Trans-aconitic acid transporter and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to trans-aconitic acid transporter and application thereof. The trans-aconitic acid (TAA) transporter provided by the invention has an effect of transporting extracellular TAA into microbial cells, plays an important role in TAA metabolic pathway utilization by microorganisms, provides a new genetic resource for regulation and control of synthesis and utilization of microbial TAA, has a good application prospect in the fields of screening, cultivation and improvement of TAA efficient utilization bacteria, and has a wide application prospect. And a new method and thought are provided for enhancing the carbon assimilation capability of the probiotics, improving the rhizosphere colonization capability and the like. Meanwhile, by expressing the protein in plants, microorganisms and the like, the nematicidal activity of the protein is improved, and a new thought is provided for biological control of nematode infection. In addition, the TAA transporter provided by the invention can be specifically combined with TAA molecules with high affinity, and a specific carrier material and a feasible way are provided for affinity chromatography purification of TAA.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a trans-aconitate transporter and applications thereof. Background Art

[0002] Trans-aconitic acid (TAA) is a stereoisomer of cis-aconitic acid (CAA), an intermediate product of the tricarboxylic acid cycle. Although CAA and TAA can be mutually converted, the trans conformation has stronger stability. Therefore, aconitic acid in nature mostly exists in the form of TAA molecules.

[0003] In the natural environment, TAA mainly comes from plants and microorganisms. Many plants and microorganisms can efficiently produce TAA as a defense metabolite. At the same time, TAA is a component of plant rhizosphere secretions that is widely present in nature and has the potential to be used by plant probiotics. It is secreted into the rhizosphere environment and can be converted and utilized by microorganisms as a carbon source. Existing studies have found that among bacteria derived from plants, more than 90% of individuals can use TAA as a carbon source, while among bacteria of non-plant origin, only less than 15% of individuals can use TAA. This not only shows that plant-related bacteria generally have TAA metabolic pathways, but also shows that TAA metabolism plays an important role in helping plant-derived bacteria adapt to their living environment and enhance their ability to colonize the rhizosphere.

[0004] Biopesticides and biofertilizers developed based on plant probiotics have gradually become an important means for developing green agriculture and sustainable production in my country and even the world. However, in actual production and application, these biological preparations often have problems such as unstable and non-persistent effects. Enhancing the rhizosphere colonization ability of probiotics is the fundamental solution to the problem. The carbon metabolism ability of probiotics is a prerequisite for determining their survival and occupies a fundamental position in the physiological activity of probiotic colonization. Therefore, it is important to deeply understand the carbon metabolism ability of plant probiotics to utilize TAA and deeply explore the mechanism of bacterial assimilation and utilization of TAA.

[0005] Although there have been relevant reports, there are generally few studies on the cloning and functional identification of genes and proteins related to bacterial metabolism of TAA carbon sources. Therefore, it is urgent to explore and utilize new TAA-related regulatory genes and proteins, which can provide new improvement directions for efficient utilization of TAA carbon sources, improving the carbon metabolism ability of probiotics, improving the growth and reproduction ability of microorganisms, and enhancing the ability of rhizosphere colonization. Summary of the invention

[0006] In view of the above-mentioned technical problems in the prior art, the present invention provides a trans-aconitate (TAA) transporter that has the function of transporting extracellular TAA into microbial cells, plays an important role in the TAA metabolic pathway of microorganisms, provides a new genetic resource for regulating the synthesis and utilization of microbial TAA, and has good application prospects in the screening, cultivation and improvement of TAA efficient utilization bacteria, which provides a new method and idea for enhancing the carbon assimilation ability of probiotics and improving the rhizosphere colonization ability. At the same time, TAA has been reported to have good nematicidal activity. By expressing the TAA transporter of the present invention in plants, microorganisms, etc., the accumulation of TAA in biological cells is enhanced, which is conducive to improving its nematicidal activity, and provides a new idea for biological control of nematode infection. Therefore, the present invention provides the application of trans-aconitate transporter in the aforementioned fields. The present invention is specifically implemented through the following scheme:

[0007] The first aspect of the present invention provides a trans-aconitate transporter, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] Furthermore, the nucleotide sequence of the gene encoding the trans-aconitate transporter is shown in SEQ ID NO.1.

[0009] The second aspect of the present invention provides the use of the trans-aconitate transporter or the gene encoding it as described above in regulating the trans-aconitate utilization ability of microorganisms.

