Target C5AR1 for glioma treatment and application thereof

Abstract

The invention discloses a target C5AR1 for glioma treatment and application thereof, and belongs to the technical field of biological medicine. The invention provides a series of applications of C5AR1 as a glioblastoma drug target, and covers prognosis, targeted therapy and other aspects of glioblastoma. The invention proves that the expression of the C5AR1 in the glioblastoma is obviously increased, and the lifetime of a glioblastoma patient with high expression of the C5AR1 is short, so that the C5AR1 can be used as a prognostic molecule of the glioblastoma. Besides, cell proliferation and mouse intracranial tumor growth can be remarkably inhibited by knocking down the C5AR1 in a human primary glioblastoma cell line, and a C5AR1 inhibitor PMX205 can also remarkably inhibit mouse intracranial tumor growth, so that the C5AR1 can be used as a potential treatment target of glioblastoma.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a target C5AR1 for the treatment of glioma and its application. Background Technology

[0002] Glioblastoma (GBM) is the most common intracranial malignant tumor, accounting for approximately 48% of primary central nervous system tumors. The current standard treatment for GBM is maximal surgical resection followed by concurrent chemoradiotherapy and electric field therapy. However, due to the invasive growth of the tumor and its strong intratumoral and intertumoral heterogeneity, GBM patients are often insensitive to chemoradiotherapy and are highly prone to recurrence, resulting in a very poor prognosis. The median survival is only 14-16 months, and the 5-year survival rate is less than 5%. China has the highest brain tumor mortality rate globally, and malignant brain tumors, represented by GBM, pose a significant threat to public health. Therefore, identifying new therapeutic targets and improving the prognosis of GBM patients is urgently needed.

[0003] C5AR1 is a member of the G protein-coupled receptor (GPCR) family and the main receptor for its complement ligand C5a. Under physiological conditions, C5AR1 participates in recruiting and activating myeloid cells (such as neutrophils and macrophages), playing a central role in innate immunity and inflammatory responses. Recent studies have found that it plays an important role in tumorigenesis and development. C5AR1 is expressed at elevated levels in digestive system tumors such as colorectal cancer and esophageal cancer, and promotes malignant behaviors such as tumor cell proliferation and invasion by regulating key downstream signaling pathways such as NF-κB and Wnt / β-catenin. However, no studies have yet revealed the specific function and mechanism of C5AR1 in glioblastoma, and the feasibility and effectiveness of C5AR1 as a therapeutic target for GBM have not been reported. Therefore, it is urgent to study the expression characteristics and mechanism of action of C5AR1 in glioblastoma and explore its feasibility as a novel therapeutic target for glioblastoma. Summary of the Invention

[0004] The purpose of this invention is to provide a target for glioblastoma treatment, C5AR1, and its application, to address the problems existing in the prior art. This invention addresses the lack of effective targets for glioblastoma treatment in the prior art by identifying C5AR1 as a potential target for glioblastoma treatment for the first time, and providing a technical means to target C5AR1 as a new approach to glioblastoma treatment. This will provide new ideas for glioblastoma drug development, targeted therapy, and combination therapy.

[0005] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention is the application of a shRNA or C5AR1 inhibitor that targets and inhibits the C5AR1 gene in the preparation of a drug for treating glioblastoma.

[0006] The second technical solution of the present invention is the application of a marker in the preparation of products for evaluating the prognosis of neuroblastoma, wherein the marker includes C5AR1.

[0007] The third technical solution of this invention is the application of C5AR1 as a target in the preparation of products for the diagnosis or monitoring of glioblastoma.

[0008] The fourth technical solution of the present invention is a product for diagnosing or monitoring glioblastoma, with C5AR1 as the target analyte.

[0009] The fifth technical solution of the present invention is a drug for treating glioblastoma, comprising shRNA or C5AR1 inhibitors that target and inhibit the C5AR1 gene.

