°C. The PCR amplification process is quick and has high amplification efficiency. The DNA sample involved in the present invention can be derived from human blood, oral swabs, paraffin-embedded tissue, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is the amplification map of the optimized primers for site D2S441 in the hydatidiform mole genotyping detection system of the present invention;

[0046] Figure 2 The amplification pattern of the extension time after the cycle when the program is optimized for the hydatidiform mole genotyping detection system of the present invention;

[0047] Figure 3 is an amplification pattern of the sensitivity test of the hydatidiform mole genotyping detection system of the present invention;

[0048] Figure 4 It is the anti-albumin amplification pattern of the hydatidiform mole genotyping detection system of the present invention;

[0049] Figure 5 This is the formalin-resistant amplification pattern of the hydatidiform mole genotyping detection system of the present invention;

[0050] Figure 6 This is the amplification pattern of the hydatidiform mole gene typing detection system of the present invention against anhydrous ethanol;

[0051] Figure 7 This is the amplification map of the hydatidiform mole gene typing detection system of the present invention against paraffin oil;

[0052] Figure 8 An amplification pattern obtained by using the hydatidiform mole genotyping detection system of the present invention for a fetal sample;

[0053] Figure 9 This is an amplification map obtained from a maternal sample using the hydatidiform mole genotyping detection system of the present invention. DETAILED DESCRIPTION

[0054] Example 1 Design and screening of specific primers for the detection system

[0055] This application addresses the shortcomings of current detection methods in terms of sensitivity, cost, throughput, and ease of operation. Based on a capillary electrophoresis platform, through repeated optimization and exploration of the reaction system and amplification primers, a highly sensitive, high-throughput, low-cost, and easy-to-operate hydatidiform mole genetic typing detection system and kit has been developed.

[0056] Specifically, the primer optimization screening process of this application is as follows:

[0057] The amplification system designed in this application includes non-labeled primers and fluorescent primers. Specifically, when screening and designing the primer sequences, the following factors are fully considered: selection of amplification region, size of amplified fragment, 5' end base sequence, etc.

[0058] For example, taking site D2S441 as an example, this application optimized the screening of primers from the 5' end base sequence. The following primers were screened for this site (partial results are shown). The specific primers and sequences are shown in Table 6 below:

[0059] Table 6 D2S441 primer screening sequence

[0060] D2S441fn1 GCTCATCTGTGATGAAAAGTAACT(SEQ ID NO.41) D2S441f1 CCTCATCTGTGATGAAAAGTAACT(SEQ ID NO.42)

[0061] Specific primer test results are as follows Figure 1 , using D2S441ry1 and D2S441fn1 / D2S441f1, and 9948 as template for amplification, Figure 1 The lower part corresponds to the amplification results of D2S441ry1 and D2S441f1, showing that the amplification of D2S441f1 was incomplete, and the 5' tail base was modified based on the primer. Figure 1 The upper part corresponds to the amplification results of D2S441ry1 and D2S441fn1, showing that the addition of A incompleteness of D2S441fn1 was improved.

[0062] Example 2 Detection system program optimization

[0063] The system in this application requires PCR amplification, and the PCR product is detected by capillary electrophoresis platform to obtain an amplification map for the next step of data analysis. Through the optimization research of the amplification program, a simple and time-saving molar pregnancy genotyping detection system and kit have been developed.

[0064] Specifically, the program optimization process of this application is as follows:

[0065] The amplification program designed in this application includes digestion, pre-denaturation, cyclic amplification, post-amplification extension and low-temperature storage. The temperature and time of each stage are specifically considered when optimizing the program.

[0066] For example, taking the extension after amplification as an example, this application optimizes the time and tests at 5min / 10min. The specific test results are as follows Figure 2 There was no significant difference in the amplification of the three samples at 5 min and 10 min, and no incomplete addition of A occurred. In order to ensure the amplification effect of subsequent sample detection, the final extension time was selected as 10 min.

[0067] Example 3 System Sensitivity

[0068] This application aims to solve the problem of low sensitivity of existing detection kits and develop a highly sensitive hydatidiform mole gene typing detection system and kit. This kit requires a low total amount of amplified samples and has high sensitivity.

[0069] Specifically, the system sensitivity test is as follows:

[0070] The sample loading amount was 0.5ng, 1ng, 2ng, and 4ng, and the sensitivity of the test system was tested.

[0071] Specific test results such as Figure 3 , from top to bottom correspond to the amplification effects of 0.5ng, 1ng, 2ng, and 4ng, and typing at each site of 0.5ng can be accurately detected.