[0010] Furthermore, regulating the trans-aconitic acid utilization ability of the microorganism includes positive regulation and negative regulation; wherein, positive regulation of the trans-aconitic acid utilization ability of the microorganism is achieved by enhancing the expression level of the trans-aconitic acid transporter in the microorganism, and negative regulation of the trans-aconitic acid utilization ability of the microorganism is achieved by reducing the expression level of the trans-aconitic acid transporter in the microorganism.

[0011] Furthermore, negatively regulating the trans-aconitate utilization ability of the microorganism comprises the following steps: constructing a knockout vector for the trans-aconitate transporter, transforming a wild-type microorganism, and culturing to obtain a transgenic microorganism lacking the trans-aconitate transporter encoding gene.

[0012] Furthermore, constructing the transaconitate transporter knockout vector comprises the following steps: using the genome of Bacillus velezensis FZB42 as a template, and using the primer pairs shown in SEQ ID NO.3-4 and SEQ ID NO.5-6 to obtain the upstream homologous arm fragment of the transaconitate transporter gene and the downstream homologous arm fragment of the transaconitate transporter gene by PCR amplification; using the chloramphenicol resistance gene as a template, and using the primer pairs shown in SEQ ID NO.7-8 to obtain the chloramphenicol resistance gene fragment by PCR amplification; then obtaining the fusion product of the upstream homologous arm fragment of the transaconitate transporter gene, the chloramphenicol resistance gene fragment and the downstream homologous arm fragment of the transaconitate transporter gene in sequence by overlapping extension PCR, and connecting the fusion product to the T vector by TA cloning technology to obtain the transaconitate transporter knockout vector.

[0013] Furthermore, the microorganism is a bacterium; furthermore, it is Bacillus velezensis.

[0014] The third aspect of the present invention provides the use of the trans-aconitate transporter or its encoding gene as described above in enhancing the rhizosphere colonization ability of probiotics.

[0015] The fourth aspect of the present invention provides the use of the transaconitate transporter or its encoding gene as described above in controlling nematodes. The transaconitate transporter enhances the nematicidal ability by promoting the accumulation of TAA in biological cells.

[0016] The fifth aspect of the present invention provides the use of the trans-aconitate transporter or its encoding gene as described above in affinity purification of trans-aconitate.

[0017] The advantages and positive effects of the present invention are:

[0018] The trans-aconitic acid (TAA) transporter provided by the present invention has the function of transporting extracellular TAA into microbial cells, plays an important role in the TAA metabolic pathway used by microorganisms, provides a new genetic resource for regulating the synthesis and utilization of microbial TAA, and has good application prospects in the fields of screening, cultivation and improvement of TAA efficient utilization bacteria, which provides a new method and idea for enhancing the carbon assimilation ability of probiotics and improving the rhizosphere colonization ability. At the same time, TAA has been reported to have good nematicidal activity. By expressing the TAA transporter of the present invention in plants, microorganisms, etc., the accumulation of TAA in biological cells is enhanced, which is conducive to improving its nematicidal activity, and provides a new idea for biological control of nematode infection. In addition, the TAA transporter provided by the present invention can bind to TAA molecules specifically and with high affinity, providing a specific carrier material and a feasible approach for affinity chromatography purification of TAA. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings used in describing the embodiments.

[0020] Figure 1 The secondary structure analysis diagram of the TarB protein of the present invention;

[0021] Figure 2 This is a diagram showing the growth of the wild strain FZB42 and mutant strain ΔtarB of Bacillus velezinii of the present invention on an ACO solid plate with trans-aconitic acid as the sole carbon source;

[0022] Figure 3 The growth curves of the wild strain FZB42 and mutant strain ΔtarB of Bacillus velez in the embodiment of the present invention in ACO liquid medium containing glucose;

[0023] Figure 4 The concentration change curve of extracellular trans-aconitic acid during the cultivation of the wild strain FZB42 and the mutant strain ΔtarB of Bacillus velezinii in the embodiment of the present invention is shown;

[0024] Figure 5 The curve of the change of extracellular glucose concentration during the cultivation of the wild strain FZB42 and the mutant strain ΔtarB of Bacillus velezinii in the embodiment of the present invention;

[0025] Figure 6 This is the binding curve of TarB protein and trans-aconitic acid in the example of the present invention. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0027] Based on the information contained in the present invention, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for the purpose of illustrating specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0028] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers and other numerical values ​​used in the present invention to express the amount, percentage, etc. should be understood as modified by the word "approximately" in all cases. The term "approximately" has its usual meaning, which is used to indicate that a value includes the inherent variation of the error of the device or method used to determine the value, or contains a value close to the value, such as within 10% of the value (or range of values). Therefore, unless otherwise specified, the numerical parameters listed in the specification and the attached claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained.