[0010] Based on the above technical solution, the present invention has the following technical effects: This invention provides a series of applications of C5AR1 as a drug target for glioblastoma, covering aspects such as prognosis and targeted therapy of glioblastoma. This invention demonstrates that C5AR1 expression is significantly increased in glioblastoma, and patients with glioblastoma who highly express C5AR1 have shorter survival times, indicating that C5AR1 can serve as a prognostic molecule for glioblastoma. Furthermore, knockdown of C5AR1 in human primary glioblastoma cell lines significantly inhibited cell proliferation and intracranial tumor growth in mice, and the C5AR1 inhibitor PMX205 also significantly inhibited intracranial tumor growth in mice, suggesting that C5AR1 can serve as a potential therapeutic target for glioblastoma. Attached Figure Description

[0011] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0012] Figure 1 This image shows the expression of C5AR1 in glioblastoma and its correlation with patient survival. A: Survival curves analyzed in the TCGA, CGGA, and Rembrandt databases; B: Differences in C5AR1 expression between glioblastoma and normal brain tissue analyzed in the TCGA database; C: Immunohistochemical staining of C5AR1 in tissue microarrays from glioblastoma patients showed significantly increased C5AR1 expression in glioblastoma compared to normal brain tissue.

[0013] Figure 2To investigate the effect of C5AR1 expression in silenced glioblastoma cells on their proliferation and self-renewal capacity. Specifically: A: Cell viability assay showed that C5AR1 expression significantly reduced cell viability in silenced glioblastoma cells; B: In vitro limiting dilution assay showed that C5AR1 expression significantly reduced self-renewal capacity in silenced glioblastoma cells; C: Spheroid formation assay showed that C5AR1 expression significantly reduced spheroid formation capacity in silenced glioblastoma cells; D: Western blotting assay showed that C5AR1 expression in silenced glioblastoma cells significantly induced the expression of apoptosis markers (Cleaved PARP, Cleaved Caspase 3) and reduced the expression of self-renewal markers (SOX2, OLIG2).

[0014] Figure 3 This study investigates the effects of the C5AR1 inhibitor PMX205 on the in vitro and in vivo growth of glioblastoma. A: Cell viability assay showed that PMX205 treatment significantly reduced glioblastoma cell viability; B: Spheroidization assay showed that PMX205 treatment significantly reduced the spheroidization ability of glioblastoma cells; C: Statistical graph of B; D: Schematic diagram of PMX205 treatment in tumor-bearing mice; E: HE staining of brain sections from tumor-bearing mice showed significant shrinkage of intracranial tumors in the PMX205 treatment group; F: Survival curves of mice in the PMX205 treatment group and control group, indicating that PMX205 treatment significantly prolonged the survival time of tumor-bearing mice. Detailed Implementation

[0015] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0016] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0017] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0018] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0019] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0020] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0021] This invention provides the application of shRNA or C5AR1 inhibitors that target and inhibit the C5AR1 gene in the preparation of drugs for treating glioblastoma.

[0022] In some specific embodiments, the nucleotide sequence of the shRNA is the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0023] In some specific implementations, the C5AR1 inhibitor is PMX205.

[0024] This invention also provides the use of a marker in the preparation of a product for assessing the prognosis of neuroblastoma, the prognostic marker including C5AR1.

[0025] This invention also provides the application of C5AR1 as a target in the preparation of products for the diagnosis or monitoring of glioblastoma.

[0026] In some specific implementations, the method for diagnosing or monitoring glioblastoma is as follows: quantitative detection of C5AR1 in the test sample and comparison with the control sample; if the level of C5AR1 in the test sample is significantly upregulated, it indicates that the patient has glioblastoma.

[0027] This invention also provides a product for diagnosing or monitoring glioblastoma, using C5AR1 as the target analyte.

[0028] This invention also provides a drug for treating glioblastoma, including shRNA or C5AR1 inhibitors that target and inhibit the C5AR1 gene.