[0072] Example 4 System Anti-interference

[0073] The sample types corresponding to this application include paraffin samples. After extraction, the DNA may contain interferences such as albumin, formalin, anhydrous ethanol, and paraffin oil. The test system's ability to resist interference from these interfering factors is tested.

[0074] Specifically, the anti-interference ability test is as follows:

[0075] In the albumin test experiment, the control, 30g / L, 45g / L, and 60g / L addition amounts were set to test the system's resistance to albumin interference.

[0076] Specific test results such as Figure 4 From top to bottom, they correspond to 30g / L, 45g / L, 60g / L, and control amplification effects. The system can resist 60g / L albumin, and typing at each point in the system can be accurately detected.

[0077] Formalin test experiment, set the control, 0.5% and 1% addition amounts to test the system's resistance to formalin interference.

[0078] Specific test results such as Figure 5, from top to bottom correspond to 0.5%, 1%, and control amplification effects. The system can resist 1% formalin, and typing at each site of the system can be accurately detected.

[0079] In the anhydrous ethanol test experiment, the control, 1%, 1.5%, 2%, and 2.5% addition amounts were set to test the system's resistance to anhydrous ethanol interference.

[0080] Specific test results such as Figure 6 From top to bottom, they correspond to 1%, 1.5%, 2%, 2.5%, and control amplification effects. The system can resist 2.5% anhydrous ethanol, and typing at each site of the system can be accurately detected.

[0081] In the paraffin oil test experiment, the control, 1%, and 2.5% addition amounts were set to test the system's resistance to paraffin oil interference.

[0082] Specific test results such as Figure 7 , from top to bottom correspond to 1%, 2.5%, and control amplification effects. The system can resist 2.5% paraffin oil, and typing at each site of the system can be accurately detected.

[0083] Example 5 Clinical sample detection and verification

[0084] This application uses a composite system of 19 short tandem repeats and a sex locus to amplify clinical samples and obtain individual STR typing

[0085] 1. Collection of paraffin-embedded tissue samples (paraffin-embedded tissues are donated by volunteers)

[0086] 2. DNA Extraction

[0087] Genomic DNA was extracted using the Chelex-100 method (see "Forensic DNA Protocol". Humana Press, 1998). 0.5-5 μl of anticoagulated whole blood / amniotic fluid was placed in a 500 μl centrifuge tube. The Chelex solution was shaken to fully suspend the Chelex. 195 μl of Chelex-100 (5%) solution and 5 μl of proteinase K (20 mg / ml) were added to each tube and shaken to mix. After incubation at 56°C for two hours or overnight, the tube was removed and shaken for 2 minutes. After heating in boiling water for 10 minutes, the tube was centrifuged at 13,000 rpm for 5 minutes. 150 μl of the supernatant was carefully transferred to a new centrifuge tube.

[0088] The commercial paraffin-embedded tissue-specific nucleic acid extraction kit is used for extraction. The hydatidiform mole gene typing detection system of the present invention has high detection sensitivity and can detect DNA with a concentration of ≥0.5 ng / μL.

[0089] 3. Reaction System

[0090] After oscillation, each reaction reagent (buffer, primer mix, genomic DNA, etc.) was mixed to form a PCR reaction mixture as follows: the total volume of the amplification system was 20 μl, including 2 μl of primer mix (5*Primer mix), where the primer concentrations are shown in Table 2, 5 μl of reaction buffer (PCR reaction solution), 2 μl of enzyme mix, 1 μl of genomic DNA (extracted template DNA), and 10 μl of ddH2O.

[0091] 4. PCR Reaction Procedure

[0092] The PCR amplification program (Table 7) used in the multiplex amplification system of the present invention has a theoretical program time of 57 minutes, which is relatively short.

[0093] Table 7 Amplification procedures of the composite amplification system of the present invention

[0094]

[0095] 5. Capillary electrophoresis detection

[0096] Mix Orange500 internal standard and formamide in a ratio of 2.5:100, take 12.5μl of the mixture and add it to a 96-well plate. Then add 1μl of the amplified product sample or allele standard. Mix and let it stand for a few minutes. Denature at 95℃ for 3 minutes, immediately ice bath for 3 minutes, centrifuge and place on the ABI3500 sequencer for detection.