[0029] In addition, it should be noted that the meanings of the terms "include", "comprises", "contains", "has" and the like are non-restrictive, that is, other steps and other components that do not affect the results may be added. The term "and / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be regarded as including the following situations: (i) A, (ii) B, and (iii) A and B.

[0030] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0031] The present invention takes Bacillus Velez FZB42, a plant rhizosphere growth-promoting microorganism that can efficiently assimilate and utilize trans-aconitic acid (TAA), as the object, and identifies a gene encoding a TAA transporter from its genome, named tarB (TAAassimilation-related gene B), and its encoded protein is named TarB. The tarB gene and the aconitate isomerase encoding gene tarA (TAA assimilation-related gene A) are located in the same operon. The tarB gene of Bacillus Velez FZB42 was knocked out by gene knockout technology, and it was found that the tarB gene-deficient mutant strain could not utilize TAA, which was manifested as poor growth in a culture medium with TAA as the only carbon source, and only glucose could be utilized in a culture medium with glucose and TAA as carbon sources, while the TAA content remained unchanged; on the contrary, the wild-type strain could utilize TAA in the culture medium as a nutrient carbon source to maintain cell growth and reproduction, confirming that TarB plays the function of a TAA intracellular transporter, can specifically transport extracellular TAA into the cell, and promote the growth of microorganisms. Microscale thermophoresis (MST) experiments also proved that the protein can effectively bind to TAA with high affinity, and the dissociation equilibrium constant K D As low as 5.66±1.38 μM. The present invention identifies TAA intracellular transporter for the first time, which plays an important role in bacterial assimilation and utilization of TAA in the environment.

[0032] Based on the above findings, an embodiment of the present invention provides a trans-aconitate transporter, the amino acid sequence of which is shown in SEQ ID NO.2.

[0033] The trans-aconitic acid (TAA) transporter provided by the present invention has the function of transporting extracellular TAA into microbial cells, and plays an important role in the utilization of TAA metabolic pathways by microorganisms. The present invention provides a new genetic resource for regulating the synthesis and utilization of microbial TAA, and also provides a theoretical basis for analyzing the trans-aconitic acid (TAA) transporter to regulate the growth and reproduction of microorganisms. It can be used for the screening, cultivation and improvement of TAA efficient utilization bacteria, and has good application value in the efficient production and efficient utilization of microbial TAA. It is well known that the stronger the ability of microorganisms to utilize carbon sources in the environment, the more conducive to the colonization of microorganisms in the natural environment. Trans-aconitic acid, as a widely existing carbon source, can be assimilated and utilized by many bacteria. By expressing the protein in probiotics, the ability of microorganisms to synthesize, accumulate and utilize TAA can be enhanced, thereby enhancing their ability to assimilate and utilize carbon sources, which is conducive to improving the rhizosphere colonization ability of probiotics and the stress resistance survival performance in the rhizosphere environment. In addition, TAA has good nematicidal activity. By expressing the TAA transporter of the present invention in plants, microorganisms, etc., the accumulation of TAA in the aforementioned biological cells is enhanced, which is conducive to improving its nematicidal activity, providing a new idea for biological control of nematodes. In addition, the trans-aconitic acid (TAA) transporter provided by the present invention can specifically and highly affinity bind to TAA molecules, providing a specific carrier material and a feasible approach for affinity chromatography purification of TAA, and has potential application prospects in the field of TAA affinity purification.

[0034] Optionally, the nucleotide sequence of the gene encoding the trans-aconitate transporter is shown in SEQ ID NO.1.

[0035] Based on the same inventive concept as above, another embodiment of the present invention provides an application of the trans-aconitate transporter or its encoding gene as described above, specifically, providing at least one of the following applications of the trans-aconitate transporter or its encoding gene:

[0036] a) Application in regulating the trans-aconitic acid utilization ability of microorganisms;

[0037] b) Application in enhancing the rhizosphere colonization ability of probiotics;

[0038] c) Application in the control of nematodes;

[0039] d) Application in affinity purification of trans-aconitate.