[0029] To achieve the above-mentioned objectives, the present invention provides the following technical solution: 1) First, the differential expression levels of C5AR1 in glioblastoma and normal brain tissue were analyzed using multiple glioblastoma transcriptome public databases, including TCGA, CGGA, and Rembrandt, and the results were verified by immunohistochemical staining of tissue microarrays from glioma patients.

[0030] 2) Secondly, by designing shRNA sequences that specifically target the expression of the human C5AR1 gene, constructing lentiviral vectors and packaging lentiviruses, and transducing glioblastoma cells, it was found that silencing C5AR1 can significantly inhibit glioblastoma proliferation, self-renewal and intracranial tumor growth in mice.

[0031] 3) In addition, this invention also administered PMX205, a specific inhibitor of C5AR1, to glioblastoma-bearing mice via drinking water, and found that PMX205 could inhibit glioblastoma proliferation and tumor growth in vitro and in vivo.

[0032] Example 1: Expression of C5AR1 in glioblastoma and its correlation with patient survival time With the approval of the hospital's ethics committee, tissue samples from glioma patients were obtained from glioma patients who underwent craniotomy at the Department of Neurosurgery, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology.

[0033] Inclusion criteria: Complete clinical information, postoperative pathology confirmed by our hospital as glioma, WHO grade 1-4 are acceptable.

[0034] Exclusion criteria: unclear diagnosis or sample quality does not meet staining requirements.

[0035] 1. Gene C5AR1 (gene ID: 728) expression level and survival curves in glioblastoma samples were statistically analyzed using public databases TCGA, CGGA, and Rembrandt. The results are as follows: Figure 1 As shown in Figures A and B, C5AR1 expression is significantly elevated in glioblastoma, and glioblastoma patients with high C5AR1 expression have shorter survival times, indicating that glioblastoma patients with high C5AR1 expression have a poor prognosis.

[0036] 2. Immunohistochemical staining was performed on tissue microarrays from glioma patients, and the expression levels of C5AR1 in normal brain tissue and glioblastoma tumor tissue were statistically analyzed. The results are as follows: Figure 1 As shown in Figure C, C5AR1 protein expression is significantly increased in glioblastoma.

[0037] Example 2: Effects of silencing C5AR1 expression on proliferation and self-renewal capacity in glioblastoma cells. This embodiment provides shRNAs (sh#158 and sh#729) that knock down C5AR1 gene expression.

[0038] sh#158: The nucleotide sequence is (SEQ ID NO.1): CGCTCACGATTTGTTACACTT; sh#729: The nucleotide sequence is (SEQ ID NO.2): TGGACTACAGCCACGACAAAC.

[0039] The shRNA vector plasmid was PLKO.1, which was synthesized and constructed by augct.

[0040] 1. Lentiviral packaging was performed by co-transfecting psPAX2, VSVG, and the target shRNA plasmid in 293T cells. After transfection and medium change, the viral supernatant was collected 48 hours later to infect glioblastoma cells. C5AR1 gene knockdown was performed, and its effect on glioblastoma cell proliferation and self-renewal was examined. Results are as follows: Figure 2 As shown.

[0041] Cell viability assays were performed using Cell-titer reagent (Beyotime), and the results are as follows: Figure 2 As shown in Figure A, silencing C5AR1 significantly inhibited glioblastoma cell viability.

[0042] 3. In vitro limiting dilution and spheroidization assays were performed on glioblastoma cells with silenced C5AR1 and control groups to assess the effect of C5AR1 silencing on their self-renewal capacity. The results are as follows: Figure 2 As shown in B and C, silencing C5AR1 significantly reduced the self-renewal and spheroidization abilities of glioblastoma cells.