[0097] 6. Data Analysis

[0098] Import the raw data, select Add sample to project from the File menu on the main page, find the sample file, select the folder, click add to list, click add, and the sample file will be displayed in the Project window; select the analysis parameters. Define the analysis method, panel, and size standard. Browse the raw data of the sample electrophoresis, select the file name of a sample, and select "Raw data" under the "sample" menu. Move the tracking line so that the cursor stops on the right side of the primer peak (before the first orange internal standard peak), and use the value displayed on the X-axis in the lower left corner of the window as the starting point in the analysis method analysis parameters; click the green analysis button, and the save project dialog box will appear. After naming and saving, the software will start processing the data. After the analysis is completed, analysis completed will be displayed in the lower left corner. GeneMapper ID-X software is used to analyze the obtained data and generate a spectrum, such as Figures 8-9 The peaks at each site are good, there is no non-specific production, the amplification efficiency is high, and the balance between sites is good.

[0099] Example 6

[0100] The status of hydatidiform mole was detected using a multiplex amplification system of 19 short tandem repeat sequences and one sex locus.

[0101] In this test, a group of mother-child pairs were tested, and the results are shown in Figures 8-9 The identification system of the present invention was used to obtain the following typing of each individual in the mother-child pair (Table 8):

[0102] Table 8: Individual STR typing of mother and child pairs

[0103] Site fetus Mother TPOX 8 11 D5S818 11 10,11 D18S51 13 14 D7S820 13 10,11 AMEL / / D3S1358 16 15,18 D13S317 8 11 D21S11 31.2 30,31.2 D16S539 9 11,12 D2S441 12 10,11 vWA 14 14,19 D8S1179 14 10,14 D6S1043 18 18 TH01 8 6,9 D12S391 18 20,22 D2S1338 19 20,22 CSF1PO 15 10,11 D19S433 15.2 14.2,15.2 D10S1248 15 14,15 FGA 24 18,22

[0104] Analysis of the mother-child pair revealed that all loci in the fetus were monotypic (one repeat number), and 12 loci (TPOX, D18S51, D7S820, D3S1358, D13S317, D16S539, D2S441, TH01, D12S391, D2S1338, CSF1PO, and FGA) had no corresponding type in the mother's sample. A normal individual would not have monotypic loci at all, and the fetus had a repeat number consistent with the mother at each locus. Therefore, the results in the table above suggest that the fetus may have a monospermic complete hydatidiform mole, which is consistent with clinical feedback.

[0105] The above embodiments are only preferred implementations of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and equivalent substitutions can be made without departing from the principles of the present invention. These technical solutions after improvements and equivalent substitutions to the claims of the present invention all fall within the scope of protection of the present invention.

Claims

1. A hydatidiform mole genotyping detection system, characterized in that: The hydatidiform mole genotyping detection system consists of 20 primer pairs for simultaneously amplifying 20 loci: TPOX, D5S818, D18S51, D7S820, AMEL, D3S1358, D13S317, D21S11, D16S539, D2S441, vWA, D8S1179, D6S1043, TH01, D12S391, D2S1338, CSF1PO, D19S433, D10S1248, and FGA; The 20 sets of primer pairs and their concentrations are: The amplified sites in the hydatidiform mole genotyping detection system are respectively marked with five colors of fluorescent markers, and the same fluorescent markers are considered to be the same group. The five groups are: Group 1: TPOX, D5S818, D18S51, D7S820; Group 2: AMEL, D3S1358, D13S317, D21S11, D16S539; Group 3: D2S441, vWA, D8S1179, D6S1043; Group 4: TH01, D12S391, D2S1338, CSF1PO; Group 5: D19S433, D10S1248, FGA.

2. The hydatidiform mole genotyping detection system according to claim 1, characterized in that: The first group was labeled with FAM, the second group was labeled with HEX, the third group was labeled with TAMRA, the fourth group was labeled with ROX, and the fifth group was labeled with PURP.

3. The hydatidiform mole genotyping detection system according to claim 1, characterized in that: The hydatidiform mole gene typing detection system further comprises a PCR reaction solution and an enzyme mixture.

4. The hydatidiform mole genotyping detection system according to claim 3, characterized in that: The PCR reaction solution includes: 10mM ammonium sulfate, 10mM potassium chloride, 60mM Tris-HCl (pH 8.5), 2.5mM magnesium ion, 0.8ug / ul BSA, 5% DMSO, 8% ethylene glycol, 1mM Na4P2O7 and 0.25mM Dntp.

5. The hydatidiform mole genotyping detection system according to claim 3, characterized in that: The enzyme mixture includes: 8U of Taq enzyme and 0.4U of UDG enzyme.

6. A kit comprising the hydatidiform mole genotyping detection system according to any one of claims 1 to 5.

7. Use of the hydatidiform mole gene typing detection system according to any one of claims 1 to 5 or the kit according to claim 6 in the preparation of a hydatidiform mole typing detection reagent.