[0040] Optionally, the regulation of microbial trans-aconitate utilization ability includes positive regulation and negative regulation. By increasing the expression of the trans-aconitate transporter, positive regulation of microbial trans-aconitate utilization ability can be achieved. By reducing the expression of the trans-aconitate transporter, negative regulation of microbial trans-aconitate utilization ability can be achieved. It should be noted that the expression of the trans-aconitate transporter includes the expression of the gene level (mRNA) and / or the expression of the protein level. The gene level can be achieved by RNA interference technology, CRISPR-Cas9 technology or overexpression vector, and the protein level can be achieved by protein activators or inhibitors, etc. This is a conventional technical means in the art and will not be described in detail here.

[0041] Specifically, negatively regulating the trans-aconitate utilization ability of the microorganism comprises the following steps: constructing a knockout vector for the trans-aconitate transporter, transforming a wild-type microorganism, and culturing a transgenic microorganism lacking the trans-aconitate transporter encoding gene.

[0042] More specifically, constructing the transaconitate transporter knockout vector comprises the following steps: using the genome of Bacillus velezensis FZB42 as a template, using the primer pairs shown in SEQ ID NO.3-4 and SEQ ID NO.5-6 to obtain the upstream homologous arm fragment of the transaconitate transporter gene and the downstream homologous arm fragment of the transaconitate transporter gene by PCR amplification; using the chloramphenicol resistance gene as a template, using the primer pairs shown in SEQ ID NO.7-8 to obtain the chloramphenicol resistance gene fragment by PCR amplification; then obtaining the fusion product of the upstream homologous arm fragment of the transaconitate transporter gene, the chloramphenicol resistance gene fragment and the downstream homologous arm fragment of the transaconitate transporter gene by overlapping extension PCR, and connecting the fusion product to the T vector by TA cloning technology to obtain the transaconitate transporter knockout vector.

[0043] Optionally, the microorganism or probiotic mentioned above is preferably a bacterium, such as Bacillus Velezii.

[0044] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or the conditions recommended by the manufacturer.

[0045] 1. TarB protein coding gene sequence, amino acid sequence and domain analysis

[0046] The experimental material used in this study is Bacillus velezensis (B. velezensis) FZB42. FZB42 is a classic plant rhizosphere growth-promoting microorganism with advantages such as clear genetic background and mature operating system. Therefore, FZB42 is also a model strain in the study of bacteria-plant interactions. The genome sequence can be found in NCBI accession number NC_009725.2.

[0047] FZB42 can efficiently assimilate and utilize TAA carbon source. The present invention analyzes its genome sequence and finds a putative transport protein. The gene encoding the protein is in the same operon as the tarA (TAAassimilation-relatedgeneA) gene encoding aconitate isomerase. Aconitate isomerase mediates the conversion of TAA into CAA when FZB42 assimilates and utilizes TAA.

[0048] In order to further study the function of the newly discovered gene, the present invention knocked out the gene in the FZB42 strain through genetic experiments such as gene knockout. The results showed that the protein encoded by the gene can specifically transport extracellular TAA to the cell and promote the growth of microorganisms. The microthermophoresis (MST) experiment further proved that the protein can effectively bind to the TAA molecule. The present invention identified the intracellular transporter of TAA for the first time, which plays the intracellular transport function of TAA when FZB42 assimilates and utilizes TAA, and has application value in the efficient utilization and efficient production of TAA. The DNA sequence of the tarB gene and the amino acid (AA) sequence of the protein are shown in Table 1.

[0049] Table 1 tarB gene and protein sequence of the present invention

[0050]

[0051]

[0052] Bioinformatics analysis of the secondary structure of TarB protein was performed using the Transporter Classification Database (https: / / www.tcdb.org / ). It was found that TarB is an MFS superfamily domain protein with both its amino and carboxyl termini located in the cytoplasm. Each end contains 6 transmembrane helices, and between the two sets of helices is a 64-amino acid hinge region.