[0043] 4. Total protein was extracted from silent C5AR1 and control glioblastoma cells. The expression of apoptosis markers (Cleaved PARP, Cleaved Caspase3, antibodies from CST Biotechnology) and self-renewal markers (SOX2, OLIG2, antibodies from Beyotime Biotechnology) was detected by Western blotting. The results are as follows: Figure 2As shown in Figure D, silencing C5AR1 expression in glioblastoma cells significantly induced the expression of its apoptosis markers (Cleaved PARP, Cleaved Caspase 3) and reduced the expression of its self-renewal markers (SOX2, OLIG2). This further demonstrates that using lentivirus-based shRNA to silence C5AR1 expression can significantly inhibit glioblastoma cell self-renewal and induce apoptosis, representing a potential targeted therapeutic strategy for glioblastoma.

[0044] Example 3: Effects of the C5AR1-targeting inhibitor PMX205 on the in vivo and in vitro growth of glioblastoma. PMX205 (CAS: 514814-49-4), an inhibitor targeting C5AR1.

[0045] 1. Glioblastoma cells were treated with PMX205 in vitro, and cell viability and spheroidization assays were performed to evaluate the effect of C5AR1 inhibition on their proliferation and spheroidization ability. The results are as follows: Figure 3 As shown in Figures A, B, and C, PMX205 treatment significantly reduced glioblastoma cell viability and the number of spheroids, indicating that PMX205 inhibition of C5AR1 significantly suppressed glioblastoma cell proliferation and spheroid formation.

[0046] 2. Further, PMX205 was administered to tumor-bearing mice via drinking water to evaluate the therapeutic effect of PMX205 on glioblastoma in mice.

[0047] Tumor-bearing mice were constructed in our laboratory using the following methods: Four-week-old BALB / c nude mice were purchased from Beijing Huafukang Biotechnology Co., Ltd. and housed in isolation packs at the Experimental Animal Center of Tongji Medical College, Huazhong University of Science and Technology. To construct an intracranial tumor model, 20,000 glioblastoma cells were injected into the right frontal lobe of the mice using a stereotactic brain injection (RWD) device. After injection, the mice were observed; if no bleeding or hematoma occurred at the injection site within 24 hours, and the mice showed no neurological symptoms such as hemiplegia, the model was considered successfully established.

[0048] It can be used for drug treatment experiments after 3 days.

[0049] Administration via drinking water: Dissolve PMX205 in drinking water to a final concentration of 20 μg / ml, and administer continuously via drinking water.

[0050] like Figure 3As shown in Figures D, E, and F. Starting on the third day after intracranial in situ injection of glioblastoma cells into mice, mice were administered PMX205 (20 μg / ml) via drinking water. The intracranial tumor volume in the PMX205 treatment group was smaller than that in the control group (the control group received normal sterile water), and the survival time was significantly longer. This indicates that PMX205 inhibits glioblastoma growth in vivo, further demonstrating that targeting C5AR1 with PMX205 is a highly promising glioblastoma targeting strategy.

[0051] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of a shRNA or C5AR1 inhibitor that targets and inhibits the C5AR1 gene in the preparation of a drug for treating glioblastoma.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the shRNA is the sequence shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. The application according to claim 1, characterized in that, The C5AR1 inhibitor is PMX205.

4. The use of a marker in the preparation of a product for assessing the prognosis of neuroblastoma, characterized in that, The prognostic markers include C5AR1.

5. Application of C5AR1 as a target in the preparation of products for the diagnosis or monitoring of glioblastoma.

6. The application according to claim 5, characterized in that, The method for diagnosing or monitoring glioblastoma is as follows: quantitative detection of C5AR1 in the test sample and comparison with the control sample. If the level of C5AR1 in the test sample is significantly upregulated, it indicates that the patient has glioblastoma.

7. A product for the diagnosis or monitoring of glioblastoma, characterized in that, C5AR1 was used as the target analyte for detection.

8. A drug for treating glioblastoma, characterized in that, This includes shRNAs or C5AR1 inhibitors that target and suppress the C5AR1 gene.

Images