[0053] 2. Construction of the tarB gene deletion mutant strain ΔtarB of Bacillus velez

[0054] Using the genome of Bacillus velezensis FZB42 and the chloramphenicol resistance gene (artificially synthesized using the chloramphenicol resistance gene information on the cloning vector pAgR-gCBE4, the GenBank accession number of the cloning vector is MW344269.1) as templates, PCR technology was used to obtain the upstream homology arm fragment of the tarB gene, the chloramphenicol resistance gene fragment and the downstream homology arm fragment of the tarB gene, respectively.

[0055] The two primers for the upstream homology arm of the tarB gene are tarB-UF and tarB-UR, and the nucleotide sequences are as follows:

[0056] tarB-UF:TATGGATCCACATCCAAGCGGCATTTTAG (see SEQ ID NO.3);

[0057] tarB-UR: GTCAAAGCCTTGTGTATCAACCGAGTATTTCTGGGTTCCA (see SEQ ID NO. 4).

[0058] The two primers for the downstream homology arm of the tarB gene are tarB-DF and tarB-DR, and the nucleotide sequences are as follows:

[0059] tarB-DF:TCGGTGATGACGGTGAAAACCAAAAGATGCAGCAGGATGA (see SEQ ID NO.5);

[0060] tarB-DR: GAGCCGATGAATGAAGATGTGT (see SEQ ID NO. 6).

[0061] The two primers for amplifying the chloramphenicol resistance gene fragment are Cm-F and Cm-R, and the nucleotide sequences are as follows:

[0062] Cm-F: TGGAACCCAGAAATACTCGGTTGATACACAAGGCTTTGAC (see SEQ ID NO. 7);

[0063] Cm-R: TCATCCTGCTGCATCTTTTGGTTTTCACCGTCATCACCGA (see SEQ ID NO. 8).

[0064] The PCR configuration system is: 1 μL DNA template, 2 μL upstream primer and 2 μL downstream primer, 1 μL high-fidelity PCR polymerase, 20 μL 5× buffer, 2 μL dNTP, and ddH2O supplemented to 100 μL. PCR program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, 72°C extension for 1 min, and 30 cycles. The PCR product was subjected to agarose gel electrophoresis, and the target band was cut and recovered to obtain the upstream homology arm fragment tarB-U of the tarB gene, the downstream homology arm fragment tarB-D of the tarB gene, and the chloramphenicol resistance gene fragment Cm.

[0065] The upstream homology arm fragment tarB-U of the tarB gene and the chloramphenicol resistance gene fragment Cm were fused by cross-over PCR to obtain the tarB-U-Cm fragment. The PCR configuration system was: upstream homology arm fragment tarB-U 0.5μL, chloramphenicol resistance gene fragment Cm 0.5μL, primer tarB-UF 2μL, primer Cm-R 2μL, high-fidelity PCR polymerase 1μL, 5× buffer 20μL, dNTP 2μL, and ddH2O was added to 100μL. PCR program: 94℃ pre-denaturation 5min, 94℃ denaturation 30s, 50℃ annealing 40s, 72℃ extension 1.5min, and 30 cycles. The PCR product was subjected to agarose gel electrophoresis and the gel was cut and recovered to purify the tarB-U-Cm fusion fragment.

[0066] Next, the tarB-U-Cm fragment and the downstream homology arm fragment of the tarB gene, tarB-D, were fused by cross-over PCR to obtain the tarB-U-Cm-tarB-D fragment. The PCR configuration system was: 0.5 μL of tarB-U-Cm fragment, 0.5 μL of downstream homology arm fragment of the tarB gene, 2 μL of primer tarB-UF, 2 μL of primer tarB-DR, 1 μL of high-fidelity PCR polymerase, 20 μL of 5× buffer, 2 μL of dNTP, and ddH2O was added to 100 μL. PCR program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 50℃ annealing for 40 s, 72℃ extension for 2.5 min, and 30 cycles. The PCR product was subjected to agarose gel electrophoresis and the gel was cut and recovered to obtain the tarB-U-Cm-tarB-D fusion fragment.

[0067] The tarB-U-Cm-tarB-D fusion fragment was connected to the T vector by TA cloning technology. After the successful construction of the vector was verified by sequencing, the linearized recombinant plasmid was obtained by BamHI digestion. The linearized recombinant plasmid was then transformed into Bacillus velezensis FZB42.

[0068] Use an inoculation loop to inoculate Bacillus velezensis FZB42 into 20 mL LB liquid medium, and culture overnight at 200 rpm and 37°C; take 500 μL of the overnight culture solution and inoculate it into 20 mL SPI Medium, and culture at 200 rpm and 37°C. When the OD 600 When the cell density reaches 1.4-1.5, take 2.5mL of culture solution and inoculate it into 20mL SPII Medium, shake and culture at 37℃, 100rpm for 1.5h; add 250μL 10mM EGTA (pH 8.0) solution, continue to culture at 37℃, 100rpm for 10min, and divide into 500μL per tube with 1.5mL centrifuge tube; add 15μL of linearized recombinant plasmid to each tube, mix well, and culture at 37℃, 100rpm for 50min; add 800μL LB medium to each tube, continue to shake and culture at 200rpm, 37℃ for 2h; spread on LB plate containing chloramphenicol, and culture at 37℃ for 24h. The transformed product is the tarB gene deletion mutant strain ΔtarB.

[0069] SPI Medium includes: 0.19% (NH4)2SO4, 1.36% K2HPO4·3H2O, 0.58% KH2PO4, 0.10% Trisodium citrate dihydrate, 202μL 5% MgSO4·7H2O, 202μL 50% glucose and 202μL 1% CAYE, and the above percentages are mass volume ratios (w / v).

[0070] SPII Medium includes: 19.60mL SPI, 200μL 50mM CaCl2 and 200μL 250mM MgCl2. The final concentration of CaCl2 in the culture medium is 0.5mM, and the final concentration of MgCl2 is 2.5mM.

[0071] 3. Utilization of TAA by Bacillus velezensis FZB42 and ΔtarB mutant

[0072] Inoculate single colonies of the wild strain FZB42 and mutant strain ΔtarB of Bacillus velezinsis into 7mL LB liquid medium, culture at 37℃ and 200rpm for 12-14h; take 1mL of FZB42 and ΔtarB culture solution respectively in 1.5mL centrifuge tubes; centrifuge at 8000rpm for 1min, discard the supernatant, and collect the bacteria; resuspend the bacteria with 1mL sterile water, and take 1μL of the resuspended bacteria to streak culture on solid ACO medium (with TAA as the only carbon source) plates. ACO medium includes the following concentration components: 7.5g / LTAA, 2g / L (NH4)2SO4, 1g / L K2HPO4, 0.5g / L MgSO4 and 0.1g / L FeCl3·6H2O, pH 7.0.

[0073] The plates that had been cultured for 16 h were taken out to observe the growth differences between the wild-type strain FZB42 and the mutant strain ΔtarB. Figure 2 It can be seen that the FZB42 strain has obvious growth on the ACO plate, while the ΔtarB mutant strain cannot use TAA as a carbon source due to the knockout of the tarB gene, and does not grow on the ACO plate. This confirms that FZB42 can efficiently utilize TAA, while the knockout strain ΔtarB cannot utilize TAA.

[0074] 4. Bacillus velezensis TarB protein plays a role in transporting extracellular TAA into cells

[0075] Inoculate single colonies of wild strain FZB42 and mutant strain ΔtarB into 7 mL LB liquid medium, and culture at 200 rpm and 37 °C for 12-14 h; transfer FZB42 and ΔtarB to 10 mL LB fresh LB liquid medium at 1% inoculum, and culture at 200 rpm and 37 °C for 12-14 h; centrifuge at 8000 rpm for 1 min, discard the supernatant, collect the cells, wash the cells with 600 μL liquid ACO medium, and then measure the OD of FZB42 and ΔtarB. 600 value to ensure that the initial OD values ​​inoculated into ACO medium containing glucose were consistent; FZB42 and ΔtarB were inoculated into ACO medium containing glucose (including: 1g / L Glucose, 2g / LTAA, 2g / L(NH4)2SO4, 1g / LK2HPO4, 0.5g / L MgSO4 and 0.1g / LFeCl3·6H2O, pH 7.0), and cultured at 200rpm and 37℃ for 48h; during this period, samples were taken every 2h to determine the growth curves and extracellular TAA content of the two.

[0076] Take 1 mL of the cultured bacterial solution, centrifuge at 12000 rpm for 5 min, and take the supernatant to detect the concentration of extracellular TAA. Liquid chromatography detection method for extracellular TAA: The liquid chromatography model is UltiMate3000; Agilent 5TC-C18 (2) analytical column (4.6 mm × 250 mm, 5 μm) is used. The mobile phase is 89.9% (v / v) ddH2O + 10% (v / v) methanol + 0.1% (v / v) formic acid; HPLC-UV parameters are set as follows: column oven 25°C, injection volume 10 μL, flow rate 1 mL / min, detection wavelength 260 nm, analysis time 10 min.

[0077] Figure 3-5 The growth curves of the wild strain FZB42 and the mutant strain ΔtarB in ACO liquid medium containing glucose, and the change curves of extracellular TAA and glucose concentrations are shown respectively. It can be seen that from 0 to 10 hours, the growth curves of FZB42 and ΔtarB are basically consistent, and glucose is mainly used as a carbon source for growth at this stage. From the 10th hour, the FZB42 strain began to use TAA as a carbon source, and the extracellular TAA concentration gradually decreased, causing secondary growth. However, ΔtarB did not show secondary growth, and its extracellular TAA concentration remained unchanged. This result proves that the TarB protein has the function of transporting extracellular TAA into the cell.

[0078] 5. The purified TarB protein interacts with TAA molecules

[0079] Using the genome of Bacillus velez FZB42 as a template, PCR technology was used to obtain the fragments of heterologous expression of TarB protein. The two primers for heterologous expression of TarB protein are tarB-F and tarB-R, and the nucleotide sequences are as follows:

[0080] tarB-F: CTTTAAGAAGGAGATATACCATGGGAATCAATGTAAATGCGTC (see SEQ ID NO.9);

[0081] tarB-R: GTGGTGGTGGTGGTGGTGCTCGAGCAACTTTTGTTGCACGAAT (see SEQ ID NO. 10).

[0082] The PCR configuration system is: 1 μL DNA template, 2 μL upstream primer, 2 μL downstream primer, 1 μL high-fidelity PCR polymerase, 20 μL 5× buffer, 2 μL dNTP, and ddH2O to 100 μL. PCR program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, 72°C extension for 1 min, 30 cycles. The PCR product was subjected to agarose gel electrophoresis, and the target band was cut and recovered to obtain the heterologous expression fragment of TarB protein. The fragment was then connected to the pET28b vector, and after successful sequencing, it was transformed into Escherichia coli C43 (DE3) to obtain the TarB recombinant expression strain.

[0083] The TarB recombinant expression strain was inoculated into LB medium, and the TarB recombinant expression strain was induced at a final concentration of 0.5 mM isopropyl-β-d-thiogalactopyranoside (IPTG) at 37°C. After 8 hours of induction culture, the cells were collected by centrifugation and resuspended in buffer A (including: 25 mM Tris-HCl, 150 mM NaCl and 10 mM imidazole, pH 7.6). After high-pressure homogenization, the supernatant was obtained by centrifugation at 17000 rpm at 4°C for 1 hour. After ultracentrifugation at 200,000 rpm for 1 hour, the precipitate was harvested and dissolved in buffer B (including: 25 mM Tris-HCl, 150 mM NaCl, 10 mM imidazole and 1% (w / v) dodecyl β-D-maltoside, pH 7.6), stirred for 5 hours, and centrifuged at 17,000 rpm to harvest the supernatant containing TarB, which was then purified by Ni-NTA affinity purification and rapidly concentrated by ultrafiltration with a 10 kDa filter membrane. Finally, a Superdex 200 Increase 10 / 300 GL column (manufacturer: Sigma-Aldrich; catalog number: GE28-9909-44) was used for further chromatography to collect the component with the highest absorption peak to obtain the purified TarB protein.

[0084] The interaction between TarB protein and TAA molecules was analyzed using microthermophoresis (MST) technology. The principle of MST is: one of the interacting molecules (such as protein) is labeled with a fluorescent dye, and the other interacting molecule (such as protein ligand) is mixed with the labeled protein in a capillary according to a specific concentration gradient. During the detection, the infrared laser beam in the instrument heats the center of the detection area of ​​the capillary to generate a microscopic temperature gradient field. The changes in the size, hydration layer and charge of the labeled protein and ligand complex can cause the thermophoresis velocity of the complex molecule to change relative to the thermophoresis velocity of the labeled protein molecule. Therefore, it is easy to detect the MST signal change caused by the binding of the labeled protein and the ligand molecule. Specifically, 800nM purified TarB protein and 100nM NTA dye (manufacturer: Nano temper Technologies; item number: SKU: MO-L018) were mixed evenly, incubated for 30min, and centrifuged to obtain the supernatant. A total of 16 concentration gradient compounds were prepared with 1 micromole TAA as the highest concentration. Then, 10 μL of TarB protein labeled with NTA dye was added to each test tube and loaded onto the detection device using a standard capillary. The scanning parameters were MST power of 40% and LED power of 80%. MonolithNT.115 was used for fluorescence measurement to record the change of fluorescence intensity in each capillary over time in the temperature gradient. The fluorescence intensity value was then used as the ordinate and the ligand concentration as the abscissa for fitting. The affinity constant K for the binding of TarB protein and TAA was calculated. D Data were analyzed using MO.AffinityAnalysis V2.3* (Nano temper Technologies, Germany).

[0085] Figure 6 The binding curve between the labeled purified TarB protein and the TAA molecule is shown. The results show that the TarB protein binds to the TAA substrate molecule and exhibits a ligand dose-dependent change in fluorescence intensity, indicating that the TarB protein can directly bind to the TAA molecule and is responsible for its transport. The dissociation equilibrium constant K between the two is D =5.66±1.38 μM, indicating that TarB protein has a higher affinity with the substrate TAA.

[0086] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A transaconitate transporter, characterized in that The amino acid sequence of the trans-aconitate transporter is shown in SEQ ID NO.

2.

2. The transaconitate transporter according to claim 1, characterized in that The nucleotide sequence of the gene encoding the trans-aconitate transporter is shown in SEQ ID NO.

1.

3. Use of the trans-aconitate transporter or its encoding gene as claimed in claim 1 in regulating the trans-aconitate utilization ability of microorganisms.

4. The use of the trans-aconitate transporter or its encoding gene according to claim 3 in regulating the trans-aconitate utilization ability of microorganisms, characterized in that: Regulating the trans-aconitic acid utilization ability of the microorganism includes positive regulation and negative regulation; wherein: By increasing the expression level of the trans-aconitate transporter in the microorganism, the trans-aconitate utilization ability of the microorganism is positively regulated; by decreasing the expression level of the trans-aconitate transporter in the microorganism, the trans-aconitate utilization ability of the microorganism is negatively regulated.

5. Use of the trans-aconitate transporter or its encoding gene according to claim 4 in regulating the trans-aconitate utilization ability of microorganisms, characterized in that: Negatively regulating the trans-aconitic acid utilization ability of the microorganism comprises the following steps: A knockout vector for the trans-aconitate transporter is constructed, a wild-type microorganism is transformed, and a transgenic microorganism lacking the trans-aconitate transporter encoding gene is obtained by culturing.

6. Use of the trans-aconitate transporter or its encoding gene according to claim 5 in regulating the trans-aconitate utilization ability of microorganisms, characterized in that: The construction of the transaconitate transporter knockout vector comprises the following steps: Using the genome of Bacillus velez FZB42 as a template, the primer pairs shown in SEQ ID NO.3-4 and SEQ ID NO.5-6 were used to PCR amplify the upstream homology arm fragment of the trans-aconitate transporter gene and the downstream homology arm fragment of the trans-aconitate transporter gene respectively; using the chloramphenicol resistance gene as a template, the primer pairs shown in SEQ ID NO.7-8 were used to PCR amplify the chloramphenicol resistance gene fragment; Then, overlapping extension PCR is used to obtain a fusion product in which the upstream homology arm fragment of the trans-aconitate transporter gene, the chloramphenicol resistance gene fragment and the downstream homology arm fragment of the trans-aconitate transporter gene are connected in sequence, and the fusion product is connected to a T vector through TA cloning technology to obtain the trans-aconitate transporter knockout vector.

7. Use of the trans-aconitate transporter or its encoding gene according to claim 3 in regulating the trans-aconitate utilization ability of microorganisms, characterized in that: The microorganism is a bacterium, and the bacterium is Bacillus Velezii.

8. Use of the trans-aconitate transporter or its encoding gene as claimed in claim 1 in enhancing the rhizosphere colonization ability of probiotics.

9. Use of the transaconitate transporter or its encoding gene in controlling nematodes according to claim 1, characterized in that: The transaconitate transporter enhances the nematicidal ability of an organism by promoting the accumulation of TAA in the biological cell.

10. Use of the transaconitate transporter or the gene encoding it as claimed in claim 1 in affinity purification of transaconitate.

Images